Plant and Animal Plant and Animal BreedingBreeding

Artificial Selection & Artificial Selection & Breeding for selected traitsBreeding for selected traitsselection of plants or animals for

desirable traits by humans through carefully planned breeding

Artificial Selection & Breeding for Artificial Selection & Breeding for selected traitsselected traits

Isolation of natural populations↓

Selective breeding of organisms showing traits useful of humans

↓Useful genotypes exits more often

(producing more offspring) than other genotype

↓Change in allele frequency towards

genotypes useful to humans

Aims of artificial selection Aims of artificial selection

1. create new breeds or varieties

Aims of artificial selection Aims of artificial selection preserve good species

Aims of artificial selection Aims of artificial selection domesticate wild plants and

animals Wildebeest Ostrich

Common types of artificial Common types of artificial selectionselectionInbreedingOutbreedingPolyploidy

InbreedingInbreedingmating between genetically

closely related individualsincrease the number of

homozygous genotypes ◦reduced variability◦decrease in heterozygosity

InbreedingInbreedingself-fertilizationcrossing the offspring of the

same parentsbackcrossing with one of the

parents

InbreedingInbreedingdecrease heterozygous

genotypes by 50% in each generation

Problems of inbreedingProblems of inbreedingreduce in fertilityInbreeding depression - vigour of

the population is gradually reduced

OutbreedingOutbreedingmating between genetically

closely unrelated individualsincrease the number of

heterozygosity ◦more variations◦produce offspring with superior

character (hybrid vigour)

use in combining two beneficial characteristics

PolyploidyPolyploidyAutopolyploidy

◦chromosome sets derived from the same species

◦created by spontaneous duplication

Allopolyploidy

PolyploidyPolyploidyAutopolyploidy

◦chromosome sets derived from the same species

◦created by spontaneous duplication

PolyploidyPolyploidyAllopolyploidy

◦two different diploid species are interbred

AllopolyploidyAllopolyploidythe hybrid form is sterile

◦different sets of chromosomes from both parents are not homologous

◦no pairing during meiosis

AllopolyploidyAllopolyploidyduplicate the genomethe tetraploid became fertile

AllopolyploidyAllopolyploidyget the advantage of inheriting

desirable characteristics from both parents

can be induced artificially by colchicine◦inhibit spindle formation

Methods commonly used in Methods commonly used in plant breedingplant breedingSelectionBackcrossHybridizationPolyploid breeding Mutation breeding

Methods commonly used in Methods commonly used in animal breedinganimal breedingSelectionArtificial insemination

Artificial insemination Artificial insemination Collection of semen from a maleDilution and artificial introduction

of sperm into female reproductive tract

Horses - Artificial Insemination

Artificial insemination Artificial insemination the semen can be stored in liquid

nitrogen for a long timeone male can be used to fertilize

a large number of females semen can be sent over long

distances commonly used in cattle

breeding

Plant cloningPlant cloningA clone is a group of genetically

identical cells or an individual derived from a single ancestral cell, tissue or individual by repeated asexual divisions

Cloning is the production of genetically identical individuals

Cloning is naturally Cloning is naturally occurring occurring Organisms which reproduce

asexually give rise to progeny by mitotic nuclear divisione.g. binary fission, vegetative propagation

produces exact copies of the parental genotype

Gardeners frequently maintain clones of desirable varieties of plants by vegetative propagation.

Plant cloningPlant cloning

Materials needed for cloning:

Somatic cells (primordial cells)

Culture medium

Tissue cultureTissue culture• Each somatic cell contains all the

information required to code for an entire organism.

• The cells to be cloned are allowed to grow in a medium containing suitable nutrients and hormones to form a mass of genetically identical cells called callose.

The callose are then separated and induced to produce new individuals

Advantages of plant Advantages of plant cloningcloningmaintain desirable traits in

selected plantsrapid way of propagating plants

in a short period of timeplants are grown in sterile

medium (disease-free)

Advantages of plant Advantages of plant cloningcloningplants are grown in sterile

medium (disease-free)

Advantages of plant Advantages of plant cloningcloningmaintain the genetic uniformityless space is needed

Animal cloningAnimal cloningFirst clone animal (1997)by Professor Ian Wilmut works at

the Roslin Institute in Edinburgh, which specializes in research on farm and other animals

Animal cloning - DollyAnimal cloning - DollyAn unfertilized egg was collected

from a Scottish blackface sheep

Animal cloning - DollyAnimal cloning - DollyThe nucleus of the unfertilized

egg cells was removed (enucleated)

Animal cloningAnimal cloningThe nucleus from a mammary

gland cell taken from a sheep Y.

Cloning of DollyCloning of DollyThe nucleus transfer to the

enucleated cell.An electro fusion was given

Cloning of DollyCloning of DollyIncubate the new cell in a culture

medium for 6 days ◦ embryo formed

Cloning of DollyCloning of DollyThe embryo was implanted into

the uterus of another blackface sheep (surrogate / foster mother)

Cloning of DollyCloning of DollyThe foster mother gave birth to

Dolly (baby sheep)

Implications of animal cloningmaintain the desirable traits in

selected animals Increase the population of

endangered species

Cloning on extinct animal -Thylacine - the largest known

carnivorous marsupial of modern times

Native to Australia and New Guinea

What’s the next?

Implications of animal cloningtissue from cloning of human

embryo for curing Parkinson’s disease

Implications of animal cloning

Recombinant DNA Recombinant DNA technologytechnology1. Transferring a particular gene to

a self-replicating chromosome (usually in bacteria)

2. Amplification of the resulting recombinant DNA molecule

Recombinant DNA Recombinant DNA technologytechnology

Recombinant DNA Recombinant DNA technologytechnology1. Transferring a particular gene to

a self-replicating chromosome (usually in bacteria)

2. Amplification of the resulting recombinant DNA molecule

Recombinant DNA Recombinant DNA technologytechnologyalso called gene manipulation genetic engineering

Genetic Engineering

Basic steps of recombinant Basic steps of recombinant DNA technologyDNA technologyidentifying a target geneisolating the target geneinserting the target gene into a

vector transferring the vector containing

the target gene into a host cell for producing a certain gene product

harvesting and purifying the gene product

Isolate the target geneIsolate the target geneuse restriction enzymesproduced by bacteria which cut

on the DNA at particular sites (recognition sites)

1978 Nobel Prize Physiology or Medicine

Werner Arber

Hamilton Smith

Daniel Nathans

Restriction enzymesRestriction enzymescan be extracted from bacterial

culturescut the double helix at specific

sites along the sequencesmost recognize sequences of

DNA with 4, 6 or 8 bases

Donor DNA

(Target DNA)

Restriction enzymes

(restriction endonucleases)

Break at specific site

Restriction enzymesRestriction enzymesact as powerful scissors create sticky ends

Formation of recombinant Formation of recombinant DNA moleculeDNA moleculeapply the restriction enzyme in

vitro with 2 different DNA fragments

DNA ligaseDNA ligasecan join ‘sticky ends’ of the DNA

fragments

Ways to locate the genes Ways to locate the genes Short gun sequencingTop-down sequencing

Shotgun approach

Genome from an organism

Restriction enzymes

Fragments of DNA

(some just contains the base sequences of a gene)

Gene probe

Desired base sequence

Shotgun approachShotgun approach• not specific

• but useful when no idea about the sequence of the desired gene

Shotgun Shotgun sequencingsequencingDNA is broken up randomly into

numerous small segmentssequenced using the chain

termination method Multiple overlapping reads for the

target DNA are obtained

Shotgun Shotgun sequencingsequencingStrand Sequence

Original XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX

First shotgun sequence

XXXAGCATGCTGCAGTCATGCTXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXTAGGCTAXXXX

Second shotgun sequence

XXXAGCATGXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXCTGCAGTCATGCTTAGGCTAXXXX

Reconstruction

XXXAGCATGCTGCAGTCATGCTTAGGCTAXXXX

Bottom up sequencing Bottom up sequencing

Complementary DNA Complementary DNA (cDNA)(cDNA)conversion of mRNA into DNA can be used to find out the

location of gene

Protein

Amino acids sequence

Nucleotides sequence

Only restricted to small gene with short DNA

Structure of mRNAStructure of mRNA

with a poly A tail d

all eukaryotic mRNA molecules contain a poly-A tail

for stabilization of mRNA molecule during transcription

cDNAcDNAusing a poly-T oligomer as a

primer(Primer is a short single-stranded DNA or RNA that functions as the starting site for the elongation of a new chain)

cDNAcDNAThe poly-T oligomer binds to the

complementary poly-A tail of mRNA

Formation of cDNAFormation of cDNAIn the presence of

enzyme ,reverse transcriptase a single strand of cDNA copy is formed

Release of the cDNARelease of the cDNAcDNA can be released by the

addition of alkali

Synthesis of DNA double Synthesis of DNA double helixhelixwith the help of DNA polymerase

VectorsVectorsa self-replicating DNA molecule

that carries a foreign DNA segment to a host cell for amplification

come from bacterial plasmids and viruses

PlasmidPlasmida small circular molecule of

double stranded DNA present in bacterial cell

carries a minor fraction of the bacterial genome ◦code important traits

Advantages of using plasmid Advantages of using plasmid as vectoras vectorlow molecular weight (contains

several thousand base pairs)

Advantages of using plasmid Advantages of using plasmid as vectoras vectorplasmid replicates autonomouslyindependent of the chromosomes

in bacteria

Advantages of using plasmid Advantages of using plasmid as vectoras vectorcontains antibiotic resistance

genes which facilities selection

Advantages of using plasmid Advantages of using plasmid as vectoras vectorcontain a number of unique

cleavage sites for the actions of several different restriction enzymes

Isolation of plasmid from Isolation of plasmid from bacteriabacteriaby breaking up the bacterial cellsseparation by centrifugation

Cleavage of plasmid Cleavage of plasmid cleavage by the same restriction

enzyme used in cutting the short length of DNA (target gene) to be inserted

form the same sticky ends

Insertion of plasmid to Insertion of plasmid to host cellhost cellwith the help of DNA ligase

Insertion of plasmid to Insertion of plasmid to host cellhost cellthe resulting plasmids can be

replicated if they are introduced into a bacterial host cells

Introducing the target gene Introducing the target gene into the host cellinto the host cellDNA molecules can be taken up

by pre-treating the bacterial cells with a solution containing Ca2+ ions followed by a rapid heat shock(42oC)

Introducing the target gene Introducing the target gene into the host cellinto the host cellapply a brief electrical shock that

generates temporary pores in the bacterial cell membrane

Production of human insulin Production of human insulin from genetically engineered from genetically engineered bacteriabacteriaType I Diabetes

◦failed to produce sufficient insulin ◦due to insufficient insulin by Islets of

Langerhans in the pancreas ◦can only get insulin from the

panaceas from cows or pigs

Problems of using insulin Problems of using insulin from other animalsfrom other animalsthough the insulin is biologically

active but the amino acid sequences are slightly different from those of humans

some patients are stimulated to produce antibodies against the injected insulin

Structure of human insulin Structure of human insulin consists of two separate

polypeptides chains: A and Bjoined together by special

disulphide bridges (S~S)A-chain contains 21 amino acidsB-chain is 30 amino acids long

Structure of human insulin Structure of human insulin two chains originate from a large

gene product called preproinsulin

Structure of human insulin Structure of human insulin function of C-chain is to bring the

A-chain and B-chain together in the correct alignment

Structure of human insulin Structure of human insulin A-chain and B-chain will join to

form a mature insulin

Genetically engineered Genetically engineered human insulinhuman insulinisolate 2 synthetic DNA

fragments (genes)◦encoding A-chain and B-chain

Introduce the 2 genes into plasmids

Genetically engineered Genetically engineered human insulinhuman insulinthe plasmids are introduced into

2 E. coli bacteriaproduce the chain A and chain B

polypeptides separately

Genetically engineered Genetically engineered human insulinhuman insulinthe polypeptides are extracted

and purifiedmixed under appropriate

conditions to produce functional human insulin

Applications of recombinant Applications of recombinant DNA technologyDNA technology

Production of therapeutic proteins for pharmaceutical uses◦Human insulin◦Blood clotting factor VIII◦Human growth hormone◦Protein coat of hepatitis B virus

Diagnosis of genetic Diagnosis of genetic diseasesdiseasescompare the nucleotides

sequences of affected patients and unaffected individuals◦diabetes◦pancreas cancer◦cystic fibrosis◦haemophilia◦AIDS

Production of enzymes for Production of enzymes for industrial applicationsindustrial applicationsbiological detergents

◦protease and amylaseBrewing industryTextile industryBaking industry

◦cellulaseLeather industry

Transgenic technologyTransgenic technologytransfer a desirable gene from

another species to a recipient organism

form a new character which is beneficial to human

produce transgenic animals and transgenic plants Genetically Modified Organisms (GMO)

• Introducing new genes from another Introducing new genes from another organismorganism

Bt gene

DNA Fingerprinting

Sir Professor Alec Jeffreys

Background information

No. of base pairs in human: 3 billion

No. of coding gene: 30,000

about 95% of the base pairs are non-coding

about 30-40% of the base pairs consists of short sequence of repeats

some of the repeats are joined together in cluster (tandem)

DNA fingerprintingDNA fingerprintingOn the DNA there are region

which do not code for polypeptides ◦Exon – coded for polypeptide◦Intron – non-coding DNA sequences

Non-coding sequenceNon-coding sequencemake up over 90% of the

genomeabout half of them carry short

repetitive sequences of nucleotides – tandem repeats

The tandem repeats are known as satellite DNA.

Some just have a small number of repeats: minisatillites.

• Different individual have a different number of tandem repeated

• Minisatillate known as variable number tandem repeats (VNTRs)

Procedure

Extraction

Amplification:

Polymerase Chain Reaction (PCR)

Polymerase Chain Reaction (PCR)

1. Denature: made single-stranded

2. Add DNA polymerase

3. Add primer (a short DNA sequence)

Treatment with restriction enzyme

• cut DNA into smaller fragments

• contain minisatellites

• length of the DNA fragments remains unchanged

Agrose gel electrophoresis

• agrose gel with pores

• Separate the DNA fragments according to size

• DNA carries negative charge and will move to positive pole if a voltage is applied to it.

• Smaller size: move faster

• Bigger size: move slower

Splitting the DNA into single strands

• by alkaline treatment

Addition of a radioactive probe

• Identify the location of the minisatillites

• number of tandem repeats can be shown as bands

Applications of DNA fingerprinting

• Identification of criminal

• very sensitiveType of sample Amount of DNA (ng); 1ng = 10-9 g

Blood 20,000 – 40 000 ng / ml

Stain 1 cm2 in area ~ 200 ng

Stain in 1 mm2 area ~ 2 ng

Semen 150, 000 – 300, 000 ng / ml

Postcoital vaginal swab 0 – 3, 000 ng

Hair

Plucked 1 – 750 ng / hair

shed 1 –12 ng / hair

Saliva 1, 000 – 10, 000 ng / ml

Urine 1 – 20 ng / ml

Fig. 8 DNA content in biological sample

Number of Bands Odds against a chance match

4 250 to 1

6 4000 to 1

8 65000 to 1

10 1 million to 1

12 17 million to 1

14 268 million to 1

16 4300 million to 1

18 68000 million to 1

20 1 million million to 1

Fig. 9 The chance occurrence of Band matching

Chance occurrence of band matching

Settling paternity disputesSettling paternity disputes• every child must inherit one copy

of a pair of homologous chromosome from each parent

Mother Father

Genetic disorder and its diagnosis

• due to mutation

Sickle cell anaemia

Haemophilia