Published by Oxford University Press on behalf of the Society of Toxicology 2013. This work is written by (a) US Government employee(s) and is in the public domain in the US.

Sertraline, an Antidepressant, Induces Apoptosis in Hepatic Cells Through the Mitogen-Activated Protein Kinase Pathway

Si Chen,* Jiekun Xuan,* Liqing Wan,*,† Haixia Lin,‡ Letha Couch,* Nan Mei,‡ Vasily N. Dobrovolsky,‡ and Lei Guo*1 

*Division of Biochemical Toxicology, National Center for Toxicological Research, U.S. FDA, Jefferson, AR 72079; †Shanghai Institute for Food and Drug Control, Shanghai 201203, PR China; and ‡Division of Genetic and Molecular Toxicology, National Center for Toxicological

Research, U.S. FDA, Jefferson, AR 72079

1To whom correspondence should be addressed at Division of Biochemical Toxicology, National Center for Toxicological Research, U.S. FDA, 3900 NCTR Road, HFT-110, Jefferson, AR 72079. Fax: (870) 543-7136. E-mail: lei.guo@fda.hhs.gov.

Received August 22, 2013; accepted October 29, 2013

Sertraline is generally used for the treatment of depression and is also approved for the treatment of panic, obsessive-com-pulsive, and posttraumatic stress disorders. Previously, using rat primary hepatocytes and isolated mitochondria, we dem-onstrated that sertraline caused hepatic cytotoxicity and mito-chondrial impairment. In the current study, we investigated and characterized molecular mechanisms of sertraline toxicity in human hepatoma HepG2 cells. Sertraline decreased cell viability and induced apoptosis in a dose- and time-dependent manner. Sertraline activated the intrinsic checkpoint protein caspase-9 and caused the release of cytochrome c from mitochondria to cytosol; this process was Bcl-2 family dependent because antia-poptotic Bcl-2 family proteins were decreased. Pretreatment of the HepG2 cells with caspase-3, caspase-8, and caspase-9 inhibi-tors partially but significantly reduced the release of lactate dehydrogenase, indicating that sertraline-induced apoptosis is mediated by both intrinsic and extrinsic apoptotic pathways. Moreover, sertraline markedly increased the expression of tumor necrosis factor (TNF) and the phosphorylation of JNK, extracellular signal-regulated kinase (ERK1/2), and p38. In sertraline-treated cells, the induction of apoptosis and cell death was shown to be the result of activation of JNK, but not ERK1/2 or p38 in the mitogen-activated protein kinase (MAPK) path-way. Furthermore, silencing MAP4K4, the upstream kinase of JNK, attenuated both apoptosis and cell death caused by sertra-line. Taken together, our findings suggest that sertraline induced apoptosis in HepG2 cells at least partially via activation of the TNF-MAP4K4-JNK cascade signaling pathway.

Key Words: sertraline; liver toxicity; mitochondrial dysfunc-tion; apoptosis; cell death; MAPK pathway.

Sertraline (trade name Zoloft), a selective serotonin reup-take inhibitor (SSRI) class antidepressant, is the most pre-scribed psychiatric medication in the United States (Kaplan and Zhang, 2012). Acute liver failure due to sertraline use has been

described, although the frequency is relatively low (Carvajal Garcia-Pando et  al., 2002; Collados et  al., 2010; Fartoux-Heymann et al., 2001; Galan Navarro, 2001; Hautekeete et al., 1998; Kim et al., 1999; Persky and Reinus, 2003; Tabak et al., 2009; Verrico et al., 2000). Recently, we reported that sertraline induced cell death and the disrupted liver mitochondrial func-tion in rat hepatocytes. Our mechanistic study suggested that mitochondrial dysfunction contributes to sertraline-associated liver toxicity (Li et al., 2012).

Mitochondria, the power house of the cell, contain proap-optotic molecules that are important in programmed cell death (apoptosis). Generally, 2 major pathways are recognized to be involved in apoptosis, namely, the mitochondria-mediated intrinsic pathway and the death receptor–mediated extrinsic pathway (Danial and Korsmeyer, 2004; Kroemer et al., 2007; Taylor et al., 2008). The intrinsic pathway is characterized by the loss of mitochondrial membrane potential, mitochondrial dysfunction, and the subsequent release of cytochrome c. The Bcl-2 family of proteins is closely involved in permeabiliza-tion of mitochondrial membrane and the leakage of cytochrome c.  The Bcl-2 family is composed of proapoptotic members (eg, Bax, Bak, Bid, Bik, Bim, and Puma) and antiapoptosis members (eg, Bcl-2 and Mcl-1) (Chao and Korsmeyer, 1998). Proapoptotic proteins suppress the protective effect of antia-poptotic proteins and promote the release the apoptogenic factor cytochrome c from the mitochondria into the cytosol (Marsden et  al., 2002). Cytochrome c subsequently activates caspase-9, which causes the activation of caspase-3, the “exe-cutioner” of apoptosis, resulting in cell death (Degterev et al., 2003; Zimmermann and Green, 2001). The extrinsic apop-totic pathway is initiated by binding of proapoptotic ligands, such as tumor necrosis factor (TNF) and Fas ligand, to their specific receptors, tumor necrosis factor receptor 1 (TNFR1) and Fas, forming a death-inducing signaling complex (DISC). The formation of the DISC recruits procaspase-8 and leads to

toxicological sciences 137(2), 404–415 2014doi:10.1093/toxsci/kft254Advance Access publication November 5, 2013

Sertraline induceS apoptoSiS in Hepatic cellS

the activation of caspase-8 that eventually activates caspase-3 as well.

Studies have shown that mitogen-activated protein kinase (MAPK) pathway is involved in the apoptotic process (Chang and Karin, 2001). The activity of the MAPK superfamily mem-bers is regulated through reversible dual phosphorylation of threonine and tyrosine residues. Three major MAPKs have been classified: extracellular signal-regulated kinase (ERK1/2), JNK, and p38. The ERK signaling cascade activation is stimu-lated by growth factors, linking cell proliferation to survival. In contrast, JNK and p38 are activated by cellular damage sign-aling, linking the induction of apoptosis to cell death (Chang and Karin, 2001; Xia et al., 1995). JNK also plays a role in the release of cytochrome c.  JNK’s activity can also be induced by proapoptotic ligand TNF (Dhanasekaran and Reddy, 2008); thus, JNK participates in both intrinsic and extrinsic apoptotic pathways.

In the present study, we investigated the involvement of MAPK signaling pathway in the toxic effect of sertraline in HepG2 cells. We demonstrate that sertraline induces apoptosis via both intrinsic and extrinsic caspase-dependent pathways. We also demonstrate that the TNF-initiated MAPK signaling pathway is involved in sertraline-induced apoptosis as well as cellular damage.

MATERIAlS ANd METHodS

Chemicals and reagents. Sertraline, William’s E medium, penicillin, streptomycin, propidium iodide, selective p38 MAPK inhibitor SB 239063, JNK inhibitor SP600125, ERK inhibitor PD184352, and dimethysulfoxide (DMSO) were from Sigma-Aldrich (St Louis, Missouri). Fetal bovine serum (FBS) was obtained from Atlanta Biologicals (Lawrenceville, Georgia). RNase A  was from Qiagen (Valencia, California). The general caspase inhibitor (Z-VAD-FMK), the caspase-3 inhibitor (Z-DEVD-FMK), the caspase-8 inhibi-tor (Z-IETD-FMK), and the caspase-9 inhibitor (Z-LEHD-FMK) were from R&D systems (Minneapolis, Minnesota). Blasticidin S HCl was from Life Technologies (Grand Island, New York).

Cell culture. The human hepatoma cell line HepG2 was obtained from the American Type Culture Collection (Manassas, Virginia). The cells were grown in Williams’s E medium supplemented with 10% FBS and antibiotics (50 U penicillin/ml and 50 μg streptomycin/ml) at 37°C in a humidified atmosphere with 5% CO

2. Unless otherwise specified, HepG2 cells were seeded at a con-

centration of 2–5 × 105 cells/ml in volumes of 100 μl/well in 96-well plates, in volumes of 5 ml in 60-mm tissue culture plates, or in volumes of 10 ml in 100-mm tissue culture plates. Cells were cultured for about 24 h prior to treatment with the indicated concentrations of sertraline or the vehicle control DMSO. The final concentration of DMSO was 0.1%.

The 293T cell line used for lentivirus packaging was purchased from Biosettia (San Diego, California) and maintained in Dulbecco’s Modified Eagle’s Medium supplemented with 10% FBS in the presence of 1mM sodium pyruvate and nonessential amino acids.

Vector construction and stable cell lines establishment. A specific tar-get site for silencing of human MAP4K4 was identified using RNAi Designer available at the Invitrogen’s Web site (https://rnaidesigner.invitrogen.com/rnaiexpress/index.jsp). Small hairpin RNA (shRNA) sequences were designed according to the structure of a doxycycline (DOX)-inducible shRNA lentivi-ral expression vector (Biosettia Inc.). The following shRNA-encoding DNA

oligo containing inner palindromic sequences was synthesized (Biosythesis, Inc., Lewisville, Texas): sh1 (5′- AAAAGACCAACTCTGGCTTGTT ATTGG ATCCAATAACAAGCCAGAG TTGGTC-3′) and the scramble shRNA (5′-AA AAGCTAC ACTATCGAGCAATTTTGGATCCAAAATTG CTCGATAGTGT AGC-3′), which did not contain significant homology to known genes, were used as control in silencing experiments. The generation of the lenti-shRNA vectors and the establishment of the stable cell lines were described previously (Chen et al., 2013). In total, 2 stable cell lines were generated, namely, scram-ble control (SC) and sh1-MAP4K4.

Cellular ATP level measurement. ATP content was quantified using the CellTiter-Glo Luminescent Cell Viability Assay (Promega Corporation, Madison, Wisconsin) and measured with a Synergy 2 Microplate Reader (BioTek, Winooski, Vermont). The cellular ATP content was calculated by com-paring the intensities of luminescence of the treated cells to that of the DMSO controls.

Lactate dehydrogenase assay. The cytotoxicity of sertraline was assessed using the lactate dehydrogenase (LDH) assay as described previously (Li et al., 2012)

Mitochondria isolation. The separation of mitochondria from cyto-solic components was performed using Pierce’s mitochondria isolation kit (ThermoScientific, Wilmington, Delaware) according the instruction of manu-facturer. Briefly, HepG2 cells (2 × 107), treated with different concentrations of sertraline for 6 h, were pelleted by centrifuge. The cells were lysed and the resultant lysates were collected and processed according to the Dounce homog-enization protocol of the manufacturer.

Cell cycle analysis. The subdiploid DNA peaks of HepG2 cells after ser-traline treatments were measured using cell cycle analysis as described previ-ously (Chen et al., 2013).

Assessment of mitochondrial membrane potential. Changes in mito-chondrial membrane potential were assessed by staining with JC-1 dye (5,50,6,60-tetrachloro-1,10,3,30-tetraethylbenzimidazol-carbocyanine iodide) (Sigma). HepG2 cells, seeded in 96-well plates, were treated with sertraline at specified concentrations or DMSO for 2 and 6 h. After treatment, the plates were centrifuged at 400 × g for 5 min and the supernatant was aspirated. The cells were then incubated in 100 μl medium containing JC-1 dye (2.5 μg/ml) for 20 min at 37°C and subsequently washed with 100 μl PBS 3 times by cen-trifugation at 400 × g for 5 min. The ratio of red to green fluorescence was determined by a Synergy 2 Microplate Reader (BioTek).

Caspase-3/7 and caspase-9 activity measurement. The enzymatic activi-ties of caspase-3/7 and caspase-9 were assayed using luminescent assay kits (Caspase-Glo 3/7 Assay Systems or Caspase-Glo 9 Assay Systems, Promega) according to the manufacturer’s instructions and measured with a Synergy 2 Microplate Reader (BioTek). The induction was calculated by comparing the luminescence of the treated cells to that of the DMSO controls.

RNA isolation. sh1-MAP4K4 and SC stable cell lines were seeded in 6-well plates and incubated with 1 μg/ml DOX for 4 days followed by con-tinued culture for additional 24 h without DOX. Total RNA from cells was iso-lated using the RNeasy system (Qiagen). The yield of the extracted RNA was determined spectrophotometrically by measuring absorption at 260 nm using a NanoDrop 8000 (ThermoScientific).

Real-time PCR assay. The expression of TNF and MAP4K4 was determined using a Bio-Rad CFX96 Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, California). Reactions were prepared according to the manufacturer’s instructions for FastStart Universal SYBR Green Master (Roche Applied Science, Indianapolis, Indiana) using the fol-lowing primers: human TNF (5′-CAGAGGGCCTGTACCTCATC-3′ and 5′-GGAAGACCCCTCCCAGATAG-3′), human MAP4K4 (5′- GAGAG GCTCCAGAGGCAGTTGCA-3′ and 5′- CCACCTCTCGCGCTCGGTC AG-3′), and human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (5′-AGAAGGCTGGGGCTCATTTG-3′ and 5′-AGGGGCCATCCACAGTCT

405

Chen et al.

TC-3′). Assays were run with FastStart Universal SYBR Green Master Mix (2×) (ROX) under universal cycling conditions (10 min at 95°C; 15 s at 95°C, 1 min 60°C, 40 cycles). Data normalization and analysis were conducted as described previously (Guo et al., 2009, 2010).

Western blot analysis. Cells were grown and treated with sertra-line in 60- or 100-mm tissue culture plates. Standard Western blots were performed using antibodies against caspase-3, caspase-9, cytochrome c, Bak, Bid, Bik, Bim, Bax, Puma, Bcl-2, Mcl-1, JNK, phospho-JNK (Thr 183/Thr 185), ERK1/2, phospho-ERK1/2 (Thr 202/Tyr 204), p38, and phospho-p38 (Thr 180/Tyr 182)  (Cell Signaling Technology, Danvers, Massachusetts), and c-Jun, phospho-c-Jun (Ser 63), using GAPDH as internal control (Santa Cruz Biotechnology, Santa Cruz, California) fol-lowed by a secondary antibody conjugated with horseradish peroxidase (Santa Cruz Biotechnology).

Statistical analyses. Data are presented as mean ± SD of at least 3 inde-pendent experiments. Analyses were performed using GraphPad Prism 5 (GraphPad Software, San Diego, California). Statistical significance was deter-mined by 1-way ANOVA followed by the Dunnett’s tests for pairwise com-parisons or 2-way ANOVA followed by the Bonferroni’s post hoc test. The difference was considered statistically significant when p < .05.

RESulTS

Sertraline Causes Cellular Damage and Mitochondrial Membrane Potential Depolarization in HepG2 Cells

To determine whether sertraline induces cytotoxicity to HepG2 cells, cells were incubated in medium containing sertra-line at concentrations from 6.25 to 50μM, and an LDH release assay was performed at 2, 6, and 24 h. Figures 1A–C (lines) showed that LDH release increased in a time- and dose-depend-ent manner following the treatment with sertraline. Significant LDH release was observed with 37.5μM sertraline treatment for 2 h, with about 16% of LDH being released into the cul-ture medium, whereas only about 8% of LDH was released in DMSO control cells (Fig. 1A). At 6 and 24 h, sertraline caused significant cell damage, 25μM sertraline increased LDH release to about 21% and 55%, respectively (Figs. 1B and 1C).

ATP level was measured in parallel to determine imbalances in energy metabolism in sertraline-treated cells. As shown in

FIG. 1. Sertraline caused cellular damage and mitochondrial membrane potential depolarization. HepG2 cells were exposed to increasing concentrations (6.25, 12.5, 25, 37.5, and 50μM) of sertraline, with DMSO as the vehicle control for 2, 6, and 24 h. A–C, Cellular ATP content (bars) and LDH release (lines) were determined as described under Materials and Methods section; the results shown are mean ± SD of 4 separate experiments. #p < .05, ##p < .01, and ###p < .001 represent ATP is significantly different from the control for each time point; **p < .01 and ***p < .001 represent LDH release is significantly different from the control for each time point. D, Mitochondrial membrane potential was measured by JC-1 staining. Data are calculated based on the percent red (Ex = 530 nm, Em = 590 nm)/green (Ex = 485 nm, Em = 538 nm) fluorescence ratio and are presented as percentage in comparing with the vehicle control (vehicle control treated cells = 100). Data for 2 and 6 h after indicated concentrations of sertraline treatment are given as the mean ± SD of 4 separate experiments (**p < .01, ***p < .001). Abbreviations: DMSO, dimethysulfoxide; LDH, lactate dehydrogenase.

406

Sertraline induceS apoptoSiS in Hepatic cellS

Figures 1A–C (bars), at concentrations of 6.25 and 12.5μM, sertraline significantly decreased ATP levels, whereas no obvi-ous or much less cell death was detected as measured with LDH release at the same concentrations. These data indicate that in HepG2 cells, ATP depletion occurred prior to the dis-ruption of cellular membrane integrity, which is in good agree-ment with our previous results with rat primary hepatocytes (Li et al., 2012).

To determine whether sertraline causes mitochondrial disruption in HepG2 cells, membrane permeable JC-1 dye staining was performed. JC-1 dye exhibits potential-depend-ent aggregation in healthy mitochondria, signaled by a fluorescence emission shift from green to red. When mito-chondrial membranes depolarize, JC-1-stained cells show a decrease in the ratio of red/green fluorescence. As shown in Figure 1D, there is a significant decrease in mitochondrial membrane potential in HepG2 cells exposed to sertraline starting from 12.5μM. These data showed that sertraline initiated changes in the mitochondrial membrane potential,

which could further result in disruption of active mitochon-dria and apoptosis.

Sertraline Induces Apoptosis in HepG2 Cells

Because the disruption of mitochondrial function is a distinc-tive characteristic of apoptosis, the above results encouraged us to test whether or not sertraline induces apoptosis. A set of apoptotic tests, including subdiploid DNA content characteri-zation and caspase-9 and caspase-3/7 activation, were applied. Flow cytometric analysis of cell apoptosis showed that the ratio of cells with subdiploid nuclei formation increased signifi-cantly in a dose- and time-dependent manner following treat-ment with sertraline (Figs. 2A and 2B). At 6 h, 50μM sertraline induced nearly 100% cell apoptosis, as all DNA peaks shifted to the sub-G1 phase.

Sequential activation of caspases plays a vital role in the apoptotic process. Accordingly, the enzymatic activities of cas-pase-9 and caspase-3/7 were measured. At 2 h, caspase-9 and caspase-3/7 were activated in response to sertraline treatment.

FIG. 2. Sertraline induced apoptosis in HepG2 cells. HepG2 cells were exposed to increasing concentrations (0, 6.25, 12.5, 25, 37.5, and 50μM) of sertraline for 2 and 6 h. A, Flow cytometric analysis for the percentages of apoptotic cells with sub-G1 DNA content. Histograms shown are DNA content analyses for HepG2 cells treated with the indicated concentrations of sertraline for 2 and 6 h. Treated cells were stained with propidium iodide and processed for cell cycle analysis. Sub-G1 was defined as the cells undergoing apoptosis. B, The line graph depicts the mean percentage of sub-G1 ± SD from 3 independent experiments. *p < .05, **p < .01, and ***p < .001 versus DMSO-treated cells. C and D, Cellular caspase-9 and caspase-3/7 activity were expressed as fold change to DMSO control cells (*p < .05, **p < .01, and ***p < .001). Abbreviation: DMSO, dimethysulfoxide.

407

Chen et al.

The effect started to be seen at 25μM, and the maximum induc-tion appeared at 50μM. At 6 h, the activities declined at the 37.5μM treatment (Figs. 2C and 2D), presumably due to sig-nificant necrotic cell death as measured with the LDH release assay (Fig. 1B).

To confirm further the caspase activation in sertraline-induced apoptosis, Western blot analysis was used to determine the cleavage of caspase-9 and caspase-3 and also the release of cytochrome c to the cytoplasm. The cleaved form of cas-pase-9 or caspase-3 was markedly increased at 50μM sertra-line treatment, as demonstrated in Figure 3A. As indicated in Figure 3B, the cytosolic fraction of cytochrome c was signifi-cantly increased, accompanied by a decreased proportion in mitochondria.

The protective effects of general and specific caspase inhibitors on sertraline-induced cytotoxicity were assessed. As shown in Figure 3C, pretreatment (1 h) with 10μM VAD-FMK (general caspase inhibitor), 10μM DEVD-FMK (cas-pase-3 inhibitor), 10μM IETD-FMK (caspase-8 inhibitor), or 10μM LEHD-FMK (caspase-9 inhibitor) significantly attenuated sertraline’s cytotoxicity, indicating the direct involvement of caspase-3, -8, and -9 in sertraline-associated apoptosis. It should note that although caspase inhibitors sig-nificantly attenuated sertraline-induced apoptosis statistically,

the reserving effect was somehow partially (Fig. 3C), indicat-ing other mechanisms may exist besides caspase-dependent pathway.

Collectively, the increase of sub-G1 percentage and the activation of caspase signaling pathway indicate that cellular damage and mitochondrial disruption (Fig.  1) resulted from apoptotic cell death in HepG2 cells (Figs. 2 and 3).

Antiapoptotic Bcl-2 Family Proteins Are Involved in Sertraline-Induced Apoptosis

It is known that the balance between the activities of proap-optotic and antiapoptotic Bcl-2 family members in the intrinsic mitochondrial apoptosis pathway regulates caspase activation and determines cellular fate (Chao and Korsmeyer, 1998). The protein expression levels of proapoptotic Bax, Bid, Bik, Bim, Bak, Puma and antiapoptotic Bcl-2 and Mcl-1 were determined using Western blot analysis in sertraline-treated cells. As shown in Figure 4A, only the key antiapoptotic members Bcl-2 and Mcl-1 were notably decreased in a time- and dose-dependent manner, and there was no change in proapoptotic Bax, Bid, Bik, Bim, Bak, and Puma levels (Fig. 4B), indicating that antia-poptotic members rather than proapoptotic members contribute the most to sertraline-associated apoptosis.

FIG. 3. Effects of sertraline on apoptosis related proteins in HepG2 cells. A, Total cellular proteins were extracted at 6 h after sertraline treated, and levels of caspase-3 and caspase-9 were detected by Western blotting. GAPDH was used as a loading control. Similar results were obtained from 3 independent experi-ments. B, Mitochondrial and cytosolic proteins were extracted at 6 h after sertraline treatment, and levels of cytochrome c were detected by Western blotting. GAPDH was used as a loading control. Similar results were obtained from 3 independent experiments. C, HepG2 cells were pretreated with 10μM Z-VAD-FMK (general caspase inhibitor), Z-DEVD-FMK (caspase-3 inhibitor), Z-IETD-FMK (caspase-8 inhibitor), and Z-LEHD-FMK (caspase-9 inhibitor) for 1 h prior to treatment of sertraline for 2 h. Cell viability was assessed by LDH assay. The bar graphs are shown as mean ± SD of 3 experiments. *p < .05, **p < .01, and ***p < .001 compared with treatment of sertraline alone. Abbreviations: DMSO, dimethysulfoxide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LDH, lactate dehydrogenase.

408

Sertraline induceS apoptoSiS in Hepatic cellS

Sertraline Alters MAPK Pathway in HepG2 Cells

Apoptosis also occurs when the extrinsic pathway is acti-vated. The extrinsic apoptotic pathway is initiated by cell death receptors, such as TNFR and FAS located in the plasma mem-brane. Binding of ligands such as TNF or FASL to their recep-tors initiates the extrinsic pathway and leads to activation of caspases (Chu, 2013; Wajant, 2002).

To explore whether or not sertraline induces apoptosis through the extrinsic pathway, the expression level of the TNF gene was measured by quantitative real-time PCR. As indi-cated in Figure 5A, TNF expression was significantly increased in response to the treatment with sertraline. At 6 h, treatment of 25μM sertraline increased TNF expression about 6-fold, whereas about 66-fold induction was observed at a concentra-tion of 50μM compared with DMSO control.

Binding of TNF to its receptor triggers the MAPK signaling pathway, which is important in apoptotic process (Chang and Karin, 2001; Xia et al., 1995). In a preliminary study using gene

expression microarrays, we observed that the MAPK pathway was significantly altered in HepG2 cells exposed to sertraline (Chen et al., unpublished data). Accordingly, we investigated the activation (phosphorylation) of 3 key members (JNK, p38, and ERK1/2) in the MAPK signaling pathway. Phosphorylation of JNK and p38 was substantially increased in a dose- and time-dependent manner after 2- and 6-h sertraline treatment (Fig. 5B). Phosphorylation of ERK1/2 was also increased at 2 h in a dose-dependent manner; however, at 6 h, the maximum phosphoryla-tion occurred at 12.5μM and declined with 25 and 50μM sertraline (Fig. 5B). These results indicate that sertraline possibly regulates TNF-initiated JNK- and p38-MAPK signaling pathways.

MAP4K4-JNK Pathway Regulates Sertraline-Induced Apoptosis and Cellular Damage

To investigate further which members of MAPK pathway are involved in sertraline-induced cell death and determine the precise regulatory pathway, inhibitors targeting different

FIG. 4. Changes of Bcl-2 family members in response to sertraline treatment. Total cellular proteins were extracted at 2 and 6 h after exposure to sertraline. The expression level of proapoptosis Bcl-2 family members including Bak, Bid, Bik, Bim, Bax, and Puma (A) and antiapoptosis proteins including Bcl-2 and Mcl-1 (B) was examined by Western blotting. GAPDH was used as a loading control. The figure is representative of 3 independent experiments. Abbreviation: GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

FIG. 5. Effects of sertraline on extrinsic apoptotic pathway in HepG2 cells. A, Total RNAs were isolated at 6 h after sertraline treatment. The gene expression levels of TNF were determined by real-time PCR. Values were means ± SD of 3 separate experiments. **p < .01 and ***p < .001 versus the DMSO controls. B, Total cellular proteins were extracted at 2 and 6 h after exposure to sertraline. The expression levels of activated JNK (phospho-JNK), p38 (phospho-p38), and ERK1/2 (phospho-ERK1/2) were detected by Western blot analyses. GAPDH was loaded as internal control. Data are typical of 3 experiments. Abbreviations: DMSO, dimethysulfoxide; ERK1/2, extracellular signal-regulated kinase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TNF, tumor necrosis factor.

409

Chen et al.

members of the MAPK pathway were used. SP600125 (a spe-cific inhibitor of JNK), SB239063 (a potent p38 inhibitor), and PD184352 (a highly selective inhibitor of ERK1/2) were added to cell cultures 2 h prior to treatment with sertraline. As shown in Figure 6A, pretreatment of 10μM SP600125, 10μM SB239063, or 2μM PD184352 notably suppressed the activa-tion (phosphorylation) of JNK, p38, or ERK1/2, respectively, elicited by 25μM sertraline. As for the endpoint of apoptosis (ie, caspase-3/7), pretreatment with 10μM SP600125 signifi-cantly inhibited caspase-3/7 activation induced by 25μM ser-traline (Fig. 6B). Although there was a trend of inhibition of caspase-3/7 with SB239063 and PD184352, the changes were not statistically significant (Fig.  6B). Furthermore, 10μM SP600125 significantly reduced cell death induced by 25 and 37.5μM sertraline (as measured by LDH release) (Fig. 6C); however, did not reduce cell death induced by 50μM. The JNK inhibitor SP600125 likely blocks the early stage of cell death, that is, apoptosis (Fig. 6B), a significant necrotic

response occurred at 50μM so that the JNK inhibitor was not able to rescue cell death. Pretreatment with SP600125 also significantly diminished cell death induced by 24-h treatment of 12.5 and 25μM sertraline, again had no effect on higher doses (37.5 and 50μM) (Supplementary Figure 1). These data indicated that JNK rather than ERK1/2 or p38 is the major player in sertraline-induced cellular damage and apoptosis.

We next examined c-Jun, a transcriptional factor participat-ing in apoptosis and proliferation that is downstream of JNK (Wisdom et  al., 1999; Zhou and Thompson, 1996). Western blotting results showed that the levels of c-Jun and phosphoryl-ated c-Jun were both upregulated following the treatment with sertraline and that the upregulation was time and dose depend-ent (Fig. 6D).

MAP4K4 is an enzyme that specifically activates JNK and mediates the TNF signaling pathway (Yao et  al., 1999). To investigate the involvement of events upstream of JNK in apop-tosis induced by sertraline, MAP4K4 was silenced in HepG2

FIG. 6. Effects of SP600125, SB239063, and PD184352 on sertraline-induced apoptosis and cell death in HepG2 cells. A, HepG2 cells were pretreated with various concentrations of SP600125 (JNK inhibitor), SB239063 (p38 inhibitor), or PD184352 (ERK1/2 inhibitor) for 2 h prior to 6 h treatment with 25μM sertra-line. The inhibitory effects of SP600125, SB239063, and PD184352 were determined by Western blotting. The same blot was stripped and used to determine the amount of each kinase. B and C, After treatment with 10μM SP600125, 10μM SB239063, or 2μM PD184352 for 2 h, the cells were treated with 25μM sertraline for 6 h. B, Apoptosis was assessed by caspase-3/7 activity and (C) the LDH assay was used as an indicator of cell viability. The bar graphs show the mean ± SD of 3 experiments. **p < .005 and ***p < .001 versus treatment with sertraline alone. D, Expression of c-Jun and activated c-Jun (phospho-c-Jun) was determined by Western blotting. HepG2 cells were treated with the indicated concentrations of sertraline for 2 and 6 h. Treated cells were lysed and subjected to Western blotting analyses with antibodies against phospho-c-Jun and c-Jun. GAPDH was used as a loading control. Similar results were obtained from 3 additional experiments. Abbreviations: DMSO, dimethysulfoxide; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; LDH, lactate dehydrogenase.

410

Sertraline induceS apoptoSiS in Hepatic cellS

cells using a DOX-induced lentivirus system. shRNA target-ing MAP4K4 was designed and shown to downregulate the transcription of MAP4K4, with efficiency of 88% (Fig. 7A). As shown in Figure 7B, silencing of MAP4K4 decreased the activation of caspase-3/7 induced by 25 and 37.5μM sertra-line. Silencing of MAP4K4 also prevented the decline of ATP levels and also decreased the LDH release induced by ser-traline starting at 37.5μM for 2-h (Figs. 7C and 7D), 25μM for 6-h (Supplementary Figures 2A and 2C), and 12.5μM for 24-h treatments (Supplementary Figures 2B and 2D). These data indicate that the MAP4K4-JNK pathway is criti-cal for sertraline-induced apoptosis as well as for cellular damage.

dIScuSSIoN

Previously, we have studied the hepatotoxicity of sertraline using rat primary hepatocytes and isolated mitochondria. We

demonstrated that sertraline induced mitochondrial membrane permeability and inhibited and uncoupled mitochondrial oxi-dative phosphorylation. The liver mitochondrion is an impor-tant target through which sertraline exerts its toxicity (Li et al., 2012).

Mitochondria play important roles in activating apoptosis in mammalian cells. One of 2 major apoptotic pathways is named the “mitochondrial pathway” (Wang and Youle, 2009). The results of our previous study prompted us to determine the role of apoptosis in sertraline’s toxicity.

The convergence of intrinsic and extrinsic apoptotic path-ways occurs ultimately at the activation of caspase-3/7, the key “executioner” of downstream events in apoptosis (Degterev et  al., 2003). Therefore, caspase-3/7 was used as the primary endpoint to examine the possibility of sertraline-induced apoptosis, and 3 different cell lines—rat primary hepatocytes, the human hepatic cell line HepG2, and the murine hepatic cell line Hepa1c1c7—were tested in our ini-tial study. Treatment with 50μM sertraline for 2 h increased

FIG. 7. Effect of silencing MAP4K4 on sertraline-induced apoptosis and cell death in HepG2 cells. A, HepG2 cell lines stably express DOX-inducible sh1-MAP4K4 or a SC. These 2 cell lines were incubated with DOX for 4 days followed by continued culture for another 24 h without DOX; then the decrease in MAP4K4 mRNA was assessed by real-time PCR. Values are means ± SD of 3 separate experiments. ***p < .001 versus the SCs. B–D, sh1-MAP4K4 and SC cells were incubated with DOX for 4 days and then treated with sertraline at indicated concentration for another 2 h without DOX. Treated cells were then analyzed for caspase-3/7 activity, ATP content, and LDH release. The bar graphs show the mean ± SD of 3 experiments. *p < .05, **p < .01, and ***p < .001 compared with SCs. Abbreviations: DOX, doxycycline; LDH, lactate dehydrogenase; SC, scramble control.

411

Chen et al.

caspase-3/7 activity about 1.5-fold, 21-fold, and 8-fold in rat primary hepatocytes, HepG2, and Hepa1c1c7, respectively (Fig.  2C and Supplementary Figure  3). Because maximum apoptotic induction was observed in HepG2 cells, subsequent studies were conducted in these cells. Human primary hepato-cytes might be more relevant for studying of pharmaceuticals; however, high variability, limited availability, and inability to perform genetic modification (eg, overexpressing or silenc-ing genes of interest) limit their use (Guo et al., 2011; Ning et  al., 2008). On the other hand, HepG2 cells have proven value for toxicological studies in general (Bova et al., 2005; Dykens et al., 2008; Felser et al., 2013; Greer et al., 2010; Guo et al., 2006; Juan-Garcia et al., 2013; Marroquin et al., 2007; Nguyen et  al., 2013; Seeland et  al., 2013) and for studying drug-induced apoptosis (Guo et al., 2006; Juan-Garcia et al., 2013; Nguyen et al., 2013). The lack of some drug-metabo-lizing genes in HepG2 cells may be problematic for stud-ies focusing on metabolism; however, the ability to perform genetic modifications (ie, silencing of genes of interest, as in this study) is advantageous for the in-depth study of mecha-nisms of toxicity at the molecular level.

Clinically, the maximum plasmid concentration is around 0.3 or 0.74μM following a single oral dose of 200 or 400 mg sertra-line administered (Mandrioli et al., 2013; Saletu et al., 1986). Concentrations of sertraline used in our study were higher than reported plasma concentrations. It is known that many variables including genetic variability, race, sex, age, metabolic capacity, drug-drug interactions, and preexisting diseases contribute to individual susceptibility of idiosyncratic drugs (Lee, 2003). To identify an idiosyncratic hepatotoxic drug, it is suggested that a dose that is equivalent to 100-fold of the C

max should be tested

(Xu et al., 2008). Because the concentrations of sertraline in our study are 6.25–50μM, which is within the range of 100 times of reported C

max (30 or 74μM), the concentrations used in

our study were meaningful.Permeabilization of the mitochondrial membrane and release

of cytochrome c into the cytosol are key determinants of mitochondria-mediated intrinsic apoptotic signaling pathway (Danial and Korsmeyer, 2004). The release of cytochrome c, in turn, activates caspase-9 and caspase-3/7 (Boehning et al., 2003). In our study, cytochrome c release (Fig. 3B) and cas-pase-9 and caspase-3/7 activation (Figs. 2C, 2D, and 3A) were accompanied by the decrease in mitochondrial membrane potential suggesting that sertraline induces apoptosis via the mitochondria-mediated intrinsic apoptotic signaling pathway.

The Bcl-2 protein family members are critical intracel-lular regulators of the intrinsic apoptotic pathway that con-trols permeability of the outer mitochondrial membrane and the release of cytochrome c (Rodriguez et al., 2011; Sharpe et  al., 2004). In the present study, the Bcl-2 proapoptotic proteins Bax, Bid, Bik, Bim, Bak, and Puma showed no changes following the treatment with sertraline, whereas antiapoptosis proteins Bcl-2 and Mcl-1 were inhibited, implying that the inhibition of antiapoptosis proteins is

responsible for the subsequent cytochrome c release and apoptosis (Fig. 4).

To uncover in-depth the molecular mechanisms of sertraline-induced toxicity, we performed microarray analysis to exam-ine the global changes of gene expression in sertraline- and DMSO-treated HepG2 cells. The MAPK signaling pathway was one of the most significantly altered pathways, in addition to the cell cycle and apoptosis pathways (unpublished data). We also observed significant changes in expression of MAPK-associated genes, for example, MAP4K4, TNF, and c-Jun in sertraline-treated cells, which may help provide a better under-standing of the mechanism of apoptosis induction in vitro.

MAPKs are involved in regulating intracellular signals in response to a wide array of extracellular stimulations. MAPK family members (ERK1/2, JNK, and p38) participate in cell proliferation, differentiation, survival, and apoptosis (Pearson et al., 2001). It has been reported that the balance between the growth signal–activated ERK1/2 and stress signal–activated JNK-p38 pathways governs whether or not cells survive or undergo apoptosis and necrosis (Xia et al., 1995).

Consistent with gene expression data, 25μM sertraline treat-ment for 6 h markedly increased phosphorylation and activation of ERK1/2, JNK, and p38 (Fig.  5B). This was paralleled by ATP depletion (Fig.  1B) and significant cell apoptosis (Figs. 2A and 2B). The involvement of JNK activation in sertraline-induced cell death (apoptosis and necrosis) was further con-firmed by pretreating HepG2 cells with a specific inhibitor of JNK (SP600125) (Figs. 6B and 6C).

JNK plays an important role in both intrinsic and extrin-sic apoptotic pathways. JNK promotes intrinsic apoptosis by modulating the activities of pro- and antiapoptotic Bcl-2 family proteins (Dhanasekaran and Reddy, 2008). It is possible that the decrease in the levels of antiapoptotic proteins Bcl-2 and Mcl-1 (Fig. 4B) may be regulated by JNK. In addition, JNK activation is required for TNFα-mediated caspase-8 cleavage, which is the initiation event in death receptor apoptotic signal-ing pathway (Deng et al., 2003). In the TNFα-activated JNK signaling pathway, MAP4K4 is a specific upstream kinase in the MAP4K4→MAP3K7→MAP2K4, MAP2K7→JNK kinase cascade (Yao et  al., 1999). In the present study, we demon-strated that sertraline upregulates TNFα expression and JNK activation. Moreover, blocking JNK activation with a specific inhibitor (Fig. 6) or decreasing the upstream kinase MAP4K4 by silencing its gene expression (Fig. 7) attenuated sertraline-induced apoptosis and necrosis.

Antidepressants are classified as SSRI, tricyclic antidepres-sants, tetracyclic antidepressants, monoamine oxidase inhibi-tors, or serotonin/noradrenergic reuptake inhibitors based on their pharmacological effects (Carrasco and Sandner, 2005; Holtzheimer and Nemeroff, 2006). A number of in vitro stud-ies have reported that some antidepressants induced apop-tosis (Chang et al., 2008; Jan et al., 2013; Levkovitz et al., 2005; Xia et al., 1996, 1998; Zhang et al., 2013). Although the molecular mechanism is not clearly elucidated, it was

412

Sertraline induceS apoptoSiS in Hepatic cellS

reported that the tricyclic antidepressants clomipramine, imipramine, and citalopram had apoptotic effects in human peripheral lymphocytes, as determined by DNA gel electro-phoresis and flow cytometric analysis (Xia et al., 1996, 1998). The SSRI antidepressants paroxetine and fluoxetine also have been shown to possess apoptotic activity in glia and neural cell lines, as quantified by flow cytometric analysis, cytochrome c release, and the activation of caspase-3. Activation of c-Jun was also demonstrated in the study, indicating the involve-ment of JNK pathway because c-Jun is a major end-product of JNK pathway activation (Levkovitz et al., 2005). In human osteosarcoma cells, paroxetine evoked apoptosis via the p38 MAPK-dependent signaling pathway but not the ERK- or JNK-dependent pathways (Chou et  al., 2007). In another study, in Neuro-2a cells treated with maprotiline, a tetracy-clic antidepressant, there was an induction of apoptosis and increased caspase-3 activation. Maprotiline-induced apop-tosis was medicated through the activation of JNK and the inactivation of ERK (Jan et al., 2013). Desiparmine, another tricyclic antidepressant, displayed apoptotic activity in human PC3 prostate cancer cells and activated the phosphorylation of JNK, but not ERK or p38 in the MAPK signaling path-way (Chang et al., 2008). Due to nonspecific mode of action, it is not surprising that the apoptotic activity of antidepres-sants eventually induced cell death in various types of cells. Although it is likely that antidepressant-induced apoptosis is mediated by MAPK signaling pathway, there was discrepancy as to which signaling cascade was activated. Sertraline was found for the first time in the present study to induce apop-tosis via MAPK signaling pathway. The activation of 3 key protein kinases ERK, p38, and JNK depends on the cell type, metabolic state, and environment of the cell and the stimulus (Raman et  al., 2007). It is possible that different classes of antidepressants trigger distinct MAPK pathway in different cell types by activating various kinases.

Besides MAPK pathway, some other signaling pathways also have been shown to be involved in sertraline-induced cell death (Reddy et al., 2008; Tzadok et al., 2010). For instance, sertraline inhibited the phosphorylation of Akt and caused cell death in human melanoma cells (Reddy et al., 2008), suggest-ing a role of Akt in sertraline-induced cell proliferation and apoptosis and also a complex mode of action in sertraline’s toxicity.

In summary, sertraline induces apoptosis in HepG2 cells in a dose- and time-dependent manner. Both intrinsic and extrin-sic apoptotic pathways play roles. Although 3 key molecules (JNK, p38, and ERK1/2) in MAPK pathway were altered, TNFα-MAP4K4-JNK may be the most important pathway responsible for sertraline-induced apoptosis.

SuPPlEMENTARy dATA

Supplementary data are available online at http://toxsci.oxfordjournals.org/.

FuNdING

S.C., J.X., and H.L.  were supported by appointments to the Postgraduate Research Program at the National Center for Toxicological Research administered by the Oak Ridge Institute for Science Education through an interagency agree-ment between the U.S. Department of Energy and the U.S. FDA. L.W.  was supported by the U.S. FDA’s International Scientist Exchange Program.

AcKNowlEdGMENTS

We thank Dr William Melchior for his critical review of this manuscript. This article is not an official guidance or policy statement of the U.S. FDA. No official support or endorsement by the U.S. FDA is intended or should be inferred.

REFERENcES

Boehning, D., Patterson, R. L., Sedaghat, L., Glebova, N. O., Kurosaki, T., and Snyder, S. H. (2003). Cytochrome c binds to inositol (1,4,5) trisphos-phate receptors, amplifying calcium-dependent apoptosis. Nat. Cell Biol. 5, 1051–1061.

Bova, M. P., Tam, D., McMahon, G., and Mattson, M. N. (2005). Troglitazone induces a rapid drop of mitochondrial membrane potential in liver HepG2 cells. Toxicol. Lett. 155, 41–50.

Carrasco, J. L., and Sandner, C. (2005). Clinical effects of pharmacologi-cal variations in selective serotonin reuptake inhibitors: An overview. Int. J. Clin. Pract. 59, 1428–1434.

Carvajal Garcia-Pando, A., García del Pozo, J., Sánchez, A. S., Velasco, M. A., Rueda de Castro, A. M., and Lucena, M. I. (2002). Hepatotoxicity associated with the new antidepressants. J. Clin. Psychiatry 63, 135–137.

Chang, H. C., Huang, C. C., Huang, C. J., Cheng, J. S., Liu, S. I., Tsai, J. Y., Chang, H. T., Huang, J. K., Chou, C. T., and Jan, C. R. (2008). Desipramine-induced apoptosis in human PC3 prostate cancer cells: Activation of JNK kinase and caspase-3 pathways and a protective role of [Ca2+]i elevation. Toxicology 250, 9–14.

Chang, L., and Karin, M. (2001). Mammalian MAP kinase signalling cascades. Nature 410, 37–40.

Chao, D. T., and Korsmeyer, S. J. (1998). BCL-2 family: Regulators of cell death. Annu. Rev. Immunol. 16, 395–419.

Chen, S., Wan, L., Couch, L., Lin, H., Li, Y., Dobrovolsky, V. N., Mei, N., and Guo, L. (2013). Mechanism study of goldenseal-associated DNA damage. Toxicol. Lett. 221, 64–72.

Chou, C. T., He, S., and Jan, C. R. (2007). Paroxetine-induced apoptosis in human osteosarcoma cells: Activation of p38 MAP kinase and cas-pase-3 pathways without involvement of [Ca2+]i elevation. Toxicol. Appl. Pharmacol. 218, 265–273.

Chu, W. M. (2013). Tumor necrosis factor. Cancer Lett. 328, 222–225.

Collados, V., Hallal, H., and Andrade, R. J. (2010). Sertraline hepatotoxicity: Report of a case and review of the literature. Dig. Dis. Sci. 55, 1806–1807.

Danial, N. N., and Korsmeyer, S. J. (2004). Cell death: Critical control points. Cell 116, 205–219.

Degterev, A., Boyce, M., and Yuan, J. (2003). A decade of caspases. Oncogene 22, 8543–8567.

Deng, Y., Ren, X., Yang, L., Lin, Y., and Wu, X. (2003). A JNK-dependent path-way is required for TNFalpha-induced apoptosis. Cell 115, 61–70.

413

Chen et al.

Dhanasekaran, D. N., and Reddy, E. P. (2008). JNK signaling in apoptosis. Oncogene 27, 6245–6251.

Dykens, J. A., Jamieson, J. D., Marroquin, L. D., Nadanaciva, S., Xu, J. J., Dunn, M. C., Smith, A. R., and Will, Y. (2008). In vitro assessment of mito-chondrial dysfunction and cytotoxicity of nefazodone, trazodone, and bus-pirone. Toxicol. Sci. 103, 335–345.

Fartoux-Heymann, L., Hézode, C., Zafrani, E. S., Dhumeaux, D., and Mallat, A. (2001). Acute fatal hepatitis related to sertraline. J. Hepatol. 35, 683–684.

Felser, A., Blum, K., Lindinger, P. W., Bouitbir, J., and Krähenbühl, S. (2013). Mechanisms of hepatocellular toxicity associated with dronedarone–a com-parison to amiodarone. Toxicol. Sci. 131, 480–490.

Galan Navarro, J. L. (2001). Acute cholestatic hepatitis probably caused by sertraline. Rev. Esp. Enferm. Dig. 93, 822.

Greer, M. L., Barber, J., Eakins, J., and Kenna, J. G. (2010). Cell based approaches for evaluation of drug-induced liver injury. Toxicology 268, 125–131.

Guo, L., Dial, S., Shi, L., Branham, W., Liu, J., Fang, J. L., Green, B., Deng, H., Kaput, J., and Ning, B. (2011). Similarities and differences in the expres-sion of drug-metabolizing enzymes between human hepatic cell lines and primary human hepatocytes. Drug Metab. Dispos. 39, 528–538.

Guo, L., Li, Q., Xia, Q., Dial, S., Chan, P. C., and Fu, P. (2009). Analysis of gene expression changes of drug metabolizing enzymes in the livers of F344 rats following oral treatment with kava extract. Food Chem. Toxicol. 47, 433–442.

Guo, L., Mei, N., Liao, W., Chan, P. C., and Fu, P. P. (2010). Ginkgo biloba extract induces gene expression changes in xenobiotics metabolism and the Myc-centered network. OMICS 14, 75–90.

Guo, L., Zhang, L., Sun, Y., Muskhelishvili, L., Blann, E., Dial, S., Shi, L., Schroth, G., and Dragan, Y. P. (2006). Differences in hepatotoxicity and gene expression profiles by anti-diabetic PPAR gamma agonists on rat primary hepatocytes and human HepG2 cells. Mol. Divers. 10, 349–360.

Hautekeete, M. L., Colle, I., van Vlierberghe, H., and Elewaut, A. (1998). Symptomatic liver injury probably related to sertraline. Gastroenterol. Clin. Biol. 22, 364–365.

Holtzheimer, P. E., III, and Nemeroff, C. B. (2006). Advances in the treatment of depression. NeuroRx 3, 42–56.

Jan, C. R., Su, J. A., Teng, C. C., Sheu, M. L., Lin, P. Y., Chi, M. C., Chang, C. H., Liao, W. C., Kuo, C. C., and Chou, C. T. (2013). Mechanism of mapro-tiline-induced apoptosis: Role of [Ca2+](i), ERK, JNK and caspase-3 signal-ing pathways. Toxicology 304, 1–12.

Juan-Garcia, A., Manyes, L., Ruiz, M. J., and Font, G. (2013). Involvement of enniatins-induced cytotoxicity in human HepG2 cells. Toxicol. Lett. 218, 166–173.

Kaplan, C., and Zhang, Y. (2012). Assessing the comparative-effectiveness of antidepressants commonly prescribed for depression in the US Medicare population. J. Ment. Health Policy Econ. 15, 171–178.

Kim, K. Y., Hwang, W., and Narendran, R. (1999). Acute liver damage pos-sibly related to sertraline and venlafaxine ingestion. Ann. Pharmacother. 33, 381–382.

Kroemer, G., Galluzzi, L., and Brenner, C. (2007). Mitochondrial membrane permeabilization in cell death. Physiol. Rev. 87, 99–163.

Lee, W. M. (2003). Drug-induced hepatotoxicity. N. Engl. J.  Med. 349, 474–485.

Levkovitz, Y., Gil-Ad, I., Zeldich, E., Dayag, M., and Weizman, A. (2005). Differential induction of apoptosis by antidepressants in glioma and neu-roblastoma cell lines: Evidence for p-c-Jun, cytochrome c, and caspase-3 involvement. J. Mol. Neurosci. 27, 29–42.

Li, Y., Couch, L., Higuchi, M., Fang, J. L., and Guo, L. (2012). Mitochondrial dysfunction induced by sertraline, an antidepressant agent. Toxicol. Sci. 127, 582–591.

Mandrioli, R., Mercolini, L., and Raggi, M. A. (2013). Evaluation of the phar-macokinetics, safety and clinical efficacy of sertraline used to treat social anxiety. Expert Opin. Drug Metab. Toxicol. 9, 1495–1505.

Marroquin, L. D., Hynes, J., Dykens, J. A., Jamieson, J. D., and Will, Y. (2007). Circumventing the Crabtree effect: Replacing media glucose with galactose increases susceptibility of HepG2 cells to mitochondrial toxicants. Toxicol. Sci. 97, 539–547.

Marsden, V. S., O’Connor, L., O’Reilly, L. A., Silke, J., Metcalf, D., Ekert, P. G., Huang, D. C., Cecconi, F., Kuida, K., Tomaselli, K. J., et al. (2002). Apoptosis initiated by Bcl-2-regulated caspase activation independently of the cytochrome c/Apaf-1/caspase-9 apoptosome. Nature 419, 634–637.

Nguyen, K. C., Willmore, W. G., and Tayabali, A. F. (2013). Cadmium telluride quantum dots cause oxidative stress leading to extrinsic and intrinsic apop-tosis in hepatocellular carcinoma HepG2 cells. Toxicology 306, 114–123.

Ning, B., Dial, S., Sun, Y., Wang, J., Yang, J., and Guo, L. (2008). Systematic and simultaneous gene profiling of 84 drug-metabolizing genes in primary human hepatocytes. J. Biomol. Screen. 13, 194–201.

Pearson, G., Robinson, F., Beers Gibson, T., Xu, B. E., Karandikar, M., Berman, K., and Cobb, M. H. (2001). Mitogen-activated protein (MAP) kinase path-ways: Regulation and physiological functions. Endocr. Rev. 22, 153–183.

Persky, S., and Reinus, J. F. (2003). Sertraline hepatotoxicity: A case report and review of the literature on selective serotonin reuptake inhibitor hepatotoxic-ity. Dig. Dis. Sci. 48, 939–944.

Raman, M., Chen, W., and Cobb, M. H. (2007). Differential regulation and properties of MAPKs. Oncogene 26, 3100–3112.

Reddy, K. K., Lefkove, B., Chen, L. B., Govindarajan, B., Carracedo, A., Velasco, G., Carrillo, C. O., Bhandarkar, S. S., Owens, M. J., Mechta-Grigoriou, F., et al. (2008). The antidepressant sertraline downregulates Akt and has activity against melanoma cells. Pigment Cell Melanoma Res. 21, 451–456.

Rodriguez, D., Rojas-Rivera, D., and Hetz, C. (2011). Integrating stress signals at the endoplasmic reticulum: The BCL-2 protein family rheostat. Biochim. Biophys. Acta 1813, 564–574.

Saletu, B., Grünberger, J., and Linzmayer, L. (1986). On central effects of sero-tonin re-uptake inhibitors: Quantitative EEG and psychometric studies with sertraline and zimelidine. J. Neural Transm. 67, 241–266.

Seeland, S., Török, M., Kettiger, H., Treiber, A., Hafner, M., and Huwyler, J. (2013). A cell-based, multiparametric sensor approach characterises drug-induced cytotoxicity in human liver HepG2 cells. Toxicol. In Vitro 27, 1109–1120.

Sharpe, J. C., Arnoult, D., and Youle, R. J. (2004). Control of mitochondrial per-meability by Bcl-2 family members. Biochim. Biophys. Acta 1644, 107–113.

Tabak, F., Gunduz, F., Tahan, V., Tabak, O., and Ozaras, R. (2009). Sertraline hepatotoxicity: Report of a case and review of the literature. Dig. Dis. Sci. 54, 1589–1591.

Taylor, R. C., Cullen, S. P., and Martin, S. J. (2008). Apoptosis: Controlled demolition at the cellular level. Nat. Rev. Mol. Cell Biol. 9, 231–241.

Tzadok, S., Beery, E., Israeli, M., Uziel, O., Lahav, M., Fenig, E., Gil-Ad, I., Weizman, A., and Nordenberg, J. (2010). In vitro novel combinations of psy-chotropics and anti-cancer modalities in U87 human glioblastoma cells. Int. J. Oncol. 37, 1043–1051.

Verrico, M. M., Nace, D. A., and Towers, A. L. (2000). Fulminant chemical hepatitis possibly associated with donepezil and sertraline therapy. J. Am. Geriatr. Soc. 48, 1659–1663.

Wajant, H. (2002). The Fas signaling pathway: More than a paradigm. Science 296, 1635–1636.

Wang, C., and Youle, R. J. (2009). The role of mitochondria in apoptosis*. Annu. Rev. Genet. 43, 95–118.

Wisdom, R., Johnson, R. S., and Moore, C. (1999). c-Jun regulates cell cycle progression and apoptosis by distinct mechanisms. EMBO J. 18, 188–197.

414

Sertraline induceS apoptoSiS in Hepatic cellS

Xia, Z., Depierre, J. W., and Nässberger, L. (1996). The tricyclic antidepres-sants clomipramine and citalopram induce apoptosis in cultured human lym-phocytes. J. Pharm. Pharmacol. 48, 115–116.

Xia, Z., DePierre, J. W., and Nässberger, L. (1998). Modulation of apopto-sis induced by tricyclic antidepressants in human peripheral lymphocytes. J. Biochem. Mol. Toxicol. 12, 115–123.

Xia, Z., Dickens, M., Raingeaud, J., Davis, R. J., and Greenberg, M. E. (1995). Opposing effects of ERK and JNK-p38 MAP kinases on apoptosis. Science 270, 1326–1331.

Xu, J. J., Henstock, P. V., Dunn, M. C., Smith, A. R., Chabot, J. R., and de Graaf, D. (2008). Cellular imaging predictions of clinical drug-induced liver injury. Toxicol. Sci. 105, 97–105.

Yao, Z., Zhou, G., Wang, X. S., Brown, A., Diener, K., Gan, H., and Tan, T. H. (1999). A novel human STE20-related protein kinase, HGK, that specifically activates the c-Jun N-terminal kinase signaling pathway. J. Biol. Chem. 274, 2118–2125.

Zhang, Z., Du, X., Zhao, C., Cao, B., Zhao, Y., and Mao, X. (2013). The anti-depressant amitriptyline shows potent therapeutic activity against multiple myeloma. Anticancer Drugs 24, 792–798.

Zhou, F., and Thompson, E. B. (1996). Role of c-jun induction in the gluco-corticoid-evoked apoptotic pathway in human leukemic lymphoblasts. Mol. Endocrinol. 10, 306–316.

Zimmermann, K. C., and Green, D. R. (2001). How cells die: Apoptosis path-ways. J. Allergy Clin. Immunol. 108(4 Suppl.), S99–S103.

415