prevention of oculopharyngeal muscular dystrophy by muscular expression of llama single-chain...

Prevention of oculopharyngeal muscular dystrophyby muscular expression of Llama single-chainintrabodies in vivo

Aymeric Chartier1, Vered Raz2, Ellen Sterrenburg2, C. Theo Verrips3, Silvere M. van der Maarel2

and Martine Simonelig1,�

1mRNA Regulation and Development, Institut de Genetique Humaine, CNRS UPR 1142, 141 rue de la Cardonille

34396, Montpellier Cedex 5, France, 2Leiden University Medical Center, Center for Human and Clinical Genetics,

Leiden, The Netherlands and 3Cellular Achitecture and Dynamics, Biology Department, University of Utrecht,

Padualaan 8 3584, CH Utrecht, The Netherlands

Received January 5, 2009; Revised and Accepted February 27, 2009

Oculopharyngeal muscular dystrophy (OPMD) is a late onset disorder characterized by progressive weaken-ing of specific muscles. It is caused by short expansions of the N-terminal polyalanine tract in the poly(A)binding protein nuclear 1 (PABPN1), and it belongs to the group of protein aggregation diseases, such asHuntington’s, Parkinson’s and Alzheimer diseases. Mutant PABPN1 forms nuclear aggregates in diseasedmuscles in both patients and animal models. Intrabodies are antibodies that are modified to be expressedintracellularly and target specific antigens in subcellular locations. They are commonly generated by artifi-cially linking the variable domains of antibody heavy and light chains. However, natural single-chain anti-bodies are produced in Camelids and, when engineered, combined the advantages of being single-chain,small sized and very stable. Here, we determine the in vivo efficiency of Llama intrabodies againstPABPN1, using the established Drosophila model of OPMD. Among six anti-PABPN1 intrabodies expressedin muscle nuclei, we identify one as a strong suppressor of OPMD muscle degeneration in Drosophila, lead-ing to nearly complete rescue. Expression of this intrabody affects PABPN1 aggregation and restores musclegene expression. This approach promotes the identification of intrabodies with high therapeutic value andhighlights the potential of natural single-chain intrabodies in treating protein aggregation diseases.

INTRODUCTION

Intrabodies have high therapeutic potential and have beendesigned for a variety of diseases including protein aggrega-tion diseases such as Huntington’s, Parkinson’s and Alzhei-mer diseases (1). Intrabodies (or intracellular antibodies)are antibodies that have been designed to be expressed intra-cellularly. The most common approach to produce an intra-body is to generate a single-chain antibody (scFv) byjoining the antigen-binding variable domains of heavy andlight chain with an interchain linker. However, cytoplasmicexpression of such intrabodies can result in low solubilityand stability, and therefore poor efficiency, leading to therequirement of an improvement step in the generation of anefficient intrabody (2,3). Intracellular expression of scFv

intrabodies was found to be beneficial in cell or animalmodels of cancer, human immunodeficiency virus infectionand neuropathology, highlighting the interest of intrabodiesas therapeutic tools (1). A single-chain scFv intrabodyagainst huntingtin was shown to reduce protein aggregationin a cell model of Huntington’s disease (4). This intrabodyis also active in increasing survival to adulthood and adultlifespan in a Drosophila model of the disease, although therescue is not complete (5,6).

In addition to conventional antibodies, the Camelidaepossess a repertoire of antibodies that is devoid of lightchains, the heavy-chain antibodies. These antibodies arethus naturally single-chain. Their variable domain (VHH)is small sized and retains the capacity to bind antigenswith high affinity, when isolated from the rest of the

�To whom correspondence should be addressed. Tel: þ33 499619959; Fax: þ33 499619957; Email: [email protected]

# The Author 2009. Published by Oxford University Press. All rights reserved.For Permissions, please email: [email protected]

Human Molecular Genetics, 2009, Vol. 18, No. 10 1849–1859doi:10.1093/hmg/ddp101Advance Access published on March 3, 2009

at State University of N

ew Y

ork at Buffalo on O

ctober 9, 2014http://hm

g.oxfordjournals.org/D

ownloaded from

http://hmg.oxfordjournals.org/

antibody. Therefore, these single-domain VHH fragmentsare particularly suited for phage display screening andproduce high affinity, highly specific monoclonal anti-bodies (7). Utilization of Camelidae natural single-chainantibodies to produce intrabodies has the important advan-tage of avoiding the difficult step of linking domains ofheavy and light chains. In addition, this type of intrabodieshas proven to be very stable and efficient (7). Llama single-domain intrabodies have been used to modulate proteinactivity in cultured cells and in plants (8,9). However,such intrabodies have not yet been used in vivo as thera-peutic tools.

We study oculopharyngeal muscular dystrophy (OPMD)as a paradigm for protein aggregation disorders to evaluatethe therapeutic potential of Llama intrabodies in vivo.OPMD is a dominant late onset disorder characterized byprogressive weakening of muscles that hold eyelids, thoseinvolved in swallowing and proximal limb muscles(10,11). OPMD is caused by short expansions of the N-terminal polyalanine tract in the poly(A) binding proteinnuclear 1 (PABPN1) (12). PABPN1 has an essential cellularfunction in nuclear poly(A) tail synthesis and poly(A) taillength control (13–15). Because mutant-PABPN1 nuclearaggregates is a hallmark of the disease, OPMD is classifiedas a protein aggregation disorder, along with neurodegen-erative diseases including Huntington’s, Parkinson’s, Alz-heimer diseases and prion-based dementia (11,16,17). Themolecular mechanisms leading to OPMD are stillunknown, although a role of mRNA metabolism hasbeen proposed, and recent data have implicated apoptosis(18–20).

Several lines of evidence also point to a role of PABPN1misfolding and/or aggregation in OPMD pathogenesis.PABPN1 nuclear aggregates form in cell and animal modelsof OPMD (20–25), and reducing PABPN1 aggregation incell models with drugs or chaperone expression improvescell survival (21–23,26). In addition, the reduction ofPABPN1 aggregate formation in a mouse model of OPMD,using doxycycline or trehalose treatments, correlates withreduced muscle weakness (24,27).

We have set up a Drosophila model of OPMD that recapi-tulates the characteristics of the disease, in particular, muscledegeneration and the formation of fibrilar aggregates in musclenuclei (20). Here, we analyze the efficiency of Llama anti-PABPN1 intrabodies in vivo, using this OPMD Drosophilamodel. Monoclonal Llama antibodies against PABPN1 havebeen isolated by screening a phage display library of VHH

single-domain fragments for their interaction with PABPN1(28). Six antibodies have been recovered and one of them isefficient in preventing the PABPN1 aggregation in a cellmodel of OPMD, when expressed intracellularly as an intra-body (28). We have expressed the six different anti-PABPN1intrabodies in Drosophila muscle nuclei. Among them, onehas a strong suppressor activity on OPMD muscle degener-ation. Expression of this intrabody decreases the PABPN1aggregation load and restores muscle gene expression. Wehave thus identified an intrabody showing very high efficiencyin vivo. These results demonstrate the potential of naturalsingle-chain intrabodies in treating protein aggregation dis-eases.

RESULTS

Identification of intrabodies with a beneficial effectfor OPMD in vivo

Six intrabodies against PABPN1 have previously beenselected (28). Of these, the 3F5 intrabody was mapped pre-cisely in the coiled-coil domain of PABPN1, two others(3A9 and 3E9) were mapped in the 155 N-terminal-most resi-dues, and the last three (#08, #18 and #29) were selected byepitope masking using 3F5 (Fig. 1A) (patent WO 2007/035092 A2). Expression of Llama anti-PABPN1 antibodiesin Drosophila muscle nuclei was achieved by cloning theircoding sequence downstream of UAS and in frame with anuclear localization signal (NLS) (Fig. 1B). Expressioninduced with the muscle specific driver Mhc-Gal4 (29) ledto the production in Drosophila adult thoracic muscles ofsmall proteins of 18–20 kDa, targeted to nuclei (Fig. 1C andD). Expression of alanine expanded PABPN1(PABPN1-17ala) in Drosophila muscles with Mhc-Gal4results in flies suffering from muscular dystrophy that causesinability of a normal wing posture (20). Such phenotypes areprogressive and correlate with muscle degeneration. Thecapacity of the six PABPN1 intrabodies to reduce OPMD phe-notypes in vivo was assayed using the coexpression ofPABPN1-17ala with each of the intrabodies in muscles withMhc-Gal4. In the absence of intrabody, expression ofPABPN1-17ala in muscles led to 87% of adults showing anabnormal wing position (at 188C, day 6) (Fig. 1E). Severaltransgenic lines expressing the same intrabody were analyzed.For a specific intrabody, the ability of the different lines todecrease OPMD phenotypes fell into the same range (e.g.60% of flies with abnormal wing posture for the more efficientline expressing intrabody #29, versus 68% for the less efficientline, at day 6, Fig. 1E). On the basis of these results, we classi-fied the six intrabodies from their suppressor activity. Thecapacity to reduce OPMD phenotypes was different for eachof them. Three intrabodies, #08, #18 and #29, had a veryweak or null effect on suppressing abnormal wing position(Fig. 1E). Intrabodies 3E9 and 3A9 showed an intermediateeffect with the former reducing the percentage of individualswith abnormal wing position down to 31%. Expression ofintrabody 3F5 decreased the percentage of flies showing wing-position defects to as little as 3%, thus proving to have a strongsuppressor effect (Fig. 1E). The difference in suppressoractivities of the six intrabodies could result either from theirintrinsic efficiency or from their expression level and stabilityin muscles. We, therefore, quantified the amounts of the differ-ent intrabodies by western blots (Fig. 1C). The suppressionefficiency of the six intrabodies did not correlate with theiramounts in thoracic muscles (Fig. 1C and E), demonstratinga specific intrinsic efficiency for each intrabody.

The molecular basis to explain the difference in the suppres-sion efficiencies of the six intrabodies remains unknown.However, a possible explanation for the high suppressoractivity of the 3F5 intrabody could lie in that, among the sixintrabodies, it has the highest affinity for PABPN1 (28).

As intrabody 3F5 showed the strongest suppressor effect,we analyzed its expression level in three independent trans-genic lines. The ability to reduce the percentage of individualswith affected wing position depended on this level of

1850 Human Molecular Genetics, 2009, Vol. 18, No. 10


ew Y

ork at Buffalo on O



ownloaded from


expression, indicating that the suppressor effect of this specificintrabody is dose-dependent (Fig. 2A and B).

We verified that the suppressor effect of the 3F5 intrabodyresulted from the specific binding to its epitope withinPABPN1. We took advantage of our previous analysis ofdomains involved in OPMD phenotypes (20), in which weshowed that the coiled-coil domain in PABPN1 (residues116–147) is not required; PABPN1-17ala deleted for thisdomain (PABPN1-17ala-DCLD) still induced wing-positiondefects, as well as muscle degeneration and formation ofnuclear inclusions. PABPN1-17ala-DCLD lacks the epitopefor 3F5 (Fig. 2C) and we used the 3F5 antibody in westernblots to confirm it recognizes PABPN1-17ala, but notPABPN1-17ala-DCLD (Fig. 2C). Accordingly, coexpressionof the 3F5 intrabody with PABPN1-17ala-DCLD in muscles

did not lead to a decrease in the number of adults with wing-position defects (Fig. 2D). This demonstrates that the suppres-sor effect of the 3F5 intrabody results from interaction with itsepitope in PABPN1.

We next addressed whether the 3F5 intrabody acted inaffecting the accumulation of PABPN1-17ala, using westernblots to quantify the protein amounts, with or without 3F5coexpression in muscles (Fig. 2E). The accumulation ofPABPN1-17ala was slightly decreased, when the 3F5 intra-body was coexpressed using the transgenic line UAS-3F5(1)that shows the highest suppressor activity. However, thisdecrease was not observed with the line UAS-3F5(2), althoughthis line has a substantial suppressor activity (Fig. 2A and E).This suggests that PABPN1 destabilization is not the majormechanism of action of the 3F5 or, at least, that additional

Figure 1. Suppression of OPMD phenotypes in Drosophila by intramuscular expression of anti-PABPN1 single-chain antibodies. (A) Schematic representationof PABPN1 and mapping of the PABPN1 regions or epitope recognized by the antibodies. A: tract of ten alanines, CLD: coiled-coil domain, RRM: RNA bindingdomain, R rich: arginine rich domain. The lines indicate the maximal regions where the antibodies can bind. The 3F5 epitope (VREMEE) was determined pre-cisely (28). (B) Schematic representation of the constructs generated to express the single-chain antibodies in Drosophila muscles. (C) Western blots of thoraxesshowing expression of the six intrabodies. Protein extracts were from 0.25 thoraxes of UAS–intrabody/þ; Mhc-Gal4/þ adult. Intrabody expression was detectedusing anti-myc antibody. Anti-a-Tubulin was used as a loading control. Expression of each intrabody in the transgenic line that has the strongest suppressoreffect on wing position phenotype is shown. (D) Immunostaining of adult thoracic muscles showing the nuclear accumulation of the 3F5 intrabody. The intra-body was detected using anti-myc antibody; DNA was revealed with DAPI. (E) Suppressor activity of the six intrabodies. The capacity of the intrabodies todecrease OPMD phenotypes was determined by scoring the number of adults with abnormal wing position at day 6 and 11, at 188C. Flies expressing the intra-bodies were UAS-PABPN1-17ala, UAS–intrabody/þ; Mhc-Gal4/þ or UAS-PABPN1-17ala/þ; UAS–intrabody/Mhc-Gal4. The genotype of OPMD flies wasUAS-PABPN1-17ala/þ; Mhc-Gal4/þ. Two to five independent transgenic stocks were analyzed for each intrabody. The percentages of flies with abnormal wingposture indicated are those of the transgenic stocks showing the lowest and highest effect for a same intrabody. 150 to 200 adults were scored in each case.

Human Molecular Genetics, 2009, Vol. 18, No. 10 1851


ew Y

ork at Buffalo on O



ownloaded from


mechanisms are involved in its suppressor activity. Consistentwith this, prevention of aggregate formation by the 3F5 intra-body in the cell model of OPMD does not correlate withreduced accumulation of PABPN1-17ala (28).

Together, these results identify the 3F5 intrabody as a strongsuppressor of OPMD phenotypes in the Drosophila model; itseffect is dose-dependent and is achieved through its interactionwith an epitope in the coiled-coil domain of PABPN1.

Figure 2. Suppression of OPMD phenotypes with the 3F5 intrabody requires direct binding of the intrabody to PABPN1-17ala. (A) Quantitative analysis of thesuppressor effect of the 3F5 intrabody for three independent transgenic stocks, at day 6 and 11, at 188C. Percentages of individuals with wing-position defectswere calculated based on 150 to 250 individuals from two independent crosses. The genotypes are indicated. (B) Western blots showing the expression level ofthe 3F5 intrabody in UAS-3F5/þ; Mhc-Gal4/þ adult thoraxes, for the three transgenic stocks shown in (A). Protein extracts were from 0.25 thoraxes. The 3F5intrabody was detected using anti-myc. Anti-a-tubulin was used as a loading control. The strength of the effect correlates with the amount of intrabody. The lineUAS-3F5(1) was then used throughout. We checked that the expression of UAS-3F5(1) alone with Mhc-Gal4 does not induce wing-position defects. (C) Top:schematic representation of PABPN1-17ala and PABPN1-17ala-DCLD showing that the 3F5 epitope (VREMEE) is lacking in PABPN1-17ala-DCLD. Bottom:western blots of adult thoraxes showing that PABPN1-17ala-DCLD is not recognized by the 3F5 antibody. Protein extracts were from 0.5 thoraxes of the indi-cated genotypes. The blot was first revealed with the purified 3F5-VSV/His6 antibody. 3F5-VSV/His6 was detected using anti-VSV. The blot was then dehy-bridized and revealed with anti-PABPN1. Anti-a-tubulin was used as a loading control. (D) Quantitative analysis showing that expression of the 3F5intrabody does not prevent wing-position defects resulting from the expression of PABPN1-17ala-DCLD. The genotypes are indicated. The percentageswere calculated from 150 individuals scored at day 6, at 188C. (E) Western blot of adult thoraxes showing the amounts of PABPN1-17ala with or without coex-pression of the 3F5 intrabody. Protein extracts were from 0.25 thoraxes of the indicated genotypes. The blot was revealed with anti-PABPN1. Anti-a-tubulin wasused as a loading control.



ew Y

ork at Buffalo on O



ownloaded from


Suppressor activity of the 3F5 intrabody requiresits nuclear localization

Although PABPN1 has a nuclear role in mRNA polyadenyla-tion (13,14), we have more recently, however, described acytoplasmic function of the PABPN1 homologue in Droso-phila during early development (15). The proposal thatrimmed vacuoles in OPMD patients represent a degradationpathway of toxic cytoplasmic PABPN1 (30,31) led us tosuggest that an increased amount of cytoplasmic PABPN1could contribute to OPMD (20). To further test this hypoth-esis, we expressed the 3F5 intrabody with Mhc-Gal4, in theabsence of an NLS (3F5-DNLS), and analyzed the suppressorcapacity of this new transgene. When coexpressed withPABPN1-17ala, 3F5-DNLS showed a weak to intermediatesuppressor effect (Fig. 3A), even if its expression level washigher than that of the 3F5 intrabody containing an NLS(Fig. 3B). The transgenic line that had the highest suppressioncapacity showed some nuclear accumulation of the intrabodyin addition to cytoplasmic expression (Fig. 3C), suggestingthat the suppressor activity of the 3F5 depended on itsnuclear localization. These results indicate that the beneficialeffect of the 3F5 intrabody is increased by its nucleartargeting.

Expression of the 3F5 intrabody prevents muscledegeneration and reduces PABPN1-17alanuclear aggregation

Wing-position defects in the Drosophila model of OPMD cor-relate with progressive muscle degeneration, as visualized bypolarized light or electron microscopy on indirect flightmuscles (dorso-longitudinal muscles: DLM or dorso-ventralmuscles: DVM) in adult thoraxes (20). Expression of

PABPN1-17ala with Mhc-Gal4 led to defects in all indirectflight muscles (DLM and DVM), which appeared thin orwere lacking at day 16 (Fig. 4C and E). Coexpression of the3F5 intrabody with PABPN1-17ala prevented muscle degener-ation (Fig. 4D and E). Following expression ofPABPN1-17ala, myofibril sarcomeric structure visualized byelectron microscopy was strongly disorganized, with brokenZ-bands and the absence of M-bands (Fig. 4F). Coexpressionof the 3F5 intrabody restored a normal ultrastructural appear-ance of muscle fibers (Fig. 4G).

Muscular expression of PABPN1-17ala in Drosophilainduces the formation of dense PABPN1 nuclear inclusions,composed of filaments, similar to those in OPMD patients(20). Nuclei containing an inclusion were quantified in thor-acic muscles expressing PABPN1-17ala and found to rep-resent 10 and 16% of all nuclei at day 6 and 11,respectively (Fig. 5A). Concomitant expression of the 3F5intrabody did not reduce the number of nuclei containinginclusions (Fig. 5A). However, strikingly, coexpression ofthe intrabody had two effects on nuclear inclusions: (i) theirsize was significantly reduced by a factor of up to 2.5(Fig. 5B, D and E) and (ii) nuclear inclusions appeared as dis-persed small inclusions for 32% of nuclear inclusions (n ¼ 68)(Fig. 5B). When 3F5 was coexpressed, the reduction in size ofPABPN1 nuclear inclusions was maintained during the life-span and was even more marked at day 11 (Fig. 5D). We ver-ified that the 3F5 intrabody was present in the nuclearinclusion (Fig. 5C).

Expression of the 3F5 intrabody restores musclegene expression

We next analyzed the suppressor activity of the 3F5 intrabodyat the level of gene expression using transcriptome analysis.

Figure 3. The suppressor activity of the 3F5 intrabody requires its nuclear accumulation. (A) Quantitative analysis showing that expression of the 3F5 intrabodywithout an NLS has a weak suppressor activity on the wing-position defects which result from expression of PABPN1-17ala. Results from two independenttransgenic lines are shown. The genotypes are indicated. The percentages were calculated from 150 individuals per genotype, scored at day 6 and 11, at188C. (B) Western blots showing that the 3F5-DNLS intrabody accumulated at higher levels than the 3F5 intrabody with an NLS (line 1) which reduces thewing-position defects to 3% (Fig. 2A). Legend as in Figure 2B. (C) Immunostaining of adult thoracic muscles showing that the 3F5-DNLS intrabody in line2 that shows the strongest suppressor effect is present both in the cytoplasm and in nuclei. The presence of the intrabody in nuclei in the absence of anNLS could result from passive diffusion due its small size.



ew Y

ork at Buffalo on O



ownloaded from


Using microarrays, thorax gene expression was comparedbetween control flies (Mhc-Gal4/þ), flies expressingPABPN1-17ala, and flies coexpressing PABPN1-17ala and3F5, at three time points (day 2, 6 and 11). Two-wayANOVA with genotype and time as the first and second vari-ables, respectively, followed by K-means clustering, revealed795 deregulated genes after expression of PABPN1-17ala

(including all time points). Among these genes, 464 (58.4%)showed a partial or total expression rescue when 3F5 wascoexpressed with PABPN1-17ala (Fig. 6, SupplementaryMaterial, Tables S1 and 2). The rescue was initiated at day2 and maintained at a substantial level during the lifespan(Fig. 6A and C, Supplementary Material, Fig. S1). For alarge proportion of genes, expression was restored at two

Figure 4. Expression of the 3F5 intrabody prevents OPMD muscle degeneration in Drosophila. (A–D) Indirect flight muscles (IFMs) visualized with polar-ized light. Left panel: dorso-longitudinal muscles (DLMs); right panel: dorso-ventral muscles (DVMs). (A and B) Controls showing normal muscle mor-phology. (A) Mhc-Gal4 /þ, (B) UAS-3F5/þ; Mhc-Gal4/þ. (C) IFMs from UAS-PABPN1-17ala/þ; Mhc-Gal4/þ individuals are strongly affected.Arrows indicate regions where muscles are very thin or lacking. (D) IFMs from UAS-PABPN1-17ala, UAS-3F5/þ; Mhc-Gal4/þ appear normal. IFMs atday 16, at 188C are shown. (E) Quantification of affected muscles in UAS-PABPN1-17ala/þ; Mhc-Gal4/þ and in UAS-PABPN1-17ala, UAS-3F5/þ;Mhc-Gal4/þ individuals at day 16, at 188C. All (6) DLMs and all (7) DVMs were scored per hemi-thorax. The percentages were calculated based on150 to 200 DLMs and on 150 to 200 DVMs. The genotypes are indicated. Nearly, all IFMs were affected following expression of PABPN1-17ala. In con-trast, muscle defects when the 3F5 intrabody was coexpressed with PABPN1-17ala were reduced to background levels. (F and G) Ultrastructure of IFMsvisualized by electron microscopy from UAS-PABPN1-17ala/þ; Mhc-Gal4/þ (F) and UAS-PABPN1-17ala, UAS-3F5/þ; Mhc-Gal4/þ (G) at day 11, at188C. Expression of PABPN1-17ala led to muscle degeneration characterized by the dissociation of the myosin–actin network in myofibrils and thelack of Z- and M-bands (F). Coexpression of the 3F5 intrabody prevented muscle degeneration as shown by the normal structure of myofibrils (G) (Z:Z-bands, M: M-bands).



ew Y

ork at Buffalo on O



ownloaded from


consecutive time points, and expression of 100 genes from 464(21.5%) was restored at all three time points (Fig. 6B).

These results show that the expression of the 3F5 intrabodyacts in reducing OPMD-induced gene deregulation. This effectin preventing gene deregulation is the strongest in early stages(day 2) and persists during the lifespan.

DISCUSSION

Collectively, these results provide strong support that intra-muscular expression of the 3F5 single-chain anti-PABPN1antibody prevents muscle degeneration in vivo by restoringgene expression and altering the nuclear PABPN1-17ala

Figure 5. Expression of the 3F5 intrabody reduces PABPN1-17ala nuclear aggregation. (A) Quantification of nuclear inclusions after expression ofPABPN1-17ala or coexpression of PABPN1-17ala and 3F5. Adult thoracic muscles at day 6 and 11 at 188C were stained with anti-PABPN1 and DAPI.Nuclear inclusions were identified and scored using both staining, examples are shown in (B). (B) Nuclear inclusions visualized with anti-PABPN1 staining.DNA was revealed with DAPI. In UAS-PABPN1-17ala/þ; Mhc-Gal4/þ individuals, nuclear inclusions are large (inclusion), DNA is excluded from theinclusion. An example of nucleus without an inclusion (no inclusion) is also shown for comparison. Nuclear inclusions are smaller when the 3F5 intrabodyis coexpressed, and nuclear morphology visualized using DAPI staining is less affected. Examples of a small inclusion (middle panel) and of dispersed inclusions(bottom panel) are shown. (C) Presence of 3F5 intrabody in PABPN1-17ala nuclear inclusions. Double staining of IFMs expressing PABPN1-17ala and 3F5 withanti-PABPN1 and anti-myc to reveal 3F5. The intrabody is distributed in the whole nucleus and accumulates in the inclusion. (D and E) Quantification of nuclearinclusion areas. IFMs of UAS-PABPN1-17ala/þ; Mhc-Gal4/þ and UAS-PABPN1-17ala, UAS-3F5/þ; Mhc-Gal4/þ at day 6 or 11, at 188C were stained withanti-PABPN1 and DAPI. Each nuclear inclusion was delimited in a focal plan and the surface area was calculated using ImageJ. (D) Distribution of nuclearinclusion surface areas shown as a box plot. The boxes represent 50% of the values, the horizontal lines correspond to the medians (50% of the values oneach side on the line), the vertical bars correspond to the range. Extreme values are in open circles. �� indicates that the distributions are different usingthe Student’s t-test, P-value,0.001. (E) Mean values of the surface areas shown in (D) in arbitrary units.



ew Y

ork at Buffalo on O



ownloaded from


aggregation. The intrabody acts through direct binding toPABPN1-17ala and its efficiency requires nuclear targeting.

We have identified a single-domain Llama antibody thatacts as a strong suppressor of OPMD phenotypes in Droso-phila. Demonstrating almost complete rescue, 3F5 is in factthe strongest suppressor of the wing-position defect identifiedto date. Expression and targeting of this antibody in musclenuclei as an intrabody prevent muscle degeneration associatedwith PABPN1-17ala expression in Drosophila. We have usedthe Drosophila OPMD model to identify the intrabody that hasthe highest efficiency in vivo, from six anti-PABPN1 anti-bodies. As this model recapitulates the characteristics ofOPMD, our results provide strong support to further evaluatethe potential of this intrabody in OPMD therapeuticapproaches.

A cellular hallmark of the OPMD condition is the pre-sence of mutant-PABPN1 nuclear inclusions in a numberof nuclei in muscles of patients (17,30). Nuclear inclusionsin affected Drosophila muscles are similar to inclusions inpatients both in protein composition (they containPABPN1-17ala, HSP70, ubiquitin) and at the ultrastructurallevel (they are composed of unbranched filaments of 8–10 nm outer diameter) (20). Interestingly, 3F5 expressionin muscle nuclei does not reduce the occurrence of nuclearinclusions but does reduce their size. In addition, in the pre-sence of the 3F5 intrabody, nuclear inclusions appear asseveral small dispersed aggregates. In its normal function,PABPN1 accumulates in nuclear speckles, which arenuclear subdomains enriched in mRNA processing factors(32,33). The dispersed aggregates in the presence of the3F5 could indicate that nuclear inclusions in OPMD wouldresult from several independent aggregate seedings and sub-

sequent assembly in a large inclusion per nucleus. The seed-ings could occur in nuclear speckles as these sitescorrespond to the sites of highest PABPN1 concentration.The 3F5 intrabody would delay or prevent some step inthe aggregation process, allowing the visualization of anintermediate stage in the process.

Coexpression of the 3F5 intrabody with PABPN1-17alareduces the size of nuclear inclusions and prevents muscledegeneration. This suggests that at least some step ofPABPN1 aggregate formation could contribute to OPMD.Transcriptome analysis reveals gene deregulation at day 2 inOPMD flies, prior to formation of visible nuclear inclusions.Rescue of gene expression with the intrabody also starts atday 2. As it has been proposed for several protein aggregationdiseases, including OPMD (34,35), this might suggest thatearly oligomeric forms of PABPN1 are active in the pathologyand that the intrabody interferes with these oligomers toprevent their toxicity. Consistent with the idea that oligomericintermediates may be more deleterious than mature insolublenuclear inclusions per se, the phenotypic rescue of wing pos-ition is fully efficient at day 6, whereas the reduction in size ofnuclear inclusions continues after this time.

The 3F5 intrabody is not specific to alanine-expandedPABPN1, as it recognizes an epitope present in the coiled-coildomain of the normal protein (28). Therefore, expression ofthis intrabody in human cells could potentially affect normalPABPN1 function. We find that the expression of the 3F5intrabody alone does not induce muscle degeneration. 3F5expression in mammalian cell models of OPMD does notaffect cell viability either (28). Because muscle degenerationin Drosophila can be induced by overexpression of normalPABPN1 (albeit to a lesser extent than expression of

Figure 6. The 3F5 intrabody rescues gene expression deregulated in OPMD flies. (A) Numbers of genes whose expression is deregulated after expressingUAS-PABPN1-17ala and restored by coexpressing 3F5, calculated from Supplementary Material, Tables S1, 2. (B) Venn diagram showing the overlap ofgenes whose expressions are restored at two or three time points. (C) Examples of expression profiles of representative gene clusters whose expressions arerestored by coexpressing the 3F5 intrabody.



ew Y

ork at Buffalo on O



ownloaded from


alanine-expanded PABPN1) (20), we think that a higher thannormal accumulation of PABPN1 contributes to OPMD.Expression of 3F5 intrabody in diseased tissues could thuscounterbalance detrimental amounts of PABPN1 withoutaffecting PABPN1 normal function. Dosage control will bean important point to address in the utilization of the 3F5 intra-body in therapeutic strategies.

Intrabody engineering has emerged as an attractive thera-peutic strategy for several diseases, including protein aggrega-tion and neurodegenerative diseases (1,3,5,36,37). Up to now,the beneficial effect in such diseases had been assayed for asingle intrabody using the Drosophila model. The single-chainantibody C4 scFv consists in the VH and VL variable domainsof human antibodies bridged by a linker peptide, specific to theN-terminal-most region of huntingtin (4). When expressed asan intrabody in the Drosophila model of Huntington’sdisease, C4 scFv decreases neurodegeneration in the com-pound eye and improves adult survival (5). However, suppres-sion of neuropathology is not complete and this intrabody hasbeen used in combination with other strategies to improve therescue (6).

Here, we investigate the potential of Llama intrabodies forOPMD therapy. These antibodies are naturally single-chain.This essential feature allows to avoid the difficult step oflinking the variable domains of heavy and light chains andfacilitates engineering and screening of these antibodies toproduce high affinity intrabodies. Moreover, these intrabodiesare very stable when expressed intracellularly, making themexcellent tools to be used in therapeutic strategies. An import-ant step in these strategies is to assay the functionality of intra-bodies in vivo and to identify those with the highesttherapeutic potential. Our approach combining the efficiencyof Llama intrabody technology and of the Drosophilamodel, allows the rapid production and analysis of several rel-evant intrabodies, to select intrabody reagents with the highestactivity in vivo. We show that Llama intrabodies are extremelyefficient in vivo. This provides strong support for pursuingLlama intrabody technology and delivery in therapies.

MATERIALS AND METHODS

Drosophila stocks

The w1118 stock was used as a control. The Mhc-Gal4 driverinduces expression in muscles (29). The UAS-PABPN1-17alaand UAS-PABPN1-17ala-DCLD transgenic stocks have beendescribed earlier (20). Two to five independent transgenicstocks able to express each intrabody were analyzed.

DNA constructs

The cDNAs encoding each of the six single-chain antibodieswere cloned into the pUR8101 vector, in frame with the C-terminal myc- and His6-tag (7). The pUAS–NLS vector wasproduced by cloning an EcoRI–XbaI fragment encoding thenuclear localization signal of SV40 (NLS) into the pUASTvector (38), digested with EcoRI and XbaI. The EcoRI–XbaI NLS fragment was obtained by annealing and extendingtwo partially complementary primers: 50CATGAATTCCAAAATGACTGCTCCAAAGAAGAAGCGTAAGGGC and

50CATTCTAGATTTTTCTACCGGGGCGCCCTTACGCTTCTT. In order to generate UAS–intrabody constructs, thecoding sequence of each single-chain antibody followed bythe myc/His6-tag was polymerase chain reaction (PCR) ampli-fied using the primers 50CATGCTAGCGCGGCCCAGCCGGCCATGGCC and 50CATGCTAGCAACAGTTAAGCTCTATGCGGC. This PCR fragment was digested with NheIand cloned into the pUAS–NLS vector digested withXbaI. The UAS-3F5-DNLS transgene was constructed byamplifying a PCR fragment corresponding to the 3F5 codingsequence in frame with an ATG, using primers 50CATGCTAGCCAAAATGGCGGCCCAGCCGGCCATGGCC and 50

CATGCTAGCAACAGTTAAGCTCTATGCGGC. This frag-ment was digested with NheI and cloned into the pUASTvector digested with XbaI. The sequences of all tagged single-chain antibodies were verified. Transgenic stocks were gener-ated by P-element transformation using the w1118 stock andstandard methods.

Immunostaining and western blots

Immunostaining and western blots were performed asdescribed previously (20,39). Antibody dilutions were asfollows: rabbit anti-PABPN1 (33), 1:1000 for immunostain-ing, 1:2500 for western blots; monoclonal anti-myc (9E10,Santa Cruz), 1:1000 for immunostaining, 1:5000 for westernblots; purified 3F5-VSV/His6 produced in Escherichia coli(28), 2 mg/ml. Detection of 3F5-VSV/His6 antibody was per-formed with monoclonal anti-VSV, 1:100 (Roche), prior toincubation with the secondary antibody. DNA was labeledwith 1 mg/ml DAPI (Sigma-Aldrich). Western blots were per-formed as described (39). Anti-a-tubulin for western blots wasused at dilution 1:5000 (T5168, Sigma-Aldrich).

Analysis of wing position and adult musculature

Wing-position defects were scored by collecting adult males atbirth, pooling five males per vial and scoring abnormal wingposition at different days, by direct observation of the fliesthrough the vial, without anesthesia (20). Visualization ofthoracic muscles under polarized light or by electronmicroscopy was carried out as described (20).

Microarray analysis

Total RNA was isolated from 50 adult thoraxes per genotype,per time point, in triplicates, as shown in SupplementaryMaterial, Table S3. RNA was extracted using Trizol (Invitro-gen) as recommended by the manufacturer, followed by aRNA cleanup using the RNeasy mini kit (Quiagen). Qualityand quantity of the RNA were checked using the BioanalyzerLab-on-a-Chip. The INDAC oligo set (15K, produced by Illu-mina) was obtained from Dr O. Sibon (Department of Radi-ation and Stress Cell Biology, Groningen, The Netherlands)and was printed in duplicate on poly-L-lysine coated slidesby Leiden Genome Technology Center. Per sample, 1 mg oftotal RNA was amplified with the Message Amp kit(Ambion) and the cRNA labeled through incorporation ofaminoallyl-uridine-5’-triphosphate and coupling with Amer-sham monoreactive Cy3 or Cy5 dyes. For all samples,



ew Y

ork at Buffalo on O



ownloaded from


1.5 mg of labeled cRNA was hybridized to the oligonucleotidearrays against a common reference and dye-swap experimentswere performed (in total: six hybridizations per condition, pertime point). The common reference is made of a pool of tripli-cate Mhc-Gal4/þ samples at day 2. Slides were scanned withan Agilent scanner (Model 2565BA) and spot intensities werequantified with the GenePix Pro 5.0 program (Axon). For dataanalysis, raw intensity files were imported into Rosetta Resol-verw v7.0 (RosettaBio, Seattle, WA, USA) and normalizedwith the Axon/Genepix error model. A two-way ANOVAwas performed to identify genes that were differentiallyexpressed between any of the three genotypes per timepoint. Genes were considered differentially expressed whenthe P-value was ,7.1 � 1027 (Bonferroni corrected). Geneswith similar expression patterns were clustered usingK-means clustering with cosine correlation as a similaritymeasure that was performed with the Functional Genomicsapplication of the Spotfire Decision Site 7.3 (Spotfire AB,Goteborg, Sweden). The average log[10] ratio and standarderrors for the genes within a cluster were calculated inExcel. Clusters with less than five genes were excluded fromthe analysis. To select gene clusters whose expression isderegulated following PABPN1-17ala expression, andrestored or not with coexpression of 3F5, paired Student’st-tests (Control/OPMD, Control/OPMD þ 3F5, OPMD/OPMD þ 3F5) were performed for each cluster and at eachtime point. A cluster was considered differentially expressedin two genotypes when P-value was ,0.01. The lists of clus-ters and the total number of genes in each category are shownin Supplementary Material, Table S2 and Figure 6.

SUPPLEMENTARY MATERIAL

Supplementary Material is available at HMG online.

ACKNOWLEDGEMENTS

We thank N. Lautredou and C. Cazevieille for technical assist-ance with confocal and electron microscopy. We also thankK. van der Wees for technical support for the transcriptomeanalysis and Dr P.B. ‘t Hoen for excellent bioinformaticadvice.

Conflict of Interest statement. None declared.

FUNDING

This work was supported by the CNRS (UPR1142), TheAssociation Francaise contre les Myopathies (no. 9756), theGIS ‘Maladies Rares’ (no. 35), the European Commission(STREP PolyALA, LSHM-CT-2005-018675), the ANR‘Maladies Rares’ (ANR-06-MRAR-035-01) and the Fondationpour la Recherche Medicale (Equipe FRM 2007) to M.S. andby European Commission (STREP PolyALA,LSHM-CT-2005-018675) and Muscular Dystrophy Associ-ation (68016) to S.M.M. A.C. held a grant from the Associ-ation Francaise contre les Myopathies, then a salary fromthe ANR ‘Maladies Rares’.

REFERENCES

1. Lo, A.S., Zhu, Q. and Marasco, W.A. (2008) Intracellular antibodies(intrabodies) and their therapeutic potential. Handb. Exp. Pharmacol.,181, 343–373.

2. Colby, D.W., Garg, P., Holden, T., Chao, G., Webster, J.M., Messer, A.,Ingram, V.M. and Wittrup, K.D. (2004) Development of a human lightchain variable domain (V(L)) intracellular antibody specific for the aminoterminus of huntingtin via yeast surface display. J. Mol. Biol., 342, 901–912.

3. Colby, D.W., Chu, Y., Cassady, J.P., Duennwald, M., Zazulak, H.,Webster, J.M., Messer, A., Lindquist, S., Ingram, V.M. and Wittrup, K.D.(2004) Potent inhibition of huntingtin aggregation and cytotoxicity by adisulfide bond-free single-domain intracellular antibody. Proc. Natl Acad.

Sci. USA, 101, 17616–17621.

4. Lecerf, J.M., Shirley, T.L., Zhu, Q., Kazantsev, A., Amersdorfer, P.,Housman, D.E., Messer, A. and Huston, J.S. (2001) Human single-chainFv intrabodies counteract in situ huntingtin aggregation in cellular modelsof Huntington’s disease. Proc. Natl Acad. Sci. USA, 98, 4764–4769.

5. Wolfgang, W.J., Miller, T.W., Webster, J.M., Huston, J.S., Thompson,L.M., Marsh, J.L. and Messer, A. (2005) Suppression of Huntington’sdisease pathology in Drosophila by human single-chain Fv antibodies.Proc. Natl Acad. Sci. USA, 102, 11563–11568.

6. McLear, J.A., Lebrecht, D., Messer, A. and Wolfgang, W.J. (2008)Combinational approach of intrabody with enhanced Hsp70 expressionaddresses multiple pathologies in a fly model of Huntington’s disease.FASEB J., 22, 2003–2011.

7. van Koningsbruggen, S., de Haard, H., de Kievit, P., Dirks, R.W., vanRemoortere, A., Groot, A.J., van Engelen, B.G., den Dunnen, J.T.,Verrips, C.T., Frants, R.R. et al. (2003) Llama-derived phage displayantibodies in the dissection of the human disease oculopharyngealmuscular dystrophy. J. Immunol. Methods, 279, 149–161.

8. Dekker, S., Toussaint, W., Panayotou, G., de Wit, T., Visser, P., Grosveld,F. and Drabek, D. (2003) Intracellularly expressed single-domainantibody against p15 matrix protein prevents the production of porcineretroviruses. J. Virol., 77, 12132–12139.

9. Jobling, S.A., Jarman, C., Teh, M.M., Holmberg, N., Blake, C. andVerhoeyen, M.E. (2003) Immunomodulation of enzyme function in plantsby single-domain antibody fragments. Nat. Biotechnol., 21, 77–80.

10. Abu-Baker, A. and Rouleau, G.A. (2007) Oculopharyngeal musculardystrophy: recent advances in the understanding of the molecularpathogenic mechanisms and treatment strategies. Biochim. Biophys. Acta,1772, 173–185.

11. Davies, J.E., Berger, Z. and Rubinsztein, D.C. (2006) Oculopharyngealmuscular dystrophy: potential therapies for an aggregate-associateddisorder. Int. J. Biochem. Cell Biol., 38, 1457–1462.

12. Brais, B., Bouchard, J.-P., Xie, Y.-G., Rochefort, D.L., Chretien, N.,Tome, F.M.S., Lafreniere, R.G., Rommens, J.M., Uyama, E., Nohira, O.et al. (1998) Short GCG expansions in the PABP2 gene causeoculopharyngeal muscular dystrophy. Nat. Genet., 18, 164–167.

13. Wahle, E. (1991) A novel poly(A)-binding protein acts as a specificityfactor in the second phase of messenger RNA polyadenylation. Cell, 66,759–768.

14. Kuhn, U. and Wahle, E. (2004) Structure and function of poly(A) bindingproteins. Biochim. Biophys. Acta, 1678, 67–84.

15. Benoit, B., Mitou, G., Chartier, A., Temme, C., Zaessinger, S., Wahle, E.,Busseau, I. and Simonelig, M. (2005) An essential cytoplasmic functionfor the nuclear poly(A) binding protein, PABP2, in poly(A) tail lengthcontrol and early development in Drosophila. Dev. Cell, 9, 511–522.

16. Calado, A., Tome, F.M., Brais, B., Rouleau, G.A., Kuhn, U., Wahle, E.and Carmo-Fonseca, M. (2000) Nuclear inclusions in oculopharyngealmuscular dystrophy consist of poly(A) binding protein II aggregateswhich sequester poly(A) RNA. Hum. Mol. Genet., 9, 2321–2328.

17. Brais, B. (2003) Oculopharyngeal muscular dystrophy: a late-onsetpolyalanine disease. Cytogenet. Genome Res., 100, 252–260.

18. Fan, X., Messaed, C., Dion, P., Laganiere, J., Brais, B., Karpati, G. andRouleau, G.A. (2003) HnRNP A1 and A/B interaction with PABPN1 inoculopharyngeal muscular dystrophy. Can. J. Neurol. Sci., 30, 244–251.

19. Davies, J.E., Sarkar, S. and Rubinsztein, D.C. (2008) Wild-type PABPN1is anti-apoptotic and reduces toxicity of the oculopharyngeal musculardystrophy mutation. Hum. Mol. Genet., 17, 1097–1108.



ew Y

ork at Buffalo on O



ownloaded from


20. Chartier, A., Benoit, B. and Simonelig, M. (2006) A Drosophila model ofoculopharyngeal muscular dystrophy reveals intrinsic toxicity ofPABPN1. EMBO J., 25, 2253–2262.

21. Wang, Q., Mosser, D.D. and Bag, J. (2005) Induction of HSP70expression and recruitment of HSC70 and HSP70 in the nucleus reduceaggregation of a polyalanine expansion mutant of PABPN1 in HeLa cells.Hum. Mol. Genet., 14, 3673–3684.

22. Bao, Y.P., Cook, L.J., O’Donovan, D., Uyama, E. and Rubinsztein, D.C.(2002) Mammalian, yeast, bacterial, and chemical chaperones reduceaggregate formation and death in a cell model of oculopharyngealmuscular dystrophy. J. Biol. Chem., 277, 12263–12269.

23. Abu-Baker, A., Messaed, C., Laganiere, J., Gaspar, C., Brais, B. andRouleau, G.A. (2003) Involvement of the ubiquitin-proteasome pathwayand molecular chaperones in oculopharyngeal muscular dystrophy. Hum.Mol. Genet., 12, 2609–2623.

24. Davies, J.E., Wang, L., Garcia-Oroz, L., Cook, L.J., Vacher, C.,O’Donovan, D.G. and Rubinsztein, D.C. (2005) Doxycycline attenuatesand delays toxicity of the oculopharyngeal muscular dystrophy mutationin transgenic mice. Nat. Med., 11, 672–677.

25. Hino, H., Araki, K., Uyama, E., Takeya, M., Araki, M., Yoshinobu, K.,Miike, K., Kawazoe, Y., Maeda, Y., Uchino, M. et al. (2004) Myopathyphenotype in transgenic mice expressing mutated PABPN1 as a model ofoculopharyngeal muscular dystrophy. Hum. Mol. Genet., 13, 181–190.

26. Bao, Y.P., Sarkar, S., Uyama, E. and Rubinsztein, D.C. (2004) Congo red,doxycycline, and HSP70 overexpression reduce aggregate formation andcell death in cell models of oculopharyngeal muscular dystrophy. J. Med.Genet., 41, 47–51.

27. Davies, J.E., Sarkar, S. and Rubinsztein, D.C. (2006) Trehalose reducesaggregate formation and delays pathology in a transgenic mouse model ofoculopharyngeal muscular dystrophy. Hum. Mol. Genet., 15, 23–31.

28. Verheesen, P., de Kluijver, A., van Koningsbruggen, S., de Brij, M.,de Haard, H.J., van Ommen, G.J., van der Maarel, S.M. and Verrips, C.T.(2006) Prevention of oculopharyngeal muscular dystrophy-associatedaggregation of nuclear polyA-binding protein with a single-domainintracellular antibody. Hum. Mol. Genet., 15, 105–111.

29. Schuster, C.M., Davis, G.W., Fetter, R.D. and Goodman, C.S. (1996)Genetic dissection of structural and functional components of synaptic

plasticity. I. Fasciclin II controls synaptic stabilization and growth.Neuron, 17, 641–654.

30. Tome, F.M. and Fardeau, M. (1980) Nuclear inclusions inoculopharyngeal dystrophy. Acta Neuropathol. (Berl.), 49, 85–87.

31. Tome, F.M., Chateau, D., Helbling-Leclerc, A. and Fardeau, M. (1997)Morphological changes in muscle fibers in oculopharyngeal musculardystrophy. Neuromuscul. Disord., 7 (Suppl. 1), S63–S69.

32. Calado, A. and Carmo-Fonseca, M. (2000) Localization ofpoly(A)-binding protein II (PABP2) in nuclear speckles is independent ofimport into the nucleus and requires binding to poly(A) RNA. J. Cell Sci.,113, 2309–2318.

33. Krause, S., Fakan, S., Weis, K. and Wahle, E. (1994) Immunodetection ofpoly(A) binding protein II in the cell nucleus. Exp. Cell Res., 214, 75–82.

34. Messaed, C., Dion, P.A., Abu-Baker, A., Rochefort, D., Laganiere, J.,Brais, B. and Rouleau, G.A. (2007) Soluble expanded PABPN1 promotescell death in oculopharyngeal muscular dystrophy. Neurobiol. Dis., 26,546–557.

35. Chiti, F. and Dobson, C.M. (2006) Protein misfolding, functional amyloid,and human disease. Annu. Rev. Biochem., 75, 333–366.

36. Fukuchi, K., Tahara, K., Kim, H.D., Maxwell, J.A., Lewis, T.L.,Accavitti-Loper, M.A., Kim, H., Ponnazhagan, S. and Lalonde, R. (2006)Anti-Abeta single-chain antibody delivery via adeno-associated virus fortreatment of Alzheimer’s disease. Neurobiol. Dis., 23, 502–511.

37. Levites, Y., Jansen, K., Smithson, L.A., Dakin, R., Holloway, V.M., Das,P. and Golde, T.E. (2006) Intracranial adeno-associated virus-mediateddelivery of anti-pan amyloid beta, amyloid beta40, and amyloid beta42single-chain variable fragments attenuates plaque pathology in amyloidprecursor protein mice. J. Neurosci., 26, 11923–11928.

38. Brand, A.H. and Perrimon, N. (1993) Targeted gene expression as ameans of altered cell fates and generating dominant phenotypes.Development, 118, 401–415.

39. Benoit, B., Nemeth, A., Aulner, N., Kuhn, U., Simonelig, M., Wahle, E.and Bourbon, H.M. (1999) The Drosophila poly(A)-binding protein II isubiquitous throughout Drosophila development and has the same functionin mRNA polyadenylation as its bovine homolog in vitro. Nucleic Acids

Res., 27, 3771–3778.



ew Y

ork at Buffalo on O



ownloaded from


prevention of oculopharyngeal muscular dystrophy by muscular expression of llama single-chain...

Documents