INFECTION AND IMMUNITY, Sept. 2005, p. 5988–5994 Vol. 73, No. 90019-9567/05/$08.00�0 doi:10.1128/IAI.73.9.5988–5994.2005Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Both Corynebacterium diphtheriae DtxR(E175K) and Mycobacteriumtuberculosis IdeR(D177K) Are Dominant Positive Repressors of

IdeR-Regulated Genes in M. tuberculosisYukari C. Manabe,1,2,3* Christine L. Hatem,1 Anup K. Kesavan,1

Justin Durack,1 and John R. Murphy4

Department of Medicine, School of Medicine,1 and Departments of Molecular Microbiology and Immunology2 andInternational Health,3 Bloomberg School of Public Health, The Johns Hopkins University, Baltimore, Maryland,

and Section of Biomolecular Medicine, Boston University School of Medicine, Boston, Massachusetts4

Received 4 January 2005/Returned for modification 11 February 2005/Accepted 27 April 2005

The diphtheria toxin repressor (DtxR) is an important iron-dependent transcriptional regulator of knownvirulence genes in Corynebacterium diphtheriae. The mycobacterial iron-dependent repressor (IdeR) is phylo-genetically closely related to DtxR, with high amino acid similarity in the DNA binding and metal ion bindingsite domains. We have previously shown that an iron-insensitive, dominant-positive dtxR(E175K) mutant allelefrom Corynebacterium diphtheriae can be expressed in Mycobacterium tuberculosis and results in an attenuatedphenotype in mice (Y. C. Manabe, B. J. Saviola, L. Sun, J. R. Murphy, and W. R. Bishai, Proc. Natl. Acad. Sci.USA 96:12844–12848, 1999). In this paper, we report the M. tuberculosis IdeR(D177K) strain that has thecognate point mutation. We tested four known and predicted IdeR-regulated gene promoters (mbtI, Rv2123,Rv3402c, and Rv1519) using a promoterless green fluorescent protein (GFP) construct. GFP expression fromthese promoters was abrogated under low-iron conditions in the presence of both IdeR(D177K) andDtxR(E175K), a result confirmed by reverse transcription-PCR. The IdeR regulon can be constitutivelyrepressed in the presence of an integrated copy of ideR containing this point mutation. These data also suggestthat mutant IdeR(D177K) has a mechanism similar to that of DtxR(E175K); iron insensitivity occurs as aresult of SH3-like domain binding interactions that stabilize the intermediate form of the repressor afterancillary metal ion binding. This construct can be used to elucidate further the IdeR regulon and its virulencegenes and to differentiate these from genes regulated by SirR, which does not have this domain.

DtxR (diphtheria toxin repressor) is an iron-dependent re-pressor in Corynebacterium diphtheriae that regulates the ex-pression of the diphtheria toxin gene tox, an important viru-lence factor, as well as other genes important in ironacquisition and homeostasis. DtxR is the prototype for a grow-ing family of iron-regulated bacterial proteins in many patho-genic prokaryotes such as Staphylococcus aureus (1, 11), Trepo-nema pallidum (10, 22), Streptococcus gordonii (13, 15), andBacillus subtilis (23). In mycobacteria, the iron-regulated tran-scriptional repressor IdeR (iron-dependent repressor) is a ho-mologue of DtxR (5) and is essential in Mycobacterium tuber-culosis (26). IdeR and DtxR show remarkable amino acidsimilarity (88%) in the first 140 amino acids and are identicalin the metal ion binding, DNA binding, and protein-proteininteraction domains (34) (Fig. 1). Both proteins contain ahelix-turn-helix domain critical for binding to a palindromicDNA sequence that is well conserved (21). Evidence for cross-genus functional complementation has been published previ-ously and shows by gel shift assay that mycobacterial IdeR isable to bind to the corynebacterial tox operator region in ametal cation-dependent manner (27).

Using PCR mutagenesis, Sun and colleagues isolated astrain with a point mutation in dtxR that resulted in a single

amino acid substitution (glutamic acid to lysine) at position 175[DtxR(E175K)]. Merodiploid strains containing 1 wild-typecopy of dtxR and the mutant allele had a dominant hyperre-pressor phenotype under low-iron conditions (29). In a previ-ous paper, we showed by Western blot analysis that this mutantcorynebacterial gene could be expressed in M. tuberculosis.When tested in vivo in mice, the DtxR(E175K)-expressing M.tuberculosis strain was attenuated, suggesting that IdeR con-trols genes essential for virulence in M. tuberculosis (19). Thespecific IdeR-regulated virulence genes responsible for thisattenuation have yet to be fully elucidated; specific genes, suchas a siderophore gene (fxbA) (6), a histidine synthesis gene(hisE) (25, 26), Rv3402c, mycobactin genes (mbtA, mbtB,mbtI), and bacterioferritin genes (bfd, bfrA) (9), have beenreported to be well regulated.

The amino acid substitution occurs in the C-terminal srchomology 3-like (SH3) domain of DtxR (3, 20, 33) that inter-acts with the polyprolyl tether region (residues 125 to 139)linking the conserved N-terminal with the more divergent C-terminal domain (18, 35). Crystal structures of both DtxR andIdeR have confirmed the structures in the N-terminal domain,including the helix-turn-helix motif that binds the palindromicDNA iron box consensus sequence, ancillary and primary ironbinding sites (21), and multiple hydrophobic amino acid resi-dues important for dimer formation. Although the C-terminaldomain is less well conserved, crystallography has confirmedthat the secondary structures forming the SH3-like fold (7) andits interaction with the ancillary metal ion binding site exist in

* Corresponding author. Mailing address: Johns Hopkins UniversitySchool of Medicine, 1503 E. Jefferson Street, Rm. 108, Baltimore, MD21231-1004. Phone: (410) 614-6600. Fax: (410) 614-8173. E-mail:ymanabe@jhmi.edu.

5988

on August 31, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

both DtxR and IdeR (35). Nuclear magnetic resonance anal-ysis has confirmed that the mutant DtxR(E175K) adopts amore ordered conformation through binding of the SH3-likedomain to the polypropyl tether region between the N- andC-terminal domains (17).

In this work, we have constructed the IdeR(D177K) mutant,which has a point mutation in the amino acid similar to that inDtxR(E175K). Using a promoterless green fluorescent protein(GFP) construct in Mycobacterium smegmatis and M. tubercu-losis, we have shown that the upregulation of IdeR-regulatedgenes in the absence of iron is abrogated by the presence ofIdeR(D177K). IdeR(D177K) also has an iron-insensitive,dominant-positive repressor phenotype. These data are cor-roborated by reverse transcription-PCR (RT-PCR) showingthat both the cognate IdeR mutant and the DtxR mutant resultin hyperrepression of IdeR-regulated genes. Taken together,these data suggest that mutant IdeR(D177K) has a mechanismsimilar to that of DtxR(E175K), stabilizing the intermediateform of the repressor after ancillary metal ion binding andresulting in iron insensitivity through SH3-like domain bindinginteractions.

MATERIALS AND METHODS

Plasmids, strains, and culture. The bacterial strains and plasmids used in thisstudy are listed in Table 1. Escherichia coli cultures were grown in LB or Luriaagar supplemented with ampicillin (100 �g/ml) or hygromycin (200 �g/ml). M.

tuberculosis CDC1551 and M. smegmatis cultures were grown in standardMiddlebrook 7H9 broth (Difco Laboratories, Detroit, MI), supplemented withalbumin, dextrose, and catalase (Becton Dickinson, Inc., Sparks, MD), 0.1%glycerol, and 0.05% Tween 80 and were incubated at 37°C in roller bottles.

Construction of IdeR(D177K) integrating vector. The 1.2-kb ideR gene wasPCR amplified using Taq polymerase (Sigma-Aldrich, St. Louis, MO) fromH37Rv genomic DNA and cloned into a TA cloning vector (Invitrogen, Carls-bad, CA). This plasmid was used as a template to generate the two fragments ofideR on either side of the site to be mutated (codon 177; base pair change froma guanine to an adenosine). The single-base-pair mutation was engineered intothe primers for both the left (1-kb fragment using primers ider1 [5�-GGAATTCCTCCGGCATTCCAATCGACAAG] and idermut1 [5�-CGTGATCAGGTCGATTTTGCCCTGAACGTG]) and right (165-bp fragment using primers ider2[5�-GGAATTCCGCAGGGTAGGTGCGGGTTAGC] and idermut 3 [5�-GAGCACGTTCAGGGCAAAATCGACCTGATC]) sides of ideR. PCR productswere gel purified using the QiaexII bead purification system (QIAGEN, Valen-cia, CA). Equimolar amounts of both fragments were used as a template for anew PCR using ider1 and ider2 as primers. A 1.2-kb product (idermut) waspurified and cloned into a TA vector (Invitrogen, Carlsbad, CA). The insert inthis plasmid was sequenced to confirm the ideR mutation. A PacI 1.2-kb fragmentwas purified and ligated into pCK0601 (see below). The integration of themutated gene into the attB site of M. tuberculosis was confirmed by PCR usingprimers unique to the pCK0601 vector.

To make pCK0601, plasmid pMH94 (16) was digested with KpnI, filled in withKlenow fragment, and then ligated with PacI linkers (New England Biolabs,Beverly, MA) to make pCK0246. The kanamycin resistance cassette was re-moved by digesting pCK0246 with HindIII and filling in the ends with Klenowpolymerase. A 1.7-kb PstI-BamHI cassette carrying the Streptomyces hygroscopi-cus hyg gene from p16R1 (8) was cloned into pUC19 to make pHyg1. A 1.9-kbfragment containing the hygromycin cassette was cut from pHJ1 with HindIII

FIG. 1. Amino acid alignment of C. diphtheriae DtxR, M. tuberculosis SirR, and M. tuberculosis IdeR. Heavy line shows the helix-turn-helixdomain, with short arrows indicating amino acids important in DNA contact. Triangle-circles show amino acids in the primary metal binding site;long arrows mark those amino acids in the ancillary metal binding site. The bases mutated for this study are outlined in bold.

VOL. 73, 2005 REPRESSORS OF IdeR-REGULATED GENES IN M. TUBERCULOSIS 5989

on August 31, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

and BamHI, filled in with Klenow fragment, and then ligated to pCK0246 withthe kanamycin cassette removed as described above to construct pCK0601.

DtxR and IdeR protein overexpression and purification. DtxR protein wasoverexpressed and purified as previously described (31). IdeR protein was over-expressed in E. coli using the pTrc99 plasmid (Amersham Pharmacia Biotech,Piscataway, NJ) grown in a fermenter with IPTG (isopropyl-�-D-thiogalactopy-ranoside) induction in E. coli. Bacteria were harvested by centrifugation. Bacte-rial pellets were lysed by sonication, centrifuged, applied to a 5.0-cm by 10-cmDEAE-cellulose column, and finally batch eluted with 20 mM Tris–500 mMNaCl (pH 8) buffer (150 ml). The DEAE eluate was loaded onto a Ni2� affinitycolumn (25 ml) and then washed with 20 mM Tris-HCl–500 mM NaCl (pH 8)buffer (100 ml). The bound proteins were then eluted in 20 mM Tris-HCl–2 mMimidazole (pH 8) buffer. The eluate was further purified using a DEAE-Sepha-rose column (1.6 cm by 20 cm). Purified protein was stored in 20 mM Tris-Cl (pH7.5)–5 mM dithiothreitol buffer and stored at �80°C until use.

DNA electromobility shift assay. The gel electrophoresis mobility shift assaywith purified DtxR (250 ng) and IdeR (250 ng) proteins was performed aspreviously described (19, 30). Radiolabeled tox promoter-operator region DNAcontaining the DtxR box was generated by PCR using 100 ng of 32P-end-labeledprimer mixed with 150 ng of unlabeled primer and template DNA from gel-purified 100-bp cold fragments containing the DtxR box PCR amplified with theprimers listed in Table 2. Binding reactions were carried out in 10 mM Tris-HCl(pH 7.4), 5 mM MgCl2, 50 mM KCl, 1 mM dithiothreiotol, 5% glycerol, 50 �g/mlcalf thymus DNA, and 5 �g of bovine serum albumin. Freshly prepared MnSO4

was added at 125 �M. For the divalent metal ion-free sample, the divalent metaliron chelator EDTA at a concentration of 0.1 mM was added to the reactionsolution. Binding reactions were equilibrated for 30 min. Samples were imme-diately submitted to electrophoresis at 200 V on a 5% nondenaturing polyacryl-amide gel in 0.5� Tris-borate-EDTA buffer.

Quantification of iron-dependent promoter activity using a FACS. The orig-inal in silico searches to identify candidate genes transcriptionally regulated byIdeR were done with the unannotated sequence of H37Rv by using the DtxRconsensus sequence (TTAGGTTAGCCTAACCTTT) and allowing for as manyas 4 mismatches. Iron boxes that were within 500 bp of a start codon predictedby MacVector were accepted. Later, when TubercuList (Pasteur Institute data-base of the M. tuberculosis genome, available at http://genolist.pasteur.fr/TubercuList/) was published, we confirmed those iron boxes that were within 150 bp ofa predicted gene and eliminated all others. By using the search tool in Tubercu-List, all of the iron boxes we tested could be selected by searching for AGGseparated by 8 to 9 bp followed by CCT. Promoters containing iron boxes ofcandidate genes were cloned in front of a promoterless gfpmut3 (enhanced GFP[eGFP]) shuttle vector optimized for fluorescence-activated cell sorting (FACS),pFPV27 (24). Primers are listed in Table 2. Each candidate promoter-GFPvector was transformed into four different bacterial strains: M. smegmatis, M.tuberculosis, M. tuberculosis DtxR(E175K), and M. tuberculosis IdeR(D177K). M.tuberculosis DtxR(E175K) is an M. tuberculosis strain containing an integratedsingle copy encoding the corynebacterial DtxR(E175K), which has a single aminoacid change from glutamic acid to lysine, conferring a positive-dominant pheno-type on the parent strain, CDC1551 (19). M. tuberculosis IdeR(D177K) is an M.tuberculosis strain with an integrated copy of the mycobacterial ideR gene mu-tated in the homologous amino acid, changing the aspartic acid to a lysine. Anhsp60 promoter-driven eGFP in pFPV27 was used as a positive control (a kindgift of Lalita Ramakrishnan). Strains were cultivated in glycerol alanine saltsmedium with or without iron (4). The degree of fluorescence of each bacterialstrain in media with and without iron was quantified using FACS (see Fig. 2).Each fluorescence reading was the average of triplicate readings, and each strainwas biologically replicated twice. Readings were taken on the day of peak fluo-rescence of the wild-type strain, which was day 4 for mbtI, Rv1519, and Rv3402c,

TABLE 1. Bacterial strains and plasmids used in this study

Strains and plasmids Description Reference

PlasmidspFPV27 Ampr Kanr 24pMH94 Ampr Kanr 16pCK0601 Ampr Hygr This paperpRS551-toxPO Ampr toxPO-lacZ 2

StrainsE. coli DH5�M. tuberculosis CDC1551 Virulent clinical isolate 32M. smegmatis mc261-2c ept1 mutation conferring high efficiency of transformation 28

M. tuberculosis IdeR(D177K) M. tuberculosis CDC1551 containing an integrated copy of IdeR(D177K)point mutation

This paper

M. tuberculosis DtxR(E175K) M. tuberculosis CDC1551 containing an integrated corynebacterial dtxRwith its own promoter with a dtxR point mutation

19

TABLE 2. Primers for PCR amplification of iron-dependent promoters

Promoter Forward primer (5�-) Reverse primer (5�-)

mbtI GATATCCGGTGGCGAGTAATCGGTC GGATCCCGACGAGCATTTTCTTCCAGTCRv2123 GGATCCAGTGCGTCGTTGGATTCGTG GATATCAACTGCGAACCACATCGGGAAGRv3402c CCCGATATCTGAACGACGGCATCAGCAGGTAGCG CCCGGATCCACGAATGAGGCGGGTGAGACACRv1519 GGATCCAGCGGCGGACGCACTTGAAG GATATCAACTGGCAGCGACACGATTChisE GATATCAACTGCGAACCACATCGGGAAG GGATCCAGTGCGTCGTTGGATTCGTGRv2417C CCCGATATCCGTATCGGTCACCACCACAACG CCCGGATCCATCATCGCATCGCTGCCCTCRv2366c CCCGATATCGCTGAAGTGGTATCGGATGAAAAC CCCGGATCCGGAAAAAGAGATGTTCGCCCTGRv2869c CCCGATATCGGCAGATAGCGAGGTTCATTCC CCCGGATCCAAGAAGCAGCAGCGGCGTTCCTTGRv0127 CCCGGATCCCGTGCTCTGTGTCAACAACCTGTC CCCGATATCCTCAAAATCCCATCCGACGAGfadE30 GATATCCGTATTCCTCGTAGAACGCCAC GGATCCCGGACGCTCCTAACAAAGCAAGRv1396c GATATCAAACGCCGCCGCCTGAGTTC GGATCCTGACACCGACGACACCTCGCpheA GATATCTCACAACCCTAACGACGCAAAG GGATCCCGCATAGTCAGTCAACTCCAGCAGtox GGATCCGCAGAATTCTGCAGGGCATTGA GATATCCATGGATCCAGGACTCATAAA

5990 MANABE ET AL. INFECT. IMMUN.

on August 31, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

and day 2 for Rv2123. Ratios were calculated by dividing the peak fluorescenceby the baseline fluorescence before iron was depleted. P values could not bedetermined, because only two biologic replicates were done.

RT-PCR verification of abrogation of IdeR-regulated gene transcripts withexpression of IdeR(D177K). Wild-type CDC1551, M. tuberculosis DtxR(E175K),and M. tuberculosis IdeR(D177K) were grown in Middlebrook 7H9 broth tomid-log phase (optical density at 600 nm [OD600], 0.7). Cells were pelleted,washed with phosphate-buffered saline, and then resuspended to an OD600 of 0.2in minimal medium (26) with either low iron (2 �M) or high iron (200 �M).Thirty minutes after growth in iron-poor and iron-rich media, 50 ml of cells waspelleted and suspended in Trizol. RNA was extracted according to previouslypublished methods (14). RNA was reverse transcribed into cDNA. The tran-scripts were quantified using RT-PCR with the iCycler (Bio-Rad, Hercules, CA)and SYBR green fluorescence. Quantification of the transcripts for the genes ofinterest Rv1519, mbtI, Rv2123, and Rv3402c was performed. The number ofcopies of the gene by RT-PCR was calculated based on the standard curve anddivided by the number of copies of 16S rRNA. This calculation was done forstrains grown under iron-poor conditions and under iron-rich conditions, and theiron-poor values were divided by the iron-rich values to calculate the inductionratio.

RESULTS

GFP reporter assay. Twelve potential IdeR-regulated pro-moters were identified using MacVector and the TubercuList

sequence-searching programs. Because this search was doneprior to the publication of other known IdeR-regulated pro-moters such as fxbA, mbtA, mbtB, bfd, and bfrA, these promot-ers were not identified by our screen and therefore are notincluded in our analysis. Using the promoterless eGFP con-struct, we tested all of these promoters for upregulation iniron-poor minimal medium compared to iron-replete minimalmedium. Four promoters were found to be iron regulated inboth M. smegmatis and M. tuberculosis by use of the FACSassay. These genes (mbtI, Rv2123, Rv3402c, and Rv1519) arelisted with their respective iron boxes in Table 3; Table 4 showsan alignment to the consensus sequence. Four other promoters(hisE, Rv2869, fadE30, Rv0127) constitutively expressed GFPat high levels in M. smegmatis but had iron-regulated expres-sion of GFP in M. tuberculosis by use of our FACS assay. Theother three promoters (Rv1396c, Rv2366c, and Rv2417c) wereonly minimally induced under iron-poor conditions. pheA wasminimally induced in both M. smegmatis and M. tuberculosis,but cultures suffered from poor growth and could not be in-terpreted (Tables 3 and 4).

TABLE 3. IdeR regulation of selected iron boxes

Gene promoterGFP expression inductiona in:

Iron box sequence

Gel shift assayresultb Strandc and

no. of bp fromORFM. smegmatis M. tuberculosis IdeR DtxR

IdeR regulatedmbtI I�� I��� GTAGGTTAGGCTACATTTA � � Minus, �25Rv2123 I�� I�� ATAGGTTAGGCTACCCTAG � � Plus, �50Rv3402c I��� I��� TGAGGTTAGCCTTACCTCT � � Minus, �140Rv1519 I�� I�� CAAGGTAAGGCTAGCCTTA � � Plus, �49

Iron inducible inM. tuberculosis only

hisE C��� I��� CTAGGGTAGCCTAACCTAT � � Plus, �95Rv2869c C��� I�� CGAGGT-GTCAGGACCTTT (�) (�) Minus, �18fadE30 C��� I�� GTAGGTTAGCCTACAGGGC (�)d (�) Minus, �19Rv0127 C� I� TGAGGT-GGGGGCACCTCC (�)d (�) Plus, �148

Controlstox NT Poor growth TTAGGATAGCTTTACCTAA � � NAhsp60 C���� C���� —e NAEmpty � � —e NA

a C, constitutive; I, inducible; NT, not tested. Plus signs represent qualitative assessments of expression levels; minus signs, no expression.b �, iron box promoter DNA fragments that were retarded in the gel shift assay; (�), no mobility shift with the addition of protein.c Minus, encoded on the minus strand; plus, encoded on the plus strand. ORF, open reading frame; NA, not applicable.d Gel shift with IdeR showed a 10-fold increase in the protein level.e —, no iron box.

TABLE 4. Alignment of the iron boxes in the promoter-operator regions of selected genes

GeneBase in the indicated gene corresponding to the base in the consensus sequencea

T W A G G T W A G S C T W A C C T W A

tox T T A G G A T A G C T T T A C C T A ARv1519 C A A G G T A A G G C T A G C C T T ARv2123 A T A G G T T A G G C T A C C C T A GRv3402c T G A G G T T A G C C T T A C C T C TmbtI G T A G G T T A G G C T A C A T T T A

hisE C T A G G G T A G C C T A A C C T A TRv2869c C G A G G T . G T C A G G A C C T T TRv0127 T G A G G T . G G G G G C A C C T C CfadE30 G T A G G T T A G C C T A C A G G G C

a Dots indicate gaps in the sequence. “W” stands for “A” or “T”; “S” stands for “G” or “C.” Underlined bases are those that directly interact with the IdeR dimer.

VOL. 73, 2005 REPRESSORS OF IdeR-REGULATED GENES IN M. TUBERCULOSIS 5991

on August 31, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Next we transformed M. tuberculosis DtxR(E175K) and M.tuberculosis IdeR(D177K) with each of the four promoter-GFPconstructs that were iron regulated in both M. smegmatis andM. tuberculosis. The relative upregulation of promoter activitywas blunted in M. tuberculosis strains expressing either domi-nant repressor (Fig. 2).

Gel retardation assay with IdeR and DtxR. The same fourpromoters (mbtI, Rv1519, Rv2123, Rv3402c) also showed di-valent cation-dependent binding to both DtxR and IdeR in anin vitro gel retardation assay. By using 250 ng of purifiedprotein, each promoter-operator iron box was retarded by bothIdeR and DtxR (Fig. 3). The corynebacterial tox iron box isshown in lanes 1 and 2 as a positive control.

Non-IdeR-regulated promoters that are iron sensitive. Theother three promoters (Rv2869, fadE30, Rv0127) constitutive-ly-expressing GFP at high levels in M. smegmatis, but with

iron-regulated expression of GFP in M. tuberculosis by ourFACS assay, did not exhibit the same affinity of binding in thegel retardation assay as the first four promoters and boundneither IdeR nor DtxR under high-salt conditions with 250 ngof purified protein. Increasing the protein concentration 10-fold led to binding of both the fadE30 and Rv0127 promoters,however (data not shown). Interestingly, the nucleotide se-quence identity between this second set of promoters was alsolower. hisE was excluded from this analysis because its pro-moter-operator region is the same as that of Rv2123.

Transcriptional expression of IdeR-regulated promoters inwild-type M. tuberculosis, M. tuberculosis DtxR(E175K), and M.tuberculosis IdeR(D177K) by RT-PCR. To confirm that thefour promoters (mbtI, Rv1519, Rv2123, and Rv3402c) werepart of the IdeR regulon and were hyperrepressed in the pres-ence of mutant DtxR(E175K) or IdeR(D177K), we quantifiedthe transcriptional message in both high- and low-iron growthmedia by using RT-PCR. The expression of the Rv1519, mbtI,and Rv3402c genes relative to the expression of 16S RNA wasupregulated under iron-poor conditions. This upregulation wasabrogated in the presence of either the mutant IdeR or themutant DtxR strain constructs, corroborating the FACS data.Consistent data for Rv2123 could not be obtained and aretherefore not shown (Fig. 4).

DISCUSSION

Recent high-resolution crystal data confirm that the SH3-like domain seen in DtxR also exists in IdeR and that thecritical amino acid residues in this C-terminal domain areconserved in both structures (35). A multistep model for theactivation of apo-DtxR has been suggested by Love et al.;metal ion binding in the ancillary metal ion site leads to sta-bilization of this conformation with the C-terminal SH3-likedomain (18). In the case of the DtxR(E175K) andIdeR(D177K) mutants, electrostatic interactions with the N-terminal domain are postulated to result in a partially orderedstructure. Under low-iron conditions, the mutation allows formaintenance of the ordered conformation and prevents thetranscription of IdeR-regulated genes. Interestingly, our RT-

FIG. 2. Flow cytometry of the eGFP plasmid transcriptionally linkedto the promoters of mbtI, Rv1519, Rv2123, and Rv3402c and trans-formed into wild-type M. tuberculosis CDC1551 (black bars), M. tuber-culosis DtxR(E175K) (white bars), or M. tuberculosis IdeR(D177K)(grey bars). Each bar represents a ratio calculated as the fluorescenceof cells grown in glycerol alanine salts minimal medium in �2 �M irondivided by the fluorescence of cells grown in minimal medium supple-mented with 50 �M iron, as measured by flow cytometry. Each bar isthe average of two biologic replicates, with each replicate analyzed onthe flow cytometer in triplicate.

FIG. 3. Electromobility shift assays. 32P-labeled iron boxes in thepromoter-operator regions of the corynebacterial tox gene (lanes 1 and2), trpE2 gene (lanes 3 and 4), Rv1519 (lanes 5 and 6), Rv2123 (lanes7 and 8), and Rv3402c (lanes 9 and 10) were incubated in the presence(�) or absence (�) of 250 ng of either IdeR (A and B) or DtxR (C andD). A divalent metal ion (manganese) was added in some reactions (Aand C) and omitted from others (B and D).

FIG. 4. Real-time PCR induction of selected genes in M. tubercu-losis CDC1551, M. tuberculosis IdeR(D177K), and M. tuberculosisDtxR(E175K). RT-PCR induction ratios, calculated as low-iron mes-sage divided by high-iron message normalized for 16S RNA, are shownin black (Rv1519), white (mbtI), and grey (Rv3402c). Error bars, stan-dard deviations for three separate cultures. The Mann-Whitney U(StatView) test was used to compare mutant strains to the wild-typestrain. P values of �0.05 are indicated with an asterisk.

5992 MANABE ET AL. INFECT. IMMUN.

on August 31, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

PCR data support the notion that the presence of low-levels ofiron is required for the hyperrepressor phenotype of bothDtxR(E175K) and IdeR(D177K) (18). We were unable to seeabrogation of the transcriptional expression of the IdeR-regu-lated genes in the absolute absence of iron (data not shown).

The transcriptional expression of those genes that were ironregulated in M. tuberculosis and constitutively expressed in M.smegmatis was not modulated by the presence of eitherDtxR(E175K) or IdeR(D177K). Although bearing some ho-mology to the DNA binding consensus sequence of IdeR, thesegenes did not contain many of the crucial base pairs identifiedby crystallography (7, 21, 35). One can speculate that the rel-ative affinity of IdeR for various promoter-operator sequencescould be a regulatory mechanism. Alternatively, SirR may beinvolved in the transcriptional regulation of some of thesegenes. SirR is another mycobacterial DtxR homologue thatwas first described in staphylococci (11). SirR bears less aminoacid similarity to DtxR than IdeR (54%) but shows conservedamino acids in the important regions of the protein, includingthe metal ion binding sites and the DNA-protein interactiondomain (Fig. 1). The critical amino acid residues of the SH3-like domain differ, however. Although SirR appears to controlvirulence genes in staphylococci, its role in pathogenic myco-bacteria remains unclear.

We have shown previously that the dominant-positiveDtxR(E175K) mutant was markedly attenuated, especially inlater lung infection after the formation of cellular aggregates inmice (19). In addition, IdeR has been shown to be upregulatedunder acidic conditions in vitro, a finding confirmed in macro-phages (12). Iron scavenging by siderophores (mycobactins) isregulated by IdeR, and we demonstrated that the mutant hy-perrepressor impairs the ability of M. tuberculosis to upregulatemycobactin production. In this work, we have constructed anM. tuberculosis strain with an integrated copy of the mutantideR that constitutively represses IdeR-regulated genes. Boththe DtxR(E175K) and IdeR(D177K) mutants abrogate theupregulation of the previously described IdeR-regulated genesmbtI, Rv2123, and Rv3402c. We have also confirmed anotherputative IdeR-regulated gene, Rv1519. Taken together withrecent IdeR crystallography data (35) and functional study ofthe DtxR(E175K) mutant (17), our data corroborate thatIdeR(D177K) likely stabilizes the same SH3 domain interac-tion that results in the hyperrepressor phenotype. There is agrowing body of evidence to support IdeR’s role in both the invivo and in vitro survival of M. tuberculosis. This mutant strainwill prove useful in further analysis of the IdeR regulon and inthe identification of iron-regulated virulence genes. As an es-sential gene in M. tuberculosis (26), IdeR is a logical drug targetto exploit for M. tuberculosis chemotherapy. Drugs that haveinterfered with mycobactin production in the past, such as PAS(para-aminosalicylate), have been shown to be efficacious.

ACKNOWLEDGMENTS

We thank John Love, Robert Harrison, and William Bishai forinvaluable advice and help.

This work was supported by funding from the National Institutes ofHealth (1 K08 AI 01689, 1R01 HL71554) and a grant from the Amer-ican Lung Association.

REFERENCES

1. Ando, M., Y. C. Manabe, P. J. Converse, E. Miyazaki, R. Harrison, J. R.Murphy, and W. R. Bishai. 2003. Characterization of the role of the divalentmetal ion-dependent transcriptional repressor MntR in the virulence ofStaphylococcus aureus. Infect. Immun. 71:2584–2590.

2. Boyd, J., M. N. Oza, and J. R. Murphy. 1990. Molecular cloning and DNAsequence analysis of a diphtheria tox iron-dependent regulatory element(dtxR) from Corynebacterium diphtheriae. Proc. Natl. Acad. Sci. USA 87:5968–5972.

3. D’Aquino, J. A., and D. Ringe. 2003. Determinants of the SRC homologydomain 3-like fold. J. Bacteriol. 185:4081–4086.

4. De Voss, J. J., K. Rutter, B. G. Schroeder, H. Su, Y. Zhu, and C. E. Barry III.2000. The salicylate-derived mycobactin siderophores of Mycobacterium tu-berculosis are essential for growth in macrophages. Proc. Natl. Acad. Sci.USA 97:1252–1257.

5. Doukhan, L., M. Predich, G. Nair, O. Dussurget, I. Mandic-Mulec, S. T.Cole, D. R. Smith, and I. Smith. 1995. Genomic organization of the myco-bacterial sigma gene cluster. Gene 165:67–70.

6. Dussurget, O., J. Timm, M. Gomez, B. Gold, S. Yu, S. Z. Sabol, R. K.Holmes, W. R. Jacobs, Jr., and I. Smith. 1999. Transcriptional control of theiron-responsive fxbA gene by the mycobacterial regulator IdeR. J. Bacteriol.181:3402–3408.

7. Feese, M. D., B. P. Ingason, J. Goranson-Siekierke, R. K. Holmes, and W. G.Hol. 2001. Crystal structure of the iron-dependent regulator from Mycobac-terium tuberculosis at 2.0-Å resolution reveals the Src homology domain3-like fold and metal binding function of the third domain. J. Biol. Chem.276:5959–5966.

8. Garbe, T. R., J. Barathi, S. Barnini, Y. Zhang, C. Abou-Zeid, D. Tang, R.Mukherjee, and D. B. Young. 1994. Transformation of mycobacterial speciesusing hygromycin resistance as selectable marker. Microbiology 140:133–138.

9. Gold, B., G. M. Rodriguez, S. A. Marras, M. Pentecost, and I. Smith. 2001.The Mycobacterium tuberculosis IdeR is a dual functional regulator thatcontrols transcription of genes involved in iron acquisition, iron storage andsurvival in macrophages. Mol. Microbiol. 42:851–865.

10. Hardham, J. M., L. V. Stamm, S. F. Porcella, J. G. Frye, N. Y. Barnes, J. K.Howell, S. L. Mueller, J. D. Radolf, G. M. Weinstock, and S. J. Norris. 1997.Identification and transcriptional analysis of a Treponema pallidum operonencoding a putative ABC transport system, an iron-activated repressor pro-tein homolog, and a glycolytic pathway enzyme homolog. Gene 197:47–64.

11. Hill, P. J., A. Cockayne, P. Landers, J. A. Morrissey, C. M. Sims, and P.Williams. 1998. SirR, a novel iron-dependent repressor in Staphylococcusepidermidis. Infect. Immun. 66:4123–4129.

12. Hobson, R. J., A. J. McBride, K. E. Kempsell, and J. W. Dale. 2002. Use ofan arrayed promoter-probe library for the identification of macrophage-regulated genes in Mycobacterium tuberculosis. Microbiology 148:1571–1579.

13. Jakubovics, N. S., A. W. Smith, and H. F. Jenkinson. 2000. Expression of thevirulence-related Sca (Mn2�) permease in Streptococcus gordonii is regulatedby a diphtheria toxin metallorepressor-like protein ScaR. Mol. Microbiol.38:140–153.

14. Kaushal, D., B. G. Schroeder, S. Tyagi, T. Yoshimatsu, C. Scott, C. Ko, L.Carpenter, J. Mehrotra, Y. C. Manabe, R. D. Fleischmann, and W. R.Bishai. 2002. Reduced immunopathology and mortality despite tissue per-sistence in a Mycobacterium tuberculosis mutant lacking alternative sigmafactor, SigH. Proc. Natl. Acad. Sci. USA 99:8330–8335.

15. Kitten, T., C. L. Munro, S. M. Michalek, and F. L. Macrina. 2000. Geneticcharacterization of a Streptococcus mutans LraI family operon and role invirulence. Infect. Immun. 68:4441–4451.

16. Lee, M. H., L. Pascopella, W. R. Jacobs, Jr., and G. F. Hatfull. 1991.Site-specific integration of mycobacteriophage L5: integration-proficientvectors for Mycobacterium smegmatis, Mycobacterium tuberculosis, and ba-cille Calmette-Guerin. Proc. Natl. Acad. Sci. USA 88:3111–3115.

17. Love, J. F., J. C. vanderSpek, V. Marin, L. Guerrero, T. M. Logan, and J. R.Murphy. 2004. Genetic and biophysical studies of diphtheria toxin repressor(DtxR) and the hyperactive mutant DtxR(E175K) support a multistep modelof activation. Proc. Natl. Acad. Sci. USA 101:2506–2511.

18. Love, J. F., J. C. VanderSpek, and J. R. Murphy. 2003. The src homology3-like domain of the diphtheria toxin repressor (DtxR) modulates repressoractivation through interaction with the ancillary metal ion-binding site. J.Bacteriol. 185:2251–2258.

19. Manabe, Y. C., B. J. Saviola, L. Sun, J. R. Murphy, and W. R. Bishai. 1999.Attenuation of virulence in Mycobacterium tuberculosis expressing a consti-tutively active iron repressor. Proc. Natl. Acad. Sci. USA 96:12844–12848.

20. Pohl, E., R. K. Holmes, and W. G. Hol. 1999. Crystal structure of a cobalt-activated diphtheria toxin repressor-DNA complex reveals a metal-bindingSH3-like domain. J. Mol. Biol. 292:653–667.

21. Pohl, E., R. K. Holmes, and W. G. Hol. 1999. Crystal structure of theiron-dependent regulator (IdeR) from Mycobacterium tuberculosis showsboth metal binding sites fully occupied. J. Mol. Biol. 285:1145–1156.

22. Posey, J. E., J. M. Hardham, S. J. Norris, and F. C. Gherardini. 1999.Characterization of a manganese-dependent regulatory protein, TroR, fromTreponema pallidum. Proc. Natl. Acad. Sci. USA 96:10887–10892.

VOL. 73, 2005 REPRESSORS OF IdeR-REGULATED GENES IN M. TUBERCULOSIS 5993

on August 31, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

23. Que, Q., and J. D. Helmann. 2000. Manganese homeostasis in Bacillussubtilis is regulated by MntR, a bifunctional regulator related to the diph-theria toxin repressor family of proteins. Mol. Microbiol. 35:1454–1468.

24. Ramakrishnan, L., N. A. Federspiel, and S. Falkow. 2000. Granuloma-specific expression of Mycobacterium virulence proteins from the glycine-richPE-PGRS family. Science 288:1436–1439.

25. Rodriguez, G. M., B. Gold, M. Gomez, O. Dussurget, and I. Smith. 1999.Identification and characterization of two divergently transcribed iron reg-ulated genes in Mycobacterium tuberculosis. Tuber. Lung Dis. 79:287–298.

26. Rodriguez, G. M., M. I. Voskuil, B. Gold, G. K. Schoolnik, and I. Smith.2002. ideR, an essential gene in Mycobacterium tuberculosis: role of IdeR iniron-dependent gene expression, iron metabolism, and oxidative stress re-sponse. Infect. Immun. 70:3371–3381.

27. Schmitt, M. P., M. Predich, L. Doukhan, I. Smith, and R. K. Holmes. 1995.Characterization of an iron-dependent regulatory protein (IdeR) of Myco-bacterium tuberculosis as a functional homolog of the diphtheria toxin re-pressor (DtxR) from Corynebacterium diphtheriae. Infect. Immun. 63:4284–4289.

28. Snapper, S. B., R. E. Melton, S. Mustafa, T. Kieser, and W. R. Jacobs, Jr.1990. Isolation and characterization of efficient plasmid transformation mu-tants of Mycobacterium smegmatis. Mol. Microbiol. 4:1911–1919.

29. Sun, L., J. vanderSpek, and J. R. Murphy. 1998. Isolation and characteriza-

tion of iron-independent positive dominant mutants of the diphtheria toxinrepressor DtxR. Proc. Natl. Acad. Sci. USA 95:14985–14990.

30. Tao, X., J. Boyd, and J. R. Murphy. 1992. Specific binding of the diphtheriatox regulatory element DtxR to the tox operator requires divalent heavymetal ions and a 9-base-pair interrupted palindromic sequence. Proc. Natl.Acad. Sci. USA 89:5897–5901.

31. Tao, X., H. Y. Zeng, and J. R. Murphy. 1995. Transition metal ion activationof DNA binding by the diphtheria tox repressor requires the formation ofstable homodimers. Proc. Natl. Acad. Sci. USA 92:6803–6807.

32. Valway, S. E., M. P. Sanchez, T. F. Shinnick, I. Orme, T. Agerton, D. Hoy,J. S. Jones, H. Westmoreland, and I. M. Onorato. 1998. An outbreak in-volving extensive transmission of a virulent strain of Mycobacterium tubercu-losis. N. Engl. J. Med. 338:633–639. (Erratum, 338:1783.)

33. Wang, G., G. P. Wylie, P. D. Twigg, D. L. Caspar, J. R. Murphy, and T. M.Logan. 1999. Solution structure and peptide binding studies of the C-termi-nal src homology 3-like domain of the diphtheria toxin repressor protein.Proc. Natl. Acad. Sci. USA 96:6119–6124.

34. White, A., X. Ding, J. C. vanderSpek, J. R. Murphy, and D. Ringe. 1998.Structure of the metal-ion-activated diphtheria toxin repressor/tox operatorcomplex. Nature 394:502–506.

35. Wisedchaisri, G., R. K. Holmes, and W. G. Hol. 2004. Crystal structure of anIdeR-DNA complex reveals a conformational change in activated IdeR forbase-specific interactions. J. Mol. Biol. 342:1155–1169.

Editor: J. L. Flynn

5994 MANABE ET AL. INFECT. IMMUN.

on August 31, 2018 by guest

http://iai.asm.org/

Dow

nloaded from