Top results
plpd: protein localization prediction for imbalanced and overlapped datasets semantic similarity over gene ontology for multi-label protein subcellular localization shibiao…
intelligo semantic similarity measure for gene ontology annotations marie-dominique devignes laboratoire lorrain de recherche en informatique et ses applications loria equipe…
protein structure similarity computation of best matches two “simultaneous” subproblems find maximal correspondence set c find alignment transform t chicken-and-egg issue:…
protein structure similarity secondary structure elements: a helices, b strands/sheets, & loops structure prediction/determination computational tools homology, threading…
slide 1 protein ontology (pro) amherst, ny may 15, 2013 cathy h. wu, ph.d. director, protein information resource (pir) edward g. jefferson chair and director center for…
a framework for ontology-driven similarity measuring using vector learning tricks mengxiang chen, beixiong liu, desheng zeng and wei gao, abstract—ontology learning problem…
abstract—ontology similarity calculation and ontology mapping are important research topics in information retrieval. by learning optimization similarity function, we propose…
slide 1 1 gene ontology and semantic similarity measures slide 2 2 copyright notice many of the images in this power point presentation are from bioinformatics and functional…
powerpoint presentationfunctional networks university of ulster, ukuniversity of ulster, uk goals of this researchgoals of this research to propose a method to incorporate
welcome to pro annotation jamboree the protein ontology (pro) natalia roberts university of delaware [email protected] pathways tools workshop october 28, 2010 1 outline…
journal of king saud university – computer and information sciences 2015 27 1–12 king saud university journal of king saud university – computer and information sciences…
computer science ph. d. seminar gene ontology (go) based search for protein structure similarity clustering metrics ph.d. candidate steve johnson committee members dr. debasis…
author:reformat, m.; golmohammadi, s.k. department of electrical and computer engineering, university of alberta, canada content type:conferences this paper appears in: fuzzy…
plpd: protein localization prediction for imbalanced and overlapped datasets semantic similarity over gene ontology for multi-label protein subcellular localization shibiao…
optimizing similarity computations for ontology matching - experiences from gomma optimizing similarity computations for ontology matching - experiences from gomma michael…
using semantic similarity in ontology alignment valerie cross and xueheng hu computer science and software engineering department, miami university, oxford, oh 45056 [email protected]…
microsoft powerpoint - tutorial3d.pptxcompound profiling using similarity between compound profiling using similarity between
slide 1 crop plant ontologies & protein ontology (pro) amherst, ny may 16, 2013 cathy h. wu, ph.d. pro-po-go meeting 1 2 3 pro communities ontology developers go ontology:…
1.similarity search in large datasets using gene ontology computational informatics heiko müller, david rozado, mat cook, ashfaqur rahman 2. gene01: acggtaggctagactagatattaacg…
similarity-based learning methods for the semantic web claudia d’amato dipartimento di informatica • università degli studi di bari campus universitario via orabona…