at SciVerse ScienceDirect

Plant Physiology and Biochemistry 71 (2013) 22e30

Contents lists available

Plant Physiology and Biochemistry

journal homepage: www.elsevier .com/locate/plaphy

Research article

Overexpression of GsZFP1 enhances salt and drought tolerancein transgenic alfalfa (Medicago sativa L.)

Lili Tang a, Hua Cai a, Wei Ji a, Xiao Luo b, Zhenyu Wang b, Jing Wu a, Xuedong Wang c,Lin Cui c, Yang Wang a, Yanming Zhu a,*, Xi Bai a,*aCollege of Life Science, Northeast Agricultural University, Harbin 150030, ChinabKey Laboratory of Soybean Molecular Design Breeding, Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences, Harbin 150040,Chinac Electron Microscopy Center, Northeast Agricultural University, Harbin 150030, China

a r t i c l e i n f o

Article history:Received 16 May 2013Accepted 20 June 2013Available online 3 July 2013

Keywords:GsZFP1AlfalfaSalt toleranceDrought toleranceMarker genes

Abbreviations: C2H2, Cys2/His2; qRT-PCR, quantitreverse transcription PCR; M. sativa L., Medicago sativABA, abscisic acid; MDA, malondialdehyde; TBA, tchloroacetic acid; SEM, scanning electron microscopymicroscopy; GPDH, glyceraldehyde-3-phosphate dehy* Corresponding authors. Tel.: þ86 18604512008.

E-mail addresses: tanglili19861126@126.com (L.(H. Cai), iwei_j@hotmail.com (W. Ji), luoxiao@wangzhenyu128@163.com (Z. Wang), azaazanl@sinasohu.com (X. Wang), cuilin123123@sohu.com (L. C(Y. Wang), yamzhu201@neau.edu.cn (Y. Zhu), baixi@n

0981-9428/$ e see front matter � 2013 Elsevier Mashttp://dx.doi.org/10.1016/j.plaphy.2013.06.024

a b s t r a c t

GsZFP1 encodes a Cys2/His2-type zinc-finger protein. In our previous study, when GsZFP1 was heterol-ogously expressed in Arabidopsis, the transgenic Arabidopsis plants exhibited enhanced drought and coldtolerance. However, it is still unknown whether GsZFP1 is also involved in salt stress. GsZFP1 is from thewild legume Glycine soja. Therefore, the aims of this study were to further elucidate the functions of theGsZFP1 gene under salt and drought stress in the forage legume alfalfa and to investigate its biochemicaland physiological functions under these stress conditions. Our data showed that overexpression ofGsZFP1 in alfalfa resulted in enhanced salt tolerance. Under high salinity stress, greater relative mem-brane permeability and malondialdehyde (MDA) content were observed and more free proline andsoluble sugars accumulated in transgenic alfalfa than in the wild-type (WT) plants; in addition, thetransgenic lines accumulated less Naþ and more Kþ in both the shoots and roots. Overexpression ofGsZFP1 also enhanced the drought tolerance of alfalfa. The fold-inductions of stress-responsive markergene expression, including MtCOR47, MtRAB18, MtP5CS, and MtRD2, were greater in transgenic alfalfathan those of WT under drought stress conditions. In conclusion, the transgenic alfalfa plants generatedin this study could be used for farming in salt-affected as well as arid and semi-arid areas.

� 2013 Elsevier Masson SAS. All rights reserved.

1. Introduction

High salinity and drought are two major environmental factorsthat adversely affect plant growth and crop productivity. Plantshave adapted to respond to stresses at the molecular and cellularlevels as well as at the physiological and biochemical levels. Theinduction of stress-responsive and stress-tolerant genes, attenu-ated growth, closure of stomata, accumulation of compatible

ative real-time PCR; RT-PCR,a L; TFs, transcription factors;hiobarbituric acid; TCA, tri-; TEM, transmission electrondrogenases.

Tang), small-big@sohu.comneigaehrb.ac.cn (X. Luo),

.com (J. Wu), wangxd5821@ui), dongtian_601@126.comeau.edu.cn (X. Bai).

son SAS. All rights reserved.

solutes, and protective proteins are several examples [1e5]. Insignal transduction from perception of stress signals to stressresponse, the functions of various transcription factors allow plantsto adapt to stresses. Transcription factors play critical roles in theresponse to salt and drought stress via transcriptional regulation ofthe downstream genes responsible for plant tolerance.

Plant genomes contain a large number of genes capable ofencoding transcription factors. The C-repeat binding factor/dehy-dration responsive element binding factor (CBF/DREB), MYB andCUC (NAC) transcription factors, and zinc-finger proteins (ZFPs)have been described as important regulators in plant responses toenvironmental stress [6e8]. Sakamoto has previously reported agene family of Cys2/His2-type zinc-finger proteins in Arabidopsis[9]. Some members of this family are upregulated by abiotic stressin Arabidopsis. The Cys2/His2-type zinc-finger, also called theclassical or TFIIIA-type finger, is one of the best-characterizedDNA-binding motifs found in eukaryotic transcription factors.This motif is represented by the signature of CX2-4CX3X5LX2HX3e

5H, consisting of about 30 amino acids and 2 pairs of conservedCys and His residues bound tetrahedrally to a zinc ion [10].

L. Tang et al. / Plant Physiology and Biochemistry 71 (2013) 22e30 23

Most of the Cys2/His2-type ZFPs in plants play various roles indevelopmental processes and abiotic stress [11]. Previously, threeTFIIIA-type zinc finger genes, ZFP245 [12], ZFP182 [13], and ZFP252(renamed from RZF71) [14], were isolated from rice; it was foundthat these genes were induced by various abiotic stresses. In addi-tion, it has been reported that overexpression of some Cys2/His2-type ZFP genes results in enhanced tolerance to salt, dehydration,and cold stress by changing downstream regulation of geneexpression and signal transduction in stress-response pathways[9,15,16]. However, the biochemical and physiological functions ofmost plant Cys2/His2-type ZFPs and the roles of Cys2/His2-type zinc-finger genes from soybean in plant stress tolerance are still poorlycharacterized. To the best of our knowledge, few ZFPs from soybeanhave been isolated and studied; SCOF-1, a Cys2/His2-type ZFP geneisolated from soybean, acts as a positive regulator of cold regulated(COR) gene expression and enhances the cold tolerance of transgenicArabidopsis [17]. When SCOF-1 was expressed in sweet potato, theplants showed enhanced tolerance to low-temperature stress [18].

In our previous study, by transcriptome profile analysis using amicroarray method of wild soybean (Glycine soja) under NaHCO3conditions, GsZFP1was isolated as a candidate gene responsible forabiotic stress [19]. Our further studies showed that GsZFP1 could beinduced by cold, salt, ABA, and drought. Furthermore, when GsZFP1was heterologously expressed in Arabidopsis, the drought and coldtolerance were significantly enhanced and the sensitivity to ABAduring seed germination and seedling growth were reduced[16,20]. Since GsZFP1 could be induced by salt exposure, it remainsto be determined whether it is also involved in salt tolerance. Thus,because GsZFP1 is a gene from a legume, the function of GsZFP1wasstudied using alfalfa, a type of leguminous forage crop.

Alfalfa (Medicago sativa L.) is an important worldwide legumi-nous forage crop. It not only supplies abundance of forage for ani-mals but also improves soil fertility [21]. However, soil salinity andlimited water supplies in agriculture represent major constraints inthe productivity of alfalfa. Therefore, breeding salt- and drought-tolerant alfalfa cultivars is very necessary for this importantforage crop to adapt to environmental stresses. By overexpressing

Fig. 1. A. Map of the pCEOM-GsZFP1 plasmid. The GsZFP1 gene was under the control of theanalysis of GsZFP1 in transgenic alfalfa andWT plants by semi-quantitative RT-PCR and real-ttransgenic lines overexpressing GsZFP1. Each value is the mean of three independent measuWT are denoted by one or two stars corresponding to P < 0.05 and P < 0.01, respectively,

GsZFP1 ectopically in alfalfa, the aims of this study were to furtherelucidate the functions of the GsZFP1 gene under salt and droughtstress, to investigate its biochemical and physiological functionsunder these stress conditions, and to breed salt- and drought-resistant alfalfa cultivars.

2. Results

2.1. Ectopic overexpression of GsZFP1 in alfalfa

Transgenic alfalfa plants overexpressing GsZFP1, under the con-trol of the cauliflower mosaic virus (CaMV) 35S promoter (Fig. 1A),were generated via Agrobacerium-mediated transformation. Afterglufosinate selection, the regenerated alfalfa plants were analyzedby semi-quantitative reverse transcription polymerase chain reac-tion (RT-PCR) and real-time RT-PCRmethods (Fig.1B and C). Becauseof the existence of the endogenous gene, GsZFP1 transcripts can alsobe detected inwild-type (WT) plants. As shown in Fig. 1B and C, thetranscript levels of GsZFP1 in transgenic lines #20, #33, and #41were significantly greater than that of the WT, and the transcriptlevel in #24 was comparable to that of theWT. Therefore, lines #20,#33, and #41 were chosen for further analysis.

2.2. Overexpression of GsZFP1 increases salt tolerance in alfalfa

To test the tolerance of transgenic alfalfa lines to salt stress,plants derived from transgenic lines #20, #33, #41, and WT wereirrigated with NaCl solutions (250 mM) for 26 d. Under normalgrowth conditions, there were no obvious differences in terms ofappearance or growth rates of shoots between WT and threeGsZFP1 transgenic lines (Fig. 2A). However, after 17 d of NaCltreatment (250 mM), the growth of WT plants was significantlyinhibited compared with the transgenic lines (Fig. 2B). Threetransgenic lines grewwell and only slight yellowing of a few leaves,whereas some leaves of WT plants showed severe chlorosis(Fig. 2B). After 26 d of NaCl treatment, WT plants were all dead,while the three transgenic lines all survived (Fig. 2C). The shoot

double CaMV 35S promoter with the binding enhancer E12. B and C. Transcript levelime RT-PCR. WT represents nontransgenic plants, and #20, #24, #33, and #41 representrements, and error bars indicate standard deviation (SD). Significant differences fromby the Student’s t-test.

L. Tang et al. / Plant Physiology and Biochemistry 71 (2013) 22e3024

heights and fresh weights of the transgenic lines under salt treat-ment were all significantly greater than the salt-treated WT plants(Fig. 2D and E). These results indicated that overexpression ofGsZFP1 increases tolerance of alfalfa to salt stress.

Physiological and biochemical parameters, including prolinecontent, relative membrane permeability, and MDA content beforeand after salt stress were then investigated. Proline, a type ofcompatible osmolyte [22], plays a critical role in protecting plantsunder stress, particularly under saline conditions. So, proline con-tents were tested in transgenic and WT plants. Under the controlconditions, the contents of free proline were not significantlydifferent between WT and transgenic alfalfa lines. However, after250 mM NaCl treatment for 17 d, the three overexpression linesaccumulated greater free proline content than the WT plant(Fig. 3A). To test the membrane stability, which represents thedegree of cell membrane damage under stress, relative membranepermeability andMDA content were determined. Under the controlconditions, the relative membrane permeability and MDA contentof transgenic lines were similar to those of WT plants (Fig. 3B andC). Under 250 mM NaCl treatment for 17 d, the relative membranepermeability and MDA of WT plants were greater than those of thelines overexpressing GsZFP1 (Fig. 3B and C). Thus, the degree ofdamage to the cell membrane of WT plants was greater than thatfound in plants overexpressing GsZFP1 under salt stress conditions.

High salinity stresses plants in twoways: osmotic effect and toxiceffect. High salt concentrations make it more difficult for roots toextract water, and high salt concentrations within the plant can betoxic. To understand the physiological mechanisms responsible forthe salinity tolerance of transgenic alfalfa, the toxic effects of the saltwithin the plant were investigated. We analyzed the levels of Naþ

and Kþ to determine whether the salt tolerance of transgenic alfalfawas caused by a Naþ exclusion mechanism. The transgenic lines and

Fig. 2. Salt stress tolerance of GsZFP1-transgenic alfalfa. A. Plant growth under normal condsalt stress (250 mM NaCl) for 26 d. D. Shoot height of plants in the presence or in the abserepresent means from three replicates, and the error bars indicate SD. Significant differencrespectively, by the Student’s t-test.

WT were treated with 250 mM NaCl for 17 d under greenhouseconditions, and the total Naþ and Kþ contents were measured. Asshown in Fig. 4, without NaCl stress, cation contentswere almost thesame in WT and transgenic lines both in the leaves and the roots(Fig. 4AeD); while under NaCl treatment, the Naþ content increasedand the Kþ content decreased in WT and all transgenic linescompared with nonstressed control both in the leaves (Fig. 4A andC) and the roots (Fig. 4B and D), whereas the transgenic lines con-tainedmuch less Naþ andmore Kþ in comparisonwith theWT bothin the leaves and the roots. These results indicated that increasedsalt tolerance in GsZFP1-overexpressed alfalfa might partially resultfrom reduced Naþ absorption or increased Naþ exclusion.

2.3. Overexpression of GsZFP1 increases alfalfa tolerance to droughtstress

In order to determinewhether GsZFP1 is involved in the droughttolerance of transgenic alfalfa, the performance of the GsZFP1-overexpressing plants under drought stress was studied. Undernormal growth conditions, there were no significant differences inperformance and growth rate of shoots betweenWT plants and thethree transgenic lines (Fig. 5A). After drought treatment for 20 d,the three transgenic lines grew well and only some leaves turnedyellow, whereas the leaves of the WT plants showed severe wiltingand curling (Fig. 5B). When rewatered after drought treatment, thetransgenic lines grew better than the WT plants (Fig. 5C). Thesurvival rates, fresh weights, root lengths, and shoot heights of thethree transgenic lines after drought treatment were greater thanthose of the WT plants (Fig. 5DeG). In addition, the relativemembrane permeability and MDA content were less in the GsZFP1-overexpressing transgenic lines after drought treatment comparedwith those of the WT plants (Fig. 5HeI), which indicated a lower

itions. B. Plant growth under salt stress (250 mM NaCl) for 17 d. C. Plant growth undernce of salt. E. Fresh weight of plants in the presence or in the absence of salt. Valueses from WT are denoted by one or two stars corresponding to P < 0.05 and P < 0.01,

Fig. 3. Free proline and MDA contents and the relative membrane permeability of theWT and three transgenic lines. Each bar represents means from three replicates �SD.Significant differences from WT are denoted by one or two stars corresponding toP < 0.05 and P < 0.01, respectively, by the Student’s t-test.

L. Tang et al. / Plant Physiology and Biochemistry 71 (2013) 22e30 25

degree of damage to the cell membrane of the transgenic plants.Moreover, the soluble sugar and free proline levels were signifi-cantly upregulated in the three transgenic lines compared withthose of the WT after drought treatment (Fig. 5JeK). The water lossrate was also analyzed. It showed that the three transgenic lineshad lower rates of water loss compared with the WT plants duringthe dehydration process (Fig. 5L). Under normal conditions, theWTand the transgenic plants grew well and showed no significantdifferences in phenotypes (Fig. 5AeC) or physiological parameters(Fig. 5DeL). These results indicated that overexpression of GsZFP1increased alfalfa tolerance to dehydration stress.

2.4. Overexpression of GsZFP1 results in increased expression ofdrought stress-related genes

To gain more insight into the role played by GsZFP1 underdrought stress conditions, we analyzed the expressions of somedrought stress-related genes by real-time RT-PCR analysis,

includingMtCOR47,MtRAB18,MtP5CS, andMtRD2 [23]. Expressionsof these genes were induced by drought both in WT and transgenicplants, and they exhibited similar expression patterns over time.However, the expression level of MtCOR47 was greater at 0 h and3 h in the GsZFP1-overexpressing lines than in the WT. Theexpression level of MtRAB18 was greater at 3 h and 6 h in theGsZFP1-overexpressing lines. In addition, for MtP5CS and MtRD2,the expression levels in the transgenic plants were greater at 3 hand 6 h, respectively, than that of WT. These results demonstratedthat GsZFP1 enhances the transcription levels of the drought-related genes, indicating that a correlative link exists betweentheir expression and drought tolerance.

3. Discussion

GsZFP1encodingaCys2/His2-type zinc-fingerproteinwas isolatedfrom the transcriptome profile of G. soja [19]. Our previous studieshave shown that GsZFP1 can be upregulated by ABA, cold, drought,and salt. Overexpression of GsZFP1 improves plant tolerance to coldand dehydration stresses and reduces ABA sensitivity in transgenicArabidopsisplants [16,20], but its role in salt stress is still unknown. Inthis study, we found that GsZFP1 is also involved in salt stress.Overexpression ofGsZFP1 significantly enhanced the salt tolerance ofalfalfa, similar to the results found in Arabidopsis. In addition, GsZFP1significantlyenhanced thedrought toleranceof alfalfa. Therewerenosignificant changes in morphological or agronomic traits among thetransgenic plants and the WT plants under normal conditions(Figs. 2A and5A). Transgenic plants andWTplants grewwell and thephysiological and biochemical parameters were the same. Theseresults indicated that the GsZFP1 gene is very suitable for geneticengineering breeding to cultivate a stress-tolerant crop.

Salt and drought stress cause the production of active O2 spe-cies, which results in the accumulation of MDA in plants due tomembrane lipid peroxidation [24]. Oxidative stress-inducedmembrane damage and cell membrane stability have been usedas efficient criteria to assess the degree of salt and drought toler-ance of plants [25,26]. Our results showed that lower relativemembrane permeability and MDA content existed in transgenicalfalfa under both salt and drought stress when compared with theWT plants (Figs. 3B, C and 5H, I). These results implied that thedegree of membrane injury of transgenic plants was less than thatof WT plants, which was consistent with the enhanced salt anddrought tolerance phenotype of transgenic alfalfa.

There is evidence that high levels of salt cause an imbalance ofthe cellular ions leading to both ion toxicity and osmotic stress [27].High salt concentrations make it more difficult for roots to uptakewater. Additionally, high salt concentrations within the plant can betoxic because essential cellular metabolism pathways, such asprotein synthesis and enzyme activity, are disturbed. Osmotic ad-justments by accumulating osmoprotectants inside the cell areessential to reduce the cellular osmotic potential (Josm) against anosmotic gradient between root cells and the outside saline solution,which eventually restore thewater uptake into roots during salinitystress [27]. When suffering from abiotic stresses, many plants canaccumulate more compatible osmolytes, such as free proline[28,29] and soluble sugars [30]. These osmolytes function asosmoprotectants so that plants can tolerate stress. In this study, theosmoprotectant contents, including proline and soluble sugars,were examined. Our results showed that the contents of free pro-line and soluble sugar were greater under salt and drought stressconditions, and the free proline and soluble sugar levels in GsZFP1-overexpressing transgenic plants were greater than those in WTplants (Figs. 3A and 5J, K). Thus, the increased accumulation ofproline and soluble sugarsmust contribute to the increased salt anddrought tolerance of transgenic alfalfa.

Fig. 4. Content of ions in roots and leaves of WT and three transgenic lines in the presence or absence of 250 mM NaCl treatment. A. Naþ content in leaves. B. Naþ content in roots. C.Kþ content in leaves. D. Kþ content in roots. Each bar represents means from three replicates �SD. Significant differences fromWT are denoted by one or two stars corresponding toP < 0.05 and P < 0.01, respectively, by the Student’s t-test.

L. Tang et al. / Plant Physiology and Biochemistry 71 (2013) 22e3026

To fully understand thephysiologicalmechanisms responsible forthe salinity tolerance of transgenic alfalfa, the toxic effects of ionswere evaluated in this study. The maintenance of high cytosolic Kþ/Naþ ratios has been strongly suggested to be crucial for salt-tolerantplants [31,32]. So, the Kþ/Naþ content was examined in this study.Our results showed that GsZFP1-overexpressing alfalfa lines haddecreased levels of Naþ and increased levels of Kþ, resulting in ahigherKþ/Naþ ratiowhen compared toWTplants (Fig. 4AeD). Theseresults indicated thatGsZFP1 positively regulates the salt tolerance ofalfalfa by regulating Kþ/Naþ homeostasis to reduce ion toxicity.

GsZFP1 encodes a Cys2/His2-type transcription factor that func-tions in transcriptional regulation. Our previous studies haveshown that GsZFP1 strongly induces the expression of variousdrought-responsive genes when overexpressed in Arabidopsis [16].In this study, we checked the expression of stress-responsive genessuch as MtP5CS, MtRD2, MtRAB18, and MtCOR47 in two GsZFP1-overexpressing lines. TheMtP5CS gene, which has been reported toplay a predominant role in stress-induced proline accumulation[33], has been isolated from themodel legumeMedicago truncatula.MtRD2, MtRAB18, and MtCOR47 are the homologous genes of RD2,RAB18, and COR47 of Arabidopsis, respectively, which have beenused as stress-related marker genes.MtP5CS, MtRD2, MtRAB18, andMtCOR47 were induced by drought conditions and exhibitedsimilar expression patterns in both the transgenic lines andWT, butthe fold-changes in the transgenic lines was greater than that ofWTat some time points (Fig. 6). Our results showed that GsZFP1 playsan important role in transcriptional regulation under drought stressconditions. Nevertheless, the direct downstream genes of GsZFP1are unknown, and further studies are needed to identify thedownstream target genes of GsZFP1 to provide a better under-standing of this gene’s involvement in plant abiotic stress.

Alfalfa is a perennial forage legume of great agronomic impor-tance worldwide. As a perennial forage crop, alfalfa is a fairly hardyspecies and has a relatively high level of drought and salt tolerancecompared with many food crops. Alfalfa can be grown in slightlysaline-alkaline conditions and semi-arid areas, but its productivityis significantly reduced under high salinity and drought stressconditions. It is estimated that approximately 20% of the world’scultivated land and nearly half of all irrigated land are salt-affectedand that arid and semi-arid regions account for approximately 30%of the total worldwide area [34,35]. Therefore, breeding high salt-and drought-tolerant alfalfa cultivars is very necessary forimproving land use efficiency. In our study, transgenic alfalfaoverexpressing GsZFP1was found to be significantly more drought-and salt-tolerant than WT plants. We hope that the transgenicalfalfa plants generated in this study can be used for farming in salt-affected as well as arid and semi-arid areas.

4. Materials and methods

4.1. Plant material and stress treatments

All the lines were vegetatively propagated by cutting the youngshoots. WhenWTcontrols and the three transgenic lines (#20, #33,and #41) were approximately 25 cm high, plants of similar sizewere chosen for further culture. For salt stress treatments, 30 plantsof each WT and transgenic line were transplanted into plastic cul-ture pots (8 cm � 10 cm) containing 80 cm3 of vermiculite andperlite (1:1) and grown under a 16-h photoperiod with an irradi-ance of approximately 600 mmol m�2 s�1, a temperature of24 � 2 �C, and a relative humidity of 60 � 5%. Plants were wateredevery 2 d with 3 L of 1/8 Hoagland’s nutrient solution for 4 weeks.

Fig. 5. Drought stress tolerance of GsZFP1 transgenic plants. A. Plant growth under normal conditions. B. Plant growth when watering was stopped for 20 d. C. Plant growth whenwatering was resumed for 7 d. D. Survival rate after rewatering. E. Fresh weight measurements for plants shown in A and C. F. Shoot height measurements for plants shown in A andC. G. Root length measurements of plants shown in A and C. For D, E, F, and G, values are means from three independent experiments (30 seedlings per experiment). Error barsindicate SD. H. Relative membrane permeability of plant leaves. I. MDA contents of plant leaves. J. Soluble sugar contents of plant leaves. K. Free proline contents in plant leaves. L.Water loss rate of plants when detached. For H, I, J, K, and L, each value is the mean of three independent measurements. Significant differences fromWT are denoted by one or twostars corresponding to P < 0.05 and P < 0.01, respectively, by the Student’s t-test.

L. Tang et al. / Plant Physiology and Biochemistry 71 (2013) 22e30 27

After the nutrient solution was supplemented with NaCl at finalconcentrations 250mM for 0 d, 17 d, and 26 d, the plants were usedfor further analyses. For drought stress treatments, WT and trans-genic lines were transplanted to plastic culture pots and grown asdescribed above for 4 weeks. After drought treatment for 20 dfollowed by watering for 7 d, all the plants were used for furtheranalyses.

4.2. MDA, relative membrane permeability, and free proline andtotal soluble sugar contents of leaf tissues

4.2.1. Measurement of lipid peroxidationLipid peroxidation was measured using a modified thio-

barbituric acid (TBA) method [32,33]. Approximately 0.1 g of leaftissues were ground in 10 ml of 10% trichloroacetic acid (TCA)

Fig. 6. Expression patterns of stress-responsive genes in WT and transgenic lines. x-axis time (h) of 20% (w/v) PEG6000 treatment; y-axis: relative transcript level. Transcript levelsof MtCOR47, MtP5CS, MtRAB18, and MtRD2 under normal conditions and 20% (w/v) PEG6000 treatment were measured by real-time RT-PCR. Transcript levels relative to GPDH arepresented for each treatment; untreated plants were used as controls. Values represent means of three biological replicates. Significant differences from WT are denoted by one ortwo stars corresponding to P < 0.05 and P < 0.01, respectively, by the Student’s t-test.

L. Tang et al. / Plant Physiology and Biochemistry 71 (2013) 22e3028

using a mortar and pestle. The homogenate was centrifuged at10,000 rpm for 20 min. The reaction mixture containing 2 ml ofextract and 2 ml of TBA was heated at 95 �C for 30 min, quicklycooled on ice, and then centrifuged again at 10,000 rpm for 20 min.The absorbances at 450, 532, and 600 nm were determined usingan ultraviolet spectrophotometer (UV-2550, Shimadzu, Japan).Three biological replicates were performed.

4.2.2. Measurement of relative membrane permeabilityMembrane permeability can be reflected by the electrolyte

leakage rate (ELR), which was determined with a conductivitymeter (DDSJ-308A, Precision and Scientific Instruments, Shanghai,China) according to the method described by Gibon et al. [36], withslight modifications. Briefly, three leaf discs in the leaf segmentsfrom 6 to 10 seedlings were vacuum-infiltrated in deionized waterfor 20 min and maintained in water for 2 h. The conductivities (C1)of the obtained solutions were then determined. Next, the leafsegments in deionized water were boiled for 15 min. After beingthoroughly cooled to room temperature, the conductivities (C2) ofthe resulting solutions were determined. The values of C1 to C2 (C1/C2) were calculated and used to evaluate the relative electrolyteleakage. Each data point represents the average from three inde-pendent experiments. The data were subjected to statistical anal-ysis using the t-test.

4.2.3. Measurement of free proline and total soluble sugar contentsFree proline content of drought- and salt-treated WT and

transgenic alfalfa plants was measured spectrophotometrically

according to the method of Bates et al. [37]. Leaf tissue (0.2 g) washomogenized in 4 ml of sulfosalicylic acid (3%) and centrifuged at10,000g for 30min. 2ml of the supernatantwas added to a test tube,and 2 ml of glacial acetic acid and 2 ml of ninhydrin reagent wereadded. The reactionmixturewas boiled in awater bath at 100 �C for30 min. After cooling the reaction mixture, 4 ml of toluene wasadded, the mixture was vortexed for 30 s, and the upper phasecontaining proline was measured with a spectrophotometer (UV-2550, Shimadzu, Japan) at 520 nm using toluene as the blank. Theproline content (mg/g FW) was quantified by the ninhydrin acidreagent method by using proline as the standard [37].

The total soluble sugar content of plants was assayed using thephenol-sulfuric acid assay [30]. Briefly, a fresh alfalfa leaf was ho-mogenized with deionized water, the mixture was filtered andtreatedwith 5% phenol and 98% sulfuric acid, and the absorbance at485 nm was determined with a spectrophotometer (UV-2550,Shimadzu, Japan).

4.3. Measurement of Naþ and Kþ contents

Measurement of tissue Naþ and Kþ concentrations was per-formed as described by Cuin and Shabala [38]. The shoots and rootswere collected into 1.5 mL microcentrifuge tubes and immediatelyfrozen by liquid nitrogen. A based opening in the tube allows cell sapbut not tissue fragments to pass through to a collection tube. Thesample was then thawed and spun for 3 min at 11,000g in a micro-centrifuge. The collected sample was measured for its Naþ and Kþ

concentrations using a flame photometer (6400A, Shandong, China).

Table 1Gene-specific primers used for quantitative real-time PCR assays.

Gene name Primer sequence (50e30)

GsZFP1 Forward: ATTAGCCTTAGCCACCGTTTReverse: GTCCACCACTTACCCATTCT

GPDH Forward: GTGGTGCCAAGAAGGTTGTTATReverse: CTGGGAATGATGTTGAAGGAAG

MtRAB18 (Mt3G143270.1) Forward: GGACACACCTAGCCTCCTAGGCGReverse: TGCATCGGACTGGGGCTTGTC

MtCOR47 (Mt3G162790.1) Forward: CGTTGCTTACGGTGGCGGTGCReverse: TCCGGGTGGTGGTTCGGTGG

MtRD2 (Mt3G162380.1) Forward: GCAGCTGTGGTTCTGGGGACCReverse: AGCAATACTCACCGACGCTTCCT

MtP5CS (Mt3G092110.1) Forward: ATGGCGAACGCCGACCCTTGTReverse: CGGCAACAGCCATCTCGCGT

L. Tang et al. / Plant Physiology and Biochemistry 71 (2013) 22e30 29

4.4. Measurement of water loss

WT control and transgenic plants of similar size were chosenand young shoots were cut. 0.5 g leaves of WT control and trans-genic plants grown under normal conditions were detached andweighed immediately on a piece of weighing paper and then placedon a laboratory bench (40% relative humidity) and weighed atdesignated time intervals. Three replicates were performed for eachline. The relative water content was calculated on the basis of theinitial weight of the plants.

4.5. Quantitative real-time PCR

Transgenic lines (#20 and #41) and WT plants were treatmentwith 20% PEG6000 (imitation drought) for 0 h, 1 h, 3 h, 6 h and 12 h.Leaves of total RNA was extracted using an RNAprep pure plant kit(Tiangen Biotech, Beijing, China). The isolated RNA was then sub-jected to reverse transcription, using an M-MLV Reverse Tran-scriptase kit (Invitrogen). Prior to the qRT-PCR assays, the quality ofthe cDNA was assessed by PCR using the glyceraldehyde-3-phosphate dehydrogenase (GPDH) gene as an internal control.One microliter of synthesized cDNA (diluted 1:5) was used as atemplate. qRT-PCR was performed on each cDNA template usingSYBR Green Master Mix on an ABI 7500 sequence detection systemaccording to the manufacturer’s protocol (Applied Biosystems,Foster City, CA, USA). GPDH was used as an internal control for thedrought stress marker gene in alfalfa. Primers for qRT-PCR weredesigned using Primer 5.0 software and are listed in Table 1. Forstatistical analysis, three fully independent biological replicateswere obtained and subjected to real-time PCR in triplicate.Expression levels for all candidate genes were determined usingthe 2�DDCT method. Relative transcript levels were calculated andnormalized as described previously [39].

4.6. Statistical analysis

All the assays described above were repeated at least threetimes on three biological replicates. The data were subjected toanalysis of variance (ANOVA) to discover significant differences,and the least significant difference (LSD) of means was determinedby using the t-test at the level of significance (defined as a ¼ 0.05).

Acknowledgments

Thisworkwas supportedby theKey Projectof ChineseMinistryofEducation (212049), Research Fund for the Doctoral Program ofHigher Education of China (20102325120002), National Natural Sci-ence Foundation of China (31171578) and Technological Innovation

Team Building Program of College of Heilongjiang Province(2011TD005).

References

[1] J. Flexas, H. Medrano, Drought-inhibition of photosynthesis in C3 plants:stomatal and non-stomatal limitations revisited, Ann. Bot. 89 (2002) 183e189.

[2] J.Y. Zhang, C.D. Broeckling, E.B. Blancaflor, M.K. Sledge, L.W. Sumner,Z.Y. Wang, Overexpression of WXP1, a putative Medicago truncatula AP2domain-containing transcription factor gene, increases cuticular wax accu-mulation and enhances drought tolerance in transgenic alfalfa (Medicagosativa), Plant J. 42 (2005) 689e707.

[3] D. Bartels, D. Nelson, Approaches to improve stress tolerance using moleculargenetics, Plant Cell Environ. 17 (2006) 659e667.

[4] C. Bengtson, S. Larsson, C. Liljeberg, Effects of water stress on cuticular tran-spiration rate and amount and composition of epicuticular wax in seedlings ofsix oat varieties, Physiol. Plant. 44 (2006) 319e324.

[5] A. Matsui, J. Ishida, T. Morosawa, Y. Mochizuki, E. Kaminuma, T.A. Endo,M. Okamoto, E. Nambara, M. Nakajima, M. Kawashima, M. Satou, J.M. Kim,N. Kobayashi, T. Toyoda, K. Shinozaki, M. Seki, Arabidopsis transcriptomeanalysis under drought, cold, high-salinity and ABA treatment conditionsusing a tiling array, Plant Cell Physiol. 49 (2008) 1135e1149.

[6] L. Xiong, J.K. Zhu, Abiotic stress signal transduction in plants: molecular andgenetic perspectives, Physiol. Plant. 112 (2001) 152e166.

[7] H. Hu, M. Dai, J. Yao, B. Xiao, X. Li, Q. Zhang, L. Xiong, Overexpressing a NAM,ATAF, and CUC (NAC) transcription factor enhances drought resistance andsalt tolerance in rice, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 12987e12992.

[8] L. Cong, T.Y. Chai, Y.X. Zhang, Characterization of the novel gene BjDREB1Bencoding a DRE-binding transcription factor from Brassica juncea L, Biochem.Biophys. Res. Commun. 371 (2008) 702e706.

[9] H. Sakamoto, K. Maruyama, Y. Sakuma, T. Meshi, M. Iwabuchi, K. Shinozaki,K. Yamaguchi-Shinozaki, Arabidopsis Cys2/His2-type zinc-finger proteinsfunction as transcription repressors under drought, cold, and high-salinitystress conditions, Plant Physiol. 136 (2004) 2734e2746.

[10] C.O. Pabo, E. Peisach, R.A. Grant, Design and selection of novel Cys2His2 zincfinger proteins, Annu. Rev. Biochem. 70 (2001) 313e340.

[11] S. Ciftci-Yilmaz, R. Mittler, The zinc finger network of plants, Cell Mol. Life Sci.65 (2008) 1150e1160.

[12] J. Huang, J.F. Wang, Q.H. Wang, H.S. Zhang, Identification of a rice zinc fingerprotein whose expression is transiently induced by drought, cold but not bysalinity and abscisic acid, Inf. Healthc. 16 (2005) 130e136.

[13] J. Huang, X. Yang, M.M. Wang, H.J. Tang, L.Y. Ding, Y. Shen, H.S. Zhang,A novel rice C2H2-type zinc finger protein lacking DLN-box/EAR-motif playsa role in salt tolerance, Biochim. Biophys. Acta, Gene Struct. Expr. 1769(2007) 220e227.

[14] S.Q. Guo, J. Huang, Y. Jiang, H.S. Zhang, Cloning and characterization of RZF71encoding a C2H2-type zinc finger protein from rice, Yi chuan 29 (2007) 607.

[15] X.Y. Huang, D.Y. Chao, J.P. Gao, M.Z. Zhu, M. Shi, H.X. Lin, A previously un-known zinc finger protein, DST, regulates drought and salt tolerance in rice viastomatal aperture control, Genes Dev. 23 (2009) 1805e1817.

[16] X. Luo, X. Bai, D. Zhu, Y. Li, W. Ji, H. Cai, J. Wu, B. Liu, Y. Zhu, GsZFP1, a newCys/2His2type zinc-finger protein, is a positive regulator of plant tolerance tocold and drought stress, Planta 235 (2012) 1141e1155.

[17] J.C. Kim, S.H. Lee, Y.H. Cheong, C.M. Yoo, S.I. Lee, H.J. Chun, D.J. Yun, J.C. Hong,S.Y. Lee, C.O. Lim, M.J. Cho, A novel cold-inducible zinc finger protein fromsoybean, SCOF-1, enhances cold tolerance in transgenic plants, Plant J. 25(2001) 247e259.

[18] Y.H. Kim, M.D. Kim, S.C. Park, K.S. Yang, J.C. Jeong, H.S. Lee, S.S. Kwak, SCOF-1-expressing transgenic sweetpotato plants show enhanced tolerance to low-temperature stress, Plant Physiol. Biochem. 49 (2011) 1436e1441.

[19] Y. Ge, Y. Li, Y. Zhu, X. Bai, D. Lv, D. Guo, W. Ji, H. Cai, Global transcriptomeprofiling of wild soybean (Glycine soja) roots under NaHCO3 treatment, BMCPlant Biol. 10 (2010) 153.

[20] X. Luo, N. Cui, Y. Zhu, L. Cao, H. Zhai, H. Cai, W. Ji, X. Wang, D. Zhu, Y. Li, Over-expression of GsZFP1, an ABA-responsive C2H2-type zinc finger proteinlacking a QALGGH motif, reduces ABA sensitivity and decreases stomata size,J. Plant Physiol. 169 (2012) 1192e1202.

[21] H. Jin, Y. Sun, Q. Yang, Y. Chao, J. Kang, H. Jin, Y. Li, Screening of genes inducedby salt stress from Alfalfa, Mol. Biol. Rep. 37 (2010) 745e753.

[22] A.J. Delauney, D.P.S. Verma, Proline biosynthesis and osmoregulation inplants, Plant J. 4 (1993) 215e223.

[23] D. Huang, W. Wu, S.R. Abrams, A.J. Cutler, The relationship of drought-relatedgene expression in Arabidopsis thaliana to hormonal and environmental fac-tors, J. Exp. Bot. 59 (2008) 2991e3007.

[24] S.J. Neill, R. Desikan, A. Clarke, R.D. Hurst, J.T. Hancock, Hydrogen peroxideand nitric oxide as signalling molecules in plants, J. Exp. Bot. 53 (2002)1237e1247.

[25] D.A. Meloni, M.A. Oliva, C.A. Martinez, J. Cambraia, Photosynthesis and activityof superoxide dismutase, peroxidase and glutathione reductase in cottonunder salt stress, Environ. Exp. Bot. 49 (2003) 69e76.

[26] R.K. Sairam, G.C. Srivastava, S. Agarwal, R.C. Meena, Differences in antioxidantactivity in response to salinity stress in tolerant and susceptible wheat ge-notypes, Biol. Plant 49 (2005) 85e91.

L. Tang et al. / Plant Physiology and Biochemistry 71 (2013) 22e3030

[27] H. Greenway, R. Munns, Mechanisms of salt tolerance in nonhalophytes, Ann.Rev. Plant Physiol. 31 (1980) 149e190.

[28] J. Liu, J.K. Zhu, Proline accumulation and salt-stress-induced gene expression ina salt-hypersensitive mutant of Arabidopsis, Plant Physiol. 114 (1997) 591e596.

[29] P. Armengaud, L. Thiery, N. Buhot, G. Grenier-de March, A. Savouré, Tran-scriptional regulation of proline biosynthesis in Medicago truncatula revealsdevelopmental and environmental specific features, Physiol. Plant. 120 (2004)442e450.

[30] O. Chyzhykova, T. Palladina, The role of amino acids and sugars in supportingof osmotic homeostasis in maize seedlings under salinization conditions andtreatment with synthetic growth regulators, Ukr. Biokhim. Zh. 78 (2006)124e129.

[31] Z.H. Ren, J.P. Gao, L.G. Li, X.L. Cai, W. Huang, D.Y. Chao, M.Z. Zhu, Z.Y. Wang,S. Luan, H.X. Lin, A rice quantitative trait locus for salt tolerance encodes asodium transporter, Nat. Genet. 37 (2005) 1141e1146.

[32] Sunarpi, T. Horie, J. Motoda, M. Kubo, H. Yang, K. Yoda, R. Horie, W.Y. Chan,H.Y. Leung, K. Hattori, M. Konomi, M. Osumi, M. Yamagami, J.I. Schroeder,N. Uozumi, Enhanced salt tolerance mediated by AtHKT1 transporter-inducedNaþ unloading from xylem vessels to xylem parenchyma cells, Plant J. 44(2005) 928e938.

[33] G.B. Kim, Y.W. Nam, A novel D1-pyrroline-5-carboxylate synthetase gene ofMedicago truncatula plays a predominant role in stress-induced prolineaccumulation during symbiotic nitrogen fixation, J. Plant Physiol. 170 (2013)291e302.

[34] M.V.K. Sivakumar, H.P. Das, O. Brunini, Impacts of present and future climatevariability and change of agriculture and forestry in the arid and semi-aridtropics, Climatic Change 70 (2005) 31e72.

[35] B.S. Mali, S.S. Thengal, P.N. Pate, Physico-chemical characteristics of saltaffected soil from Barhanpur, M.S., India, Ann. Biol. Res. 3 (2012) 4091e4093.

[36] Y. Gibon, F. Larher, Cycling assay for nicotinamide adenine dinucleotides: NaClprecipitation and ethanol solubilization of the reduced tetrazolium, Anal.Biochem. 251 (1997) 153e157.

[37] L. Bates, R. Waldren, I. Teare, Rapid determination of free proline for water-stress studies, Plant Soil 39 (1973) 205e207.

[38] T.A. Cuin, S. Shabala, Exogenously supplied compatible solutes rapidlyameliorate NaCl induced potassium efflux from barley roots, Plant CellPhysiol. 46 (2005) 1924e1933.

[39] E. Willems, L. Leyns, J. Vandesompele, Standardization of real-time PCR geneexpression data from independent biologica replicates, Anal. Biochem. 379(2008) 127e129.