Vol. 163, No. 1

Nucleotide Sequence of the Bacillus stearothermophiluso-Amylase Gene

RYOICHI NAKAJIMA, TADAYUKI IMANAKA,* AND SHUICHI AIBADepartment of Fermentation Technology, Faculty of Engineering, Osaka University, Yamada-oka, Suita-shi,

Osaka 565, JapanReceived 27 December 1984/Accepted 23 April 1985

The nucleotide sequence of the Bacillus stearothermophilus a-amylase gene and its flanking regions wasdetermined. An open reading frame was found, comprising a total of 1,647 base pairs (549 amino acids) andstarting from a GUG codon as methionine. It was shown by NH2-terminal amino acid sequence analysis thatthe extracellular amylase consisted of 515 amino acid residues, which corresponded to a molecular weight of58,779. Thus the NH2-terminal portion of the gene encodes 34 amino acid residues as a signal peptide. Theamino acid sequence deduced from the a-amylase gene was fairly homologous (61%) with that of anothertherniostable amylase from Bacillus amyloliquefaciens.

oc-Amylase (1,4-at-D-glucan glucanohydrolase; EC 3.2.1.1)is a widely distributed secretory enzyme. Various studies ofthis enzyrie have investigated its protein structure andfunction, the mechanism of its secretion through the mem-brane, and its industrial application. Several workers haveeither deduced the amino acid sequences of a-amylase from

stable a-amylase from Bacillus stearothermophilus in bothB. stearothermophilus and Bacillus subtilis and examinedthe gene expression in each host bacterium (1).The purpose of this research was to study the nucleotide

sequence of the cloned ot-amylase gene and its flankingregions in light of gene expression. It has been shown that

t~~~~~~~~~~~~~~~~~~~~~~~BpBR2.OAU

Py 33 5 MdE E

Pv

FIG. 1. Structure of the plasmids pATS, pAT5dP, and pBR322, with relevant restriction sites, and construction of pBR2.OA. Heavy arcsindicate the DNA fragment from B. stearothermophilus. The a-amylase gene is contained in the heavy arc of the 4.8-MDa HindlIl fragmentof pATS (1). BamHI, EcoRI, HindIII, and PvuII cleavage sites are indicated by B, E, H, and Pv, respectively.

nucleotide sequences of cloned genes (3, 7, 8, 14, 16, 17, 21,22) or determined them directly by amino acid analysis (6,19). We have already cloned the structural gene of thermo-

* Corresponding author.

the B. stearothermophilus a-amylase gene is contained in a4.8-megadalton (MDa) HindIlI fragment of plasmid pAT5(resistant to both kanamycin and tetracycline; Kmr TcrAmy') (Fig. 1) (1). pAT5 was partially digested with PvuII,ligated with t4 DNA ligase, and used to transform B. subtilis

401

JOURNAL OF BACTERIOLOGY, JUlY 1985, p. 401-4060021-9193/85/070401-06$02.00/0Copyright © 1985, American Society for Microbiology

on January 22, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

402 NOTES J. BACTERIOL.

NH2 1 sCOOH

PVUll _0.5 o 0.5 1.O 1.5 2.0 HindlillKb

Hind IIIEcoR I

BamH I

PstBcII

HincFrHinf I

Hpa 1 TSau3A

Taq lI-

FokHae III

RsaIAva

Ava 11FIG. 2. Restriction map and sequencing strategy of the PvuII-HindIII fragment of pBR2.OA. The location and size of the x-amylase gene

are shown by the open bar. Arrows indicate the direction of individual sequencing for one or both strands; dotted portions, not determined.Since the DNA fragment prepared from E. coli could not be cleaved by Bcll because of methylation of the specific site, DNA extracted fromB. subtilis was used when the digest with Bcll was needed.

TN106 (arg-15 rM- mM- Amy-) (1). For the transformation cin or tetracycline at 5 ,ug/ml. Amylase-producing coloniesof B. subtilis with plasmid DNA, competent cells were were detected on plates as described elsewhere (1). Amongprepared as described elsewhere (4), and transformants were many transformants which exhibited Kmr Tcs Amy', aselected on L agar or LS agar (1) containing either kanamy- deletion plasmid of 13.2 MDa, designated as pAT5dP, was

-679CTGCCGTTCACCGCAATTTTGTACTCATAGGTCCCGGCTGGCGACGTCCCGGTGAATGTATAAAGCCCATTCCCTTCAT

-600CATGCATCCTCGTCGCCAATGCCCCCGGCTCCCATTCCGCCGTATCGCCCAACTCATCTTGCAAATTGCCCGACTAGCGTGATCGTCCCTGGCTGCGAGCCCGTGGATTrCGGCCGTTCACC

-480GATGCTCCCCATTCCCTACAGCGCTACAACTTCCTCTTTCCTTCCCGCCGCAACCGCCTGCAACGAGTCAATGCCAGCAACAACACCGATGCCCAAAACCAATCATAGCATTCTCCTTGCC

-360CTCTTGATCATCCCCCGCTCCCTTCTCCTTTGTTTGGCCAACTTCCTTCTCTCCTCTCCTTTTTATTTCTTTGTCAATCGTTTCAAAAATGGTTGGTGCAAACGATTTC-ATCMXTCT

-240TTATCTTATACCAATAAACAGAATATTTCAACTATATTCCCCTCTGTTTTTTTATTTTCGATTCACTCCTMCTCAAAATCGTTTAAATTCGATATTGAAACGAT,CACAAATAAAAAT T

-120 -35 regionATAATAGACGTAACCGTTCGAGGTTTTGCTTCCTGTTTACTCTTTTTATGCAATCATTTCCCTTCATTTTTTGGAATCCAAACCGTCGAATGTAACATTTGATTA^S,GGG oGGGCATT

+1 -10 region SD 120

GTGCTAACGTTTCACCGCATCATTCGArAAAGGATGGATGTTCCTGCTCGCGTTTTTGCTCACTQCCTTGCTGTTCTGCCCAACCGGACAGCCCGCCAAGGCTGCCGCACCGTTTAACGGCfMetT.uThrPheHisArgIleIleArgLysGlyTrpMetPheLeuLeuAlaPheLeuLeuThrAlaLeuLeuPheCysProThrGlyGlnProAlaLysAlaAlaProPheAsnGly-34 -20 -1 +1

240ACCATGATGqAGTATTTTGAATGGTACTTGCCGGATGATGGCACGTTATGGACCAAAGTGGCCAATGAAGCCAACAACTTATCCAGCCTTGGCATCACCGCTCTTTGGCTGCCGCCCGCTThrMetMetGlnTyrPhecluTrpTyrLeuProAspAspGlyThrLeuTrpThrLysValAlaAsnGluAlaAsnAsnLeuSerSerLeuGlyIleThrAlaLeuTrpLeuProProAla

20 40

360TATAAAGGAACAAGCCGCAGCCGACGTAGGGTACGGAGTATACGACTTGTATGACCTCGGTGAATTCAATCAAAAAGGGGCCCGTCCGCACAAAATACGGMACAAAAGCTCAATATCTTCAATyrLysGlyThrSerArgSerAspValGlyTyrGlyValTyrAspLeuTyrAspLeuGlyGluPheAsnGlnLysGlyAlaValArgThrLysTyrGlyThrLysAl'aGInTyrLeuGln

60 80

480GCCATTCAAGCCGCCCACGCCGCTGGAATGCAAGTGTACGCCGATGTCGTGTTCGACCATAAAGGCGGCGCCGACGGCACGGAATGGGTGGACGCCGTCGAAGTCAATCCGTCCGACCGCCAlalleGlnAlaAlaHisAlaAlaGlyMetGlnValTyrAlaAspValValPheAspHisLysClyGlyAlaAspGlyThrGluTrpValAspAlaValGluValAsnProSerAspArg

100 120

600AACCAAGAAATCTCGGGCACCTATCAAATCCAAGCATGGACGAAATTTGATTTTCCCGGGCGGGGCAACACCTACTCCAGCTTTAAGTGGCGCTGGTACCATTTTGATGGCGTTGATTGGAsnGlnGluIleSerGlyThrTyrGlnIleGlnAlaTrpThrLysPheAspPheProGlyArgGlyAsnThrTyrSerSerPheLysTrpArgTrpTyrHisPheAspGlyValAspTrp

140 160

720GACGAAAGCCGAAAATTGAGCCGCATTTACAAATTCCGCGGCATCGGCAAAGCGTGGGATTGGGAAGTAGACACGGAAAACGGAAACTATGACTACTTAATGTATGCCGACCTTGATATGAapGluSerArgLysLeuSerArgIleTyrLys8PheArgGlyIleGlyLysAlaTrpAspTrpGluValAspThrGluAsnGlyAsnTyrAspTyrLeuMetTyrAlaAspLeuAspMet

180 200

840

AspHisProGluValValThrGluLeuLysSerTrpGlyLysTrpTyrValAsnThrThrAsnIleAsp2lyPheArgLeuAspAlaValLysHisIleLysPheSerPhePheProAsp220 240

on January 22, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

NOTES 403

identified by screening (Fig. 1). This finding indicates thatthe 2.0-MDa HindIII-PvuII fragment contains the a-amylasegene. The DNA fragment was recloned in Escherichia coliC600-1 (leu-6 thr-J thi-J supE44 lacY) tonA2I hsdR hsdMTrp-) (5) to facilitate the preparation of DNA fragments fornucleotide sequencing. Transformation of E. coli with plas-mid DNA was performed as described earlier (5), andtransformants were selected on L agar containing eitherampicillin or tetracycline at 20 ,ug/ml. The recombinantplasmid (Apr Tcs Amy') thus obtained was designated aspBR2.OA (Fig. 1).The nucleotide sequencing strategy and the restriction

map of the 2.0-MDa PvuII-HindIII fragment of pBR2.OA areshown in Fig. 2. The DNA fragment was treated withbacterial alkaline phosphatase, and the 5' end was labeled inthe presence of [y-32PJATP with T4 polynucleotide kinase.DNA sequencing was performed by the method of Maxamand Gilbert (11). The nucleotide sequence of the a-amylasegene amyT and its flanking regions (3,048 base pairs) isshown in Fig. 3.

Starting from the GTG codon at nucleotide + 1 and termi-nating in a TGA nonsense codon at nucleotide +1648, thesingle open reading frame was composed of 1,647

A

'I

_m

B C

- 74.4 K

--4 9.6 K

-_-37.2 K

o 24.8 K

.;&

FIG. 4. Sodium dodecyl sulfate-polyacrylamide gel electropho-resis of cx-amylase. Lane A, Crude extract; lane B, first DEAE-Sephadex A50 column chromatogram; lane C, second DEAE-Sephadex A50 column chromatogram. Marker proteins used arecytochrome c oligomers (molecular weights 24,800 to 74,400).

960TGGTTGTCTGATGTGCGTTCTCAGACTGGCAAGCCGCTATTTACCGTTGGGGAATATTGGAGCTATGACATCAACAAGTTGCACAATTACATTATGAAAACAAACGGAACCATGTCTTTGTrpLeuSerAspValArgSerGInThrGlyLysProLeuPheThrValGlyGluTyrTrpSerTyrAspIleAsnLysLeuHisAsnTyrIleMetLysThrAsnGlyThrMetSerLeu

260 280

1080TTTGATGCCCCGTTACACAACAAATTTTATACCGCTTCCAAATCAGGGGGCACATTTGATATGCGCACGTTAATGACCMATACTCTCATGAAAGATCAACCAACATTGGCCGTCACCTTCPheAspAlaProLeuHisAsnLysPheTyrThrAlaSerLysgerGlyGlyThrPheAspMetArgThrLeuMetThrAsnThrLeuMetLysAspGlnProThrLeuAlaValThrPhe

300 320

1200GTTGATAATCATGACACCGAACCCGGCCAAGCGCTGCAGTCATGGGTCGACCCATGGTTCAAACCGTTGGCTTACGCCTTTATTCTAACTCGGCAGGAAGGATACCCGTGCGTCTTTTATValAspAsAHisAspThrGluProGlyGlnAlaLeuGlnSerTrpValAspProTrpPheLysProLeuAlaTyrAlaPhelleLeuThrArgGlnGluGlyTyrProCysValPheTyr

340 360

1320GGTGACTATTATGGCATTCCACAATATAACATTCCTTCGCTGAAMAGCAAAATCGATCCGCTCCTCATCGCGCGCAGGGATTATGCTTACGGAACGCAACATGATTATCTTGATCACTCCGlyAspTyrTyrGlyIleProGlnTyrAsnIleProSerLeuLysSerLysIleAspProLeuLeuIleAlaArgArgAspTyrAlaTyrGlyThrGlnHisAspTyrLeuAspHisSer

380 400

1440GACATCATCGGGTGGACAAGGGAAGGGGTCACTGAAAAACCAGGATCCGGACTGGCCGCATTGATCACCGATGGGCCGGGAGGAAGCAAATGV,ATGTACGTTGGCAAACAACACGCCGGAAspIleIleGlyTrpThrArgGluGlyValThrGluLysProGlySerGlyLeuAlaAlaLeuIleThrAspGlyProGlyGlySerLysTrpMetTyrValGlyLysGInHisAlaGly

420 440

1560AAAGTGTTCTATGACCTTACCGGCAACCGGAGTGACACCGTCACCATCAACAGTGATGGATGGGGGGAATTCAAAGTCAATGGCGGTTCGGTTTCGGTTTGGGTTCCTAGAAAAACGACCLysValPheTyrAspLeuThrGlyAsnArgSerAspThrValThrIleAsnSerAspGlyTrpGlyGluPheLysValAsnGlyGlySerValSerValTrpValProArgLysThrThr

460 480

1680GTCTCTACTATCGCTTGGTCGATCACAACCCGACCGTGGACTGATGAATTCGTCCGTTGGACCGAACCACGGTTGGTGGCATGGCCTTGATGCCTGCGATCGCGTTGTAAAGATATTCCGValSerThrIleAlaTrpSerIleThrThrArgProTrpThrAspGluPheValArgTrpThrGluProArgLeuValAlaTrpPro***

500 515

w _____________ 1800CTCTATCATTGAGACAAAAAACACGGCCTT CCCGCCATGAATGGCGGCACAAGGCCGTGTTTGATGTTACCATCCATTTGCTTGCTTCAACTTCTCCTTTGACGGCGTTTCATAGCGGA

v% 1. 1920

2040AGGCGCCCATCCTTCGTTTCCGTTTCCATAGATTGATTGGCTTTTGCACCGTTTGATGATTGTACCGTGATTTTCTTCGCGAGGAAGTGAGACGAAATGACGATTTTCGACCTTTGAACC

2160ATTTCATATATGTCTCAAACATTCCTGGGTTACCATTAAATCCCTAGTTGAAATGCCGTGjTACAGTATATTTGCTTTTTGTCACAACTCCCGGGAGCCGCAATGTTTCATGCACGTTCTC

2280ATGATACAACCGAACGTTTTCATTCATGACCTTCCACTCAACCGATCGTTGATGGCAAAACCCATCGATATCATTGTCGAGATGTTTCACATAGCGATAGGGGCTAATGATCCCAATGCT

2369GAGCCATGCTCCATTGCGAACCAACACGATAtCCCCTTGTTCCATCGTATGGAcAAACGccCAGATTGcGccAAGAGcGAAGccAAGcT

FIG. 3. Nucleotide and amino acid sequence of the a-amylase gene. The nucleotide sequence is presented from the PvuII site (nucleotide-679) to the HindIll site (nucleotide +2369). The nucleotide sequence is numbered from the first base of initiation codon GTG. The aminoacid sequence is shown beneath the nucleotide sequence. The NH2-terminal amino acid sequence of the extracellular amylase, determinedby the Edman tnethod, is indicated by a bar above the line. The first amino acid of the extracellular amylase, Ala, is counted as +1.Hydrophobic amino acids in the signal peptide (amino acids -34 to -1) are indicated by underlining. A probable Shine-Dalgarno (SD)sequence (nucleotides -16 to -9) and a putative promoter (-35 and -10 regions) are shown by solid lines below the nucleotide sequence.The palindromic sequences at the 5' and 3' ends of the a-amylase gene are indicated by arrows above the nucleotide sequence. Asterisks (***)indicate a stop codon.

VOL. 163, 1985

on January 22, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

404 NOTES

A

.

3

_3.c0

:(c

100

Sequence No.200 300

B.stea rothermophilus

400

0

0

N

0 U1)n

0

z0

CA)00

0

nucleotides (Fig. 3). Two more reading frames in the samestrand and three reading frames of the complementary strandwere available, but these entailed numerous stop codonswhen frames were shifted. We concluded that the singleopen reading frame was the most appropriate one to haveencoded the precursor, because the molecular weight of themature a-amylase, calculated (see below) from Fig. 3 as58,779, was within a permissible deviation from the directassessment (molecular weight, 53,000) (1). Accordingly, thepreamylase consists of 549 amino acid residues. The de-duced amino acid sequence is also given in Fig. 3.At 8 bases upstream from the GTG codon, there was a

8-base sequence, AAGGGGGA (-16 to -9), which exhib-

ited complementarity with the 3' end of B. subtilis 16SrRNA, HO-UCUUUCCUCCACUAG (12, 13). The freeenergy of formation of the most stable double-helical Shine-Dalgarno pairing (18) was calculated as -19.6 kcal/mol, andthis 8-base sequence could serve as a ribosome binding sitefor the translation of amylase. A putative promoter(TTGAAA for the -35 region and TATAAT for the -10region) is shown in Fig. 3. This promoter is similar to theconsensus sequence (TTGACA for the -35 region andTATAAT for the -10 region) recognized by the cr RNApolymerase of B. subtilis (2, 13). The distance between thetwo regions was 18 base pairs, the same as that for thekanamycin nucleotidyltransferase gene kan (9). However, it

.-\;, . , .v 'I. s ........................ l . ' . :1. .g.-. 5 , *.,.-....,, .,--.5- *,... *...' * --- *' * '-- -. * *. *. -- * -.-. *- t-- .- *'

_-*.--- ..o--;-. o ---.t t..-t*.0.%.---, * * * *- *-.--* --.. *--* *** .*-,* *** * -. - @ *- -*'-

,'-:'-."',,{"',"s,.',,',,s't,:'"'..'-"-'"."''' ', '"' ;: '-''' :-' {' '.'' ' '-: jt . . . .. s.. .. ,.... .. . '. § .. '.U...w. . ' 8 * 8 ', S 8 , ' * - {

*' %- *' *s .; *,,*';... eS§@. *-. * ..- .-: ,. ' l,.- ;;* --.-,, *@; .2@ 2. *.. ..;* %% - t5..8- .gs\; *- *'.. ;. %*-,*-.-t-.-.- .-; .'-;* *N- .-.-.v w.-X-. *n* . -. rw ....... - - . @ * . * - . ; *- . * , -: * ............................................ .. *. . w ..... .. - - ., .- . -. . . ., ,: .* *.

- :- ' # 8 8 * - J : " * -- * * *- * 2'. * * * * @ * .-_ s @ * *;s .. *@ s *@ @ 4 ;§2 - *- *--- * {- * -- -; - - -- e *; @e .; * ;- * * . * -. . @;. - l. ;FF - - *Z <--@8 @-v t --s aL - -we - - -- *--% ;w w *5--- @'- - ; * ' *-e t * t - @ , - w -* * - s X * * -* * * * * r . . ................................................ *' ;, ..... .... . .. .. . . t .* ... * : ;-:,,-. ., . '@: . . .§. , ...................................... .- .. *- *- *- . *.- *-. *.-- *---:: .. - .: *¢ . .- .: . v v . . . * .. - .. ........ * - . ..,, X,,. . , ,,*, .8 ; .^.,., ,, > *-- s :- ' * ' " * '- ' ' '' . . * - * . .: * . . - - - .,' ..................... * . ': * *; . ':. . * . - .: ...................................... . ' : .- . - .'. * . :. * . - . ,- * .:_ ' - -^ ....... * ** s* r -, .-.-t *- ........................ ... ;.:- . ... * w ,. .. * - - _*. * * . ............ - ... * %,% . ........... v . *; * : , s . ' - .......... * .. . *. w -. , .:. .- * . * ........... . ..

| w , ,; ,, ' r > @ ,. r , @ e ! l- e. * -; * - , * s * .v * w -,; . r; *}- * *; - X -- * t -;-e *-- 2- @2 * -- 2'- ' * * | ;* . @ . . . e ................... . e B . .. .t * *- * t * @- ................. - e @ *. ..... * . * * - .. *^' . **'.>.* t :-* - -*.- . ........................... ... ....... ..... -*. *'- -- tit *''-'''.-e.,{-§ *,t .'r-' ',<i-'i'.' *t'.''t *i 't.- e ¢'t.'**.* *;t ',,, . . t, ... .. . 2. ; . . 2 . t . .. - . X @ .... @ ; .2 . * .2 2 2 . *2@@ 8 . ,* § ; . @ :2 ................. e e- . - e § -- - - @ - - -- *; * @ -- . ,-- - s *- ............................. ---- - - t- - * ;* ' .9; ''§ § ------ *',',*'@ ;-;; *' 9 ;-' -.' ., - ; -. ' 'A' -, ** @ ;N'- *2- ;- -@e *- * '¢-'t* - ;;; < * % e ,<* -*w Z e *oE O--*- x s - ; e N- - § ---- - -- *-_@' * v-*@@*'-*.-wf-'''4- *-,--o'la---2- eetE e-@@ @ @--@w -e-e--rJ* * ' *- - *' " -- *; *---- w- *- '.. *- '. *-. *- * a *-

¢- ;;**; * *; ; *- *- ** *;*@- * ; --;** -e s22--! ' .' .@e . ' !: 1...'! ': .". !.. " . ' ... ' ! .. ' ' '.. " .. .. ' ' '! .-'-.'., . *,, *,. ,.- ;,,' * ,;, . i,.- ............................................... , ;. . ..... , ¢; ... - *'' ' ;'. . * . ' .'.. ,' *-- ' - *' ; - t

* ***@1;|t**** |ttt@t>@ '#;@@; @_ 't***-*-w'000- 0@- -0.0 0*'' , ; - ,**w*.--*@'7e'* w>@0 @ @{ % X

heB * *@@-§-**-* %; *¢ -t *; *-¢--*-Je --- *--*+v *' -+ ** **- * * '2 *w* -*- /-we*... .s .s.... \- .^ s- N *0 .''. ' .' .. ... - . , *.; * *- .-

- @v *'55--*- ***- ;w *X- \-t

III

I

J. BACTERIOL.

I

on January 22, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

VOL. 163, 1985

B

(n

c(_-.

(A.

100

Sequence No.200 300,~~~~ , .,.;I.,t,*^- ., .;,sU, ' I.:: *

*' n,s*-v,, -. *., , *..... -. * - -'-* v X ** *-*..-i

.'% \S. , .,A ,, . . , > t ; *

,'.#t..,',--'--'*'.'.'', * .''. *.'s > -" .-"' '- '.- }'- ' -' -' 'es--' - . -* s - *--- ' - ' ' *

.-','-s.---5---t-',-.'-I I.- I*t ; -'.-''4--4.'-;-.-.'.- '..!:

|~~~ ~e I I|1** | @X 2 §n_.~~~

stearothzermophiluw....2.*-.**-*-s--,**-S.-*'-*

400

00

00

U)0

C

0

z0.

CA)00

0

FIG. 5. Computer search for homologous area of the amino acid sequence. (A) B. stearothermophilus versus B. amyloliquefaciens; (B) B.stearothermophilus versus B. subtilis. Areas surrounded by boxes indicate homologous regions among the three Bacillus a-amylases.

appeared to be slightly longer than the consensus distance of17 base pairs in B. subtilis (13).Examination of the nucleotide sequence close to the 5' and

3' regions of the ox-amylase gene amyT reveals one and twopalindromic sequences in these regions, respectively(searched by computer) (Fig. 3). These sequences could beturned into stable hairpin structures when transcribed intomRNA and may function as transcription termination sig-nals. Although we do not have any concrete evidence toshow where the transcription of a-amylase mRNA starts orterminates, it appears most likely that a-amylase is trans-lated from a monocistronic mRNA.

To determine the NH2-terminal amino acid sequence ofmature a-amylase, extracellular amylase was purified from aculture broth of B. stearothermophilus AN174 (streptomycinresistance, Amy-) containing pAT9 (Kmr Tcr amyT+) (1) asfollows. The plasmid carrier strain was cultivated in 1 liter ofL broth (1) containing kanamycin (5 ,ug/ml) at 55°C for 24 h.After centrifugation (8,000 x g, 10 min) of the culture broth,ammonium sulfate (70% saturation) was added to the super-natant, and the solution was kept at 4°C overnight. Aftercentrifugation (15,000 x g, 30 min), the precipitate wasdissolved in 20 ml of 50 mM Tris hydrochloride buffer (pH7.5) and dialyzed against the same buffer. The enzyme

NOTES 405

on January 22, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

406 NOTES

solution was applied to a column (2 by 40 cm) of DEAE-Sephadex A50 that had been equilibrated with the samebuffer. Most of the amylase activity was eluted in the voidvolume. The enzyme fractions were pooled and concen-trated to 5 ml by ultrafiltration (Toyo Ultrafilter UK-50,Toyo Roshi Co., Tokyo, Japan). The enzyme solution wasagain subjected to the same column chromatography. Activefractions were pooled, and the enzyme was precipitated with70% saturated ammonium sulfate. The precipitate was col-lected by centrifugation and dissolved in 2 ml of distilledwater. The enzyme solution was dialyzed against distilledwater at 4°C for 3 days and then freeze-dried.Sodium dodecyl sulfate-polyacrylamide gel electrophore-

sis of crude extract and purified amylase was performed asdescribed earlier (9) (Fig. 4). The NH2-terminal amino acidsequence of the purified amylase was determined manuallyby Edman degradation as described previously (9). The firstfive amino acids were Ala-Ala-Pro-Phe-Asn. The sequenceof the five amino acids completely matched that deducedfrom the nucleotide sequence (+103 to +117), and the firstamino acid, Ala, was counted as + 1. Thus, the extracellulara-amylase consists of 515 amino acid residues (molecularweight of 58,779). These results imply that the NH2-terminalportion of the amyT gene encodes a 34-amino acid-longsignal peptide. Indeed, the amino acid sequence, containingpositively charged residues of His, Arg, and Lys near thebeginning, followed by large hydrophobic regions (under-lined in Fig. 3) around the center, is consistent with a generalpicture of the signal peptide (20).The amino acid sequence of the thermostable a-amylase

was compared with those of other Bacillus amylases by adot-matrix plot (15) with the aid of an NEC PC-8001 com-puter (Nippon Electric Co., Japan). The sequence of a-amylase from B. stearothermophilus yas fairly homologous(61%) with that of another thermostable a-amylase fromBacillus amyloliquefaciens (10, 17) (Fig. SA). In contrast,the amino acid sequence of B. stearothermophilus amylasewas not homologous with that of the thermolabile a-amylasefrom B. subtilis (22) (Fig. 5B). However, two highly homolo-gous regions were found by a dot-matrix plot (Fig. 5). Sincethese two regions were shared in these amylases examinedhere, it was inferred that the two regions might have func-tioned as active sites, substrate binding sites, or both. Thesefeatures might present a clue for further study of the basicnature of enzyme activity.

We thank F. Sakiyama, Institute for Protein Research, OsakaUniversity, for the determination of the NH2-terminal amino acidsequence of a-amylase.

LITERATURE CITED

1. Aiba, S., K. Kitai, and T. Imanaka. 1983. Cloning and expres-sion of thermostable a-amylase gene from Bacillusstearothermophilus in Bacillus stearothermophilus and Bacillussubtilis. Appl. Environ. Microbiol. 46:1059-1065.

2. Fliss, E. R., and P. Setlow. 1984. Complete nucleotide sequenceand start sites for transcription and translation of the Bacillusmegaterium protein C gene. J. Bacteriol. 158:809-813.

3. Hagenbuchle, O., R. Bovey, and R. A. Young. 1980. Tissue-specific expression of mouse a-amylase genes: nucleotide se-quence of isoenzyme mRNAs from pancreas and salivary gland.Cell 21:179-187.

4. Imanaka, T., M. Fujii, and S. Aiba. 1981. Isolation and charac-terization of antibiotic resistance plasmids from thermophilicbacilli and construction of deletion plasmids. J. Bacteriol.146:1091-1097.

5. Imanaka, T., T. Tanaka, H. Tsunekawa, and S. Aiba. 1981.Cloning of the genes for penicillinase, penP and penI, ofBacillus licheniformis in some vector plasmids and their expres-sion in Escherichia coli, Bacillus subtilis, and Bacilluslicheniformis. J. Bacteriol. 147:776-786.

6. Kluh, I. 1981. Amino acid sequence of hog pancreatic a-amylaseisozyme I. FEBS Lett. 136:231-234.

7. MacDonald, R. J., M. M. Crerar, W. F. Swain, R. L. Pictet, G.Thomas, and W. J. Rutter. 1980. Structure of a family of ratamylase genes. Nature (London) 287:117-122.

8. MacDonald, R. J., S. J. Stary, and G. H. Swift. 1982. Twosimilar but nonallelic rat pancreatic trypsinogens: nucleotidesequences of the cloned cDNAs. J. Biol. Chem. 257:9724-9732.

9. Matsumura, M., Y. Katakura, T. Imanaka, and S. Aiba. 1984.Enzymatic and nucleotide sequence studies of a kanamycin-in-activating enzyme encoded by a plasmid from thermophilicbacilli in comparison with that encoded by plasmid pUB110. J.Bacteriol. 160:413-420.

10. Matsuzaki, H., K. Yamane, K. Yamaguchi, Y. Nagata, and B.Maruo. 1974. Hybrid ox-amylases produced by transformants ofBacillus subtilis. I. Purification and characterization of extracel-lular a-amylases produced by the parental strains and trans-formants. Biochim. Biophys. Acta 365:235-247.

11. Maxam, A. M., and W. Gilbert. 1980. Sequencing end-labeledDNA with base-specific chemical cleavages. Methods Enzymol.65:499-560.

12. McLaughlin, J. R., C. L. Murray, and J. C. Rabinowitz. 1981.Unique features in the ribosome binding site sequence of theGram-positive Staphylococcus aureus P-lactamase gene. J.Biol. Chem. 256:11283-11291.

13. Moran, C. P., Jr., N. Lang, S. F. J. LeGrice, G. Lee, M.Stephens, A. L. Sonenshein, J. Pero, and R. Losick. 1982.Nucleotide sequences that signal the initiation of transcriptionand translation in Bacillus subtilis. Mol. Gen. Genet. 186:339-346.

14. Nakamura, Y., M. Ogawa, T. Nishide, M. Emi, G. Kosaki, S.Himeno, and K. Matsubara. 1984. Sequences of cDNAs forhuman salivary and pancreatic a-amylases. Gene 28:263-270.

15. Novotny, J. 1982. Matrix program to analyze primary structurehomology. Nucleic Acids Res. 10:127-131.

16. Rogers, J. C., and C. Milliman. 1983. Isolation and sequenceanalysis of a barley a-amylase cDNA clone. J. Biol. Chem.258:8169-8174.

17. Takkinen, K., R. F. Pettersson, N. Kalkkinen, I. Palva, H.Soderlund, and L. Kaariainen. 1983. Amino acid sequence ofoa-amylase from Bacillus amyloliquefaciens deduced from thenucleotide sequence of the cloned gene. J. Biol. Chem.258:1007-1013.

18. Tinoco, I., P. N. Borer, B. Dengler, M. D. Levine, 0. C.Uhlenbeck, D. M. Crothers, and J. Gralla. 1973. Improvedestimation of secondary structure in ribonucleic acids. Nature(London) New Biol. 246:40-41.

19. Toda, H., K. Kondo, and K. Narita. 1982. The complete aminoacid sequence of Taka-amylase A. Proc. Jpn. Acad. 58:208-212.

20. Watson, M. E. E. 1984. Compilation of published signal se-quences. Nucleic Acids Res. 12:5145-5164.

21. Yamazaki, H., K. Ohmura, A. Nakayama, Y. Takeichi, K.Otozai, M. Yamasaki, G. Tamura, and K. Yamane. 1983.ca-amylase genes (amyR2 and amyE+) from an ot-amylase-hyperproducing Bacillus subtilis strain: molecular cloning andnucleotide sequences. J. Bacteriol. 156:327-337.

22. Yang, M., A. Galizzi, and D. Henner. 1983. Nucleotide sequenceof the amylase gene from Bacillus subtilis. Nucleic Acids Res.11:237-249.

J. BACTERIOL.

on January 22, 2020 by guesthttp://jb.asm

.org/D

ownloaded from