Quantification of ammonia-oxidising bacteria in limed and non-limed

acidic coniferous forest soil using real-time PCR

Anna Hermanssona, Jenny S.K. Backmana, Bo H. Svenssonb, Per-Eric Lindgrena,c,*

aDepartment of Physics and Measurement Technology, Biology and Chemistry, Linkopings Universitet, SE-581 83 Linkoping, SwedenbDepartment of Water and Environmental Studies, Linkopings Universitet, SE-581 83 Linkoping, Sweden

cDivision of Medical Microbiology, Department of Molecular and Clinical Medicine, Linkopings Universitet, SE-581 85 Linkoping, Sweden

Received 15 December 2003; received in revised form 7 May 2004; accepted 20 May 2004

Abstract

Ammonia-oxidising bacteria (AOB) in limed and non-limed acidic coniferous forest soil were investigated using real-time PCR. Two sites

in southern Sweden were studied, 244 Aled and Oxafallan. The primers and probe used earlier appeared to be specific to the 16S rRNA gene

of AOB belonging to the b-subgroup of the Proteobacteria [Appl. Environ. Microbiol. 67 (2001) 972]. Plots treated with two different doses

of lime, 3 or 6 t haK1, were compared with non-limed control plots on two occasions during a single growing season. Three different soil

depths were analysed to elucidate possible differences in the density of their AOB communities. The only clear effect of liming on the AOB

was recorded in the beginning of the growing season at 244 Aled. In samples taken in April from this site, the numbers of AOB were higher in

the limed plots than in the control plots. At the end of the growing season the AOB communities were all of a similar size in the different plots

at both sites, irrespective of liming. The number of AOB, determined using real-time PCR, ranged between 6!106 and 1!109 cells gK1 soil

(dw) at the two sites, and generally decreased with increasing soil depth. The results showed no correlation between community density and

potential nitrification. This may indicate a partly inactive AOB community. Furthermore, more than 107 cells gK1 soil (dw) were recorded

using real-time PCR in the control plot at 244 Aled, although Backman et al. [Soil Biol. Biochem. 35 (2003) 1337] detected no AOB like

sequences in the same plots using PCR followed by DGGE. Taken together our results strongly suggest that the primers and probe set used

are not well suited for quantifying AOB in acidic forest soils, which is probably due to an insufficient specificity. This shows that it is

extremely important to re-evaluate any primers and probe set when used in a new environment. Consideration should be given to the

specificity and sensitivity, both empirically and using bioinformatic tools.

q 2004 Elsevier Ltd. All rights reserved.

Keywords: Ammonia-oxidising bacteria; Real-time PCR; Acidic coniferous forest; Liming; TaqMane

1. Introduction

In acidic forest soils, as in most other environments,

autotrophic bacteria appear to dominate the nitrification

process (Pennington and Ellis, 1993; De Boer et al., 1995;

Persson and Wiren, 1995; Rudebeck and Persson, 1998). In

such soils, the initial oxidation of ammonia to nitrite

is carried out by the ammonia-oxidising bacteria (AOB).

0038-0717/$ - see front matter q 2004 Elsevier Ltd. All rights reserved.

doi:10.1016/j.soilbio.2004.05.014

* Corresponding author. Address: Division of Medical Microbiology,

Department of Molecular and Clinical Medicine, Linkopings Universitet,

SE-581 85 Linkoping, Sweden. Tel.: C46-13-22-85-86; fax: C46-13-22-

47-89.

E-mail address: perli@imk.liu.se (P.-E. Lindgren).

Soil-dwelling representatives of these bacteria belong to the

b-subgroup of the Proteobacteria. Nitrosospira species

have been found to dominate in terrestrial environments,

including acidic habitats (Klemedtsson et al., 1999;

Hastings et al., 2000; Backman et al., 2003) in which both

acid-sensitive and acid-tolerant strains have been observed

(De Boer et al., 1992). There are also reports suggesting the

possible presence of inactive populations of nitrifiers in

acidic soils (Degrange et al., 1998; Rudebeck and Persson,

1998). Today, hemi-boreal forests are partly exposed to

acidification. To reduce or remedy its adverse effects,

forests have been subjected to liming experiments. The

pH increase as a result of liming has been shown to

stimulate nitrification (Martikainen et al., 1993; Rudebeck

Soil Biology & Biochemistry 36 (2004) 1935–1941

www.elsevier.com/locate/soilbio

A. Hermansson et al. / Soil Biology & Biochemistry 36 (2004) 1935–19411936

and Persson, 1998; Backman and Kasimir Klemedtsson,

2003) and the AOB community has been reported to

increase in soils treated with lime (Klemedtsson et al., 1999;

Backman et al., 2003). The enlarged community is sustained

for several years (Klemedtsson et al., 1999). Scandinavian

boreal forest ecosystems were long considered to be

nitrogen limited, with low rates of leaching and gaseous

emissions (Tamm, 1991). However, due to elevated levels

of nitrogen deposition, there is now a risk that rates

of nitrogen exchange between the forest soil and the

surrounding water and atmosphere could increase

(Martikainen et al., 1993; Sitaula and Bakken, 1993;

Gundersen, 1995). This risk is especially pronounced for

forest soils that are limed, because this increases nitrifying

activity (De Boer et al., 1993; Persson et al., 1995; Simmons

et al., 1996; Backman and Kasimir Klemedtsson, 2003).

There are several methods for quantifying AOB in

different environments (Sanden et al., 1994; Bruns et al.,

1999; Schramm et al., 1999; Kowalchuk et al., 2000;

Phillips et al., 2000; Hermansson and Lindgren, 2001). The

most probable number (MPN)-technique is most common

for estimating AOB community sizes in forest soils

(De Boer et al., 1992; Paavolainen and Smolander, 1998;

Carnol and Ineson, 1999; Klemedtsson et al., 1999; Priha

and Smolander, 1999; Hastings et al., 2000). The MPN-

technique is known to underestimate the number of bacteria

generally, due to its dependence on culturability (Belser and

Mays, 1980; Klemedtsson et al., 1999). Furthermore, since

AOB tend to grow poorly in liquid media and vary widely in

their responsiveness to MPN assays (Belser and Schmidt,

1978), the use of this method for quantification is

questionable. Molecular biological techniques have the

potential to circumvent these problems. Detection of

specific DNA target sequences, such as the 16S rRNA

gene (rDNA), is commonly used both as a taxonomic tool

and for quantitative studies. A real-time PCR assay, using

primers and a probe targeting the V2–V3-region of the 16S

rDNA, developed by Hermansson and Lindgren (2001), has

previously been successfully applied in arable soil

(Hermansson and Lindgren, 2001), activated sludge

(Harms et al., 2003) and nitrifying biofilms from wastewater

treatment plants (unpublished data). In activated sludge as

well as in the biofilm the real-time PCR quantification has

been confirmed by other well-established methods for

determining cell quantities. The high sensitivity of the

assay and the potential for detecting a broad range of

starting template concentrations (Heid et al., 1996) should

make it suitable for quantifying bacteria with large

variations in community densities.

The aim of this study was to investigate the effect of

liming on the community densities of AOB in acidic

coniferous forest soils. We used real-time PCR based on

16S rDNA for quantifying AOB, as developed by

Hermansson and Lindgren (2001). We investigated soils at

two field sites in southern Sweden. Within each site, plots

had been subjected to different rates of lime application six

years prior to sampling. In addition, we wished to study how

the community sizes of AOB varied down the soil profiles.

Three different depths within each plot on two sampling

occasions in one season were investigated.

2. Material and methods

2.1. Study sites and soil characteristics

Two sites were studied: 244 Aled, in the southwest of

Sweden (568 46 0N, 128 56 0E) and Oxafallan, in central

southern Sweden (57808 0N, 14845 0E). The soils at both sites

were podsolic sandy tills, at 244 Aled supporting a 65-year-

old forest, composed of Norway spruce (Picea abies (L.)

Karst.) together with some Scots pine (Pinus sylvestris L.)

and birch (Betula pendula (L.)) and at Oxafallan supporting

a 40-year-old Norway spruce (Picea abies (L.) Karst.) stand.

Both sites had a fermentation layer and a humus layer each

about 5 cm deep, a distinct elluvial horizon (its depth was

not measured) and below that an illuvial layer of at least

20 cm. The mean annual (1993–1996) nitrogen throughfall

was higher at 244 Aled than at Oxafallan: 6.4 kg NH4C–

N haK1 yearK1 and 8.4 kg NO3K–N haK1 yearK1 at 244

Aled compared to 1.6 kg NH4CKN haK1 yearK1 and 2.2 kg

NO3K–N haK1 yearK1 at Oxafallan (http://www.ivl.se/

miljo/). The two study sites are both part of long-term

liming projects. The 244 Aled site is managed by

the Forestry Research Institute of Sweden, while

the Swedish University of Agricultural Sciences and the

Swedish Environmental Research Institute maintain the

Oxafallan site. Samples from 244 Aled were collected in

April and September 1998 and in June and September the

same year from Oxafallan. Three treatments were studied:

control plots without liming (C) and limed plots treated with

either 3 t haK1 (L3) or 6 t haK1 (L6), applied in 1992. At

244 Aled there were three plots (30!30 m) per treatment

and at Oxafallan four plots (30!30 m) per treatment. The

lime was added in the form of CaCO3: CaMg(CO3)2 in a 1:1

ratio at 244 Aled and as CaCO3: CaMg(CO3)2 in a 2:1 ratio

at Oxafallan. The lime was spread manually at both sites and

the size of the granules was %3 mm. The concentrations of

NH4C–N and (NO2

KCNO3K)–N detected in the soil samples,

together with their potential nitrification, and pH at both

sites are presented in Table 1 (Backman and Kasimir

Klemedtsson, 2003).

2.2. Soil sampling

The litter layer was removed and the soil was sampled

using a soil auger (: 25 mm), from three depths: 0–5 cm

(approximately representing the fermentation horizon),

5–10 cm (approximately representing the humus horizon),

and 20–25 cm (within the illuvial horizon). Multiple

samples (20) were collected every second metre along one

diagonal of the plots and then pooled, representing each plot

Table 1

Soil characteristics 6 years after liming at 244 Aled (southwest Sweden) and Oxafallan (central southern Sweden), from Backman and Kasimir Klemedtsson

(2003)

Month Depth

(cm)

Lime dose

(t haK1)

pH(KCl)a NH4

C-N

(mg kgK1)

NOxK-Nb

(mg kgK1)

Pot. nit.c

(mg N gK1 dK1)

244 Aled

April 0–5 0 2.9 (0.2) 40 0.3 K0.5 (0.4)

0–5 3 4.0 (0.1) 110 59 5.0 (2.5)*

0–5 6 4.5 (0.1) 46 1.1 2.1 (0.5)*

5–10 0 2.9 (0.1) 15 0.2 K0.6 (0.3)

5–10 3 3.7 (0.2) 64 18 1.0 (1.2)*

5–10 6 4.0 (0.3) 23 0.7 1.0 (0.4)*

20–25 0 4.1 (0.1) 2.6 0.1 K0.2 (0.4)

20–25 3 4.3 (0.1) 12 3.7 0.2 (0.0)

20–25 6 4.3 (0.1) 2.8 0.2 0.0 (0.3)

Sept. 0–5 0 2.6 (0.1) 84 0.4 0.1 (0.8)

0–5 3 3.6 (0.1) 150 27 0.9 (0.9)

0–5 6 4.8 (0.2) 130 30 3.0 (1.4)*

5–10 0 2.9 (0.0) 16 0.2 0.2 (0.1)

5–10 3 3.3 (0.0) 22 0.9 0.1 (0.1)

5–10 6 3.6 (0.3) 15 0.6 0.2 (0.2)

20–25 0 4.0 (0.1) 2.7 0.7 0.1 (0.1)

20–25 3 4.1 (0.1) 5.5 1.1 0.0 (0.1)

20–25 6 4.2 (0.0) 2.6 0.6 0.0 (0.0)

Oxafallan

June 0–5 0 3.2 (0.2) 44 0.0 0.5 (0.4)

0–5 3 3.9 (0.3) 65 0.0 0.3 (0.7)

0–5 6 4.9 (0.5) 75 0.1 K0.2 (0.5)*

5–10 0 3.4 (0.2) 18 0.0 0.1 (0.1)

5–10 3 3.7 (0.2) 20 0.0 0.0 (0.1)

5–10 6 3.9 (0.2) 20 0.1 0.2 (0.1)*

20–25 0 4.1 (0.1) 2.8 0.2 0.1 (0.2)

20–25 3 4.0 (0.1) 2.8 0.1 0.7 (1.5)

20–25 6 4.2 (0.1) 2.5 0.3 0.2 (0.1)

Sept. 0–5 0 3.0 (0.4) 50 0.2 0.1 (0.4)

0–5 3 3.8 (0.3) 73 0.1 K0.4 (0.1)*

0–5 6 4.3 (0.1) 94 1.2 K0.2 (0.1)*

5–10 0 3.4 (0.2) 14 0.2 K0.1 (0.1)

5–10 3 3.6 (0.2) 14 0.2 0.0 (0.2)

5–10 6 3.8 (0.1) 15 0.1 K0.1 (0.3)

20–25 0 4.0 (0.1) 4.1 0.5 K0.2 (0.3)

20–25 3 4.1 (0.2) 4.5 0.5 K0.1 (0.3)

20–25 6 4.1 (0.2) 4.4 0.9 0.0 (0.2)

Standard deviations are within parenthesis (nZ3 at 244 Aled and nZ4 at Oxafallan). NOxK indicates both NO2

K and NO3K. * indicates a significant difference

(Mann-Whitney’s U Test, p!0.05) between limed and non-limed soil, for each soil depth.a pH was measured in suspensions of 5 g soil and 10 ml 1.0 M KCl after shaking for 1 h at room temperature.b The mineral N [NH4

C–N and (NO2KCNO3

K)–N] was determined by 2M KCl extraction and colorimetric analysis (AutoAnalyzer TRAACS 800,

BranCLoebbe, Norderstedt, Germany) according to Swedish Standard methods nos. ST9002-NH4D and ST9002-NO3D.c Pot. nit. is the potential nitrification. The negative values indicate nitrogen consumption.

A. Hermansson et al. / Soil Biology & Biochemistry 36 (2004) 1935–1941 1937

and depth. The pooled soil samples from each plot were

subsequently combined to give one composite sample per

treatment and depth. After sieving (6.3 mm grid size) the

soil was stored at K20 8C.

2.3. DNA extraction

DNA was extracted using a FastDNA SPIN kit for soil

(Bio 101, Inc, La Jolla, California, US). Soil samples

(1.25 g) were suspended in 5 ml of sodium phosphate buffer

(supplied with the FastDNA SPIN kit). After homogenis-

ation with a hand-held blender (DIAX 900, Homogenizer

tool G6, Heidolph, Kelheim, Germany) for 5 min, the

soil slurry was aliquoted into five tubes with 1 g of

glass beads (0.1 mm in diameter; BioSpec Products,

Bartlesville, Oklahoma, US). The samples were shaken in

a mini-beadbeater (BioSpec Products) at 5000 rev minK1

for 3!30 s. The DNA was purified as recommended by

the manufacturer, except that the centrifugation was

increased to 2!5 min after the bead beating, and to

5 min after washing with SEWS-M (supplied with the

FastDNA SPIN kit). Earlier experiments have shown that

the columns used for DNA extraction were not over-

loaded (data not published). Thus the amount of soil

A. Hermansson et al. / Soil Biology & Biochemistry 36 (2004) 1935–19411938

sample used for the DNA extraction was maintained

within the range where direct proportionality to the DNA

yield is obtained.

2.4. Quantification of ammonia-oxidising bacteria by

real-time PCR

The primers and probes used in the study are listed in

Table 2. The primers CTO 189fA/B and CTO 189fC

(Kowalchuk et al., 1997) were used in a 2:1 ratio, resulting

in equal concentrations of A, B, and C. The conditions and

the procedure for the real-time PCR followed those

described previously by Hermansson and Lindgren, 2001.

Briefly, the DNA amplification was performed in 25 ml

reaction mixtures, using buffers supplied with a TaqMan

Universal PCR Master Mix kit (PE Applied Biosystems,

Foster City, CA, USA). The template DNA was amplified

and monitored using an ABI Prism SDS 7700 instrument

(PE Applied Biosystems, Foster City, CA, USA). The

linearised plasmid pUC18 (Norrander et al., 1983) was

added to each sample (0.7 pg pUC18 reactionK1) to act as

an internal control, and to allow for normalisation of real-

time PCR data. In order to obtain PCR-products from all

samples without interference from humic substances, the

DNA extract was diluted by a factor of 1000. This was the

case for all sample extracts except those from the 5–10 cm

soil depth at 244 Aled, which were diluted by a factor of

2000. The temperature profiles for the amplification

reactions were: 2 min at 50 8C, 10 min at 95 8C followed

by 40 cycles of 15 s at 95 8C and 1 min at 60 8C. The

quantification of the AOB DNA was based on a mean slope

value (K3.58) derived from standard curves. The estimates

of bacterial cell numbers were derived from the amount of

template AOB DNA as described by Hermansson and

Lindgren (2001).

Table 2

Primers and probes used in real-time PCR targeting the 16S rDNA of b-subgrou

Oligonucleotides Nucleotide sequence (50-30)

Primers:

CTO 189 f A/B GGAGRAAAGCAGGGGATCG

CTO 189 f C GGAGGAAAGTAGGGGATCG

RT 1r CGTCCTCTCAGACCARCTACTG

RT 2f CTCCCGGCATCCGCTA

RT 2r CGCGCGTTTCGGTGAT

R-Q probes:c

TMP 1 (5 0-FAM and 30-TAMRA) CAACTAGCTAATCAGR-

CATCRGCCGCTC

TMP 2 (5 0-CR6G and 3 0-TAMRA) ACGGTGAAAACCTCTGACACA

CAGCT

a E. coli numbering (Brosius et al., 1981).b pUC18 numbering (Norrander et al., 1983).c FAM, 6-carboxyfluorescein; TAMRA, 6-carboxy-tetramethylrhodamine; CR

3. Results

PCR products were obtained from all the samples using

real-time PCR amplification with primers and probe earlier

designed to be AOB specific targeting the 16S rRNA gene.

Each estimate of cell numbers detected using this set of

primers and probe (Fig. 1) is the mean of five separate

quantification reactions, using DNA originating from five

extraction replicates. The estimates of total AOB numbers

(hereafter it is stated AOB numbers, when the above

mentioned primers and probe set is used for the community

analysis) ranged between 6!106 and 1!109 cells gK1 soil

(dw) at 244 Aled and between 3!107 and 3!108 cells gK1

soil (dw) at Oxafallan.

At 244 Aled in April, liming clearly produced a positive

effect of liming on the numbers of AOB (Fig. 1a). In the

plots limed with 6 t haK1, the AOB community had a higher

density at all three depths compared to the non-limed

control plots, while the effect was seen only in the two upper

horizons at the 3 t haK1 level. The numbers of AOB

decreased with increasing soil depth in all plots, including

the control. In September no effect of liming on the AOB

cell density was recorded, but there were indications of a

slight tendency towards a reduction in cell numbers in all

plots, with increasing soil depth (Fig. 1b). Comparing the

samples in April and September revealed a clear increase in

the number of AOB in the control plots, a slight increase in

the plots limed with 3 t haK1 and no change in the cell

numbers in the plots limed with 6 t haK1 (Fig. 1a and b).

This trend was obvious at all soil depths.

At Oxafallan in June, liming produced no stimulatory

effect, but rather there was a tendency towards a reduction in

cell numbers with increasing lime dose (Fig. 1c). The

numbers of AOB decreased with increasing soil depth in all

plots. In September, there was no clear effect of liming on

the numbers of AOB (Fig. 1d). As in June, the numbers of

p ammonia-oxidising bacteria and the pUC18 plasmid

Sequence

position

Target Reference

189–207a AOB Kowalchuk et al. (1997)

189–207a AOB Kowalchuk et al. (1997)

283–304a AOB Hermansson and Lindgren

(2001)

597–622b pUC18 Hermansson and Lindgren

(2001)

668–683b pUC18 Hermansson and Lindgren

(2001)

226–253a AOB Hermansson and Lindgren

(2001)

TG- 639–666b pUC18 Hermansson and Lindgren

(2001)

6G, 6-carboxyrhodamine 6G.

Fig. 1. Average numbers (log) of AOB, determined by real-time PCR, found in soils from 244 Aled and Oxafallan at the three sampling depths 0–5, 5–10, and

20–25 cm. Control plots (white); Plots with 3 t lime haK1 (grey); Plots with 6 t lime haK1 (dots). Panel a, 244 Aled April; b, 244 Aled September; c, Oxafallan

June; and d, Oxafallan September. The bars correspond to the 95% confidence limit.

A. Hermansson et al. / Soil Biology & Biochemistry 36 (2004) 1935–1941 1939

AOB showed a slight decrease with increasing soil depth in

all plots. The numbers of AOB increased between June and

September at all soil depths after liming at both application

doses (Fig. 1c and d). In the C plots no such effect was

detected.

In summary, our results demonstrated that there was no

obvious effect of liming on the AOB cell density, except at

244 Aled in April. These data were supported by our

findings that there was no correlation between the number of

AOB and pH when considering all the results.

4. Discussion

The aim of the present study was to investigate the effect

of liming on the community sizes of AOB. The cell density

was determined using real-time PCR. Two acidic coniferous

forest soils, treated six years earlier with 3 t lime haK1 and

6 t lime haK1, were examined. In addition, we wished to

apply the real-time PCR technique to an environment not

previously investigated using this method. Bacteria were

quantified using primers/probe earlier shown to be specific

for AOB. Except in one case, no clear effect of liming was

detected either at 244 Aled or Oxafallan. The only effect of

liming was recorded in the April sampling at 244 Aled,

where there appeared to have been some promotion of cell

growth. In all plots, at both sampling times and at both sites,

there was a tendency towards a decrease in AOB cell

numbers with increasing depth.

Compared to other studies of forest soils, where AOB

have been quantified using the MPN-technique (De Boer

et al., 1992; Paavolainen and Smolander, 1998; Carnol and

Ineson, 1999; Klemedtsson et al., 1999; Priha and

Smolander, 1999; Hastings et al., 2000), the numbers of

AOB found in our study were several (1–6) orders of

magnitude higher. There are several possible explanations

for this discrepancy. The difference may be due to the

tendency of ammonia-oxidisers to occur in micro-colonies

(Belser and Mays, 1980; Berg and Rosswall, 1985; Hesselsø

and Sørensen, 1999). These can be counted as single

bacteria by MPN if they are not efficiently dispersed, so the

MPN-technique generally underestimates AOB numbers.

AOB differ widely in their ability to grow in MPN tests

(some even appear to be impossible to cultivate in liquid

A. Hermansson et al. / Soil Biology & Biochemistry 36 (2004) 1935–19411940

medium (Belser and Schmidt, 1978), which further

exacerbates underestimation in MPN-counts. Another

explanation is that the PCR quantification is based on the

total amount of DNA extracted from the sample. In contrast

to the MPN-technique, this detects bacteria regardless of

their physiological state (i.e. both active and non-active

bacteria will be counted).

Our results from the April sampling at 244 Aled in the

plot limed with 6 t haK1 showed that liming stimulated the

growth of AOB in the mineral soil of a spruce forest, which

is in agreement with an earlier study by Klemedtsson et al.

(1999). Furthermore, our observations that liming has a

stimulating effect on the growth of AOB at 244 Aled but not

at Oxafallan, are partly supported by Backman and Kasimir

Klemedtsson (2003), who reported that liming had an effect

on the potential nitrification at 244 Aled, but not at

Oxafallan (Table 1). This was explained by the higher

availability of ammonia at 244 Aled than at Oxafallan.

However, the results obtained by Backman and Kasimir

Klemedtsson (2003) showed that liming at 244 Aled

resulted in a much higher potential nitrification than in

any plot at Oxafallan (Table 1). These data are not reflected

in this study, which shows similar AOB community sizes of

AOB at 244 Aled and Oxafallan.

One explanation may be that not all AOB cells are

activated in the potential nitrification assay. If we assume

that the potential nitrifying activity per cell and hour is

constant and that all active cells contribute equally to the

nitrification in the potential measurement, it is possible to

calculate the fraction of active cells in the AOB

community. Based on the data by Schmidt (1982) for

members of the genus Nitrosospira, which is assumed to

be the dominant AOB in forest soil, that one cell has an

oxidation potential per hour of 0.056 pg NH4C–N, the

active fraction of the community should be in the range

from zero to two percent. Rudebeck and Persson (1998)

and Degrange et al. (1998) also discussed the possible

occurrence of inactive nitrifier communities in acidic

forest soils, lacking or very low in nitrifying activity. In

both studies, they were able to activate the nitrifying

community by favourable incubation conditions (e. g.

addition of ammonia-containing substrates). However,

Backman and Kasimir Klemedtsson (2003) also incubated

the target soils under favourable conditions but were still

not able to measure any nitrifying activity after short-term

incubation of the soil from Oxafallan, indicating the

absence of an AOB community or a community of a very

low density. This observation makes it difficult to argue

that the high AOB cell numbers detected in the present

study being the result of an inactive AOB community.

Although the real-time PCR quantification is based on

extracted DNA from both active and non-active cells and

the nitrifying potential provides a measure of the active

and activated part of the AOB community, it appears

unlikely that there really is no relationship between

potential nitrification and AOB community size.

Another explanation is that the set of primers/probe

applied are not sufficiently specific for quantifying the AOB

in acidic forest soils. Backman et al. (2003) have investigated

the AOB populations at 244 Aled using a molecular approach

based on 16S rDNA with AOB-specific CTO-primers

(Kowalchuk et al., 1997) for PCR followed by DGGE and

nucleotide sequencing. As well as sequences clustering

together with previously known AOB, they observed

the presence of other sequences mainly belonging to

b-Proteobacteria (Backman et al., 2003). These latter

sequences, not, at that time, present in the sequence

databases, were primarily detected in the control soil and in

the 5–10 cm soil layer in the soil limed with 3 t haK1.

Moreover, in the control plots, where no potential nitrifica-

tion was measured (Table 1), no sequences clustering

together with known AOB sequences were detected. When

aligning the real-time reverse primer and probe, used in this

real-time PCR assay, to the AOB-like sequences detected in

Backman et al. (2003) there are no mismatches. However, for

the non-AOB-like sequences there are in many cases not

more than 1–2 mismatches. This indicates that these

sequences might have been counted in the real-time PCR

assay. These observations indicate the possibility that

previously unknown sequences were included in the present

count. Only a few investigations of microbial diversity, based

on nucleotide sequences, in acid forest soils have, hitherto,

been carried out and the number of bacterial sequences

available from this environment is still very limited.

The high AOB cell numbers observed in the present

study, compared to corresponding studies from similar forest

soils, together with the lack of correlation between

community size and the potential nitrification activity as

well as calculations based on potential specific activities per

cell, indicate the presence of a largely inactive AOB

community. Taken together this strongly suggests that the

real-time PCR primers/probe are insufficient specific when

using them in this environment. This shows that it is

extremely important to re-evaluate the primers and probe set

developed for application in a certain habitat, when used in a

new environment. Consideration should be given to the

specificity and sensitivity, both empirically and using

bioinformatic tools. Since, in most environments, only a

small fraction of the total microbial community is known,

the risk of bias due to insufficient specificity or sensitivity

must be taken into account.

Acknowledgements

The authors would like to thank Asa Kasimir Klemedts-

son, Department of Informatics and Mathematics, Univer-

sity of Trollhattan/Uddevalla, Trollhattan, Sweden, for

valuable discussions and comments on the manuscript.

This work was supported by grants from the Swedish

Council for Forestry and Agricultural Research and

Stiftelsen Oscar och Lily Lamms Minne.

A. Hermansson et al. / Soil Biology & Biochemistry 36 (2004) 1935–1941 1941

References

Belser, L.W., Schmidt, E.L., 1978. Diversity in the ammonia-oxidizing

nitrifier population of a soil. Applied and Environmental Microbiology

36, 584–588.

Belser, L.W., Mays, E.L., 1980. Specific inhibition of nitrite oxidation by

chlorate and its use in assessing nitrification in soils and sediments.

Applied and Environmental Microbiology 39, 505–510.

Berg, P., Rosswall, T., 1985. Ammonium oxidizer numbers, potential and

actual oxidation rates in two Swedish arable soils. Biology and Fertility

of Soils 1, 131–140.

Brosius, J., Dull, T.J., Sleeter, D.D., Noller, H.F., 1981. Gene organization

and primary structure of a ribosomal RNA operon from Escherichia

coli. Journal of Molecular Biology 148, 107–127.

Bruns, M.A., Stephen, J.R., Kowalchuck, G.A., Prosser, J.I., Paul, E.A.,

1999. Comparative diversity of ammonia oxidizer, 16S rRNA gene

sequences in native, tilled, and successional soils. Applied and

Environmental Microbiology 65, 2994–3000.

Backman, J.S.K., Kasimir Klemedtsson, A., 2003. Increased nitrification in

acid coniferous forest soil due to high nitrogen deposition and liming.

Scandinavian Journal of Forest Research 18, 514–524.

Backman, J.S.K., Hermansson, A., Tebbe, C.C., Lindgren, P.-E., 2003.

Liming induces growth of ammonia-oxidising bacteria in acid spruce

forest soil as determined by SSCP and DGGE. Soil Biology &

Biochemistry 35, 1337–1347.

Carnol, M., Ineson, P., 1999. Environmental factors controlling NO3K

leaching, N2O emissions and numbers of NH4Coxidisers in a coniferous

forest soil. Soil Biology & Biochemistry 31, 979–990.

De Boer, W., Tietema, A., Klein Gunnewiek, P.J.A., Laanbroek, H.J., 1992.

The chemolithotrophic ammonium-oxidizing community in a nitrogen-

saturated acid forest soil in relation to pH-dependent nitrifying activity.

Soil Biology & Biochemistry 24, 229–234.

De Boer, W., Hundscheid, M.P.J., Schotman, J.M.T., Troelstra, S.R.,

Laanbroek, H.J., 1993. In situ net N transformations in pine, fir, and oak

stands of different ages on acid sandy soil, 3 years after liming. Biology

and Fertility of Soils 15, 120–126.

De Boer, W., Klein, P.A., Laanbroek, H.J., 1995. Ammonium-oxidation at

low pH by a chemolithotrophic bacterium belonging to the genus

Nitrosospira. Soil Biology & Biochemistry 27, 127–132.

Degrange, V., Couteaux, M.M., Anderson, J.M., Berg, M.P., Lensi, R.,

1998. Nitrification and occurrence of Nitrobacter by MPN-PCR in low

and high nitrifying coniferous forest soils. Plant and Soil 198, 201–208.

Gundersen, P., 1995. Nitrogen deposition and leaching in European forests:

Preliminary results from a data compilation. Water, Air and Soil

Pollution 85, 1179–1184.

Harms, G., Layton, A.C., Dionisi, H.M., Gregory, I.R., Garrett, V.M.,

Hawkins, S.A., Robinson, K.G., Sayler, G.S., 2003. Real-time PCR

quantification of nitrifying bacteria in a municipal wastewater treatment

plant. Environmental Science and Technology 37, 343–351.

Hastings, R.C., Butler, C., Singleton, I., Saunders, J.R., McCarthy, A.J.,

2000. Analysis of ammonia-oxidizing bacteria populations in acid soil

during conditions of moisture limitation. Letters in Applied Micro-

biology 30, 14–18.

Heid, C.A., Stevens, J., Livak, K.J., Williams, P.M., 1996. Real time

quantitative PCR. Genome Research 6, 986–994.

Hermansson, A., Lindgren, P.-E., 2001. Quantification of ammonia-

oxidizing bacteria in arable soil by real-time PCR. Applied and

Environmental Microbiology 67, 972–976.

Hesselsø, M., Sørensen, J., 1999. Microcolony formation as a viability

index for ammonia-oxidizing bacteria: Nitrosomonas europaea and

Nitrosospira sp. FEMS Microbiology Ecology 28, 383–391.

Klemedtsson, L., Jiang, Q., Klemedtsson, A.K., Bakken, L., 1999.

Autotrophic ammonium-oxidising bacteria in Swedish mor humus.

Soil Biology & Biochemistry 31, 839–847.

Kowalchuk, G.A., Stephen, J.R., De Boer, W., Prosser, J.I., Embley, T.M.,

Woldendorp, J.W., 1997. Analysis of ammonia-oxidizing bacteria of

the b subdivision of the class Proteobacteria in coastal sand dunes by

denaturing gradient gel electrophoresis and sequencing of PCR-

amplified 16S ribosomal DNA fragments. Applied and Environmental

Microbiology 63, 1489–1497.

Kowalchuk, G.A., Stienstra, A.W., Heilig, G.H.J., Stephen, J.R.,

Woldendorp, J.W., 2000. Molecular analysis of ammonia-oxidising

bacteria in soil of successional grasslands of the Drentsche A (The

Netherlands). FEMS Microbiology Ecology 31, 207–215.

Martikainen, P.J., Lehtonen, M., Lang, K., De Boer, W., Ferm, A., 1993.

Nitrification and nitrous oxide production potentials in aerobic

soil samples from the soil profile of a Finnish coniferous site

receiving high ammonium deposition. FEMS Microbiology Ecology

13, 113–122.

Norrander, J., Kempe, T., Messing, J., 1983. Construction of improved M13

vectors using oligodeoxynucleotide-directed mutagenesis. Gene 26,

101–106.

Paavolainen, L., Smolander, A., 1998. Nitrification and denitrification in

soil from a clear-cut Norway spruce (Picea abies) stand. Soil Biology &

Biochemistry 30, 775–781.

Pennington, P.I., Ellis, R.C., 1993. Autotrophic and heterotrophic

nitrification in acidic forest and native grassland soils. Soil Biology &

Biochemistry 25, 1399–1408.

Persson, T., Wiren, A., 1995. Nitrogen mineralization and potential

nitrification at different depths in acid forest soils. Plant and Soil

168/169, 55–65.

Persson, T., Rudebeck, A., Wiren, A., 1995. Pools and fluxes of carbon and

nitrogen in 40-year-old forest liming experiments in southern Sweden.

Water, Air and Soil Pollution 85, 901–905.

Phillips, C.J., Paul, E.A., Prosser, J.I., 2000. Quantitative analysis of

ammonia oxidising bacteria using competitive PCR. FEMS Micro-

biology Ecology 32, 167–175.

Priha, O., Smolander, A., 1999. Nitrogen transformations in soil under

Pinus sylvestris, Picea abies and Betula pendula at two forest sites. Soil

Biology & Biochemistry 29, 965–977.

Rudebeck, A., Persson, T., 1998. Nitrification in organic and mineral soil

layers in coniferous forests in response to acidity. Environmental

Pollution 102, 377–383.

Sanden, B., Grunditz, C., Hansson, Y., Dalhammar, G., 1994. Quantifi-

cation and characterisation of Nitrosomonas and Nitrobacter using

monoclonal antibodies. Water Science and Technology 29, 1–6.

Schmidt, E.L., 1982. Nitrification in soil. Nitrogen in Agricultural Soils.

Agronomy Monograph 22, 253–285.

Schramm, A., Beer, D.d., Heuvel, J.C.v.d., Ottengraf, S., Amann, R., 1999.

Microscale distribution of populations and activities of Nitrosospira

and Nitrospira spp. along a macroscale gradient in a nitrifying

bioreactor: Quantification by in situ hybridization and the use of

microsensors. Applied and Environmental Microbiology 65, 3690–

3696.

Simmons, J.A., Yavitt, J.B., Fahey, T.J., 1996. Watershed liming effects on

the forest floor N cycle. Biogeochemistry 32, 221–244.

Sitaula, B.K., Bakken, L.R., 1993. Nitrous oxide release from spruce

forest soil: relationships with nitrification, methane uptake, tempera-

ture, moisture and fertilization. Soil Biology & Biochemistry 25,

1415–1421.

Tamm, C.O., 1991. Nitrogen in terrestrial ecosystems: questions of

productivity, vegetational changes, and ecosystem stability. Springer

Verlag, Berlin.