research article sudden sensorineural hearing loss and...

Research ArticleSudden Sensorineural Hearing Loss and Polymorphisms in IronHomeostasis Genes New Insights from a Case-Control Study

Alessandro Castiglione1 Andrea Ciorba2 Claudia Aimoni2 Elisa Orioli3 Giulia Zeri3

Marco Vigliano3 and Donato Gemmati3

1Department of Neurosciences-Complex Operative Unit of Otorhinolaryngology and Otosurgery University Hospital of PaduaVia Giustiniani 2 35128 Padua Italy2ENT amp Audiology Department University Hospital of Ferrara Via Aldo Moro 8 44124 Cona Ferrara Italy3Centre for Haemostasis ampThrombosis Haematology Section Department of Medical Sciences University of Ferrara44100 Ferrara Italy

Correspondence should be addressed to Alessandro Castiglione alessandrocastiglioneunipdit

Received 15 September 2014 Revised 15 December 2014 Accepted 6 January 2015

Academic Editor Song Liu

Copyright copy 2015 Alessandro Castiglione et al This is an open access article distributed under the Creative Commons AttributionLicense which permits unrestricted use distribution and reproduction in any medium provided the original work is properlycited

Background Even if various pathophysiological events have been proposed as explanations the putative cause of sudden hearingloss remains unclear Objectives To investigate and to reveal associations (if any) between the main iron-related gene variants andidiopathic sudden sensorineural hearing loss Study Design Case-control study Materials and Methods A total of 200 suddensensorineural hearing loss patients (median age 6365 years range 10ndash92) were compared with 400 healthy control subjects Thefollowing genetic variants were investigated the polymorphism cminus8CG in the promoter of the ferroportin gene (FPN1 SLC40A1)the two isoforms C1 and C2 (pP570S) of the transferrin protein (TF) the amino acidic substitutions pH63D and pC282Y in thehereditary hemochromatosis protein (HFE) and the polymorphism cndash582AG in the promoter of the HEPC gene which encodesthe protein hepcidin (HAMP) Results The homozygous genotype cminus8GG of the SLC40A1 gene revealed an OR for ISSNHL riskof 427 (CI 95 265ndash689 119875 = 0001) being overrepresented among cases Conclusions Our study indicates that the homozygousgenotype FPN1 minus8GG was significantly associated with increased risk of developing sudden hearing loss These findings suggestnew research should be conducted in the field of iron homeostasis in the inner ear

1 Introduction

Sudden sensorineural hearing loss (SSNHL) represents anacute inner ear disorder mostly unilateral that generallyaffects adults worldwide even if higher occurrence rates arereported in developed countries [1 2] It has been estimatedthat SSNHL has an overall incidence rate of 5ndash20100000individuals per year though this is most likely an under-estimate [2 3] Several pathophysiological mechanisms foridiopathic sudden sensorineural hearing loss (ISSNHL) havebeen proposed in the literature local hypoxicischemic events(including coagulopathies hypotension and thromboem-bolism) autoimmune andmetabolic disorders inner ear viralinfections rupture of the inner ear membranes free radicalsinduced-damage neuronal damage and dysregulation of

the local inflammatory response [3ndash5] leading to transientor permanent dysfunction of cochlear microcirculation [6]More than isolated events they could be considered as partof a unique vicious circle determining a sudden clinicalmanifestationwhen local recovery or residual functions reacha subjective threshold or trigger point

To contribute to the comprehension of the homeostaticevents the present study focused on divalent metallic ionsand in particular on iron metabolism [7] There is a growinginterest in the association between iron metabolism andoxidative stress as it has been reported iron excess is apotential cause of increased oxidative stress and thereforeinvolved in cellular injury and death Iron is an essentialnutrient but its divalent form (Fe2+) as well as other divalentmetal ions also has the capacity to enhance redox cycling and

Hindawi Publishing CorporationBioMed Research InternationalVolume 2015 Article ID 834736 10 pageshttpdxdoiorg1011552015834736

2 BioMed Research International

free radical formation [8 9] Iron-mediated oxidative stressis hypothesized to be involved in the pathogenesis of severaldegenerative disorders including thrombosis venous ulcerschronic venous disease and central nervous system disorderssuch as multiple sclerosis or neoplasms [10ndash13] In additiona novel iron-driven etiopathogeneticmechanism responsiblefor increase in free radical generation has been formulated indegenerative skin lesions appearance comprehending coex-istence of local iron overload and iron homeostasis gene-variants [14] Accordingly similar conditions could be poten-tially associated with sudden hearing loss [15] Thereforedivalent ions homeostasis could be a central pathway involvedin the pathophysiology of sudden hearing loss [16 17] Infact the one of the known models of hearing loss in Pendredsyndrome is ironfree radical stress-mediated [18] The maingenes and their variants we selected and investigated withpossible effects on tissue injury [10 19] are described below

TheHFE gene (6p213ndash222) encodes amembrane proteinof 348 amino acids that belongs to the MHC class I familyThe protein is normally expressed in cryptal enterocytes ofthe duodenum liver placenta kidney plasma and plateletsComplexingwith beta 2microglobulin and transferrin recep-tor (TFR2) it plays a crucial role in iron homeostasisand when mutated it is believed to be responsible forhemochromatosis variegate porphyria and microvascularcomplications of diabetes Variants andor mutated proteinsbind to the transferrin receptor and reduce its affinity foriron-loaded transferrin Thus they finally unbalance theiron intake Recent increasing interest in neurodegenerativedisorders mediated by iron overload has highlighted theHFEgene among candidates for further investigations into ironhomeostasis involvement in similar conditions A review ofthe literature suggests a potential role even in iron-mediatedhearing loss also in the past [20 21] Finally it is importantto note that the HFE gene is also expressed in the brainspinal cord cortex and cerebellum [22 23] Thus it couldbe directly involved or responsible for specific conditionsconcerning the central nervous system

The FPN1 (SLC40A1) gene is located on chromosome 2(2q32) and it encodes a protein (ferroportin) of 570 aminoacids with the specific function of exporting iron out fromcells in the basolateral space except for the reticuloen-dothelial cells which can spread iron ions into the bloodcirculation Consequently FPN1 plays a crucial role in ironhomeostasis [24] and generally it has the opposite functionof the DMT1 protein product [25] which allows intracellularpassage of divalent iron (Fe2+) Ferroportin is expressed indifferent tissues though to the best of our knowledge there areno previous reported studies that document its localizationinto the cochlea Similar to other iron genes it undergoes ironregulation at the transcriptional and translational level [26ndash28]

Another important gene related to ferroportin expressionand function is the HEPC (19q131) gene encoding theprotein hepcidin (HAMP) This protein is a 25-amino-acidpeptide derived from the cleavage of an 84-amino-acid longpropeptide that is mainly synthesized by hepatocytes and isa major regulator of iron balance activity via binding to theFPN1 protein on the cell membrane suppressing it [29 30]

HEPC expression and its role in iron homeostasis may play acrucial role in different conditions [31]

The TF gene (3q221) encodes for the protein transferrinwhich forms a stable complex with the HFE protein whichfacilitates iron transfer via the transferrin receptor Thefunction of this protein is to transport iron from the intestinereticuloendothelial system and liver parenchymal cells to allproliferating cells in the body The effect of HFE on ironabsorption depends on its relationship with the transferrinreceptor HFE variants affect TF binding determining a lossof HFE-repressor function for TF uptake thereby increasingiron transport within the cells

As there are no previous reports in the literature about therole of iron metabolism regulatory genes in the pathophysi-ology of SSNHL we proceeded to evaluate if specific singlenucleotide polymorphisms within the main iron genes arepotentially involved in the susceptibility to SSNHL

2 Materials and Methods

21 Study Design Patient and Control Enrolment The re-search was designed as a case-control study A total of 200patients (104 females and 96 males) affected by idiopathicsudden sensorineural hearing loss (ISSNHL) and referredto the ENT and Audiology Department of the UniversityHospital of Ferrara from 2009 to 2013 were enrolled forthis study According to the current literature ISSNHL wasdefined as a sudden hearing loss (ge30 dB HL) within 3consecutive frequencies developing over 72 hours [32]

All patients underwent a complete clinical interview witha complete audiological evaluation includingmicrootoscopytonal and speech audiometry impedancemetry auditorybrainstem responses (ABRs) and MRI with gadolinium torule out retrocochlear pathology

The patients were enrolled in the study after diagnosis ofISSNHLmade by experienced audiologists Exclusion criteriawere specific causes of sudden hearing impairment such asmeningitis traumas or surgery outcomes and complications

For each patient a Pure Tone Average hearing threshold(PTA dBHL) was estimated from the hearing levels at 05 12 and 4 kHz The average degree of hearing loss was thenclassified into the following groups according to a modifiedmethod fromClark [33] normal hearing (10ndash15 dBHL) mildhearing loss (16ndash40 dB HL) moderate hearing loss (41ndash70 dBHL) severe hearing loss (71ndash90 dBHL) and profound hearingloss (gt90 dBHL)The type of hearing loss was then evaluatedaccording to the Tran Ba Huy classification [34] and therebystratified into five types A B C D and E

The control group consisted of 400 healthy volunteerswith no personal or familial history of previous SSNHL andtheywere completelymatchedwith the case group by sex ageand ethnicity

22 Audiological Equipment Pure tone threshold audiome-try was performed within a sound-proof cabin (model E2X2roll 01008 220V 10AMercuryMilan Italy) using anAmplaidaudiometer (Amplaid Milan Italy) calibrated to ISO 9001standards The audiometric procedure was performed usingheadphones to assess air conduction and a bone vibrator

BioMed Research International 3

for bone conduction The better ear was evaluated first Anascending method using 5 dB HL steps was utilized to cal-culate hearing threshold Air conduction hearing thresholdswere assessed at 125 250 500 1000 2000 4000 and 8000HzBone conduction hearing thresholds were assessed with theuse of a masking white and contralateral noise at 250 5001000 2000 and 4000Hz

23 Genetic Investigations All enrolled patients (119899 = 200)underwent DNA analysis for the identification of specificgenetic variants in 4 iron-related genes FPN1 (SLC40A1)(ferroportin)TF (transferrin)HFE (humanhemochromato-sis gene) and HEPCHAMP (hepcidin) All these genes areknown to play a crucial role in iron homeostasis with increas-ing evidence of involvement in inner ear pathophysiology

The following polymorphisms were examined

(i) FPN1 51015840UTR cminus8CG(ii) TF C1 and C2 variants (pP570S)(iii) HFE pH63D and pC282Y(iv) HEPC 51015840UTR cminus582AG

DNA was isolated from peripheral frozen whole bloodby an automated DNA extraction and purification robot(BioRobot EZ1 system from QIAGEN Hilden Germany)which performs purification of nucleic acids using amagneticbead technology

PCR amplifications were performed by means of thelyophilic complete UNIVERSAL MASTER MIX kit (STAT-NAT DNA-Mix SENTINEL Diagnostics Milan Italy) con-taining all the reagents useful to amplify the extracted DNAwith the exclusion of the specific pair of primers The PCRcycle for the different SNP containing fragments was asfollows HFE FPN1 HEPC and TF (one cycle of denaturingat 95∘C5min followed by 33 cycles of 94∘30 sec 57∘30 sec72∘60 sec) PCRs were performed in a PTC-200 thermalcycler (M J Research Inc Watertown MA USA) SNPdetection was performed using the Pyromark ID System(Biotage AB Uppsala Sweden) according to the standardprocedures for amplicon denaturation purification andsequencing following the manufacturerrsquos recommendationsAll the oligo sequences of the SNPs investigated (ForwardReverse and Sequence primers) were selected to have an atleast 980 compatibility score

Haplotypes were confirmed by regenotyping of approx-imately 20 of randomly selected samples among eachdifferent genotype group for each specific polymorphismby means of enzymatic restriction of PCR amplicons Allthe digestion reactions were performed according to thesupplierrsquos instructions There were no discrepancies betweengenotypes determined in duplicate andor by different meth-ods Known genotypes were used as control referencesAdditional nonreported technical details are as previouslydescribed [10]

Written informed consent was obtained from all par-ticipants according to current national rules and laws forpublication All further research was conducted in accor-dance with the ethical standards of all applicable national

Table 1 Main characteristics of the population investigated

Cases Controls 119875 valueNumber 200 400 mdashAge mean plusmn SDmedian range 6365 (10ndash92) 635 (10ndash92) NS

Malefemale 96104 190210 NSLeft side 95 mdash mdashRight side 103 mdash mdashBilateral 2 mdash mdashMild hearing loss 44 mdash mdashModerate 92 mdash mdashSevere 33 mdash mdashProfound 31 mdash mdash

and institutional committees and with the World MedicalAssociationrsquos Helsinki Declaration

24 Statistical Analysis Significant differences among groupswere assessed by chi-square test for genotype distributioncomparisons When appropriate Yatesrsquo correction or Fisherrsquosexact test was applied Adjusted odds ratios (OR) and95 confidence intervals (95 CI) calculated by logisticregression models were used to estimate the risk associatedwith the presence of the rare homozygous condition (egFPN1 minus8GG Tf C2C2 HFE 63DD and HEPC-582GG) orwith the heterozygotes (ie HFE 282CY) compared with theremaining genotypes (ie heterozygous andor homozygousfor the common allele) in cases versus the controls accordingto a recessive model of phenotype expression

3 Results

31 Single Analyses A total of 200 patients affected byISSNHL and referred to the ENT and Audiology Departmentof the University Hospital of Ferrara between January 2009and December 2013 were included in this study Of these104 (52) were females and 96 (48) were males quietly all(119899 = 198 99)were unilateral cases (103 515 right side and95 475 left side) and 2 (1) cases were bilateral themedianage was 6365 years (age range 10ndash92 years) (Table 1)

The DNA of the 200 patients was sampled and analyzedto identify the polymorphism minus8CG of the FPN1 genepromoter region A total of 123 (615) patients were minus8CChomozygotes 62 (31)were heterozygotes and 15 (75)wereminus8GG homozygotes

The same 200 patientswere searched for the variantH63Dof the HFE gene 56 (28) were heterozygous 2 (1) caseswere 63DD homozygotes and the remaining 142 (71) were63HH homozygotes

Concerning the polymorphism analysis for the C282YHFE gene we identified 7 (35) cases as 282CY heterozy-gotes and no 282YY homozygous were found Furthermore12 (6) cases presented the polymorphism minus582AG in theHEPC gene in homozygosis (GG) and 77 (385) in heterozy-gosis (AG) whereas the remaining 111 (555) cases did notpresent the genetic variant


Table 2 Gene variants distribution and associated ORs values The ORs have been calculated comparing the number of the polymorphichomozygotes with the rest of genotypes among cases versus the controls

Gene variant FPN1 (SLC40A1) Tf HFE HFE HEPC (HAMP)minus8CG C1 C2 H63D C282Y minus582AG

Cases 200 200 200 200 200Controls 400 400 400 400 400Genotypes CC CG GG C1C1 C1C2 C2C2 HH HD DD CC CY AA AG GGCases 123 62 15 139 53 8 142 56 2 193 7 111 77 12 615 31 75 695 265 4 71 28 1 965 35 555 385 6Controls 268 125 7 270 119 11 294 98 8 383 17 229 147 24 67 3125 175 675 2975 275 735 245 2 9575 425 5725 3675 6119875 value 0001 063 055 080 092OR (95 CI) 427 (265ndash689) 139 (071ndash273) 052 (013ndash208) 082 (033ndash20) 103 (060ndash176)Alleles C G C1 C2 H D C Y A GCases number 30877 9223 3318275 691725 34085 6015 3939825 7175 2997475 1012525Controlsnumber 661826 139174 659824 141176 686857 114143 783979 1721 605756 195244

119875 value 002 094 079 083 079OR (95 CI) 142 (106ndash191) 097 (071ndash134) 106 (076ndash149) 082 (034ndash199) 105 (08ndash138)

Table 3 Hearing loss severity score stratified by different genotypes among the different gene variants 44 (mild) 92 (moderate) 33 (severe)and 31 (profound) HL severity score is graded in the following mild hearing loss (16ndash40 dBHL) moderate hearing loss (41ndash70 dBHL) severehearing loss (71ndash90 dBHL) and profound hearing loss (gt90)


Cases 200 200 200 200 200Genotypes CC CG GG C1C1 C1C2 C2C2 HH HD DD CC CY AA AG GGTotal (119899) 123 62 15 139 53 8 142 56 2 193 7 111 77 12

HL severity score (PTA dB HL)16ndash40 dBHL 27 12 5 27 16 1 31 13 0 42 2 34 6 441ndash70 dBHL 60 26 6 66 24 2 62 28 2 88 4 51 35 671ndash90 dBHL 18 12 3 21 8 4 25 8 0 32 1 12 19 2gt90 dBHL 18 12 1 25 5 1 24 7 0 31 0 14 17 0

Finally the presence of the two variants C1 and C2 of thetransferrin protein yielded 8 (4) patients C2C2 homozy-gotes 53 (265) C1C2 heterozygotes and 139 (695) C1C1homozygotes for the isoforms (Table 2)

The homozygous genotype cminus8GG of the SLC40A1 generevealed an OR for ISSNHL risk of 427 (CI 95 265ndash689 119875 = 0001) being significantly overrepresented amongcases No significantORswere observed under the additive ordominantrecessivemodels for the analysis in the other genesinvestigated

32 Combined Analyses In attempt to calculate a cumulativeHL risk associated with the coexistence of multiple predis-posing genotypes we compared the whole group of casesand controls carrying a combination of different polymorphicalleles In detail subjects carrying at least four ldquorisk-allelesrdquoin at least two different SNPs (multicarriers) were computedand compared with subjects who were homozygous for thecommon allele in all the considered gene variants (fully

wild-types) Combined homozygotes at least in two differentSNPs single homozygotes in one and combined carriers inat least two or carrying at least a quadruple heterozygouscondition they globally were 70 in patients (119899 = 14)and 475 in controls (119899 = 19) Conversely the fully wild-type condition was 185 in cases (119899 = 37) and 190 incontrols (119899 = 76) Although the slight trend observed inthe overrepresentation of the rare at risk combined alleles nosignificant risk-values were obtained from this kind of com-parison (OR = 151 CI 95 068ndash335) Finally stratifying thegroups of patients by their hearing loss score no significantcorrelation was observed between a particular allele and theclinical severity (Table 3)

4 Discussion

Sudden hearing loss has been reported to be associated witha huge number of clinical conditions [35ndash38] The uncer-tainty of reasonable etiologies has encouraged continuous


Mus musculusRattus norvegicusSus scrofaBos taurusCapra hircusHomo sapiens

Start (Met)

AGGGGAGAGCGTCTGGTGCCATGACCAAGTCAAGAGATCAGACCCATCAG 321AGTGGGGGTCGCCTTGTGTCATGACCAGGGCAAGAGAGCAAAACCGCCAG 349AGCGGGGGGCGTCTGGTGTCATGACCAGGACAAGAGAGCAGAGCCGTCAG 191

AGCGGGGGGCGTCTGGTGTCATGACCAGGACAAGAGAGCAGAGCCGTCAG 246AGCGGGG-TCGCCTAGTGTCATGACCAGGGCGGGAGATCACAACCGCCAG 334

FPN1 (SLC40A1)AGGGGAGAACGCCTGGTGTCATGACCAAGGCAAGAGATCAAACCCATCAG 327

minus8CG

Figure 1 The panel shows how much the promoter region of SLC40A1 gene containing the polymorphic nucleotide is conserved amongdifferent kinds of mammals ClustalW2 httpwwwebiacuk

investigations aimed at identifying the most convincingpathological explanation Moreover it has encouraged newconsiderations of the predisposing genetic conditions thatmight explain the clinical variability when a positive correla-tion with factorial events occurs Far from the identificationof an unequivocal mutated gene the study of genetic variantsappears to better meet researcher expectations even whensuch variants actually cannot be paired with the unilateralmanifestation of ISSHL In addition previous studies havereported the correlation of various polymorphisms with anincreased [39ndash43] or reduced [44] risk of developing hearingimpairment Thus currently the definition of new pathwaysof molecular interactions is essential in supporting geneticobservations (Figures 1ndash3)

Recent advanced findings in regards to ROS-mediateddamage and nitric oxide (NO) activity have encouragedresearchers to focus their studies on possible connectionsbetween microvascular damage and free radical produc-tion The study of polymorphisms of genes related to ironmetabolism in relation to SSNHL has not been previouslyreported we hypothesized that these variants could also beinvolved in the pathogenesis of SSNHL [45] Nonethelessthe role of ferroportin in managing the delicate iron redoxbalance at the level of the cochlea or the auditory nerveis still unclear [46] However it is possible to assume thatunder stressful conditions cells need to rapidly reduce theintracellular free divalent iron pool and this can produceoxidative damage Moreover increased levels of Fe2+ inhibitthe intracellular production of NO a fundamental elementin the regulation of local microcirculation Nitric oxide has adecisive role in the regulation of cochlear flowWe can dividethe inner ear into four large anatomofunctional districts(1) homeostasis of labyrinthine fluid (2) stria vascularis (3)organ of Corti and (4) neurons and spiral ganglion Mito-chondria could be considered as the center of connectionof these parts or as a fifth district [47ndash49] Thus unilateralsudden hearing loss might be considered the consequence ofrecurrent aggression of important inner ear structures thatin the end leads to local damage with trigger points thatare linked to general clinical conditions comorbidity andfunctioning local anatomyThese elements might explain theage of onset and unilateral expression of the disease

The auditory system might be optimized to minimizethe persistence and the concentration of divalent metalions in the inner ear fluids [50] This homeostatic systemis finely tuned to prevent ultimately damage to the sen-sorineural cells without compromising the function of vital

Start of Start of

IRE

Promoter region

IRP

minus98GC minus8CG

minus235 minus196

5998400 3998400

transcription translation

Figure 2 Schematic representation of the hairpin of the iron reg-ulatory element (IRE) interacting with the iron regulatory protein(IRP) in the FPN1 promoter region It is to note the closeness of theminus98GC SNP to the ldquobeginningrdquo of the IRE sequence

processes dependent on the presence of iron especially atthe mitochondrial level (Figure 3) Studying the location ofother proteins involved in the metabolism of iron (ferritintransferrin andDMT1) we determined a precise localizationof the ferroportin in the associated pathway and speculatedon possible effects of the polymorphism FPN1 minus8CG inthe promoter area (Figure 2) This polymorphism belongsto a group of iron gene variants previously investigatedby our group in other complex diseases in which iron-driven inflammation or anomalous redox balance may havea role or be suspected (10 13 14 19) On the basis of theassumption that they are not the only ones responsible for thedisease they could instead act together with something notcompletely known (often acquired but not exclusively) andaccount for the establishment of the pathological conditionIn detail the five variants are relatively common in theracial group investigated and are selected just to sound ourtheory not considering this fact as definitive and completelyexhaustive Finally having performed in this study a case-control comparison in which the two groups completely


Perilymph

Perilymph

Blood vessel

TransferrinFe3+

TransferrinFe3+

TransferrinFe3+

TransferrinFe3+ TransferrinFe3+

basolateral

Ferritin

Ferritin

Ferritin

junctions

junctions

Stria vascularis

apical

cytoplasmatic

Spiral ganglion

Endolymph

Endolymph

290mOsm

310mOsm

darrdarrdarr Fe2+darrdarr Fe2+

CSFgap junctions

DMT1

TfRDMT1

TfRDMT1cytoplasmatic

Perilymph uarruarruarr Na+

darrdarr Fe2+ darrdarrdarr K+

FPN1gap FPN1

FPN1gap

FPN1 150mM K+ +80mV

Figure 3 Divalentmetal ion homeostasis in the inner earThe picture shows a schematic representation of a section of the inner ear reviewingthe literature allowed the speculation around the potential involvement of specific proteins in the iron homeostasis Considering distributionand function of those proteins it may be possible that iron ions follow a cycle similar to the potassium cycle also through gap junctions Inparticular transferrin is concentrated in perilymph and cerebrospinal fluid and it transports trivalent (ferric) ions from and to blood vesselsIn addition iron ions are stocked in the stria vascularis (ferritin depots) In fact the apical expression of DMT1 is reasonably involved inreabsorption of free divalent ions from inner ear fluids thus maintaining electrochemical features Cytoplasmic DMT1 allows the uptake ofmolecules of transferrin through Tf receptors Ferroportin (FPN 1) is basolaterally located and probably helps inner ear cells in the reuptakeof divalent ions taking them away from the sensorineural epithelium during acoustic stimulation to avoid free radical damage Ions aretaken off through the basolateral part of cells and ldquopushedrdquo towards spiral ganglion and stria vascularis It is possible that divalent ions passthrough gap junctions (metal divalent ion diameter could be less than 1 nanometer thus molecules can passively diffuse through connexonsin the intercellular space) Summarizing divalent ions are transported from area with few blood vessels and low ferritin concentrations tothe structures that can storage or evacuate divalent ions such as stria vascularis Outer and inner ear cells may introduce a small amount ofdivalent ions through calcium channels

matched for sex age and ethnicity we can exclude that theoverrepresentation of the allele FPN1-8G observed amongcases could be due to a particular ethnicity who selects aparticular gene variant or to other influencing factors

Accordingly NO free radicals (ROS) and NF120581B mightpotentially be involved during inner ear fluid homeostasisThe interaction of these elements ultimately involves otherproteins with the precise purpose of regulating the localinflammatory response blood flow and cellular activity(including mitochondrial activity) [51ndash54] For example thestria vascularis in its basal layer and the intermediate layerreactsmainly toward a response to inflammationmediated byNF120581B [55ndash57] In another district or below a certain degree oflocal aggression an antioxidant responsemediated byNFRE-2 is favored especially at the level of the organ of Corti

The expression of ferritin [58] and the concomitant apicalexpression of DMT1 [59] suggest that the stria vascularishas an active role in restoration and deposition of iron

with particular attention to reducing the endolymphaticconcentration of divalent ions [60 61] Accordingly it isknown that free radical stress-mediated loss of specificprotein expression (ieKcnj10) in stria vascularis contributesto hearing loss in Pendred syndrome mouse model [18]Pendred syndrome the most frequent hereditary form ofsyndromic deafness is caused by loss-of-function mutationsof the gene SLC26A4 which encodes the anion exchangerpendrin [62] Transientconstitutive reduction of Kcnj10protein expression under free radical stress could be thepathobiologic mechanism of sudden hearing loss that couldbe not limited just to Pendred syndrome SLC26A4 andSLC40A1 genes belong to the same (super)family and mightbe involved by regulating inflowoutflow of different ions tomaintain specific homeostasis and redox potency [63] Striavascularis is sensitive to free radical stress due to its highmetabolic activity and dense vascular system [64] and wheniron-chelator proteins are not adequately functioning or are


not enough to contrast and neutralize the detrimental effectof iron this situation could dramatically affect the optimalstria vascularis functions

We could also hypothesizespeculate amechanismof sup-plementation of divalent ions into the endolymphatic spaceaffecting the volume and the acidification of the endolymphboth affected in the Pendred syndrome Nevertheless thisrole is most likely less important than the reuptake becauseof the endolymphatic electrical gradient

Iron is predominantly bound to transferrin that is presentin increasing respective concentrations in perilymph cere-brospinal fluid and blood [65ndash67] This could explain theintracytoplasmic expression and localization of DMT1 in theorgan of Corti Conversely DMT1 is absent at the level ofthe ciliated cells and highly expressed at the level of neuronalfibers and in particular of the basal ganglion Summarizingchanges in the redox capacity of a system affect indeedthe pH with drastic biological effects These data suggest asimilar involvement of ferroportin as indicated above andare in agreement with kidney analogous distribution [68]Furthermore the receptors for transferrin might mediate theinternalization of vesicles in ciliated cells by TfR [69] Thesereceptors must be absent in the ciliated cells and the ironmay enter in a minimum amount finely controlled mostlikely through the basolaterally expressed calciumchannels inciliated cells L-type calcium channels localized basolaterallyin hair cells that could allow the intake of a few moleculesof Fe2+ [70ndash76] An intercellular passage at the level of theinner ear through the gap junctions cannot be excluded Infact the diameter of the channels formed by the connectionwould allow the passage of molecules such as divalent metalions as these especially in the case of the iron are less than2 nm in diameter and very close in size to calcium ions thathabitually take advantage of the gap junction for cytoplasmicpassage from cell to cell [77] The gradient that the free ironcould exploit is that of bidirectional facilitated diffusion ironmight be able to ldquospreading outrdquo in case of accumulation andldquocoming backrdquo in case of consumption if necessary Accordingto this circle this type of iron distribution calls to mindin some aspects the recirculation of the potassium ions butmost likely with opposite directionThe longitudinal gradientthat is already physiologically present along the cochlea (theconcentration of endolymphatic potassium increases fromthe apex to the base) might play a role in the flow of divalentions [78] especially in pathological conditions

Summarizing FPN1minus8CGgene polymorphismdisplayeda significant association with ISSNHL as patients carryingthis polymorphism displayed an increased risk of develop-ing this disease in adulthood The distribution of proteinsinvolved in the recirculation of divalent metal ions leads usalso to believe that ferroportin is coupled to the expression ofDMT1 The distribution of DMT1 is superficial at the level ofthe stria vascularis where we find the largest concentration offerritin [58 79] The task of reabsorption of divalent metalsincluding iron with the possibility of storage is most likelyperformed by the stria vascularis [80] On the contrarythe nerve fibers spiral ganglia of the organ of Corti (withthe exception of ciliated cells internal and external) displaycytoplasmic localization ofDMT1 [81]This suggests a system

of mobilization of iron or of other divalent metals mediatedby transferrin which in fact is more represented in theperilymph and in the cerebrospinal fluid which is in contactwith the organ of Corti and nerve bundles

Conversely the outer and inner hair cells do not appearto express DMT1 This does not necessarily exclude theexpression of FPN1 at this level Nevertheless it suggests howneurosensory cells might be excluded as much as possiblefrom redox activities inflammatory responses and ionicmovements most likely because of their specific nature

Ferroportin is the main mammalian iron exporter andby means of the homozygous gene variant condition (minus8GG)could affect the local iron levels poisoning microenviron-ment In this context it is reasonable to assume that thepolymorphism by affecting the expression of ferroportincould modify the iron homeostasis at the local level Thoughthe nucleotide substitution is not strictly close to the IRE (ironregulatory element) region of the gene it is in strong dise-quilibrium with the minus98GC variant (Figure 2) that is insteadmore close [82] Then by virtue of the documented highconservation of this promoter gene area among mammals(Figure 1) it could be possible that one or both of thesevariants dysregulated optimal FPN1 function by affecting theIRE-IRP signaling pathway In addition it is to take intoaccount that macrophages carry on their surface the FPN1receptor and that they contribute to the degeneration of thestria vascularis in Pendred syndrome [83] Accordingly analtered macrophage action could further worsen the criticalhomeostasis in terms of iron overload and related oxidative-stress as previously suggested in different degenerative dis-eases considering that the ldquomutatedrdquo macrophages mightincrease the possibility of generating free iron and freeradicals possibly leading to matrix breakdown and cell death[14 84] (Figure 3)

In conclusion further larger epidemiological studies arerequired to elucidate the pathophysiological mechanismsSuch a complex disease is to consider a multifactorial andpolygenic condition in which gene-environment interactionshave a key role In particular on the basis of the iron-driven hypothesis and that of the oxidative stress additionalcorrelated gene variants could be considered as well asthose involved in the homocysteine metalloprotease orhemopexin pathways possibly playing a role in this complexbiochemical mechanism

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

References

[1] T Nakashima A Itoh H Misawa and Y Ohno ldquoClinicoepi-demiologic features of suddendeafness diagnosed and treated atuniversity hospitals in Japanrdquo OtolaryngologymdashHead and NeckSurgery vol 123 no 5 pp 593ndash597 2000

[2] V B Olzowy D Osterkorn and M Suckfull ldquoThe incidence ofsudden hearing loss is greater than previously assumedrdquoMMW-Fortschritte der Medizin vol 147 no 14 pp 37ndash38 2005


[3] C Aimoni C Bianchini M Borin et al ldquoDiabetes cardiovas-cular risk factors and idiopathic sudden sensorineural hearingloss a case-control studyrdquo Audiology amp Neurotology vol 15 no2 pp 111ndash115 2010

[4] J T Zajtchuk W H Falor Jr and M F Rhodes ldquoHyperco-agulability as a cause of sudden neurosensory hearing lossrdquoOtolaryngologymdashHead and Neck Surgery vol 87 no 2 pp 268ndash273 1979

[5] Z Yildiz A Ulu A Incesulu Y Ozkaptan and N Akar ldquoTheimportance of thrombotic risk factors in the development ofidiopathic sudden hearing lossrdquo Clinical and Applied Thrombo-sisHemostasis vol 14 no 3 pp 356ndash359 2008

[6] T H Yoon M M Paparella P A Schachern and M AllevaldquoHistopathology of sudden hearing lossrdquo Laryngoscope vol 100no 7 pp 707ndash715 1990

[7] M D Garrick ldquoHuman iron transportersrdquoGenes andNutritionvol 6 no 1 pp 45ndash54 2011

[8] G Zheng J Chen and W Zheng ldquoRelative contribution ofCTR1 and DMT1 in copper transport by the blood-CSF barrierimplication in manganese-induced neurotoxicityrdquo Toxicologyand Applied Pharmacology vol 260 no 3 pp 285ndash293 2012

[9] X Liu G Zheng YWu et al ldquoLead exposure results in hearingloss and disruption of the cochlear blood-labyrinth barrier andthe protective role of iron supplementrdquoNeuroToxicology vol 39pp 173ndash181 2013

[10] D Gemmati G Zeri E Orioli et al ldquoPolymorphisms in thegenes coding for iron binding and transporting proteins areassociated with disability severity and early progression inmultiple sclerosisrdquo BMC Medical Genetics vol 13 article 702012

[11] B B Williams G F Kwakye M Wegrzynowicz et al ldquoAlteredmanganese homeostasis and manganese toxicity in a hunting-tonrsquos disease striatal cell model are not explained by defects inthe iron transport systemrdquo Toxicological Sciences vol 117 no 1pp 169ndash179 2010

[12] E Mills X-P Dong F Wang and H Xu ldquoMechanisms ofbrain iron transport insight into neurodegeneration and CNSdisordersrdquo Future Medicinal Chemistry vol 2 no 1 pp 51ndash642010

[13] D Gemmati F Federici L Catozzi et al ldquoDNA-array of genevariants in venous leg ulcers detection of prognostic indica-torsrdquo Journal of Vascular Surgery vol 50 no 6 pp 1444ndash14512009

[14] P Zamboni M Izzo S Tognazzo et al ldquoThe overlapping oflocal iron overload and HFE mutation in venous leg ulcerpathogenesisrdquo Free Radical Biology and Medicine vol 40 no10 pp 1869ndash1873 2006

[15] T Yamasoba K Sakai and M Sakurai ldquoRole of acute cochlearneuritis in sudden hearing loss in multiple sclerosisrdquo Journal ofthe Neurological Sciences vol 146 no 2 pp 179ndash181 1997

[16] D A Wink H B Hines R Y Cheng et al ldquoNitric oxideand redox mechanisms in the immune responserdquo Journal ofLeukocyte Biology vol 89 no 6 pp 873ndash891 2011

[17] P Brissot M Ropert C le Lan and O Loreal ldquoNon-transferrinbound iron a key role in iron overload and iron toxicityrdquoBiochimica et Biophysica Acta vol 1820 no 3 pp 403ndash410 2012

[18] R Singh and P Wangemann ldquoFree radical stress-mediated lossof Kcnj10 protein expression in stria vascularis contributes todeafness in Pendred syndrome mouse modelrdquo The AmericanJournal of PhysiologymdashRenal Physiology vol 294 no 1 ppF139ndashF148 2008

[19] A V Singh L Subhashree P Milani D Gemmati and P Zam-boni ldquoInterplay of ironmetallobiology metalloproteinases andFXIII and role of their gene variants in venous leg ulcerrdquoInternational Journal of Lower Extremity Wounds vol 9 no 4pp 166ndash179 2010

[20] A-H Sun Z-M Wang S-Z Xiao et al ldquoIdiopathic suddenhearing loss and disturbance of iron metabolism A clincialsurvey of 426 casesrdquo Journal for Oto-Rhino-Laryngology and ItsRelated Specialties vol 54 no 2 pp 66ndash70 1992

[21] A-H Sun Z-M Wangb S-Z Xiao Z-J Li Z Zheng andJ-Y Li ldquoSudden sensorineural hearing loss induced by exper-imental iron deficiency in ratsrdquo ORL Journal for Oto-Rhino-Laryngology Head and Neck Surgery vol 54 no 5 pp 246ndash2501992

[22] M M Hanninen J Haapasalo H Haapasalo et al ldquoExpressionof iron-related genes in human brain and brain tumorsrdquo BMCNeuroscience vol 10 article 36 2009

[23] D Johnstone R M Graham D Trinder et al ldquoBrain transcrip-tome perturbations in the119867119891119890minusminus mouse model of genetic ironloadingrdquo Brain Research vol 1448 pp 144ndash152 2012

[24] J Mao D M McKean S Warrier J G Corbin L Niswanderand I E Zohn ldquoThe iron exporter ferroportin 1 is essential fordevelopment of the mouse embryo forebrain patterning andneural tube closurerdquo Development vol 137 no 18 pp 3079ndash3088 2010

[25] S P Bai L Lu X G Luo and B Liu ldquoCloning sequencingcharacterization and expressions of divalent metal transporterone in the small intestine of broilersrdquo Poultry Science vol 87 no4 pp 768ndash776 2008

[26] D M Ward and J Kaplan ldquoFerroportin-mediated iron trans-port expression and regulationrdquo Biochimica et Biophysica Actavol 1823 no 9 pp 1426ndash1433 2012

[27] S Gardenghi M F Marongiu P Ramos et al ldquoIneffectiveerythropoiesis in 120573-thalassemia is characterized by increasediron absorption mediated by down-regulation of hepcidin andup-regulation of ferroportinrdquo Blood vol 109 no 11 pp 5027ndash5035 2007

[28] M B Troadec DMWard E Lo J Kaplan and I deDomenicoldquoInduction of FPN1 transcription by MTF-1 reveals a role forferroportin in transitionmetal effluxrdquo Blood vol 116 no 22 pp4657ndash4664 2010

[29] D-L Zhang T Senecal M C Ghosh H Ollivierre-WilsonT Tu and T A Rouault ldquoHepcidin regulates ferroportinexpression and intracellular iron homeostasis of erythroblastsrdquoBlood vol 118 no 10 pp 2868ndash2877 2011

[30] T Ganz ldquoMolecular control of iron transportrdquo Journal of theAmerican Society of Nephrology vol 18 no 2 pp 394ndash400 2007

[31] H Ding C-Z Yan H Shi et al ldquoHepcidin is involved in ironregulation in the ischemic brainrdquoPLoSONE vol 6 no 9 ArticleID e25324 2011

[32] T J Haberkamp H M Tanyeri S D Rauch R Probst andD E Mattox ldquoManagement of idiopathic sudden sensorineuralhearing lossrdquo American Journal of Otology vol 20 no 5 pp587ndash595 1999

[33] J G Clark ldquoUses and abuses of hearing loss classificationrdquoASHA vol 23 no 7 pp 493ndash500 1981

[34] P Tran BaHuy and E Sauvaget ldquoIdiopathic sudden sensorineu-ral hearing loss is not at this time an otologic emergencyrdquoAnnales drsquoOto-Laryngologie et de Chirurgie Cervico-Faciale vol124 no 2 pp 66ndash71 2007


[35] Y-H Young and P-J Lou ldquoPost-irradiation sudden deafnessrdquoJournal of Laryngology and Otology vol 113 no 9 pp 815ndash8171999

[36] O Yossepowitch A Lossos and I S Lossos ldquoSudden hearingloss following acute hepatitisrdquo Postgraduate Medical Journalvol 75 no 883 pp 309ndash312 1999

[37] Y Yoshimoto ldquoClinico-statistical study on acoustic tumors withsudden hearing lossrdquoAuris Nasus Larynx vol 15 no 3 pp 165ndash171 1988

[38] T Yin F Huang J Ren et al ldquoBilateral sudden hearingloss following habitual abortion a case report and review ofliteraturerdquo International Journal of Clinical and ExperimentalMedicine vol 6 no 8 pp 720ndash723 2013

[39] YUchida S Sugiura F AndoH Shimokata andTNakashimaldquoAssociation of the C677T polymorphism in the methylenete-trahydrofolate reductase gene with sudden sensorineural hear-ing lossrdquo Laryngoscope vol 120 no 4 pp 791ndash795 2010

[40] YUchida S Sugiura TNakashima F Ando andH ShimokataldquoContribution of 1425GA polymorphism in protein kinase C-Eta (PRKCH) gene and brain white matter lesions to the riskof sudden sensorineural hearing loss in a Japanese nested case-control studyrdquo Journal of Neurogenetics vol 25 no 3 pp 82ndash872011

[41] Y Uchida M Teranishi N Nishio et al ldquoEndothelin-1 genepolymorphism in sudden sensorineural hearing lossrdquo Laryngo-scope vol 123 no 11 pp E59ndashE65 2013

[42] M Teranishi Y Uchida N Nishio et al ldquoPolymorphismsin genes involved in the free-radical process in patients withsudden sensorineural hearing loss and Menierersquos diseaserdquo FreeRadical Research vol 47 no 6-7 pp 498ndash506 2013

[43] P Capaccio F Ottaviani V Cuccarini et al ldquoSudden hearingloss and MTHFR 677CgtT1298AgtC gene polymorphismsrdquoGenetics in Medicine vol 7 no 3 pp 206ndash208 2005

[44] S H Cho H Chen I S Kim et al ldquoAssociation of the 4 g5 gpolymorphism of plasminogen activator inhibitor-1 gene withsudden sensorineural hearing loss A case control studyrdquo BMCEar Nose andThroat Disorders vol 12 no 1 article 5 2012

[45] Z Zhang F Zhang P An et al ldquoFerroportin1 deficiency inmouse macrophages impairs iron homeostasis and inflamma-tory responsesrdquo Blood vol 118 no 7 pp 1912ndash1922 2011

[46] X-B Liu P Hill and D J Haile ldquoRole of the ferroportin iron-responsive element in iron and nitric oxide dependent generegulationrdquo Blood Cells Molecules amp Diseases vol 29 no 3 pp315ndash326 2002

[47] F Foury and D Talibi ldquoMitochondrial control of iron home-ostasis A genome wide analysis of gene expression in a yeastfrataxin-deficient strainrdquo Journal of Biological Chemistry vol276 no 11 pp 7762ndash7768 2001

[48] M A Farooq T M Pracheil Z Dong F Xiao and ZLiu ldquoMitochondrial DNA instability in cells lacking aconitasecorrelates with iron citrate toxicityrdquo Oxidative Medicine andCellular Longevity vol 2013 Article ID 493536 10 pages 2013

[49] S Levi and E Rovida ldquoThe role of iron in mitochondrial func-tionrdquo Biochimica et Biophysica Acta (BBA)mdashGeneral Subjects vol 1790 no 7 pp 629ndash636 2009

[50] C H Choi C H Jang Y B Cho S Y Jo M Y Kim and BY Park ldquoMatrixmetalloproteinase inhibitor attenuates cochlearlateral wall damage induced by intratympanic instillation ofendotoxinrdquo International Journal of Pediatric Otorhinolaryngol-ogy vol 76 no 4 pp 544ndash548 2012

[51] N Zhao Z Sun Y Mao et al ldquoMyocardial iron metabolismin the regulation of cardiovascular diseases in ratsrdquo CellularPhysiology and Biochemistry vol 25 no 6 pp 587ndash594 2010

[52] M E Techau J Valdez-Taubas J-F Popoff R Francis MSeaman and J M Blackwell ldquoEvolution of differences in trans-port function in Slc11a family membersrdquo Journal of BiologicalChemistry vol 282 no 49 pp 35646ndash35656 2007

[53] M D Garrick and L M Garrick ldquoCellular iron transportrdquoBiochimica et Biophysica Acta vol 1790 no 5 pp 309ndash3252009

[54] L Neng F Zhang A Kachelmeier and X Shi ldquoEndothe-lial cell pericyte and perivascular resident macrophage-typemelanocyte interactions regulate cochlear intrastrial fluid-blood barrier permeabilityrdquo JAROmdashJournal of the Associationfor Research in Otolaryngology vol 14 no 2 pp 175ndash185 2013

[55] T Muurling and K M Stankovic ldquoMetabolomic and networkanalysis of pharmacotherapies for sensorineural hearing lossrdquoOtology and Neurotology vol 35 no 1 pp 1ndash6 2014

[56] J C Adams B Seed N Lu A Landry and R J XavierldquoSelective activation of nuclear factor kappa B in the cochlea bysensory and inflammatory stressrdquo Neuroscience vol 160 no 2pp 530ndash539 2009

[57] M Masuda S Kanzaki S Minami et al ldquoCorrelations ofinflammatory biomarkers with the onset and prognosis ofidiopathic sudden sensorineural hearing lossrdquo Ontology ampNeurotology vol 33 no 7 pp 1142ndash1150 2012

[58] J Santos-Sacchi and W F Marovitz ldquoA ferritin-containing celltype in the stria vascularis of the mouse inner earrdquo Acta Oto-Laryngologica vol 100 no 1-2 pp 26ndash32 1985

[59] D Ding R Salvi and J A Roth ldquoCellular localization anddevelopmental changes of the different isoforms of divalentmetal transporter 1 (DMT1) in the inner ear of ratsrdquo BioMetalsvol 27 no 1 pp 125ndash134 2014

[60] J B Hansen M F Tonnesen A N Madsen et al ldquoDivalentmetal transporter 1 regulates iron-mediated Ros and pancreatic120573 cell fate in response to cytokinesrdquo Cell Metabolism vol 16 no4 pp 449ndash461 2012

[61] M Abouhamed N A Wolff W-K Lee C P Smith andF Thevenod ldquoKnockdown of endosomallysosomal divalentmetal transporter 1 by RNA interference prevents cadmium-metallothionein-1 cytotoxicity in renal proximal tubule cellsrdquoTheAmerican Journal of PhysiologymdashRenal Physiology vol 293no 3 pp F705ndashF712 2007

[62] L A Everett B Glaser J C Beck et al ldquoPendred syndromeis caused by mutations in a putative sulphate transporter gene(PDS)rdquo Nature Genetics vol 17 no 4 pp 411ndash422 1997

[63] M Abouhamed J Gburek W Liu et al ldquoDivalent metaltransporter 1 in the kidney proximal tubule is expressed inlate endosomeslysosomal membranes implications for renalhandling of protein-metal complexesrdquoThe American Journal ofPhysiologymdashRenal Physiology vol 290 no 6 pp F1525ndashF15332006

[64] D CMarcus RThalmann andN YMarcus ldquoRespiratory rateand ATP content of stria vascularis of guinea pig in vitrordquo TheLaryngoscope vol 88 no 11 pp 1825ndash1835 1978

[65] S D Rauch ldquoTransferrin microheterogeneity in human peri-lymphrdquo Laryngoscope vol 110 no 4 pp 545ndash552 2000

[66] G Chiarella M Saccomanno D Scumaci et al ldquoProteomics inMeniere diseaserdquo Journal of Cellular Physiology vol 227 no 1pp 308ndash312 2012


[67] C A Buchman W M Luxford B E Hirsch M J Fucci andR H Kelly ldquoBeta-2 transferrin assay in the identification ofperilymphrdquo American Journal of Otology vol 20 no 2 pp 174ndash178 1999

[68] NAWolffW Liu R A FentonW-K Lee FThevenod andCP Smith ldquoFerroportin 1 is expressed basolaterally in rat kidneyproximal tubule cells and iron excess increases its membranetraffickingrdquo Journal of Cellular and Molecular Medicine vol 15no 2 pp 209ndash219 2011

[69] BMazurekNAmarjargalHHaupt et al ldquoExpression of genesimplicated in oxidative stress in the cochlea of newborn ratsrdquoHearing Research vol 277 no 1-2 pp 54ndash60 2011

[70] P S Yang B A Alseikhan H Hiel et al ldquoSwitching of Ca2+-dependent inactivation of CaV13 channels by calcium bindingproteins of auditory hair cellsrdquo Journal of Neuroscience vol 26no 42 pp 10677ndash10689 2006

[71] A Zuccotti S Clementi T Reinbothe A Torrente D HVandael and A Pirone ldquoStructural and functional differencesbetween L-type calcium channels crucial issues for futureselective targetingrdquo Trends in Pharmacological Sciences vol 32no 6 pp 366ndash375 2011

[72] R G Tsushima A D Wickenden R A Bouchard G Y OuditP P Liu and P H Backx ldquoModulation of iron uptake in heartby L-type Ca2+ channel modifiers possible implications in ironoverloadrdquo Circulation Research vol 84 no 11 pp 1302ndash13091999

[73] A Shawki and B Mackenzie ldquoInteraction of calcium withthe human divalent metal-ion transporter-1rdquo Biochemical andBiophysical Research Communications vol 393 no 3 pp 471ndash475 2010

[74] N Chattipakorn S Kumfu S Fucharoen and S ChattipakornldquoCalcium channels and iron uptake into the heartrdquo WorldJournal of Cardiologyy vol 3 no 7 pp 215ndash218 2011

[75] I S Gabashvili B H A Sokolowski C C Morton and A B SGiersch ldquoIon channel gene expression in the inner earrdquo Journalof the Association for Research in Otolaryngology vol 8 no 3pp 305ndash328 2007

[76] F Ceriani and F Mammano ldquoCalcium signaling in the coch-leamdashmolecular mechanisms and physiopathological implica-tionsrdquo Cell Communication and Signaling vol 10 article 202012

[77] T Suzuki T Takamatsu and M Oyamada ldquoExpression ofgap junction protein connexin43 in the adult rat cochleacomparison with connexin26rdquo Journal of Histochemistry ampCytochemistry vol 51 no 7 pp 903ndash912 2003

[78] J Salazar N Mena S Hunot et al ldquoDivalent metal transporter1 (DMT1) contributes to neurodegeneration in animal modelsof Parkinsonrsquos diseaserdquo Proceedings of the National Academy ofSciences of the United States of America vol 105 no 47 pp18578ndash18583 2008

[79] M Hanani ldquoSatellite glial cells in sensory ganglia from form tofunctionrdquo Brain Research Reviews vol 48 no 3 pp 457ndash4762005

[80] X Du H Xu N Song H Jiang and J Xie ldquoThe role of ATP-sensitive potassium channels on DMT1-mediated ferrous ironuptake in SK-N-SH cellsrdquo Molecular Neurodegeneration vol 7supplement 1 p S6 2012

[81] X Wang D S Miller and W Zheng ldquoIntracellular localizationand subsequent redistribution of metal transporters in a ratchoroid plexus model following exposure to manganese orironrdquo Toxicology and Applied Pharmacology vol 230 no 2 pp167ndash174 2008

[82] P L Lee T Gelbart C West C Halloran V Felitti and EBeutler ldquoA study of genes that may modulate the expressionof hereditary hemochromatosis transferrin receptor-1 ferro-portin ceruloplasmin ferritin light and heavy chains ironregulatory proteins (IRP)-1 and -2 and hepcidinrdquo Blood CellsMolecules and Diseases vol 27 no 5 pp 783ndash802 2001

[83] S V Jabba A Oelke R Singh et al ldquoMacrophage invasion con-tributes to degeneration of stria vascularis in Pendred syndromemouse modelrdquo BMCMedicine vol 4 article 37 2006

[84] E Moura M A Noordermeer N Verhoeven A P M Verheuland J J M Marx ldquoIron release from human monocytesafter erythrophagocytosis in vitro an investigation in normalsubjects and hereditary hemochromatosis patientsrdquo Blood vol92 no 7 pp 2511ndash2519 1998

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


free radical formation [8 9] Iron-mediated oxidative stressis hypothesized to be involved in the pathogenesis of severaldegenerative disorders including thrombosis venous ulcerschronic venous disease and central nervous system disorderssuch as multiple sclerosis or neoplasms [10ndash13] In additiona novel iron-driven etiopathogeneticmechanism responsiblefor increase in free radical generation has been formulated indegenerative skin lesions appearance comprehending coex-istence of local iron overload and iron homeostasis gene-variants [14] Accordingly similar conditions could be poten-tially associated with sudden hearing loss [15] Thereforedivalent ions homeostasis could be a central pathway involvedin the pathophysiology of sudden hearing loss [16 17] Infact the one of the known models of hearing loss in Pendredsyndrome is ironfree radical stress-mediated [18] The maingenes and their variants we selected and investigated withpossible effects on tissue injury [10 19] are described below

TheHFE gene (6p213ndash222) encodes amembrane proteinof 348 amino acids that belongs to the MHC class I familyThe protein is normally expressed in cryptal enterocytes ofthe duodenum liver placenta kidney plasma and plateletsComplexingwith beta 2microglobulin and transferrin recep-tor (TFR2) it plays a crucial role in iron homeostasisand when mutated it is believed to be responsible forhemochromatosis variegate porphyria and microvascularcomplications of diabetes Variants andor mutated proteinsbind to the transferrin receptor and reduce its affinity foriron-loaded transferrin Thus they finally unbalance theiron intake Recent increasing interest in neurodegenerativedisorders mediated by iron overload has highlighted theHFEgene among candidates for further investigations into ironhomeostasis involvement in similar conditions A review ofthe literature suggests a potential role even in iron-mediatedhearing loss also in the past [20 21] Finally it is importantto note that the HFE gene is also expressed in the brainspinal cord cortex and cerebellum [22 23] Thus it couldbe directly involved or responsible for specific conditionsconcerning the central nervous system

The FPN1 (SLC40A1) gene is located on chromosome 2(2q32) and it encodes a protein (ferroportin) of 570 aminoacids with the specific function of exporting iron out fromcells in the basolateral space except for the reticuloen-dothelial cells which can spread iron ions into the bloodcirculation Consequently FPN1 plays a crucial role in ironhomeostasis [24] and generally it has the opposite functionof the DMT1 protein product [25] which allows intracellularpassage of divalent iron (Fe2+) Ferroportin is expressed indifferent tissues though to the best of our knowledge there areno previous reported studies that document its localizationinto the cochlea Similar to other iron genes it undergoes ironregulation at the transcriptional and translational level [26ndash28]

Another important gene related to ferroportin expressionand function is the HEPC (19q131) gene encoding theprotein hepcidin (HAMP) This protein is a 25-amino-acidpeptide derived from the cleavage of an 84-amino-acid longpropeptide that is mainly synthesized by hepatocytes and isa major regulator of iron balance activity via binding to theFPN1 protein on the cell membrane suppressing it [29 30]

HEPC expression and its role in iron homeostasis may play acrucial role in different conditions [31]

The TF gene (3q221) encodes for the protein transferrinwhich forms a stable complex with the HFE protein whichfacilitates iron transfer via the transferrin receptor Thefunction of this protein is to transport iron from the intestinereticuloendothelial system and liver parenchymal cells to allproliferating cells in the body The effect of HFE on ironabsorption depends on its relationship with the transferrinreceptor HFE variants affect TF binding determining a lossof HFE-repressor function for TF uptake thereby increasingiron transport within the cells

As there are no previous reports in the literature about therole of iron metabolism regulatory genes in the pathophysi-ology of SSNHL we proceeded to evaluate if specific singlenucleotide polymorphisms within the main iron genes arepotentially involved in the susceptibility to SSNHL

2 Materials and Methods

21 Study Design Patient and Control Enrolment The re-search was designed as a case-control study A total of 200patients (104 females and 96 males) affected by idiopathicsudden sensorineural hearing loss (ISSNHL) and referredto the ENT and Audiology Department of the UniversityHospital of Ferrara from 2009 to 2013 were enrolled forthis study According to the current literature ISSNHL wasdefined as a sudden hearing loss (ge30 dB HL) within 3consecutive frequencies developing over 72 hours [32]

All patients underwent a complete clinical interview witha complete audiological evaluation includingmicrootoscopytonal and speech audiometry impedancemetry auditorybrainstem responses (ABRs) and MRI with gadolinium torule out retrocochlear pathology

The patients were enrolled in the study after diagnosis ofISSNHLmade by experienced audiologists Exclusion criteriawere specific causes of sudden hearing impairment such asmeningitis traumas or surgery outcomes and complications

For each patient a Pure Tone Average hearing threshold(PTA dBHL) was estimated from the hearing levels at 05 12 and 4 kHz The average degree of hearing loss was thenclassified into the following groups according to a modifiedmethod fromClark [33] normal hearing (10ndash15 dBHL) mildhearing loss (16ndash40 dB HL) moderate hearing loss (41ndash70 dBHL) severe hearing loss (71ndash90 dBHL) and profound hearingloss (gt90 dBHL)The type of hearing loss was then evaluatedaccording to the Tran Ba Huy classification [34] and therebystratified into five types A B C D and E

The control group consisted of 400 healthy volunteerswith no personal or familial history of previous SSNHL andtheywere completelymatchedwith the case group by sex ageand ethnicity

22 Audiological Equipment Pure tone threshold audiome-try was performed within a sound-proof cabin (model E2X2roll 01008 220V 10AMercuryMilan Italy) using anAmplaidaudiometer (Amplaid Milan Italy) calibrated to ISO 9001standards The audiometric procedure was performed usingheadphones to assess air conduction and a bone vibrator















3 Results


















4 Discussion




Start (Met)




minus8CG





Start of Start of

IRE

Promoter region

IRP

minus98GC minus8CG

minus235 minus196

5998400 3998400





Perilymph

Perilymph

Blood vessel

TransferrinFe3+

TransferrinFe3+

TransferrinFe3+


basolateral

Ferritin

Ferritin

Ferritin

junctions

junctions

Stria vascularis

apical

cytoplasmatic

Spiral ganglion

Endolymph

Endolymph

290mOsm

310mOsm


CSFgap junctions

DMT1

TfRDMT1




FPN1gap FPN1

FPN1gap

FPN1 150mM K+ +80mV

















References































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology















3 Results


















4 Discussion




Start (Met)




minus8CG





Start of Start of

IRE

Promoter region

IRP

minus98GC minus8CG

minus235 minus196

5998400 3998400





Perilymph

Perilymph

Blood vessel

TransferrinFe3+

TransferrinFe3+

TransferrinFe3+


basolateral

Ferritin

Ferritin

Ferritin

junctions

junctions

Stria vascularis

apical

cytoplasmatic

Spiral ganglion

Endolymph

Endolymph

290mOsm

310mOsm


CSFgap junctions

DMT1

TfRDMT1




FPN1gap FPN1

FPN1gap

FPN1 150mM K+ +80mV

















References































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology














4 Discussion




Start (Met)




minus8CG





Start of Start of

IRE

Promoter region

IRP

minus98GC minus8CG

minus235 minus196

5998400 3998400





Perilymph

Perilymph

Blood vessel

TransferrinFe3+

TransferrinFe3+

TransferrinFe3+


basolateral

Ferritin

Ferritin

Ferritin

junctions

junctions

Stria vascularis

apical

cytoplasmatic

Spiral ganglion

Endolymph

Endolymph

290mOsm

310mOsm


CSFgap junctions

DMT1

TfRDMT1




FPN1gap FPN1

FPN1gap

FPN1 150mM K+ +80mV

















References































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



Start (Met)




minus8CG





Start of Start of

IRE

Promoter region

IRP

minus98GC minus8CG

minus235 minus196

5998400 3998400





Perilymph

Perilymph

Blood vessel

TransferrinFe3+

TransferrinFe3+

TransferrinFe3+


basolateral

Ferritin

Ferritin

Ferritin

junctions

junctions

Stria vascularis

apical

cytoplasmatic

Spiral ganglion

Endolymph

Endolymph

290mOsm

310mOsm


CSFgap junctions

DMT1

TfRDMT1




FPN1gap FPN1

FPN1gap

FPN1 150mM K+ +80mV

















References































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


Perilymph

Perilymph

Blood vessel

TransferrinFe3+

TransferrinFe3+

TransferrinFe3+


basolateral

Ferritin

Ferritin

Ferritin

junctions

junctions

Stria vascularis

apical

cytoplasmatic

Spiral ganglion

Endolymph

Endolymph

290mOsm

310mOsm


CSFgap junctions

DMT1

TfRDMT1




FPN1gap FPN1

FPN1gap

FPN1 150mM K+ +80mV

















References































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology












References































































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology





























































































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

research article sudden sensorineural hearing loss and...

Documents