severe hepatitis promotes hepatocellular carcinoma ... · severe hepatitis promotes hepatocellular...

Biology of Human Tumors

Severe Hepatitis Promotes HepatocellularCarcinoma Recurrence via NF-kB Pathway-Mediated Epithelial–Mesenchymal Transition afterResectionTing-Jung Wu1,2, Shih-Shin Chang1,3, Chia-Wei Li1, Yi-Hsin Hsu1, Tse-Ching Chen4,Wei-Chen Lee2, Chau-Ting Yeh5, and Mien-Chie Hung1,3,6,7

Abstract

Purpose: Surgical resection is considered as a curative treat-ment modality for hepatocellular carcinoma; however, theincidence of postoperative tumor recurrence is high, leadingto worse patient survival. Persistent hepatitis (inflammation) isone of the risk factors of tumor recurrence after surgical resec-tion. The aim of this study is to investigate the underlyingmechanisms linking liver inflammation to hepatocellularcarcinoma progression.

Experimental Design: In this study, we used a cytokine arrayto identify important cytokines whose levels are increased inliver microenvironment with severe hepatitis. We evaluated themorphologic changes, migration and invasion ability, andsignal transduction in hepatocellular carcinoma cells withor without inflammatory cytokine in vitro. Finally, we analyzedthe NF-kB signal pathway in tumor specimens from 232patients with hepatocellular carcinoma by immunohistochem-ical staining.

Results: The proinflammatory cytokine TNFa was increased inthe peritumoral microenvironment and contributed to tumorrecurrence and metastasis. Specifically, TNFa promoted hepato-cellular carcinoma cancer cellmigration, invasion, and epithelial–mesenchymal transition (EMT) by upregulating the transcription-al regulator, Snail. We identified Snail as a direct target genedownstream of the TNFa-mediated canonical NF-kB activation.In addition, tumor recurrence-free survival of hepatocellularcarcinoma patients correlated negatively with high p65 and Snailexpression and positively with high E-cadherin expression.

Conclusions:Our results establish a signaling axis that explainshow inflammatory tumor microenvironment promotes hepato-cellular carcinoma recurrence and metastasis. These findingssuggest that controlling liver inflammation and/or targetingNF-kB–mediated Snail expression may be a potential therapeuticstrategy to prevent hepatocellular carcinoma recurrence afterhepatectomy. Clin Cancer Res; 1–13. �2015 AACR.

IntroductionHepatocellular carcinoma is the fifth most common type of

cancer worldwide, which accounts for nearly 5.6% of all can-

cers, and a leading cause of cancer-related deaths (1, 2). Morethan 90% patients with hepatocellular carcinoma have preex-isting chronic liver disease that is caused most commonly bychronic hepatitis B virus (HBV) infection, chronic hepatitis Cvirus (HCV) infection, and/or alcohol consumption (3, 4).Indeed, cumulative evidence indicates that chronic liver inflam-mation by long-term exposure to infectious agents (hepato-tropic viruses) or toxins (ethanol) results in liver cirrhosis andhepatocarcinogenesis (5). While the molecular mechanismslinking chronic inflammation to hepatocellular carcinoma arenot well defined, there is growing evidence to suggest that thecrosstalk between tumor cells and the surrounding stroma inthe tumor microenvironment serves as a key modulator inhepatocarcinogenesis and hepatocellular carcinoma progres-sion. In the tumor stroma, hepatic stellate cells, fibroblasts,inflammatory cells, and vascular endothelia cells have beenshown to secrete extracellular matrix (ECM) proteins, proteo-lytic enzymes, growth factors, and inflammatory cytokines thatalter cancer signaling pathways to promote tumor cell initia-tion, invasion, and metastasis (6).

The microenvironment of inflamed liver turns on the NF-kBpathway to promote proliferation of hepatocytes, rendering themresistant to growth arrest (7). The inhibitor kB kinases (IKK)complex, which consists of three subunits, two catalytic kinases(IKKa and IKKb), and a regulatory scaffold partner (IKKg ; ref. 8),

1Department of Molecular and Cellular Oncology, The University ofTexas MDAnderson Cancer Center, Houston, Texas. 2Division of Liverand Transplantation Surgery, Department of General Surgery, ChangGung Memorial Hospital at Linkou, Chang Gung University MedicalSchool, Taoyuan,Taiwan. 3The University of Texas Graduate School ofBiomedical Sciences at Houston, Houston, Texas. 4Department ofPathology,ChangGungMemorial Hospital at Linkou,Taoyuan,Taiwan.5Liver Research Center, Department of Hepato-Gastroenterology,Chang Gung Memorial Hospital at Linkou, Taoyuan, Taiwan. 6Centerfor Molecular Medicine and Graduate Institute of Cancer Biology,China Medical University, Taichung, Taiwan. 7Department of Biotech-nology, Asia University, Taichung, Taiwan.

Note: Supplementary data for this article are available at Clinical CancerResearch Online (http://clincancerres.aacrjournals.org/).

T.-J. Wu and S.-S. Chang contributed equally to this article.

Corresponding Author: Mien-Chie Hung, Department of Molecular and CellularOncology, The University of Texas MD Anderson Cancer Center, 1515 HolcombeBoulevard, Unit 108, Houston, TX 77030. Phone: 713-792-3668; Fax: 713-794-3270; E-mail: [email protected]

doi: 10.1158/1078-0432.CCR-15-0780

�2015 American Association for Cancer Research.

ClinicalCancerResearch

www.aacrjournals.org OF1

Cancer Research. on February 9, 2020. © 2015 American Association forclincancerres.aacrjournals.org Downloaded from

Published OnlineFirst December 11, 2015; DOI: 10.1158/1078-0432.CCR-15-0780

http://clincancerres.aacrjournals.org/

plays a key role in the NF-kB signaling pathway that is known toinduce inflammation-associated cancers (9). IKKb-dependentNF-kB activation has been shown to promote hepatocyte survivalin both developing and adult liver (10). In a study using aMdr2-knockout mouse model, which spontaneously develops chole-static hepatitis followed by hepatocellular carcinoma, Pikarskyand colleagues demonstrated that the inflammatory process trig-gers NF-kB activation in hepatocytes through upregulation ofTNFa in adjacent endothelial and inflammatory cells and thatinhibition of NF-kB by anti-TNFa treatment or induction of IkBsuper-repressor in the later stages of tumor development results inapoptosis of transformed hepatocytes, which prevents progres-sion to hepatocellular carcinoma (11). In addition, our previousstudy indicated that noncanonicalNF-kB activation is also impor-tant for tumor initiation. Specifically, IKKa activated by TNFainteracts with and phosphorylates FOXA2 at S107/S111, therebysuppressing FOXA2 transactivation activity that leads to decreasedNUMBexpression and further activating thedownstreamNOTCHpathway to promote hepatocellular carcinoma proliferation andtumorigenesis (12).

The long-term prognosis after surgical resection of hepatocel-lular carcinoma remains unsatisfactory due to high incidenceof recurrence associated with hepatocellular carcinoma (13)that ranges from 50% to 70% five years after first curative hep-atectomy (14). Several risk factors have been reported to associatewith hepatocellular carcinoma recurrence, including tumor size,multifocal lesions, and vascular invasion, which could predictpatient survival after surgical resection. In addition, investigationinto the role of HBV infection in hepatocellular carcinoma recur-rence following tumor resection by multivariate analysis showedthat elevated hepatic inflammatory activity and HBV DNA levelsas well as multinodular tumors are significantly associatedwith late hepatocellular carcinoma recurrence after operation(15). The severity of hepatitis may also influence the survivaloutcome of patients after surgery, such as sustained chronic

hepatitis is associated with worse clinical outcome in hepatocel-lular carcinoma patients. However, the mechanisms of tumorprogression in chronic hepatitis havenot yet been explored. In thisstudy, we investigate how chronic hepatitis or liver inflammationmay be involved in hepatocellular carcinoma progression, inparticular tumor recurrence and metastasis, after curative hepa-tectomy in the context of chronic inflammation in the livermicroenvironment.

Materials and MethodsCell migration and invasion assay, Western blot analysis,

real-time PCR, chromatin immunoprecipitation (ChIP) assay,and luciferase reporter assay have previously been described(16). The antibodies used for immunoblotting, immunofluo-rescence, and immunohistochemical staining are listed in Sup-plementary Table S1.

Cell cultureHuman hepatocellular carcinoma cell lines Hep3B, Huh7,

Tong/HCC, PLC/PRF/5, HepG2, HA22T/VGH, HA59T/VGH,Malhavu, and SK-HEP-1 were obtained from Center for Molec-ular Medicine, China Medical University (Taichung, Taiwan).The Hep3B, Huh7, and HepG2 cell lines were validated by STRDNA fingerprinting using the AmpFlSTR Identifiler kit accord-ing to manufacturer's instructions (Applied Biosystems). TheSTR profiles were compared with known ATCC fingerprints(ATCC.org), to the Cell Line Integrated Molecular Authentica-tion database (CLIMA) version 0.1.200808 (Nucleic AcidsResearch 37:D925-D932 PMCID: PMC2686526) and to theMD Anderson Cancer Center fingerprint database. The STRprofiles matched known DNA fingerprints or were unique. Allcell lines were maintained in DMEM/F12 medium supplemen-ted with 10% FBS and antibiotics. IKKa�/�, IKKb�/�, and wild-type mouse embryonic fibroblasts (MEF) were maintained aspreviously described (16). For analysis of ligand-dependentSnail expression, cells were serum-starved overnight and har-vested directly at the indicated time points. Human TNFa (10ng/mL) used for ligand stimulation was purchased from Roche.Details of various inhibitors used in this study are shown inSupplementary Table S2.

Primers, shRNAs, DNA plasmidsSupplementary Table S3 lists the details of the primers used

in this study. The sequences of the short hairpin RNA (shRNA)used to knock down the expression of IKKb and p65 havebeen previously described (16). The negative control vectorexpressing scrambled shRNA was obtained from Addgene(#1864). The plasmid constructs used for overexpressing IKKswere described in our published article (17). Snail-pGL2Snail promoter luciferase reporter plasmid was purchased fromAddgene (#31694; ref. 18). For ectopic overexpression ofSnail, Snail-expressing plasmid (PCDH-Snail) was constructedby cloning the full-length Snail ORF into the pCDH-CMV-MCS-EF1-Puromycin vector (CD510B-1; System Biosciences)between EcoRI and BamH1 site. PCR primers for cloning are asfollows:

50�ATACTGAATTCATGGACTACAAAGACGATGACGACAAGAT-GCCGCGCTCTTTC CTCGTCAGG�30 (forward)50�ATGATGGATCCTCAGCGGGGACATCCTGAGCA�30 (reverse)

Translational Relevance

Chronic liver inflammation caused by viral infection oralcohol consumption is associatedwith hepatocarcinogenesis.In this study, we show that severe hepatitis is significantlyassociated with recurrence and metastasis of hepatocellularcarcinoma after surgical resection of the primary tumor.Results from cytokine array analysis indicate that elevatedlevels of inflammatory cytokine TNFa in the peritumoralmicroenvironment with severe hepatitis stimulate the initia-tion of epithelial–mesenchymal transition (EMT) in hepato-cellular carcinoma cells. Moreover, TNFa activates its down-stream canonical NF-kB signaling pathway through IKKband p65 to transcriptionally upregulate the expression ofEMT regulator Snail. This p65/Snail/E-cadherin axis is inverse-ly correlated with tumor recurrence-free survival after opera-tion. These findings identify a major inflammation-mediatedpathway involved in hepatocellular carcinoma recurrenceand metastasis, providing a potential therapeutic strategy toprevent tumor recurrence after hepatectomy by controllingliver inflammation and/or targeting NF-kB–mediated Snailexpression.

Wu et al.

Clin Cancer Res; 2016 Clinical Cancer ResearchOF2




Patients and immunohistochemical staining of human tumortissue samples

Between September 2004 and August 2008, 232 hepatocel-lular carcinoma patients undergoing hepatectomy in ChangGung Memorial Hospital Linkou medical center were reviewed.Patients who were considered eligible for hepatectomy at ourhospital had acceptable liver reservoir function [i.e., acceptableindocyanine green (ICG) retention rate at 15 minutes andCHILD A status), lacked multifocal tumors at bilateral lobe ofliver, and showed no presence of extrahepatic lesion preoper-atively. Patients in our cohort did not receive antiviral therapy.All patients received adequate resection margin (>1 cm).Curative resection considered by pathology-proved sectionmargin was free of malignance. The study was approved bythe Institutional review board at Chang Gung Memorial Hos-pital (Protocol No. 100-4467B). After surgery, follow-ups wereconducted every 2 to 3 months at the outpatient clinic. Tumorrecurrence was suspected if progressive elevation of serum AFPlevels was present and/or if a new hepatic lesion was detectedby ultrasonography. Dynamic CT scan or MRI was routinelyarranged if recurrence was suspected. Intrahepatic recurrencewas diagnosed by images showing contrast enhancement dur-ing arterial phase and wash-out in venous phase. Extrahepaticrecurrence was diagnosed depending on its location accordingto the images taken by CT, MRI, Tc-99m methylene dipho-sphonate (Tc-99m MDP) bone scan, or 2-[18F]-fluoro-2-deoxy-D-gluocose ([18F]FDG) PET scan. Image-guided biopsy wasperformed only when considered necessary. Diagnosis of recur-rent hepatocellular carcinoma was confirmed in accordancewith the European Association for the Study of the Liver andthe American Association for the Study of Liver Diseases guide-lines. The last follow-up date in this study was December 31,2011. The duration from date of operation to the date of firstconfirmation of recurrence (time-to-recurrence) was recordedas the primary endpoint (shown as tumor recurrence-freesurvival).

Surgical specimens from tumorous and nontumorous sec-tions of liver were randomly sampled for histopathologicanalyses using hematoxylin and eosin (H&E) staining. TheISHAK score was used to grade the severity of hepatitis (19)by a pathologist blinded to the patients' clinical and biochem-ical information. The ISHAK score contains five parameters:(i) periportal or periseptial interface hepatitis, score 0–4;(ii) confluent necrosis, score 0–6; (iii) focal (spotty) lyticnecrosis, apoptosis and focal inflammation, score 0–4; (iv)portal inflammation, score 0–4; (v) architectural changes,fibrosis and cirrhosis, score 0–6. (19) In this study, severehepatitis is defined as the sum of total ISHAK scores > 6 (15).

Immunohistochemical staining of p65 (Millipore), Snail(Abcam), and E-cadherin (Leica Biosystems) were performed onformalin-fixed paraffin-embedded tissue. A single representativeblock from each tissue was sectioned at 3 mm onto positivelycharged slides. Slides were then stained using the Bond-Maxautostainer (LeicaMicrosystems) according to themanufacturer'sprotocol. Slides were dewaxed in Bond Dewax Solution (LeicaMicrosystems) and hydrated in Bond Wash Solution (LeicaMicrosystems). Antigen retrievalwas performed at acidic pHusingEpitope Retrieval 1 solution (Leica Microsystems) for 20 minutesat 100�C. Slides were then incubatedwith the primary antibody atsuitable concentration for 15 minutes at room temperature.Antibody detection was performed using the biotin-free Bond

Polymer Refined Detection System (Leica Microsystems). Finally,slides were counterstained with hematoxylin. The percentage ofchromogen-containing cells were estimated in the ranges of 0%,<5%, 5%–25%, 26%–50%, >51% and semiquantitatively scoredas 0 to 4. The expression intensity was determined from at leastfour fields per slide.

Statistical analysesMedian expression ratio from cytokine array and the expression

level from ELISA validation were analyzed by Mann–Whitney Utest for statistical significance. All data for histologic parametersand in vitro assays are expressed as mean �SD. Data with con-tinuous variables were analyzed by Student t test. Pearson c2 testor Fisher exact testwas used todetermine statistical significanceoncategory variables. The correlation between two parameters wasanalyzed by Spearman correlation test. Kaplan–Meier survivalcurve with log-rank test and Cox regression model were used forsurvival analysis. All statistical analyses were performed using theSPSS software program (version 17; SPSS).

ResultsSevere hepatitis is associated with tumor recurrence andextrahepatic recurrence after hepatectomy

To determine whether the severity of liver inflammation affectstumor recurrence or metastasis after curative hepatectomy, wereviewed 232 hepatocellular carcinoma cases in which patientsunderwent curative resection from 2004 to 2008 at Chung GungMemorial Hospital (Linkou; Taoyuan, Taiwan). The clinical fea-tures and tumor characteristics of these patients are summarizedin Supplementary Table S4. We used ISHAK score (19) to gradethe pathologic severity of chronic hepatitis from the patients' livertissue specimens. Among these 232 hepatocellular carcinomapatients, 165 and 67 had tumors stemming from severe hepatitis(ISHAK score > 6) and mild/none hepatitis background (ISHAKscore� 6), respectively. Viral hepatitis was significantly associatedwith more severe liver inflammation and higher ISHAK score(Supplementary Table S5). At themedian 52.8-month follow-up,123 patients suffered from disease recurrence. The recurrence ratewas significantly higher (P < 0.0001) in patients with severehepatitis (100/165 patients, 60.6%) than those with none/mildhepatitis (23/67 patients, 34.3%). Moreover, among the 123patients with disease recurrence, the rate of extrahepatic metas-tasis was also significantly higher in those who had severe hep-atitis (61/100 patients, 61.0%) than those who had none/mildhepatitis (3/23 patients, 13.0%; P < 0.0001; Supplementary TableS6). There were 66 (53.6%) patients who suffered from earlytumor recurrence within 2 years after hepatectomy, and 57(46.3%) who had late disease recurrence over 2 years afterresection. Interestingly, patients with severe hepatic inflamma-tion, not necrosis or cirrhosis, in the liver microenvironment hadhigher incidence of both early and late tumor recurrence (Sup-plementary Table S7). The mean recurrence-free survival inpatients who had none/mild hepatitis (total ISHAK score � 6)was longer than thosewhohad severe hepatitis (total ISHAK score> 6; 62.9 � 4.6 years (95% CI, 53.9–71.9) vs. 44.9 � 2.8 years(95% CI, 39.4–50.3); P ¼ 0.002; Fig. 1A). Univariate and mul-tivariate analyses identified severe hepatitis (total ISHAK score >6) as an important predictor independently associated with poorhepatocellular carcinoma tumor recurrence-free survival afterhepatectomy (Table 1).

Hepatitis Induces EMT in HCC by TNFa/NF-kB/Snail Activation

www.aacrjournals.org Clin Cancer Res; 2016 OF3




Wu et al.





TNFa is a major cytokine in the inflammatorymicroenvironment of liver andpromotes EMT inhepatocellularcarcinoma

Several inflammatory cytokines in tumor microenvironmentare associated with cancer progression, invasion, and metastasis(6). To determine which cytokines are elevated in the liver tissuesof hepatocellular carcinoma patients with severe hepatitis, wescreened 8 pairs of human tissue specimens (normal and tumor)via a cytokine antibody arrays (RayBio Human InflammationAntibody Array, Cat# AAH-INF-G3-4) and measured the expres-sion level of 40 different inflammatory cytokines (SupplementaryTable S8). Interestingly, only TNFa was consistently elevated inboth normal and tumor tissues with severe hepatitis comparedwith mild/none hepatitis (Fig. 1B). In addition, ELISA examina-tion further validated TNFa as the major cytokine that wassignificantly elevated in the microenvironment of both tumorousand nontumorous tissues with severe hepatitis (Fig. 1C).

To investigate the biologic effects of TNFa on hepatocellularcarcinoma, two epithelial-type hepatocellular carcinoma celllines, Hep3B and Tong, were stimulated by TNFa for 72 hours,which induced morphologic changes, including the loss of cell–cell adhesion, spindle shape transformation, cellular processelongation, and loss of cell polarity (Fig. 1D, top). These changessuggest that EMT may have occurred. Indeed, Western blot anal-ysis also demonstrated elevated levels of mesenchymal markers,N-cadherin and vimentin, and decreased levels of epithelialmarkers, E-cadherin and plakoglobin, post-TNFa treatment for72 hours in these cells (Supplementary Fig. S1A). The increase invimentin and decrease in E-cadherin after TNFa stimulation werealso visualized by confocal microscopy (Fig. 1D, bottom). Inaddition, TNFa-treated cells demonstrated increased cell migra-tion and invasion (Fig. 1E), which was abrogated by the additionof a TNFa-neutralizing antibody. Together, these results indicate

that TNFa is able to induce EMT in hepatocellular carcinoma cellsin culture and suggest that the increased levels of TNFa in themicroenvironment of severe hepatitis may stimulate EMT inhepatocellular carcinoma cells.

EMT regulator Snail is required for TNFa-mediated EMTSeveral EMT regulators, including Twist (20, 21), Snail (21, 22),

Slug (23, 24), Zeb1/2 (25, 26), b-catenin (27), FoxC1/2 (28), andSox4 (29) are known to induce EMT in hepatocellular carcinomacells, and their expression levels also correlate with patient sur-vival. To further delineate the importance of these EMT regulatorsin hepatocellular carcinoma, we profiled their gene expressionusing the CCLE database and found that Twist, Snail, Slug, Zeb1/2, and b-catenin were upregulated in mesenchymal-type butdownregulated in epithelial-type hepatocellular carcinoma cells(Supplementary Fig. S1B). We examined the protein expressionlevel of these EMT regulators in a panel of TNFa-treated hepato-cellular carcinoma cells to identify the potential regulator(s)responsible for TNFa-mediated EMT, As shown in Fig. 2A, onlyexpression of Snail was consistently induced upon TNFa treat-ment. We then ectopically overexpressed Snail in two epithelial-type hepatocellular carcinoma cells (Hep3B and Tong) to validateits role in EMT in hepatocellular carcinoma. Confocalmicroscopyanalysis revealed morphologic changes associated with EMTwhen Snail was overexpressed in Tong cells (SupplementaryFig. S2A). In addition, overexpression of Snail increased expres-sion of N-cadherin and vimentin and decreased the expressionE-cadherin and plakoglobin in Hepa3B and Tong cells as indi-cated by Western blot analysis (Supplementary Fig. S2B). Themigration and invasion ability of these cells also increased whenSnail was overexpressed (Supplementary Fig. S2C). To determinewhether Snail is required for TNFa-mediated EMT, we knockeddown Snail using shRNA in Tong and Hep3B cells. TNFa

Table 1. Univariate and multivariate analyses of predictors of tumor-recurrence free survival in 232 patients after resection for hepatocellular carcinoma

Univariate analysis Multivariate analysisRisk factors HR 95% CI P HR 95% CI Pb

Large tumor (maximal tumor diameter >5cm) 1.046 0.711–1.538 0.821 —

Multiple tumors (tumor number � 2) 1.061 0.627–1.795 0.825 —

Tumor rupture 1.622 0.707–3.720 0.254 —

Portal vein tumor thrombosis 4.327 2.285–8.194 <0.0001 2.475 1.237–4.951 0.010Tumor with satellite nodules 1.739 1.211–1.498 0.003 —

Tumor with capsule 0.871 0.507–1.495 0.616 —

Higher histologic grade (G4 > G3 > G2 > G1)a 1.410 1.065–1.866 0.016 —

Tumor with microvascular invasion 2.210 1.528–3.195 <0.0001 1.824 1.219–2.730 0.003Severe hepatitis (total ISHAK score > 6) 2.022 1.283–3.184 0.002 1.710 1.079–2.709 0.022AFP > 400 (ng/mL) 1.130 0.749–1.706 0.561 —aEdmondson–Steiner grading system.bThe statistical significance of P value was analyzed by Cox proportional hazard regression model with forward stepwise selection.

Figure 1.Inflammatory cytokine TNFa promotes EMT in hepatocellular carcinoma (HCC) cells. A, Kaplan–Meier survival curve with log rank test showed the correlationbetween recurrence-free survival and the severity of hepatitis (by ISHAK score) in hepatocellular carcinoma patients who received curative hepatectomy.The number of patients at risk is shown below the survival curves. B, differential expression of inflammatory cytokines from patient samples by cytokinearray analysis. Values only showed the ratio of cytokine expression significantly increased in normal or tumor part respectively in severe hepatitis in comparisonwith none/mild hepatitis. C, ELISA analysis showed the expression of TNFa in normal and tumor parts from hepatocellular carcinoma patients with or withoutsevere hepatitis. � , P < 0.05. D, morphologic changes and expression of EMT markers (phase and confocal microscopy) in cells treated with TNFa (10 ng/mL)for 72 hours. Phase contrast microscopy, 40� magnification. Scale bar, 20 mm. E, invasion and migration properties of TNFa-treated hepatocellular carcinomacells. Cells were treated with TNFa (10 ng/mL) alone or with human TNFa-neutralizing (D1B4) rabbit mAb (10 ng/mL). For migration assay, cells were incubated48 hours after treatment. For invasion assay, cells were incubated 72 hours after treatment. � , P < 0.05; �� , P < 0.001 compared with mock.






stimulation did not inducemorphologic changes (Fig. 2B) or alterthe expression levels of the EMT markers (Fig. 2C) in the absenceof Snail. Furthermore, TNFa-induced cellmigration (Fig. 2D) andinvasion (Fig. 2E) ability was significantly reduced in these Snailknockdown cells. Collectively, these results indicate that Snail issufficient to induce EMT in epithelial-type hepatocellular carci-noma cells and plays an essential role in TNFa-induced EMT.

TNFa upregulates Snail expression through canonical NF-kBactivation

Because TNFa activates various signaling pathways, we nextexplored which signaling cascade is responsible for TNFa-mediated upregulation of Snail expression in hepatocellularcarcinoma cells. To this end, Hep3B and PLC cells were serumstarved overnight and pretreated with various inhibitors priorto TNFa stimulation. As shown in Supplementary Fig. S3A,upregulation of Snail by TNFa was abolished only in thepresence of the NF-kB inhibitor, Bay11-7082, but not byinhibitors against MAPK, p38, JNK kinase, PI3K/mTOR, or Akt.The NF-kB pathway can be activated by IKKa (noncanonical)and IKKb (canonical) kinase. To determine whether IKKa orIKKb is involved in TNFa-mediated Snail upregulation, wetransiently overexpressed IKKa or IKKb in 293T cells andexamined Snail expression. We found that ectopically expressedIKKb but not IKKa increased the basal level of Snail (Supple-mentary Fig. S3B). Conversely, a kinase-dead mutant of IKKb(nIKKb) failed to do so. Furthermore, we knocked down IKKbby shRNA in three hepatocellular carcinoma cell lines (Hep3B,Tong, and PLC) and examined their Snail expression uponTNFa treatment. In the absence of IKKb, TNFa failed to induceSnail expression (Fig. 3A). In a parallel experiment using IKKaor IKKb knockout (KO) MEFs, we showed that TNFa inducedSnail expression in wild-type and IKKa-deficient (IKKa�/�)MEFs but not IKKb-deficient (IKKb�/�) MEFs (SupplementaryFig. S4A). Reexpression of wild-type IKKb but not kinase dead(KD) IKKb mutant in IKKb-deficient MEFs restored TNFa-induced Snail expression (Supplementary Fig. S4B). Theseresults support IKKb as a major downstream kinase mediatingTNFa-induced Snail expression.

Next, we examined the time-dependent expression of Snailand found it increased significantly along with the canonicalNF-kB cascade in which the signal initiated from IKKb phos-phorylation, followed by biphasic IkBa phosphorylation anddegradation after 1 hour of TNFa stimulation (Fig. 3B). Similarresults were observed in 8 of 9 liver cancer cell lines (Supple-mentary Fig. S5A). Snail expression reached a maximum at 2 to3 hours after TNFa treatment (Fig. 3B) which was attenuated bypretreatment with Bay 11-7082 (Supplementary Fig. S5B).Collectively, these data suggest that TNFa upregulates Snailexpression through the canonical NF-kB pathway via IKKb.

RelA (p65) is required for TNFa-mediatedNF-kBactivation andEMT

RelA (p65) is a key factor that mediates transcriptionalprogram in NF-kB signaling. Thus, we asked whether p65 playsa role in TNFa-induced EMT by knocking down p65 in Hep3B,Tong, and PLC cells. First, we showed that TNFa-induced Snailexpression was attenuated in p65 knockdown cells (Fig. 3C).Overexpression of p65 in Tong and Hep3B cells was sufficientto drive EMT as indicated by decreased expression of E-cadherinand plakoglobin and increased expression of in N-cadherin and

vimentin (Supplementary Fig. S6A). Nuclear translocation ofp65 is known to correlate with its activity (8). Thus, to furthervalidate the association between upregulated Snail and p65activity, we examined the p65 nuclear localization in Tongand PLC cells treated with TNFa at different time points bysubjecting nuclear and cytoplasmic fractions to Western blotanalysis (Supplementary Fig. S6B). TNFa-induced nucleartranslocation of p65 at 30 minutes led to a correspondingincrease in the nuclear expression of Snail at 1 hour aftertreatment (Supplementary Fig. S6C). These results suggest thatTNFa-mediated upregulation of Snail and subsequent EMTrequires p65 in hepatocellular carcinoma cells.

TNFa signaling transcriptionally upregulates Snail expressionBecause TNFa-induced Snail expression requires p65, we

asked whether it targets Snail transcriptionally. To this end, weanalyzed the mRNA expression level of Snail with TNFa inHep3B, Tong, and PLC hepatocellular carcinoma cells. SnailmRNA expression was elevated by TNFa treatment in a time-dependent manner (Fig. 4A). TNFa-induced Snail expressionwas attenuated in cells pretreated with actinomycin D, a tran-scriptional inhibitor (Fig. 4B). Next, we performed a ChIP assayof p65 in cells treated with TNFa and showed that p65 occupiedthe promoter region (�558 to �350) of Snail (Fig. 4C), indi-cating that Snail is specifically targeted by p65.Moreover, resultsfrom luciferase reporter assay also showed that p65 activated theSnail promoter. To further identify the site(s) within the Snailpromoter (�558 to �350) targeted by p65, we scanned thisregion using the TFSEARCH program to predict potential p65-binding sequences.We identified only oneputative site (�435 to�444) that shared high similarity with the canonical p65-bind-ing site. Deletion of this region within the Snail promoterreduced its responsiveness to p65 (Fig. 4D). These results indi-cate that Snail is ap65 target genedownstreamofTNFa signaling.

Clinical correlation of p65/Snail/EMT axis in hepatocellularcarcinoma patients

To further examine the possible clinical relevance of the afore-mentioned inflammation-related p65/Snail axis, we analyzedsurgical specimens from 232 hepatocellular carcinoma patientswho received curative hepatectomy by H&E and immunohisto-chemical staining. As shown in the Fig. 5A, tumors from patientswith severe hepatitis background hadmore infiltration of inflam-matory cells in the peritumoral area than those from cleanportohepatic areas without hepatitis. In tumors with a severehepatitis background, we detected high expression of p65 andSnail and low expression of membranous E-cadherin. In contrast,tumors from patient without hepatitis had no expression of p65or Snail but had high levels of membranous E-cadherin (Fig. 5A).The severity of hepatitis was significantly correlated with theintensity of p65, Snail, and E-cadherin expression (Supplemen-tary Table S9). Meanwhile, Snail expression correlated positivelywith p65 (N ¼ 232; P < 0.0001), and E-cadherin expressioncorrelated negatively with p65 (P < 0.0001) and Snail (P <0.0001; Fig. 5B). Furthermore, patients with higher expressionof p65 and Snail had shorter tumor recurrence-free survival, whilepatients with higher expression of E-cadherin had longer tumorrecurrence-free survival (Fig. 5C). These data suggest the inflam-mation-induced hepatocellular carcinoma tumor progression ishighly associated with upregulation of p65 and Snail and down-regulation of E-cadherin.

Wu et al.





Figure 2.EMT regulator Snail is required for TNFa-mediated EMT in hepatocellular carcinoma (HCC) cells. A,Western blot analysis of several EMT regulators in hepatocellularcarcinoma cells treated with TNFa (10 ng/mL) at different time points. B, morphologic changes of Hep3B and Tong Snail knockdown stable cells with orwithout TNFa stimulation (10 ng/mL for 72 hours). Phase contrast microscopy, 40� magnification. C, Western blot analysis of the Snail and several EMT markersfrom treated cells as described in B. D, migration analysis of Hep3B and Tong Snail knockdown stable cells after TNFa (10 ng/mL) stimulation for 48 hours.� , P < 0.05; ��, P < 0.001 compared with mock. E, invasion analysis of Hep3B and Tong Snail knockdown stable cells after TNFa (10 ng/mL) stimulation for 72 hours.� , P < 0.05; �� , P < 0.001 compared with mock.






DiscussionChronic or severe hepatitis is linked to increased risk of hepa-

tocellular carcinoma development and tumor progression, suchas invasion and metastasis, as well as worsened clinical outcome(30). However, the underlying mechanism governing the meta-static nature by inflammation inhepatocellular carcinomahasnotbeen clearly defined. In the current study, we identified animportant signaling axis in hepatocellular carcinoma that linksinflammatory cytokine TNFa and EMT. Infiltration of inflamma-tory cells at the tumor site and surrounding liver (Fig. 5A) secretTNFa to promote EMT in hepatocellular carcinoma tumor cells

and facilitate their migration and invasion ability. Specifically, weproposed a model in which elevated levels of TNFa in the tumormicroenvironment from chronic hepatitis upregulates the canon-ical NF-kB signaling via activation of IKKb but not IKKa; theliberated cytoplasmic p65 then translocates into the nucleus,binds to the Snail promoter, and rapidly turns on Snail expressionwhich promotes tumor metastasis through EMT. Several EMTregulators have been reported to initiate EMT in hepatocellularcarcinoma and correlate to patient survival in clinic; however, inour system, we found that Snail is the major regulator of EMTdownstream of TNFa signaling. Of note, our earlier study showed

Figure 3.TNFa rapidly upregulates Snail expressionthrough canonical NF-kB activation. A,Western blot analysis of Snail expression inhepatocellular carcinoma (HCC) cells with astable knockdown of IKKb compared withscrambled control. TNF-a (10 ng/mL) wasadded at the indicated time points. B,activity of canonical NF-kB pathway atdifferent time points after TNFa (10 ng/mL)stimulation in Hep3B, Tong, and PLC cells. C,Western blot analysis of Snail and canonicalNF-kB activation in cells with a stableknockdown of p65 compared withscrambled control. TNFa (10 ng/mL) wasadded at the indicated time points. Tubulinwas used as loading control.

Wu et al.





that TNFa induces expression of Twist but not Snail in breastcancers to promote EMT (16), suggesting an intricate nature ofcancer type–specific EMT program that governs inflammation-induced cancer metastasis.

NF-kB provides a mechanistic link between inflammationand cancer and is a major factor that controls the ability ofboth preneoplastic and malignant cells to resist apoptosis,regulates tumor angiogenesis, and promotes invasiveness (9).

Figure 4.TNFa transcriptionally upregulates Snail expression. A, quantitative RT-PCR analysis of Snail mRNA isolated from TNFa-treated hepatocellular carcinoma (HCC)cells normalized to GAPDH. � , P < 0.05; �� , P < 0.001 compared with the zero time point. B, Western blot analysis of Snail protein in hepatocellular carcinomacells pretreatedwith actinomycin D (ActD; 500 ng/mL) for 1 hour followed by TNFa (10 ng/mL) stimulation for 2 hourswith the indicated antibodies. C, ChIP analysisof p65 occupancy on Snail promoter in response to TNFa treatment. Primer sets used for RT-PCR detection are shown. D, luciferase reporter assay of Snailpromoter in response to p65 in HEK 293T cells. Predicted p65-binding site was deleted from the promoter (Dp65-Luc). Relative luciferase activity is presented asmeans �SE from three independent experiments.






Patient 1: No hepatitis

p65low/Snaillow/

E-cadherinhigh

Patient 2:Severe hepatitis

p65high/Snailhigh/

E-cadherinlow

p65

---- Low expression (score 0–1)---- High expression (score 2–4)

Log rank test P = 0.003

Snail

Log rank test P = 0.013

SnailH&E E-cadherin

E-cadherin

A

CB

p65

r = 0.671 P < 0.0001

r = −0.634P < 0.0001

r = −0.718P < 0.0001

---- Low expression (score 0–1)---- High expression (score 2–4)

Log rank test P = 0.035 ---- Low expression (score 0–1)---- High expression (score 2–4)

Low expression 43 30 27 22 18 13High expression 189 125 106 82 58 47

No. at risk


No. at risk


No. at risk

4

3

2

1

0

4

3

2

1

0

4

3

2

1

0

Sna

ilE

-cad

herin

E-c

adhe

rin

Tum

or re

curr

ence

-free

su

rviv

al (×

100%

)Tu

mor

recu

rren

ce-fr

ee

surv

ival

(×10

0%)

Tum

or re

curr

ence

-free

su

rviv

al (×

100%

)

1.0

0.8

0.6

0.4

0.2

0.0

1.0

0.8

0.6

0.4

0.2

0.0

1.0

0.8

0.6

0.4

0.2

0.0

0.0 12.0 24.0 36.0 48.0 60.0 72.0 84.0 96.0

0.0 12.0 24.0 36.0 48.0 60.0 72.0 84.0 96.0

0.0 12.0 24.0 36.0 48.0 60.0 72.0 84.0 96.0

Post OP months

Post OP months

Post OP months

p65

p65

Snail

0 1 2 3 4

0 1 2 3 4

0 1 2 3 4

Figure 5.Association of chronic hepatitis and p65/Snail/E-cadherin axis in human samples and its clinical significance. A, representative images from H&E andimmunohistochemical staining of p65, Snail, and E-cadherin in tumors from hepatocellular carcinoma (HCC) patients with or without hepatitis. Magnification, 200�.B, correlations between the expression level of p65, Snail, and E-cadherin in 232 hepatocellular carcinoma tumors quantitated from immunohistochemical staining.P values, Spearman rank test. C, Kaplan–Meier recurrence-free survival curves according to the expression of p65, Snail, and E-cadherin in 232 patients withhepatocellular carcinoma after curative hepatectomy. P values were statistic by log-rank test. The number of patients at risk is shown below the survival curves.


Wu et al.




Upregulation of EMT regulator Snail by the NF-kB pathway incancer cells may be through a transcriptional-dependent or-independent manner. For example, Akt and MAPK kinase canactivate NF-kB–mediated Snail mRNA upregulation in squa-mous cell carcinoma (31) and peritoneal mesothelial cells (32),respectively. Moreover, NF-kB can stabilize Snail protein viaupregulation of COP9 which subsequently blocks ubiquitina-tion of Snail protein (33). Results from this study and fromothers (31, 32) have demonstrated that Snail expression istranscriptionally regulated. Interestingly, in SW480 colon can-cer cells, the minimal p65-responsive promoter region of Snailwas identified at �194 to �78 (34); however, in hepatocellularcarcinoma cells, p65 did not occupy this region (Fig. 4C).Instead, deletion of the predicted p65-binding site in the Snailpromoter at �435 to �444 substantially inactivated its respon-siveness to p65 (Fig. 4C and D). These observations are con-sistent with previously reported complexity and cell-specificregulation of the Snail promoter by NF-kB (31).

In the current study, we found that hepatocellular carcinomapatients with more severe hepatitis had a higher tendencytoward more intrahepatic recurrence and extrahepatic metas-tasis after curative hepatectomy. The significance of the severityof hepatitis on the clinical outcome for hepatocellular carci-noma patients after surgical resection of primary tumor may beexplained by the activation of the TNFa/NF-kB/Snail pathway.First, it may be that there are more cancer cells with EMTpotential in the microenvironment of hepatocellular carcinomatumors from patients with severe hepatitis. These mesenchy-mal-type hepatocellular carcinoma cells within primary tumorsmay have already undergone micrometastases prior to opera-tion. In addition, conventional liver resection may induce therelease of cancer cells from the liver into the peripheral bloodcirculation, especially when liver is mobilized during hepatec-tomy (35). These procedure-related disseminations of cancercells have been shown as a predicator of postsurgical recurrenceof hepatocellular carcinoma (36), suggesting that the micro-environment surrounding hepatocellular carcinoma tumorsfrom patients with severe hepatitis may shed cancer cells moreeasily into the systemic circulation during hepatectomy thanthose with mild hepatitis. Moreover, microscopic tumor cells inmultifocal lesions may gain EMT potential and promote intra-hepatic recurrence and distant metastasis after operation ifhepatitis is sustained after resection. Thus, recurrent or meta-static hepatocellular carcinoma induced by hepatic inflamma-tion may lead to adverse clinical outcome after surgical resec-tion, and targeting the TNFa/NF-kB/Snail pathway or control-ling hepatitis may improve patient survival after hepatectomy.Our results are in agreement with a previous a large-scale study,which profiled gene expression and survival of hepatocellularcarcinoma patients, that the inflammatory signatures, TNFaand NF-kB signaling, in the surrounding liver tissue are corre-lated with poor survival (37).

It has become clear that dysregulation of NF-kB and thesignaling pathways that control its activity are involved in cancerdevelopment and progression (38) and that targeting NF-kB mayprovide therapeutic benefit. One successful example is the treat-ment of multiple myeloma by bortezomib (Velcade; MilleniumPharmaceuticals), a reversible 26S proteasome inhibitor thateffectively inhibits NF-kB activity (39). This drug also effectivelyinduces apoptosis and inhibits growth of hepatocellular carcino-ma cell in preclinical studies (40, 41). However, subsequent

clinical studies of bortezomib as monotherapy for patients withunresectable hepatocellular carcinoma failed to bring survivalbenefit (42). In contrast, direct inhibition of NF-kB has beenshown to reduce liver inflammation and attenuate liver fibrosis/cirrhosis (43). Several inhibitors of NF-kB, such as caffeic acid,captopril, curcumin, pyrrolidine dithiocarbamate, resveratrol,silymarin, and thalidomide, have demonstrated antinecrotic,anticholestatis, antifibrotic, and anticancer activities in the liver(43), but large prospective and randomized control clinical trialsare still required to demonstrate their efficacy in treating hepato-cellular carcinoma. Given that hepatocellular carcinoma withsevere hepatitis background has more frequent vascular invasionand poorer patient survival (44), the results from our studysuggest that hepatocellular carcinoma may be managed by con-trolling hepatitis in addition to NF-kB inhibition. As viral infec-tion is a major cause of hepatitis, antiviral therapies may alsoattenuate virus-induced inflammation in the peritumor microen-vironment and prevent hepatocellular carcinoma recurrence.Indeed, postoperative adjuvant antiviral therapy improved sur-vival of hepatocellular carcinoma patients with viral infection andhepatitis (45–50).

Our observations also raised the intriguing questions of wheth-er other cytokines are responsible for hepatocellular carcinomarecurrence and whether late recurrent hepatocellular carcinoma isa consequence of cancer metastasis. Recognizing the limited sizeof clinical samples due to scope of the current study, we certainlydo not exclude the potential importance of cytokines other thanTNFa although the results from our cytokine array analysissuggest that TNFa is correlated with the degree of hepatitis.Meanwhile, even though we observed a correlation betweeninflammation, EMT, and early and late tumor recurrence (2 yearsas the cutoff point; Supplementary Table S7), it should be notedthat only early reappearance of tumors that happenwithin thefirstyear are generally accepted as recurrences from the originaltumors. However, late recurrences (more than 2 years) can occuras a result of de novo cancer formation in themicroenvironment ofsustained hepatitis. The possibility that parts of late recurrencemay have originated from an early metastatic event of primarytumors after a long dormancy should not be fully excluded until asystematic genomics analysis is performed to compare the evo-lution of primary and late recurrent tumors.

In summary, identification of Snail as a downstream target ofIKKa/p65 links the inflammatory cytokine TNFa-mediated NF-kB activation and EMT in hepatocellular carcinoma. Moreover,the findings in this study suggest that chronic liver inflammationleads to tumor metastasis and decreases patient survival aftercurative resection of primary hepatocellular carcinoma. Inhibi-tion of NF-kB activation or diminishment of hepatitis aftersurgery, therefore, has important clinical implications for thetreatment or prevention of hepatocellular carcinoma recurrenceand metastasis.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: T.-J. Wu, C.-T. YehDevelopment of methodology: T.-J. Wu, S.-S. Chang, C.-W. LiAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): T.-J. Wu, S.-S. Chang, T.C. Chen, W.-C. Lee






Analysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): T.-J. Wu, S.-S. Chang, Y.-H. Hsu, W.-C. Lee,M.-C. HungWriting, review, and/or revision of the manuscript: T.-J. Wu, S.-S. Chang,Y.-H. Hsu, C.-T. YehAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): T.-J. Wu, S.-S. Chang, T.C. Chen, C.-T. Yeh,M.-C. HungStudy supervision: M.-C. Hung

AcknowledgmentsWe thank Dr. Jennifer L. Hsu for her assistance withmanuscript preparation.

We also thank the Liver Research Center at Linkou Chang Gung MemorialHospital for providing access to the equipment to perform immunohistochem-ical staining.

Grant SupportThis study was funded in part by the following: National Science Council

(grant NMRP 101-2314-B-182A-032-MY2; to T.-J.Wu); NIH (CA109311; toM.-C. Hung); Ministry of Science and Technology, International Research-intensive Centers of Excellence in Taiwan (I-RiCE; MOST 104-2911-I-002-302);Ministry ofHealth andWelfare,ChinaMedicalUniversityHospital CancerResearch Center of Excellence (MOHW104-TDU-B-212-124-002); and Centerfor Biological Pathways.

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received March 30, 2015; revised October 16, 2015; accepted December 1,2015; published OnlineFirst December 11, 2015.

References1. Sherman M. Hepatocellular carcinoma: epidemiology, surveillance, and

diagnosis. Semin Liver Dis 2010;30:3–16.2. Bosch FX, Ribes J, Diaz M, Cleries R. Primary liver cancer: worldwide

incidence and trends. Gastroenterology 2004;127:S5–S16.3. Perz JF, Armstrong GL, Farrington LA, Hutin YJ, Bell BP. The contributions

of hepatitis B virus and hepatitis C virus infections to cirrhosis and primaryliver cancer worldwide. J Hepatol 2006;45:529–38.

4. Tanaka K, Hirohata T, Takeshita S, Hirohata I, Koga S, Sugimachi K, et al.Hepatitis B virus, cigarette smoking and alcohol consumption in thedevelopment of hepatocellular carcinoma: a case-control study inFukuoka, Japan. Int J Cancer 1992;51:509–14.

5. Ikeda K, Saitoh S, Koida I, Arase Y, Tsubota A, Chayama K, et al. Amultivariate analysis of risk factors for hepatocellular carcinogenesis: aprospective observation of 795 patients with viral and alcoholic cirrhosis.Hepatology 1993;18:47–53.

6. Yang JD, Nakamura I, Roberts LR. The tumor microenvironment inhepatocellular carcinoma: current status and therapeutic targets. SeminCancer Biol 2011;21:35–43.

7. He G, Karin M. NF-kappaB and STAT3 - key players in liver inflammationand cancer. Cell Res 2011;21:159–68.

8. Perkins ND. Integrating cell-signalling pathways with NF-kappaB and IKKfunction. Nat Rev Mol Cell Biol 2007;8:49–62.

9. Karin M. Nuclear factor-kappaB in cancer development and progression.Nature 2006;441:431–6.

10. Maeda S, KamataH, Luo JL, Leffert H, KarinM. IKKbeta couples hepatocytedeath to cytokine-driven compensatory proliferation that promotes chem-ical hepatocarcinogenesis. Cell 2005;121:977–90.

11. Pikarsky E, Porat RM, Stein I, Abramovitch R, Amit S, Kasem S, et al. NF-kappaB functions as a tumour promoter in inflammation-associatedcancer. Nature 2004;431:461–6.

12. Liu M, Lee DF, Chen CT, Yen CJ, Li LY, Lee HJ, et al. IKKalpha activation ofNOTCH links tumorigenesis via FOXA2 suppression. Mol Cell 2012;45:171–84.

13. Tung-Ping Poon R, Fan ST, Wong J. Risk factors, prevention, and manage-ment of postoperative recurrence after resection of hepatocellular carci-noma. Ann Surg 2000;232:10–24.

14. Rahbari NN, Mehrabi A, Mollberg NM, Muller SA, Koch M, Buchler MW,et al. Hepatocellular carcinoma: current management and perspectives forthe future. Ann Surg 2011;253:453–69.

15. Wu JC, Huang YH, Chau GY, Su CW, Lai CR, Lee PC, et al. Risk factors forearly and late recurrence in hepatitis B-related hepatocellular carcinoma.J Hepatol 2009;51:890–7.

16. Li CW, Xia W, Huo L, Lim SO, Wu Y, Hsu JL, et al. Epithelial-mesenchymal transition induced by TNF-alpha requires NF-kappaB-mediated transcriptional upregulation of Twist1. Cancer Res 2012;72:1290–300.

17. Lee DF, Kuo HP, Chen CT, Hsu JM, Chou CK, Wei Y, et al. IKK betasuppression of TSC1 links inflammation and tumor angiogenesis via themTOR pathway. Cell 2007;130:440–55.

18. Fujita N, Jaye DL, Kajita M, Geigerman C, Moreno CS, Wade PA. MTA3, aMi-2/NuRD complex subunit, regulates an invasive growth pathway inbreast cancer. Cell 2003;113:207–19.

19. Ishak K, Baptista A, Bianchi L, Callea F, DeGroote J, Gudat F, et al.Histological grading and staging of chronic hepatitis. J Hepatol1995;22:696–9.

20. Lee TK, Poon RT, Yuen AP, Ling MT, Kwok WK, Wang XH, et al. Twistoverexpression correlates with hepatocellular carcinoma metastasisthrough induction of epithelial-mesenchymal transition. Clin Cancer Res2006;12:5369–76.

21. Yang MH, Chen CL, Chau GY, Chiou SH, Su CW, Chou TY, et al. Com-prehensive analysis of the independent effect of twist and snail in pro-moting metastasis of hepatocellular carcinoma. Hepatology 2009;50:1464–74.

22. Sugimachi K, Tanaka S, Kameyama T, Taguchi K, Aishima S, Shimada M,et al. Transcriptional repressor snail and progression of human hepato-cellular carcinoma. Clin Cancer Res 2003;9:2657–64.

23. SunD, SunB, Liu T, ZhaoX,CheN,GuQ, et al. Slug promoted vasculogenicmimicry in hepatocellular carcinoma. J Cell Mol Med 2013;17:1038–47.

24. Sun Y, Song GD, Sun N, Chen JQ, Yang SS. Slug overexpression inducesstemness and promotes hepatocellular carcinoma cell invasion andmetas-tasis. Oncol Lett 2014;7:1936–40.

25. Zhou YM, Cao L, Li B, Zhang RX, Sui CJ, Yin ZF, et al. Clinicopathologicalsignificance of ZEB1 protein in patients with hepatocellular carcinoma.Ann Surg Oncol 2011;19:1700–6.

26. Kim T, Veronese A, Pichiorri F, Lee TJ, Jeon YJ, Volinia S, et al. p53 regulatesepithelial-mesenchymal transition throughmicroRNAs targetingZEB1 andZEB2. J Exp Med 2011;208:875–83.

27. Inagawa S, Itabashi M, Adachi S, Kawamoto T, Hori M, Shimazaki J, et al.Expression and prognostic roles of beta-catenin in hepatocellular carcino-ma: correlation with tumor progression and postoperative survival. ClinCancer Res 2002;8:450–6.

28. Xia L, Huang W, Tian D, Zhu H, Qi X, Chen Z, et al. Overexpression offorkhead box C1 promotes tumor metastasis and indicates poor prognosisin hepatocellular carcinoma. Hepatology 2013;57:610–24.

29. Liao YL, SunYM,ChauGY,ChauYP, Lai TC,Wang JL, et al. Identification ofSOX4 target genes using phylogenetic footprinting-based prediction fromexpression microarrays suggests that overexpression of SOX4 potentiatesmetastasis in hepatocellular carcinoma. Oncogene 2008;27:5578–89.

30. Berasain C, Castillo J, Perugorria MJ, Latasa MU, Prieto J, Avila MA.Inflammation and liver cancer: new molecular links. Ann N Y Acad Sci2009;1155:206–21.

31. Julien S, Puig I, Caretti E, Bonaventure J,Nelles L, vanRoy F, et al. Activationof NF-kappaB by Akt upregulates Snail expression and induces epitheliummesenchyme transition. Oncogene 2007;26:7445–56.

32. Strippoli R, Benedicto I, Perez LozanoML, Cerezo A, Lopez-Cabrera M, delPozo MA. Epithelial-to-mesenchymal transition of peritoneal mesothelialcells is regulated by an ERK/NF-kappaB/Snail1 pathway. Dis Model Mech2008;1:264–74.

33. Wu Y, Deng J, Rychahou PG, Qiu S, Evers BM, Zhou BP. Stabilization ofsnail by NF-kappaB is required for inflammation-induced cell migrationand invasion. Cancer Cell 2009;15:416–28.

34. BarberaMJ, Puig I,DominguezD, Julien-Grille S,Guaita-Esteruelas S, PeiroS, et al. Regulation of Snail transcription during epithelial tomesenchymaltransition of tumor cells. Oncogene 2004;23:7345–54.

Wu et al.





35. Louha M, Nicolet J, Zylberberg H, Sabile A, Vons C, Vona G, et al. Liverresection and needle liver biopsy cause hematogenous dissemination ofliver cells. Hepatology 1999;29:879–82.

36. Ijichi M, Takayama T, Matsumura M, Shiratori Y, Omata M, Makuuchi M.alpha-Fetoprotein mRNA in the circulation as a predictor of postsurgicalrecurrence of hepatocellular carcinoma: a prospective study. Hepatology2002;35:853–60.

37. Hoshida Y, Villanueva A, KobayashiM, Peix J, ChiangDY, Camargo A, et al.Gene expression in fixed tissues and outcome in hepatocellular carcinoma.N Engl J Med 2008;359:1995–2004.

38. Baud V, KarinM. IsNF-kappaB a good target for cancer therapy?Hopes andpitfalls. Nat Rev Drug Discov 2009;8:33–40.

39. Raab MS, Podar K, Breitkreutz I, Richardson PG, Anderson KC. Multiplemyeloma. Lancet 2009;374:324–39.

40. Chen KF, Yeh PY, Yeh KH, Lu YS, Huang SY, Cheng AL. Down-regu-lation of phospho-Akt is a major molecular determinant of bortezomib-induced apoptosis in hepatocellular carcinoma cells. Cancer Res2008;68:6698–707.

41. Saeki I, Terai S, Fujisawa K, Takami T, Yamamoto N, Matsumoto T, et al.Bortezomib induces tumor-specific cell death and growth inhibition inhepatocellular carcinoma and improves liver fibrosis. J Gastroenterol2013;48:738–50.

42. Kim GP, Mahoney MR, Szydlo D, Mok TS, Marshke R, Holen K,et al. An international, multicenter phase II trial of bortezomib inpatients with hepatocellular carcinoma. Invest New Drugs 2012;30:387–94.

43. Muriel P. NF-kappaB in liver diseases: a target for drug therapy. J ApplToxicol 2009;29:91–100.

44. Ng IO, Poon RT, Shek TW, Fan ST. Clinicopathologic and prognosticsignificance of the histologic activity of noncancerous liver tissue inhepatitis B virus-associated hepatocellular carcinoma. Am J Clin Pathol2002;117:411–8.

45. Mazzaferro V, Romito R, Schiavo M, Mariani L, Camerini T, Bhoori S, et al.Prevention of hepatocellular carcinoma recurrence with alpha-interferonafter liver resection in HCV cirrhosis. Hepatology 2006;44:1543–54.

46. Wong JS,WongGL, Tsoi KK,Wong VW, Cheung SY, Chong CN, et al.Meta-analysis: the efficacy of anti-viral therapy in prevention of recurrence aftercurative treatment of chronic hepatitis B-related hepatocellular carcinoma.Aliment Pharmacol Ther 2011;33:1104–12.

47. Wu CY, Chen YJ, Ho HJ, Hsu YC, Kuo KN, Wu MS, et al. Associationbetween nucleoside analogues and risk of hepatitis B virus-related hepa-tocellular carcinoma recurrence following liver resection. JAMA 2012;308:1906–14.

48. Hsu YC, Ho HJ, Wu MS, Lin JT, Wu CY. Postoperative peg-interferon plusribavirin is associated with reduced recurrence of hepatitis C virus-relatedhepatocellular carcinoma. Hepatology 2013;58:150–7.

49. Miao RY, Zhao HT, Yang HY, Mao YL, Lu X, Zhao Y, et al. Postoperativeadjuvant antiviral therapy for hepatitis B/C virus-related hepatocellularcarcinoma: a meta-analysis. World J Gastroenterol 2010;16:2931–42.

50. Miyake Y, Takaki A, Iwasaki Y, Yamamoto K. Meta-analysis: interferon-alpha prevents the recurrence after curative treatment of hepatitis C virus-related hepatocellular carcinoma. J Viral Hepat 2010;17:287–92.






Published OnlineFirst December 11, 2015.Clin Cancer Res Ting-Jung Wu, Shih-Shin Chang, Chia-Wei Li, et al. Mesenchymal Transition after Resection

−B Pathway-Mediated EpithelialκRecurrence via NF-Severe Hepatitis Promotes Hepatocellular Carcinoma

Updated version

10.1158/1078-0432.CCR-15-0780doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2015/12/11/1078-0432.CCR-15-0780.DC1Access the most recent supplemental material at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://clincancerres.aacrjournals.org/content/early/2016/01/28/1078-0432.CCR-15-0780To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-15-0780

http://clincancerres.aacrjournals.org/content/suppl/2015/12/11/1078-0432.CCR-15-0780.DC1

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/early/2016/01/28/1078-0432.CCR-15-0780


severe hepatitis promotes hepatocellular carcinoma ... · severe hepatitis promotes hepatocellular...

Documents