molecular phylogeny of basal gobioid fishes: rhyacichthyidae

Molecular Phylogenetics and Evolution 37 (2005) 858–871

www.elsevier.com/locate/ympev

Molecular phylogeny of basal gobioid Wshes: Rhyacichthyidae, Odontobutidae, Xenisthmidae, Eleotridae

(Teleostei: Perciformes: Gobioidei)

Christine E. Thacker ¤, Michael A. Hardman 1

Vertebrates-Ichthyology, Natural History Museum of Los Angeles County, 900 Exposition Blvd., Los Angeles, CA 90007, USA

Received 17 February 2005; revised 5 May 2005Available online 21 June 2005

Abstract

Morphological character analyses indicate that Rhyacichthyidae, Odontobutidae, Eleotridae, and Xenisthmidae are the basalfamilies within the perciform suborder Gobioidei. This study uses DNA sequence data to infer the relationships of genera withinthese families, as well as determine the placement of more derived gobioids (family Gobiidae) and the identity of the outgroup toGobioidei. Complete sequences of the mitochondrial ND1, ND2, COI, and cyt b genes (4397 base pairs) are analyzed for representa-tives of 27 gobioid genera and a variety of perciform and scorpaeniform outgroup candidates; the phylogeny is rooted with a beryci-form as a distal outgroup. The single most parsimonious tree that results indicates that, of the outgroups sampled, the perciformfamily Apogonidae is most closely related to Gobioidei. Gobioidei is monophyletic, and Rhyacichthys aspro is the most basal taxon.The remainder of Gobioidei is resolved into clades corresponding to the families Odontobutidae (plus Milyeringa) andEleotridae + Xenisthmidae + Gobiidae. Within Eleotridae, the subfamily Butinae (minus Milyeringa) is paraphyletic with respect toGobiidae, and Eleotrinae is paraphyletic with respect to Xenisthmidae. Other than these groupings, the primary disagreement withthe current morphology-based classiWcation is that the molecular data indicate that the troglodytic Milyeringa should be placed inOdontobutidae, not Butinae, although support for this placement is weak. The most basal lineage of Gobioidei is known from thefreshwaters of the Indo-PaciWc, with marine-dwelling lineages arising several times independently in the group. The phylogeny alsoindicates that diVerent gobioid lineages are distributed in Asia, Africa, Madagascar and the Neotropics. Five sister pairs of basalgobioid species inhabit Atlantic and PaciWc drainages of Panama, with widely varying divergences. 2005 Elsevier Inc. All rights reserved.

Keywords: Gobioidei; Rhyacichthyidae; Odontobutidae; Eleotrididae; Eleotrinae; Butinae; Xenisthmidae; Gobiidae; Biogeography; Panama

1. Introduction

The suborder Gobioidei is included in Perciformes, thelargest vertebrate order, including most ocean Wshes aswell as many fresh and brackish water groups. Percifor-mes includes roughly 9300 species, of which an estimated

* Corresponding author. Fax: +1 213 748 4432.E-mail addresses: [email protected] (C.E. Thacker), m.hardman@

nhm.ac.uk (M.A. Hardman).1 Present address: Department of Parasitic Worms, Natural History

Museum, 6 Cromwell Road, London SW7 5BD, UK.

1055-7903/$ - see front matter 2005 Elsevier Inc. All rights reserved.doi:10.1016/j.ympev.2005.05.004

2121 species (23%) are gobioids (Nelson, 1994). Inferenceof relationships both within perciformes, and amongperciformes and other acanthopterygiian taxa, has beenchallenging due to the number and diversity of perci-forms (Johnson, 1993; Johnson and Patterson, 1993) andit is likely that Perciformes is not monophyletic as cur-rently construed. Large-scale molecular surveys ofacanthopterygiian phylogeny (Elmerot et al., 2002; Miyaet al., 2003) indicate that Perciformes is not monophy-letic, forming a clade only if Caproidei (Zeiformes),Ophidiiformes, Lophiiformes, Scorpaeniformes, Pleuro-nectiformes, Tetraodontiformes, and Smegmamorpha are

mailto: [email protected]





C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) 858–871 859

included. The exact placement of Gobioidei within Perci-formes is also unclear; abundant morphological charac-ter evidence indicates that the suborder Gobioidei ismonophyletic, but no sister taxon has been identiWedbased on morphological data, although several candi-dates have been proposed (Johnson and Brothers, 1993;Winterbottom, 1993). The aim of this study is to inferrelationships within Gobioidei and between Gobioideiand various candidate percomorph outgroups. A large(4397 base pairs) mitochondrial DNA dataset is used,consisting of the complete sequence of the nitrogen dehy-drogenase subunit 1 (ND1), nitrogen dehydrogenase sub-unit 2 (ND2), cytochrome oxidase subunit I (COI), andcytochrome b (cyt b) genes. Sampling within Gobioidei isconcentrated on basal taxa (Rhyacichthyidae, Odontob-utidae, Eleotridae [including subfamilies Eleotrinae andButinae (Hoese and Gill, 1993)], and Xenisthmidae,Table 1), although two gobiid species are included inorder to place the more derived gobioids in this hypothe-sis. A previous molecular study of gobioid relationships(Thacker, 2003) showed that the more derived gobioidfamilies (Gobiidae, Microdesmidae, Ptereleotridae, Kra-emeriidae, and Schindleriidae) form a monophyleticgroup to the exclusion of the basal gobioid families listedabove. That hypothesis did not include Rhyacichthyidae,and was rooted with an odontobutid, so no conclusionscould be made regarding sister taxon placement. In addi-tion to the single odontobutid taxon, Thacker (2003)included eight eleotrine eleotrids and a xenisthmid; thesetaxa formed a paraphyletic grade outside the higher gobi-oid clade. The current study provides a complement toThacker (2003) in its more detailed analysis of basal gobi-oid and outgroup relationships.

The four families targeted here have been consideredbasal relative to other gobioids due to the presence of six(rather than Wve) branchiostegal rays, and characters ofthe suspensorium and branchial apparatus (Hoese, 1984;Hoese and Gill, 1993) and in the case of Rhyacichthyi-dae and the Incertae sedis genera Terateleotris and Pro-togobius, the presence of lateral line canals on the body(absent in all other gobioids; Miller, 1973; Shibukawaet al., 2001; Watson and Pöllabauer, 1998). Basal gobi-oids generally attain a larger size than other gobioids,and exhibit less of the morphological reduction thatoccurs frequently among more derived gobioid taxa.Additionally, they are usually found in fresh or brackishwater; the major radiation of gobioids, the gobiine gobi-ids, is known primarily from marine habitats. However,exceptions to these generalizations exist, including themarine-dwelling eleotrids Calumia, Grahamichthys, Tha-lasseleotris, and all Wve genera of Xenisthmidae. Sizereduction is also known among basal gobioids, as exem-pliWed by the genera Kribia, Calumia, Leptophilypnus,Microphilypnus, and dwarf species of Oxyeleotris andPhilypnodon, all of which attain an adult size of less than40 mm. Two blind, cave-dwelling genera are also found

among basal gobies, Typhleotris known from Madagas-car, and Milyeringa from caves in northwestern Austra-lia. One aim of the current study was to determine theplacement of these marine, miniaturized or troglodytic

Table 1Valid genera of basal gobioid families, in their current classiWcation

Taxa marked with + were sequenced for this study.

Taxon Distribution Ecology

Rhyacichthyidae+Rhyacichthys W PaciWc Freshwater

OdontobutidaeMicropercops N Asia Freshwater+Odontobutis N Asia Freshwater+Perccottus N Asia Freshwater

EleotridaeButinae

+Bostrychus W PaciWc Freshwater/estuarine+Butis Indo-W PaciWc Freshwater/estuarineIncara Indo-W PaciWc Freshwater/estuarine+Kribia Africa Freshwater+Milyeringa NW Australia Freshwater+Ophiocara Indo-W PaciWc Freshwater/estuarine+Oxyeleotris Indo-W PaciWc Freshwater/estuarine+“dwarf Oxyeleotris” N Australia/

New GuineaFreshwater

Prionobutis Indo-W PaciWc Freshwater/estuarineTyphleotris Madagascar Freshwater

EleotrinaeBelobranchus W PaciWc Freshwater/estuarineBunaka W PaciWc Freshwater/estuarine+Calumia Indo-W PaciWc Marine+Dormitator E PaciWc/Atlantic Freshwater/estuarine+Eleotris Circumtropical Freshwater/estuarine+Erotelis Neotropical Freshwater/estuarine+Gobiomorphus SE Australia/

New ZealandFreshwater/estuarine

+Gobiomorus Neotropical Freshwater/estuarineGrahamichthys New Zealand Marine+Guavina Neotropical Freshwater/estuarine+Hemieleotris Neotropical Freshwater+Hypseleotris Indo-W PaciWc Freshwater/estuarineKimberleyeleotris NW Australia Freshwater+Leptophilypnus Neotropical Freshwater+Microphilypnus Neotropical Freshwater+Mogurnda N Australia/

New GuineaFreshwater

+Ophieleotris Indo-W PaciWc Freshwater/estuarine+Philypnodon SE Australia Freshwater/estuarine+Ratsirakea Madagascar Freshwater+Tateurndina SE New Guinea FreshwaterThalasseleotris SE Australia/

New ZealandMarine

XenisthmidaeAllomicrodesmus Indo-W PaciWc MarineParaxenisthmus Indo-W PaciWc MarineRotuma Indo-W PaciWc MarineTyson Indo-W PaciWc Marine+Xenisthmus Indo-W PaciWc Marine

Incertae sedisProtogobius New Caledonia FreshwaterTerateleotris Laos Freshwater

860 C.E. Thacker, M.A. Hardman / Molecular Phylogenetics and Evolution 37 (2005) 858–871

taxa, and to see if each of these characteristics arose sin-gle or multiple times in the evolution of basal gobioids.

The distribution of basal gobioids was also investi-gated in a phylogenetic context. Most of the speciesdiversity in the basal gobioid families is known fromAustralia and the islands of the Indo-West PaciWc(Table 1). However, some genera occur in Africa (Kribiaand some species of the widespread genera Bostrychus,Dormitator, and Eleotris); Asia (odontobutids Microp-ercops, Odontobutis, and Percottus); New Zealand(Grahamichthys and some Gobiomorphus and Thalassel-eotris); and the neotropics (some Dormitator and Eleo-tris; Erotelis, Gobiomorus, Guavina, Hemieleotris,Leptophilypnus, and Microphilypnus). Phylogeny of thesetaxa is used to infer the distribution patterns in Asia,Africa, New Zealand, and the Neotropics, and to deter-mine if, in particular, the large group of neotropical gen-era is monophyletic.

In addition to basal gobioids, a wide variety of perci-form and scorpaeniform outgroups were included, andthe phylogeny was rooted with a beryciform (Beryxsplendens). Inclusion of many outgroups allows conWr-mation or disconWrmation of gobioid monophyly as wellas selection of a proximal sister taxon from among thecandidates. The most comprehensive study of potentialoutgroups to Gobioidei is that of Winterbottom (1993).He examined 34 families representing a wide array ofacanthopterygiian and paracanthopterygiian taxa for 23morphological characters, in order to determine whichgroup shares the most apomorphies with Gobioidei.Winterbottom (1993) narrowed down the list of likelysister taxa to three best candidates: Gobiesocoidei(including only the clingWsh family Gobiesocidae, agroup for which relationship has been suggested with theCallionymidae, Notothenidae, or Paracanthopterygii;Nelson, 1994); “some subset of the trachinoids”, in partic-ular the trachinoid families Percophididae, Trichonotidae,and Creedidae; or “some subset of the scorpaeniforms”,especially the family Hoplichthyidae. However, even thebest candidate (Hoplichthyidae) only shared 11 of 23characters with Gobioidei, and Winterbottom (1993)concluded that gobioids were so distinctive that moredetailed analyses were needed to make a convincingargument as to the appropriate gobioid sister taxon.Miller (1973) also discussed the sister taxon problem inhis treatment of the basal gobioid Rhyacichthys, andconcluded that while gobioids were deWnitely acanth-opterygiians, and shared some characters with perciformfamilies Apogonidae, Kuhliidae, Centrarchidae, andPercidae as well as the notothenioid family Chaenich-thyidae, no obvious sister taxon could be identiWed. Inthe present study, representatives of Gobiesocidae(Gobiesociformes), Dactylopteridae (Dactylopterifor-mes), Pinguipedidae, Cheimarrichthyidae, Trichodonti-dae (Trachinoidei: Perciformes), Cottidae, Cyclopteridae(Cottoidei: Scorpaeniformes), Triglidae (Scorpaenoidei:

Scorpaeniformes), Lutjanidae, Apogonidae (Percoidei:Perciformes) are included, with the aim of providing awide range of possibilities for potential outgroups.Gobiesocidae, Trachinoidei, and Scorpaenoidei areincluded as suggested by Winterbottom (1993); Apogon-idae (some or all) was also identiWed by Winterbottom(1993) as sharing characters with Gobioidei includingthe presence of papillae (enlarged, raised neuromasts) onthe head, loss of the basisphenoid, various fusions andlosses of caudal skeleton elements, displacement of thedorsal articulation of the symplectic away from theinterhyal, and a cartilaginous pad in the basipterygiumwhich supports articulation of the pelvic Wn rays. Addi-tionally, in both Apogonidae and most Gobioidei, eggsbear attachment Wlaments, are deposited on the sub-strate, and guarded by the male (Johnson, 1993). Dacty-lopteridae was the closest relative to Gobioidei in themolecular hypothesis of Miya et al. (2003), and otherscorpaeniform and perciform taxa are added to providedenser sampling in the outgroups.

2. Materials and methods

Fresh and ethanol-preserved tissues were obtainedfrom a variety of sources (Table 2). Whenever possible,more than one individual of a species was sequenced(Fig. 1). A total of 78 individuals of 45 species represent-ing 27 nominal basal gobioid genera were included asthe ingroup (families Rhyacichthyidae, Odontobutidae,Eleotridae, and Xenisthmidae; Table 1). Sequence forRhyacichthys aspro was obtained from GenBank(AP004454). The gobiine gobiids Gnatholepis scapulo-stigma and Bathygobius cocosensis were added as repre-sentatives of higher gobioids; sequence for the ND1,ND2, and COI genes for these species was obtainedfrom GenBank (G. scapulostigma: AF391376,AF391448, AF391520; B. cocosensis: AF391388,AF391460, AF391532). The outgroup taxa Apogon mac-ulatus, Apogon quadrisquamatus, Apogon nigrofasciatus(Perciformes: Percoidei: Apogonidae), Parapercis sp.(Perciformes: Trachinoidei: Pinguipedidae), and Chei-marrichthys fosteri (Perciformes: Trachinoidei: Chei-marrichthyidae) were sequenced for this study; sequencefor additional outgroup taxa was obtained from Gen-Bank and included two species of Gobiesocidae (Arcossp.: AP004452; Aspasma minima: AP004453); two spe-cies of Dactylopteridae (Dactyloptena tiltoni: AP004444;Dactyloptena peterseni: AP004440); one additionaltrachinoid, family Trichodontidae (Arctoscopus japoni-cus: AP002947); scorpaeniforms of the families Triglidae(Satyrichthys amiscus: AP004441), Cyclopteridae(Aptocyclus ventricosus: AP004443), Cottidae (Cottusreinii: AP004442); and a representative of the perciformfamily Lutjanidae (Pterocaesio tile: AP004447). Theberyciform B. splendens (AP002939) was included as the


(continued on next page)

Table 2Species of Odontonbutidae, Eleotridae, Xenisthmidae, Apogonidae, and trachinoids Pinguipedidae and Cheimarrichthyidae examined in this study,source of tissue sample used, and GenBank Accession Nos.

Species Locality GenBank numbers

Perciformes: GobioideiOdontobutidae

Odontobutis obscura Souro River, Japan AF391330,AF391402,AF391474Odontobutis potamophila China, AY722311,AY722371,AY722174,AY722247

AY722290,AY722353,AY722153,AY722225Percottus glenni Amur R. Basin, Khanka Lake and Dniestr R., Russia AY722367,AY722170,AY722243

AY722308,AY722368,AY722171,AY722244AY722284,AY722347,AY722146,AY722217AY722275,AY722339,AY722208

Eleotridae: ButinaeBostrychus sinensis Careening Bay, WA, Australia AY722301,AY722164,AY722236Butis butis Innes Park, QLD, Australia AY722319,AY722377,AY722180Kribia nana Niger River at Sulukudjamba AY722287,AY722221

AY722288,AY722150AY722222,AY722278,AY722211

Milyeringa veritas Northwest Cape, WA, Australia AY722305,AY722168,AY722240AY722306,AY722169,AY722241

Ophiocara porocephala Innes Park, QLD, Australia AY722314,AY722250Oxyeleotris lineolatus Adelaide, SA, Australia AY722302,AY722364,AY722165,AY722237

AY722276,AY722340,AY722139,AY722209Oxyeleotris marmorata AY722315,AY722373,AY722176,AY722251

AY722316,AY722374,AY722177,AY722252Oxyeleotris nullipora Howard River near Darwin, NT, Australia AY722313,AY722249

AY722307,AY722242Oxyeleotris selhemi Adelaide, SA, Australia AY722318,AY722376,AY722179

AY722303,AY722365,AY722166,AY722238

Eleotridae: EleotrinaeCalumia godfrayi Philippines AY722262,AY722325,AY722125,AY722194Dormitator latifrons Rio Caimito, Panama AY722280,AY722343,AY722142,AY722213

AY722274,AY722338,AY722138,AY722207Dormitator maculatus Palm Beach County, Florida and Rio Mindi, Panama AY722281,AY722344,AY722143,AY722214

AY722273,AY722337,AY722137,AY722206Eleotris amblyopsis Rio San Lorenzo and Punto del Medio, Panama AY722291,AY722354,AY722154,AY722226

AY722279,AY722342,AY722141,AY722212AY722272,AY722336,AY722136,AY722205

Eleotris fusca Sulawesi AY722309,AY722369,AY722172,AY722245Eleotris picta Rio Caimito, Panama AY722286,AY722349,AY722148,AY722219

AY722271,AY722334,AY722135,AY722204Eleotris pisonis Ounta de Mita, Mexico AY722294,AY722357,AY722157,AY722229Eleotris sandwicensis Kaaawa, Oahu, Hawaii AF391333,AF391405,AF391477,AY722186

AF391334,AF391406,AF391478Erotelis armiger Bahia de Jiquilisco, El Salvador AY722304,AY722366,AY722167,AY722239Erotelis smaragdus Twin Cays, Belize AF391355,AF391427,AF391499,AY722185Gobiomorphus australis Bucca Bucca Ck and Coraki, NSW, Australia AY722285,AY722348,AY722147,AY722218

AY722283,AY722346,AY722145,AY722216Gobiomorphus breviceps Ashley River, New Zealand AY722289,AY722352,AY722152,AY722224Gobiomorphus coxii Bucca Bucca Ck and Richmond R., NSW, Australia AY722351,AY722151,AY722223

AY722350,AY722149,AY722220Gobiomorphus hubbsi New Zealand AY722295,AY722358,AY722158,AY722229


Gobiomorus dormitor Rio San Lorenzo, Panama, Gatun Lake AY722282,AY722345,AY722144,AY722215AY722270,AY722334,AY722134,AY722203

Gobiomorus maculatus Rio Caimito and Rio Mindi, Panama AY722317,AY722375,AY722178AY722261,AY722324,AY722124,AY722193AY722269,AY722332,AY722132,AY722201AY722333,AY722133,AY722202

Guavina micropus La Palma, San Miguel Estuary, Panama AY722268,AY722331,AY722131,AY722200Hemieleotris latifasciatus Panama, Rio Cardenas, Corozal AY722310,AY722370,AY722173,AY722246Hypseleotris aurea Gascoyne River, WA, Australia AF391392,AF391464,AF391536,AY722187


distal outgroup and designated as the root of the phylog-eny. A total of 15 ougroup taxa were included.

Total genomic DNA was extracted from tissues usingthe DNeasy Tissue Kit (Qiagen, Chatsworth, CA). PCRreactions were performed directly from genomic DNA(using approximately 300 ng of DNA) with combinationsof the goby-speciWc primers listed in Table 3, using TaqDNA Polymerase (Promega, Madison, WI), or PlatinumTaq DNA Polymerase (Invitrogen, Carlsbad, CA) fordiYcult templates. PCR was performed in 50-�L reac-tions consisting of 0.4 mM dNTP, 1.25 mM magnesiumchloride, 0.25-�M of each primer, with 1.25 units of Taqpolymerase in a reaction buVer containing 50 mM potas-sium chloride, 10 mM Tris–hydrochloric acid (pH 9.0),and 0.1% Triton X-100. Thermal cycling conditions con-sisted of an initial denaturation step of 94 °C for 3 minfollowed by 35 cycles of a denaturation step of 94 °C for30 s, a variable annealing step of between 43 and 58 °C for30 s, and an extension step of 72 °C for 90 s. A Wnal incu-bation step of 72 °C for 7 min was added to ensure com-plete extension of ampliWed products. PCR products wereelectrophoresed on a low melting point agarose gel, visu-alized and photographed, then excised and puriWed withthe QIAquick gel extraction kit (Qiagen). AmpliWed

DNA fragments were cycle sequenced using Big Dye 3.0dye terminator ready reaction kits (Applied Biosystems,Foster City, CA). Sequenced products were puriWed bypassing the reactions through 750-�L Sephadex columns(2.0 g in 32.0 mL ddH2O) and were visualized with anABI Prism 377 automated DNA sequencer (Applied Bio-systems). Both the heavy and light strands weresequenced separately for each short PCR fragment.Sequence chromatograms were edited with Sequencher4.1.2 (GeneCodes, Ann Arbor, MI) and correspondingforward and reverse sequences were aligned to produce acomposite Wle of the ampliWed product for each individ-ual sequenced. Sequences were then translated intoamino acid residues and aligned by eye. There were noambiguities or gaps in the alignment; all the gaps presentin the Wnal matrix were due to missing data and treated assuch (as ? rather than a new character state) in the analy-sis. Aligned nucleotide sequences were exported fromSequencher as NEXUS Wles.

All parsimony analyses were performed using PAUP*,version 4.0b8 (SwoVord, 2001). One thousand replicationsof a heuristic search were run, using TBR branch swap-ping. The data were designated as equally weighted, fol-lowing Källersjö et al. (1999) and Broughton et al. (2000).

Table 2 (continued)

Species Locality GenBank numbers

Hypseleotris compressa Ross River, QLD, Australia AF391366,AF391438,AF391510,AY722188Hypseleotris klunzingeri Barcoo River, QLD, Australia AF391393,AF391465,AF391537,AY722189Leptophilypnus Xuviatilis Rio Mindi, Rio San Lorenzo, Panama AY722265,AY722328,AY722128,AY722197


Leptophilypnus panamensis Rio Caimito, Panama AY722264,AY722326,AY722127,AY722195AY722263,AY722327,AY722126,AY722196

Microphilypnus ternetzi Manari River, Guyana AY722320,AY722378,AY722181,AY722253Mogurnda adspersa Ross River, QLD, Australia AF391367,AF391439,AF391511,AY722184Mogurnda mogurnda Gorge Creek Spring, QLD, Australia AY722277,AY722341,AY722140,AY722210

AY722260,AY722323,AY722123,AY722192Ophieleotris aporos Ross R., QLD, Australia and Sulawesi AY722296,AY722359,AY722159,AY722231

AY722297,AY722360,AY722160,AY722231AY722298,AY722361,AY722161,AY722233AF391368,AF391440,AF391512

Philypnodon grandiceps Glenelg River, VIC, Australia AF391386,AF391458,AF391530Ratsirakea legendrei Sakalava River, Madagascar AY722299,AY722362,AY722162,AY722234

AY722300,AY722363,AY722163,AY722235Taeturndina ocellicauda Aquarium supplier (New Guinea) AY722312,AY722372,AY722175,AY722248

XenisthmidaeXenisthmus sp. Santa Cruz Island, Solomon Islands AF391372,AF391444,AF391516

Perciformes: PercoideiApogonidae

Apogon maculatus Navassa Island, Caribbean AY72254,AY722121,AY722182Apogon quadrisquamatus Navassa Island, Caribbean AY72255,AY722183Apogon nigrofasciatus Moorea, Society Islands AY72256,AY722122

Perciformes: TrachinoideiPinguipedidae

Parapercis sp. AY722257

CheimarrichthyidaeCheimarrichthys fosteri Ashley River, New Zealand AY722258,AY722321,AY722119,AY722190

AY722259,AY722322,AY722120,AY722191


Xenisthmidae).

Fig. 1. Single most parsimonious phylogenetic hypothesis derived from analysis of ND1, ND2, COI, and cyt b sequence data. Numbers on nodes aredecay indices. Brackets at right side indicate family names in current usage. Selected clades are labeled, including Gobioidei, OD (Odontobutidaeplus Milyeringa), ED (Eleotridae plus Gobiidae and Xenisthmidae), BU (Butinae, not including Milyeringa, plus Gobiidae), and EN (Eleotrinae plus


Decay indices (Bremer, 1988) were calculated withPAUP* and TreeRot v.2 (Sorenson, 1999). To assesswhether the signal from each of the four gene regions washomogeneous, the incongruence length diVerence test(ILD) of Farris et al. (1994, 1995) was conducted for allgene regions. The test was implemented as the partitionhomogeneity test in PAUP* (SwoVord, 2001), with 100replicates. Tracing of ecology (freshwater or saltwaterhabitat) and geographic distribution was done withMacClade version 4.06 (Maddison and Maddison, 2000).

3. Results

The mitochondrial regions and Xanking tRNAs ofND1, ND2, COI, and cyt b were ampliWed andsequenced. The entire ND1 (975 bases) was sequenced,as well as 988 bases of ND2 beginning 59 bases down-

stream of the start codon, and 1255 bases of the CO1gene beginning 11 bases downstream of the start codon.The cyt b region (1179) began 33 bases downstream ofthe start codon and continued beyond the stop toinclude the entire threonine tRNA. The entire matrixmeasured 4397 aligned positions. In some cases, one ormore gene fragments could not be ampliWed andsequenced successfully, resulting in gaps in the alignedmatrix. The ND1 fragment is not included for Gobiomor-phus coxii and one individual each of Gobiomorus macul-atus and Percottus glenni, and the ND2 fragment isabsent in Milyeringa veritas, Oxyeleotris nullipora, Kribianana, Bostrychus sinensis, Ophiocara porocephala, Parap-ercis sp., and the three Apogon species. COI was not usedfor Oxy. nullipora, Ophiocara porocephala, Parapercissp., A. quadrisquamatus, one individual of P. glenni, andtwo individuals of K. nana. Cyt b was absent for Philypn-odon grandiceps, Ophieleotris aporos, Odontobutis

Table 3Goby-speciWc primers used for ampliWcation of ND1, ND2, COI, and cyt b genes

All primers are given in the 5� to 3� direction. a Published in Thacker (2003). b Published in Hardman and Page (2003) and Hardman (2004).

Primer Sequence Gene region

GOBYL2812 CCCTTACCYAATGAAAVHAWCTAAA ND1GOBYL2880 GCAAAAGRCCTAAGCCCTTT ND1GOBYL3543a GCAATCCAGGTCAGTTTCTATC ND1GOBYH3985 AACCYYCATKATTCACTCTATCAAA ND1GOBYH4389a AAGGGGGCYCGGTTTGTTTC ND1GOBYL4201a GTTGCMCAAACMATTTCHTATGAAG ND1GOBYH4937a GGGGTATGGGCCCGAAAGC ND1GOBYL4035 CCCATACCCCAAACATGTCGGTTA ND2GOBYL4040 GCCCATACCCCWAAYATGTTGGT ND2GOBYL4041 AAAACTCTTAGTGCTYCCA ND2GOBYL4575 TGAGGNGGYYTMAAYCAAACHCAA ND2GOBYL4919a CCCATACCCCGAAAATGATG ND2GOBYH5513a GAGTAGGCTAGGATTTTWCGAAGYTG ND2GOBYL4641 TGAGGNGGNYTNAAYCAAACTCAA ND2GOBYL5464a GGTTGAGGRGGCCTMAACCARAC ND2GOBYH5174 GGGCTTTGAAGGCYCYTGGTCT ND2GOBYH5258 TTCACYCYCGCTKAGRRCTTTGAA ND2GOBYH6064a CTCCTACTTAGAGCTTTGAAGGC ND2GOBYL5490 ATGGGGCTACAATCCACCGCTT COIGOBYL6468a GCTCAGCCATTTTACCTGTG COIGOBYH7127a ACYTCTGGGTGACCAAAGAATC COIGOBYL7059a CCCTGCMGGTGGAGGAGACCC COIGOBYH7696a AGGCCTAGGAAGTGTTGAGGGAAG COIGOBYL5447 TTAGYCTGCTTCTYRAGATTT COIGOBYL5991 GRGCHATYAAYTTYATYACHACHAT COIGOBYL7558a TTTGCWATTATGGCWGGATTTG COIGOBYH7093 TTCRAAKGTGTGRTARGGMGGWGGG COIGOBYH7141 GGTTATGTRGYTGGCTTGAAAC COIGOBYH8197a ATTATTAGGGCGTGGTCGTGG COIGOBYL14673 TAATGGCGTGAAAAACCACCGTTGT Cyt bGlu-2b AACCACCGTTGTTATTCAACTA Cyt bPro-R1b TAGTTTAGTTTAGAATTCTGGCTTTGG Cyt bThr-R1b TTTAGAATTCTGGCTTTGGGAG Cyt bOsCytb-F1 CACCCATACTTCTCMTAYAAAGA Cyt bGOBYL15314 CACCTHCTHTTYCTNCAYGAAACNGGHTCHAA Cyt bGOBYH15958 TTTGAGCAGDAGGGAGGATTTTA Cyt bAcytb-R1 TCCGGATTACAAGACCGGYGCTTT Cyt b


obscura, Butis butis, Xenisthmus sp., Parapercis sp.,A. nigrofasciatus, one individual each of G. maculatus,Oxy. selhemi, and Eleotris sandwicensis, and the gobiidsBathygobius cocosensis and G. scapulostigma. GenBanknumbers for ingroup taxa and newly sequenced out-group taxa used in this study are given in Table 2.

The partition homogeneity test indicates that the par-titions are not incongruent (P D 0.45). A single most par-simonious hypothesis was obtained from analysis of thecomplete data set (Fig. 1). This phylogeny has a length of29,758 steps (2381 of 4397 characters were parsimony-informative), consistency index of 0.192, retention indexof 0.567, and rescaled consistency index of 0.109. Decayindices indicate strong support for most nodes, with theexception of some nodes in the Butinae + Gobiidae cladeand at the base of the Odontobutidae clade. As men-tioned above, several of these species have some missingdata, contributing to the low support values for thesenodes. All the species and genera examined were foundto be monophyletic (based on current sampling), withthe exceptions of Oxyeleotris (Oxy. nullipora is not partof Oxyeleotris sensu stricto) and Eleotris (Erotelis isnested within Eleotris, and El. sandwicensis containsEl. acanthopoma), as discussed below.

4. Discussion

4.1. Outgroups and sister taxon to Gobioidei

Representatives of six groups of percomorphs wereused as outgroups, based on previous hypotheses of gobi-oid sister taxon relationships: Beryciformes (used to rootthe phylogeny), Dactylopteriformes, Gobiesociformes,Scorpaeniformes (three families), and two suborders ofPerciformes: Trachinoidei and Percoidei. Two species ofthe family Dactylopteridae (found to be close relatives ofgobioids in the molecular study of Miya et al., 2003) wereincluded, as well as two species of Gobiesocidae, a candi-date gobioid outgroup suggested by Winterbottom(1993). Winterbottom also identiWed the scorpaeniformfamily Hoplichthyidae as a possible outgroup; this familywas not included in the current study, but the triglidSatyrichthys amiscus was considered; in the phylogeny ofSmith and Wheeler (2004), Triglidae is placed in the samescorpaeniform subgroup as Hoplichthyidae. The otherscorpanoids used in this study (families Cyclopteridaeand Cottidae) are both part of an expanded Cottoidei(Smith and Wheeler, 2004).

Representatives of the trachinoid families Cheimarr-ichthyidae, Pinguipedidae, and Trichodontidae were alsoincluded in accordance with the suggestions of Winter-bottom (1993), although he particularly singled out thefamilies Percophididae, Trichonotidae, and Creedidae.All of these families except the Trichodontidae are partof the Trachinoidei as enumerated by Pietsch (1989) and

Pietsch and Zabetian (1990). In the phylogenies pre-sented in these studies, Percophididae, Trichonotidae,and Creedidae form a clade, the sister to which is Pingui-pedidae, followed by Cheimarrichthyidae. The place-ment of Trichodontidae is unresolved; historically and insome recent works (Nelson, 1994), it is placed in Trachi-noidei, but Pietsch (1989) and Pietsch and Zabetian(1990) did not consider Trichodontidae a trachinoid.Additionally, many of the diagnostic trachinoid charac-ters used by Pietsch (1989) and Pietsch and Zabetian(1990) were called into question by Mooi and Johnson(1997), in their arguments for removal of Champ-sodontidae from Trachinoidei; currently the composi-tion and relationships of the various trachinoid familiesare unclear. Within Trachinoidei, the placement of Chei-marrichthys has been debated, and the genus has eitherbeen grouped with the Pinguipedidae (McDowall, 1973,2000), or in its own family, Cheimarrichthyidae (Imam-ura and Matsuura, 2003; Pietsch and Zabetian, 1990).

The Wnal outgroups considered in this hypothesis arethe perciform Pterocaesio tile (Lutjanidae), included as ageneralized perciform representative, and three speciesof the family Apogonidae. Although apogonids andgobioids do not superWcially resemble one another, theyshare a number of morphological characters of both theskeleton and soft tissues, and have similar reproductivebehavior (Johnson, 1993; Winterbottom, 1993). Themolecular phylogeny concurs with this character evi-dence, supporting a sister taxon relationship betweenApogonidae and Gobioidei. The next most distal sistertaxon is Dactylopteridae, in agreement with the molecu-lar hypothesis of Miya et al. (2003) (Apogonidae was notincluded in their study).

All the other outgroup taxa sampled form a clade out-side the Gobioidei, Apogonidae, and Dactylopteridae.Within this clade, the families are mixed, with one groupconsisting of the trachinoids Cheimarrichthyidae and Pin-guipedidae, plus Gobiesocidae and the scorpaeniform Tri-glidae. The other outgroup clade includes representativesof the perciform Lutjanidae, the scorpaeniform cottoidsCottidae and Cyclopteridae, and the questionable trachi-noid Trichodontidae. However, these results must beinterpreted cautiously, due to the sparse sampling com-pared to the overall diversity of percomorpha.

4.2. Monophyly of Gobioidei

The molecular phylogeny conWrms abundant mor-phological evidence in supporting the monophyly ofGobioidei. This character evidence is comprehensive andincludes characters of the skull, suspensorium, branchialapparatus, axial skeleton, and pectoral and pelvic Wns(Winterbottom, 1993). The gobioid otolith primordiumis distinctive, a character which has been used to deter-mine relationships of even extremely reduced, pedomor-phic gobioids (Johnson and Brothers, 1993). Soft tissue


characters also conWrm gobioid monophyly: gobioidshave an accessory sperm duct gland on the testis, whichis used to secrete the matrix of a sperm trail depositedduring demersal spawning (Mazzoldi et al., 2000; Miller,1984, 1992; Wiesel, 1949). Externally, gobioids are diag-nosed by the presence of enlarged, raised free neuro-masts (papillae) generally found in a variety of patternson the head, and the lack of lateral line canals on thebody (except in the primitive Rhyacichthys, Protogobius,and Terateleotris), although these characters are alsopresent in a few other percomorph groups (Winterbot-tom, 1993).

Until the present study, investigations of gobioidmonophyly with molecular data were limited. Large-scale molecular phylogenies typically have included atmost one gobioid, and previous molecular studiesfocused on gobioid interrelationships have generally notincluded taxa outside Gobioidei (Akihito et al., 2000;Thacker, 2003). Exceptions are the studies of Miya et al.(2003) and Wang et al. (2001). Miya et al. (2003)included two gobioids (Rhyacichthys aspro and E. acant-hopoma) in their broad analysis of acanthomorph phy-logeny, and these species formed a clade sister to twospecies of Dactyloptena. Wang et al.’s (2001) examina-tion of intra-gobioid relationships was rooted with theoutgroup Scomber japonicus. This study concurs withboth of those in conWrming the monophyly of Gobioidei,as compared to a diversity of outgroup taxa (Fig. 1).

4.3. Rhyacichthyidae and Odontobutidae

Within Gobioidei, the most basal taxon is R. aspro.The distinctive genus Rhyacichthys is the only memberof the family Rhyacichthyidae (loach gobies), andincludes two species (Dingerkus and Séret, 1992; Miller,1973). Molecular data support the morphological evi-dence in placing R. aspro as the sister to all other gobioids.Rhyacichthys exhibits a suite of primitive characters suchas retention of lateral line canals on the body, three epu-rals in the caudal skeleton, and several rows of ctenii onthe scales (transforming ctenii; Miller, 1973; Springer,1983). Rhyacichthys also is specialized for its ecology, liv-ing benthically in fast-Xowing streams, and exhibiting astrongly dorsoventrally compressed head, a ventrallydirected mouth with expanded lips, and Xeshy pectoraland pelvic Wns. These specializations have led someauthors (Akihito, 1986) to doubt the basal placement ofRhyacichthys within gobioids, but the current molecularstudy conWrms that placement. The New CaledonianProtogobius attiti (Watson and Pöllabauer, 1998) was notassigned to a family when described, but shares withRhyacichthys the retention of lateral line canals on thebody, and is likely a close relative of Rhyacichthys(Akihito et al., 2000). Similarly, the genus Terateleotris(including only one species, T. aspro), known from Laos,possesses body lateral line canals, some transforming cte-

nii on the scales, and three epurals. Terateleotris was notplaced in any gobioid family by its authors (Shibukawaet al., 2001), except to note that it shares some characterswith Rhyacichthys and Protogobius, and some withOdontobutis. Protogobius and Terateleotris were not avail-able for this molecular phylogeny.

Sister to Rhyacicthys is a large clade containing thefamilies Odontobutidae, Eleotridae, Xenisthmidae, andGobiidae. Within this large clade, clade OD of Fig. 1includes the genera Odontobutis and Percottus (Odon-tobutidae) from freshwaters of east Asia, as well as theButine eleotrid Milyeringa, a troglodytic genus fromWestern Australia. Hoese and Gill (1993) erected Odon-tobutidae for the genera Odontobutis, Percottus, andMicropercops. This study indicates that the sampled taxaof Odontobutidae are monophyletic, although Microp-ercops was not sampled. Odontobutidae is characterizedby: infraorbital bones usually present; large scapula,excluding proximal radial from cleithrum; autogenousmiddle radial of Wrst pterygiophore of second dorsal Wn;small dorsal procurrent cartilage, not supporting ante-rior unsegmented caudal rays or extending over distaltip of anterior epural; and a longitudinal papillae pat-tern. However, none of these characters are diagnostic(synapomorphic) for Odontobutidae. Birdsong et al.(1988) placed Micropercops and Percottus together intheir Micropercops group based on axial skeletal features(Odontobutis shares these characters as well). Thismolecular study also indicates that the Western Austra-lian troglodytic Milyeringa is sister taxon to the odonto-butids, but this result must be interpreted cautiously; thedecay index support values at the base of the OD, ED,and BU clades (the nodes separating Milyeringa fromthe rest of the Butinae) are the weakest part of thephylogeny.

4.4. Butinae and Gobiidae

Clade ED of Fig. 1 includes all the genera of the fam-ily Eleotridae, plus representatives of Xenisthmidae andGobiidae. Within clade ED, clade EN includes the sub-family Eleotrinae plus Xenisthmidae, and clade BUincludes the subfamily Butinae (excepting Milyeringa)plus Gobiidae. Hoese and Gill (1993) provided severaldiagnostic characters for this clade (all Gobioidei exceptOdontobutidae and Rhyacichthyidae), including ante-rior elongation of the procurrent caudal cartilage; noautogenous middle radial in the Wrst pterygiophore ofthe second dorsal Wn; the upper proximal radial of thepectoral Wn usually in contact with the cleithrum,extending well above the scapula; and a lack of trans-forming ctenii on the scales. Butinae is undiagnosed intheir hypothesis, but characters are provided to diagnoseEleotrinae (A1� sement of adductor mandibulae tendonattaching directly to maxilla, procurrent caudal cartilageextended posteriorly) and Gobiidae (Wve branchiostegal


rays, pelvic Wns often form a disk; this latter character isfrequently reversed). Hoese and Gill (1993) indicatedthat with its lack of diagnostic characters, Butinae waslikely to be paraphyletic. The current molecular hypoth-esis indicates that Butinae is indeed paraphyletic, withrespect to Gobiidae. In the molecular hypothesis ofWang et al. (2001), Butinae is a monophyletic sistertaxon to Gobiidae, with Eleotrinae placed outside thatclade, and Odontobutidae basal to the remainder. Thestudy of Akihito et al. (2000) is more diYcult to inter-pret, as their phylogeny is not rooted. If Akihito et al.’s(2000) data are reanalyzed and rooted with Rhyacich-thys, their phylogeny indicates the following relation-ships: (Rhyacichthys) (Protogobius) (((Odontobutis +Xenisthmus)(Eleotrinae))(Butinae + Gobiidae + Micropercops)). This result agrees in most respects with the cur-rent phylogeny, with the exception of the placement ofXenisthmus and the absence of Micropercops from thecurrent analysis.

Within the BU clade of Fig. 1, two smaller clades arerecovered; one includes the genera Oxyeleotris, Bostry-chus, Ophiocara, and Kribia, and the other includes Butisand the gobiids Bathygobius and Gnatholepis. The phylog-eny indicates that Oxyeleotris is not monophyletic, withthe dwarf taxon Oxy. nullipora found outside the remain-der of Oxyeleotris, as sister to the dwarf african genus Kri-bia. O. nullipora is found in northern Australia andsouthern New Guinea; Kribia is the only African repre-sentative included here (other eleotrids found in Africainclude some Bostrychus, Dormitator, and Eleotris spe-cies). The remaining three Oxyeleotris species examined(Oxy. lineolatus, Oxy. selhemi, and Oxy. marmorata) forma clade sister to Bostrychus+ Ophiocara, a result which isalso in accordance with the hypothesis of Wang et al.(2001). Of these, the sister taxa Oxy. lineolatus and Oxy.selhemi both inhabit northern Australia and southernNew Guinea; Oxy. marmorata is widespread, recordedfrom Asia, Indonesia, and the Philippines. Similarly, Bos-trychus and Ophiocara are widespread throughout theIndo-West PaciWc, Africa, Australia, and Asia.

The remaining members of clade BU are the butinegenus Butis and the two representatives of Gobiidae. Thegobiids selected represent both major lineages of Gobii-dae: Gobiinae (Bathygobius cocosensis) and Gobionelli-nae (G. scapulostigma). As expected, the gobiids arerecovered as sister taxa. Although morphological char-acters have thus far not demonstrated a close relation-ship between Gobiidae and the butines, Butinae has notbeen diagnosed morphologically (Hoese and Gill, 1993).Butis is widespread in the Indo-West PaciWc, recordedfrom East Africa to Fiji.

4.5. Eleotrinae and Xenisthmidae

The large clade EN of Fig. 1 contains all the sampledmembers of Eleotrinae, as well as the representative of

Xenisthmidae. Xenisthmidae is distinctive withinGobioidei, diagnosed by such synapomorphies as thepresence of an uninterrupted free ventral margin on thelower lip; reduced or absent premaxillary ascending pro-cess; and an ossiWed rostral cartilage (Hoese, 1984;Springer, 1983, 1988). Relationships among the Wve xen-isthmid genera have been hypothesized (Gill and Hoese,1993), but the relationship of Xenisthmidae to othergobioids is unknown; the only character identiWed thatindicates higher-level xenisthmid relationships is thepresence of six branchiostegal rays, as in other basalgobioid genera.

On a Wner scale, within clade EN a subclade is formedby the neotropical dwarf genera Microphilypnus andLeptophilypnus, plus the eastern and central AustralianPhilypnodon. Microphilypnus and Leptophilypnus are notclosely related to the other neotropical genera in thishypothesis, and additionally, are not sister to each other.Instead, the hypothesis is consistent with two invasionsof dwarf neotropical eleotrids, or with the presence ofmore widespread ancestral groups giving rise to the cur-rently present taxa. The distributions of Microphilypnusand Leptophilypnus are widely disjunct: Microphilypnusis known from South America, primarily the Orinocoand Amazon rivers and tributaries, while Leptophilypnusis restricted to Central America, from Panama north toGuatemala.

The remainder of clade EN is divided into twosubclades: a small group including Ratsirakea, Tateurn-dina, Ophieleotris, Mogurnda, and Xenisthmus, and a sec-ond clade including Gobiomorphus, Hypseleotris,Calumia, and the majority of new world eleotrines sam-pled (representatives of Dormitator, Guavina, Hemieleo-tris, Gobiomorus, Eleotris, and Erotelis). Ratsirakea is theonly Malagasy endemic taxon included in this analysis(the other endemic Malagasy eleotrid, Typhleotris, wasnot sampled). Calumia and Xenisthmus are the onlymarine-dwelling basal gobioid taxa in this hypothesis,and they are not closely related. Calumia is the only reef-dwelling eleotrid, and is known from East Africa to theSociety Islands; the Australian Hypseleotris is sister toCalumia. Like Ratsirakea, Tateurndina has a relativelyrestricted distribution, being found only in eastern NewGuinea. Xenisthmus and Ophieleotris are widespread inthe Indian Ocean and West PaciWc, and Mogurnda isknown from Australia and New Guinea.

Gobiomorphus is represented by four species fromNew Zealand and Australia in this hypothesis; G. aus-tralis and G. coxii from Australia, and G. breviceps andG. hubbsi from New Zealand. The hypothesis indicatesthat the Australian taxa form a paraphyletic grade basalto the New Zealand radiation of freshwater Gobiomor-phus. The relationships of the three Hypseleotris speciesexamined are congruent with an earlier study of phylog-eny for Hypseleotris (Thacker and Unmack, 2005), withH. compressa and H. aurea forming a clade exclusive of


H. klunzingeri. The remaining six genera in the EN cladeform a monophyletic group, and these genera comprise amajor radiation of eleotrids into the new world tropics.

The genera Dormitator, Guavina, Hemieleotris, Gobi-omorus, Eleotris, and Erotelis are all found in the neo-tropics. Of these, Dormitator includes one species knownfrom West Africa (D. lebretonis); and Eleotris is wide-spread worldwide. Of the species sampled for this study,all were neotropical except for some Eleotris species:E. sandwicensis from Hawaii, E. fusca from Sulawesi,and E. acanthopoma from Indonesia. The genera Eleotrisand Erotelis form a clade sister to the remainder of theneotropical genera; those four genera are grouped suchthat Dormitator is sister to Guavina, and Gobiomorus issister to Hemieleotris. The basal taxa in these clades,Guavina and Hemieleotris, are both known from thePaciWc.

In the molecular hypothesis, Eleotris is paraphyleticwith respect to the two Erotelis species A close relation-ship between Eleotris and Erotelis is also indicated bymorphological data. The genera share a common dorsalWn pterygiophore pattern and vertebral number (Bird-song et al., 1988). The question of whether or not to syn-onymize Erotelis under Eleotris has been debated basedon morphological data.

Eleotris is diagnosed by the presence of a preopercu-lar procurrent spine and patterns of sensory pores andpapillae (Miller, 1998). Miller (1998) also indicates thatErotelis is distinguishable from Eleotris only in that theformer has a high lateral scale count, with small, cycloidscales. Miller (1998) proposes that Erotelis and Eleotrisbe synonymized, but Pezold and Cage (2002) noted thatErotelis also diVers from Eleotris in having a taperedcaudal Wn with 12–14 unsegmented procurrent rays thatsupport a large membrane (rather than 8–10 with limitedmembrane in Eleotris), a more oblique jaw, more elon-gate body, more rays in the second dorsal and anal Wns,one more ray in the second dorsal Wn than anal Wn, and adistinctive pigmentation pattern on the Xanks. They rec-ommend that Erotelis and Eleotris be retained as sepa-rate genera. This molecular study concurs with Miller(1998) in that Erotelis is nested within Eleotris, and thusthe two genera should be synonymized. Miller (1998)also suggests that Leptophilypnus is the sister taxon toEleotris, due to the shared presence of an opercular rowof sensory papillae with some Eleotris species, althoughPezold and Cage (2002) point out that the putative syna-pomorphy is present in only one of the Leptophilypnusspecies. The molecular phylogeny indicates that Lepto-philypnus is distantly related to Eleotris, and instead, thatthe Eleotris/Erotelis clade is sister to the abovemen-tioned clade of four other neotropical genera.

Within the Eleotris/Erotelis clade, two smaller cladesare recovered. One consists of El. fusca from Sulawesi,sister to El. amblyopsis from Atlantic drainages ofCentral and South America. The second clade contains

three species pairs: most basal is the pair El. picta andEl. pisonis, sister to the pairs E. acanthopoma andEl. sandwicensis, and Er. armiger and Er. smaragdus; theWrst two pairs were also indicated to be closely related byMiller (1998). The relationships of these species present amixed pattern of distributions: El. picta and El. pisonisare known from PaciWc and Atlantic drainages of Cen-tral and South America, respectively, as are the pairEr. armiger and Er. smaragdus. The pair El. acanthop-oma and El. sandwicensis are not neotropical;El. acanthopoma is widespread in the Western PaciWcand El. sandwicensis is endemic to Hawaii. Two speci-mens of El. sandwicensis and one of El. acanthopoma(from GenBank) were included; the nesting of El. acant-hopoma within El. sandwicensis may be the result of amisidentiWcation of El. acanthopoma. Although themolecular hypothesis is informative as far as overall pat-terns within Erotelis and Eleotris, not all the species ofEleotris were sampled, so reconstruction of the completebiogeographic history of the genus would be premature.There are many additional Eleotris species known fromAsia, Africa, the Western Atlantic, Eastern PaciWc andthe PaciWc Islands not included in this study.

The clades revealed in this analysis show remarkableconcordance with the traditional, morphology-basedtaxonomy, and thus no alterations to the taxonomy areproposed. As with an earlier molecular study focussingon higher gobioids (Thacker, 2003), the primary conclu-sion of this analysis is that Eleotridae is paraphyleticwith respect to both Xenisthmidae and Gobiidae. Theextensive taxon sampling of this analysis allows moreprecise determination of the sister taxa to Xenisthmidae(Australian freshwater eleotrids Mogurnda and Ophiel-eotris), and reveals that Gobiidae is nested within thebutines (paralelling Akihito et al., 2000 and Wang et al.,2001).

4.6. Distribution and ecology of basal Gobioidei

Overall, the molecular phylogeny allows interpreta-tion both of distribution and the evolution of ecology inGobioidei. The majority of the taxa sampled inhabit theIndo-West PaciWc, including Australia, New Guinea,and New Zealand. The basal R. aspro is found in Asiaand Oceania, and clade OD includes the Western Aus-tralian Milyeringa, sister to the family Odontobutidae,known from Asia. Most of the basal goboid species areknown from the Indo-West PaciWc and Australia.Radiations in Africa (Kribia), Madagascar (Ratsirakea),and New Zealand (Gobiomorphus breviceps and G. hub-bsi) occurred independently in divergent clades. Invasionof the neotropics occurred at least twice and potentiallythree times (Microphilypnus and Leptophilypnus togetheror individually, plus the eleotrine radiation).

Within the neotropical goboids, there are Wveexamples of geminate taxa occurring on either side of the


isthmus of Panama. These are freshwater species, sounlike the more common marine geminate pairs, thepairs are separated into species inhabiting westward-Xowing PaciWc drainages and those inhabiting eastward-Xowing Atlantic drainages. Geminate pairs are includedsampled species of Eleotris, Erotelis, Gobiomorus, Dormi-tator, and Leptophilypnus, although both Eleotris andDormitator are considerably more widespread. This mul-tiplicity of phylogenetically separate contrasts allowsindependent comparisons of DNA sequence divergence.The divergences of the Wve pairs are variable; three arenear 20% (Er. smaragdus vs. Er. armiger: 19.5%;G. dormitor vs. G. maculatus: 21.4%; L. panamensis vs.L. Xuviatilis: 20.7%), one is intermediate at 9.5% (D. mac-ulatus vs. D. latifrons), and one is very shallow at 0.8%(El. pisonis vs. El. picta). In vertebrates, molecular clockrates have been estimated for COI and ND2 in Wsh (1.2and 1.3% pairwise divergence per million years (my),respectively; Bermingham et al., 1997); for cyt b in Wsh(average pairwise rate of 1.7%/my; McMillan andPalumbi, 1995); and for ND1 and ND2 in amphibiansand reptiles (1.3%/my; Macey et al., 1998a,b). Applyingthese rates to the basal gobioid transisthmian pairsyields divergence estimates of 12.5–17.8 my (Gobiomo-rus); 12.2–17.3 my (Leptophilypnus); 11.4–16.3 my (Erot-elis); 5.6–7.9 my (Dormitator); and 0.5–1.0 my (Eleotris).Even if the clock estimates are Xawed, these divergencesindicate a wide variety of timings for lineage splittingevents. Similar variation in divergence estimates forgeminate pairs have been observed in alpheid shrimp(Knowlton and Weight, 1998) and arcid bivalves(Marko, 2002), indicating that closure of the isthmuswas a protracted process, occurring from roughly 3–18 my ago. This range encompasses four of the gobioidpairs examined here; the very young divergence ofEl. pisonis and El. tecta may be due to isolation of drain-ages in an already emergent Panama, rather than upliftof the isthmus.

Ecologically, a pattern of freshwater origin followedby returns to salt-tolerance is seen when tracing the evo-lution of marine and/or freshwater ecology among gobi-oids. Gobioidei is sister to the widespread, primarilymarine family Apogonidae. It is generally assumed thatgobioids arose in freshwater, from a marine ancestor,then returned to marine habitats once or many times(Allen, 1989; Allen et al., 2002). This phylogenetic analy-sis bears out that assumption. The basal Rhyacichthys isexclusively freshwater, as are Odontobutis and Percottus.Exhibition of at least partial saltwater tolerance, how-ever, is the most widespread condition; most of the basalgobioids examined for this study are found in bothfreshwater and estuaries, and saltwater tolerance ishypothesized to have occurred at least twice (in cladeEN exclusive of Microphilypnus, Leptophilypnus, andPhilypnodon, and in the butine clade containing Ophio-cara, Bostrychus, and Oxyeleotris). Exclusively freshwa-

ter ecology is optimized as the condition at the root ofGobioidei; invasion of marine habitats is hypothesizedto have occurred independently in the distantly relatedCalumia, Xenisthmus, and Bathygobius + Gnatholepis(Gobiidae).

The Wnal trait examined on this phylogeny was theoccurrence of drastic size reduction, found in the generaKribia, Calumia, Leptophilypnus, Microphilypnus, andthe dwarf O. nullipora, all of which attain an adult size ofless than 40 mm. As with the evolution of miniaturiza-tion in higher gobioids (Thacker, 2003), these taxa repre-sent several diVerent instances of reduction. Kribia andOxy. nullipora are sister taxa, and Microphilypnus andLeptophilypnus are found in the same clade (along withPhilypnodon); both these groups are widely separated inthe phylogeny from each other and from Calumia,conWrming a pattern in which gobioids, already gener-ally small Wshes, have repeatedly undergone furtherreduction in size.

5. Conclusions

Analysis and interpretation of a large molecular data-set has resolved relationships among the basal lineagesof Gobioidei. The clades revealed in this analysis corre-spond well to the traditional taxonomy of the group: thefamily Rhyacichthyidae is basal, Odontobutidae (includ-ing Milyeringa) and Eleotridae (minus Milyeringa, andincluding Xenisthmidae and Gobiidae) are monophy-letic. Xenisthmidae is nested within Eleotrinae, and thetwo included representatives of Gobiidae are nestedwithin Butinae. A variety of outgroup taxa were exam-ined, and the closest relative to Gobioidei among thosesampled is the family Apogonidae. Interpretation of dis-tribution and ecology in the light of the phylogenyreveals that the most basal Gobioidei are found in thefreshwaters of the Indo-PaciWc, and separate radiationscolonized Asia, Africa, Madagascar, and, at least twice,the Neotropics. Five sister pairs of basal gobioid speciesinhabit Atlantic and PaciWc drainages of Panama, withwidely varying divergences. Evolution of partial salt-tol-erance or fully marine ecology evolved several times inGobioidei, as did reduced size.

Acknowledgments

The authors gratefully acknowledge all the individualswho provided tissue samples for this study: Gerry Allen,Akihisa Iwata, Andres Lopez, Bob MacDowall, FrankPezold, Leo Smith, John Sparks, Peter Unmack, Jim VanTassell, and Mark Westneat. We also thank Mark McG-routher and Don Colgan of the Australian Museum, Syd-ney; and Ed Wiley and Andy Bentley of the University ofKansas for curation and provision of tissue samples from


their collections. John Armbruster, Eldredge Berminghamand Mark Sabaj provided support for Weld collections inPanama and Guyana. Randy Mooi and Tony Gill pro-vided tissues, critiqued the manuscript, and assisted withcharacter interpretation. Two anonymous reviewers alsoprovided helpful comments on the manuscript. This studywas supported by a grant from the National ScienceFoundation (NSF DEB 0108416) and by grants from theW. M. Keck and R. M. Parsons Foundations.

References

Akihito, 1986. Some morphological characters considered to be impor-tant in gobiid phylogeny. In: Uyeno, T., Arai, R., Taniuchi, R.,Matsuura, K. (Eds.), Indo-PaciWc Fish Biology, Proceedings of theSecond International Conference on Indo-PaciWc Fishes. The Ich-thyological Society of Japan, Tokyo, pp. 629–639.

Akihito, Iwata, A., Kobayashi, T., Ikeo, K., Imanishi, T., Ono, H.,Umehara, Y., Hamamatsu, C., Sugiyama, K., Ikeda, Y., Sakamoto,K., Fumihito, A., Ohno, S., Gojobori, T., 2000. Evolutionary aspectsof gobioid Wshes based upon a phylogenetic analysis of mitochon-drial cytochrome b genes. Gene 259, 5–15.

Allen, G.R., 1989. Freshwater Fishes of Australia. T.F.H. Publications,Inc., Neptune City, NJ.

Allen, G.R., Midgley, S.H., Allen, M., 2002. Field Guide to the Fresh-water Fishes of Australia. Western Australian Museum, Perth.

Bermingham, E., McCaVerty, S.S., Martin, A.P., 1997. Fish biogeogra-phy and molecular clocks: Perspectives from the panamanian isth-mus. In: Kocher, T.D., Stepien, C.A. (Eds.), Molecular Systematicsof Fishes. Academic Press, San Francisco, pp. 113–128.

Birdsong, R.S., Murdy, E.O., Pezold, F.L., 1988. A study of the verte-bral column and median Wn osteology in gobioid Wshes with com-ments on gobioid relationships. Bull. Mar. Sci. 42 (2), 174–214.

Broughton, R.E., Stanley, S.E., Durrett, R.T., 2000. QuantiWcation ofhomoplasy for nucleotide transitions and transversions and a reex-amination of assumptions in weighted phylogenetic analysis. Syst.Biol. 49 (4), 617–627.

Bremer, K., 1988. The limits of amino acid sequence data in angio-sperm phylogenetic reconstruction. Evolution 42, 795–803.

Dingerkus, G., Séret, B., 1992. Rhyacichthys guilberti, a new species ofloach goby from northeastern New Caledonia (Teleostei: Rhyac-ichthyidae). Trop. Fish Hobby., 174–176.

Elmerot, C., Arnason, U., Gojobori, T., Janke, A., 2002. The mitochon-drial genome of the puVerWsh, Fugu rubripes, and ordinal teleosteanrelationships. Gene 295, 163–172.

Farris, J.S., Källersjö, M., Kluge, A.G., Bult, C., 1994. Testing signiW-cance of congruence. Cladistics 10, 315–320.

Farris, J.S., Källersjö, M., Kluge, A.G., Bult, C., 1995. Constructing asigniWcance test for incongruence. Syst. Biol. 44, 570–572.

Gill, A.C., Hoese, D.F., 1993. Paraxenisthmus springeri, new genus andspecies of gobioid Wsh from the West PaciWc, and its phylogeneticposition within the Xenisthmidae. Copeia 4, 1049–1057.

Hardman, M., 2004. The phylogenetic relationships among NoturuscatWshes (Siluriformes: Ictaluridae) as inferred from mitochondrialgene cytochrome b and nuclear recombination activating gene 2.Mol. Phylogenet. Evol. 30, 395–408.

Hardman, M., Page, L.M., 2003. Phylogenetic relationships amongbullhead catWshes of the genus Ameiurus (Siluriformes: Ictaluridae).Copeia 1, 20–33.

Hoese, D.F., 1984. Gobioidei: Relationships. In: Moser, H.G., (Ed.),Ontogeny and Systematics of Fishes. Spec. Pub. Amer. Soc. Ichthy.Herp. No.1. Allen Press, Lawrence, KS, pp. 588–591.

Hoese, D.F., Gill, A.C., 1993. Phylogenetic relationships of eleotridWshes (Perciformes: Gobioidei). Bull. Mar. Sci. 52 (1), 415–440.

Imamura, H., Matsuura, K., 2003. RedeWnition and phylogenetic rela-tionships of the family Pinguipedidae (Teleostei: Perciformes). Ich-thyol. Res. 50, 259–269.

Johnson, D.G., 1993. Percomorph phylogeny: progress and problems.Bull. Mar. Sci. 52 (1), 3–28.

Johnson, G.D., Brothers, E.B., 1993. Schindleria: a paedomorphic goby(Teleostei: Gobioidei). Bull. Mar. Sci. 52 (1), 441–471.

Johnson, D.G., Patterson, C., 1993. Percomorph phylogeny: a survey ofacanthomorphs and a new proposal. Bull. Mar. Sci. 52 (1), 554–626.

Källersjö, M., Albert, V.A., Farris, J.S., 1999. Homoplasy increasesphylogenetic structure. Cladistics 15, 91–93.

Knowlton, N., Weight, L.A., 1998. New dates and new rates for diver-gence across the Isthmus of Panama. Proc. R. Soc. Lond. B 265,2257–2263.

Macey, J.R., Schulte II, J.A., Ananjeva, N.B., Larson, A., Rastegar-Pouyani, N., Shammakov, S.M., Papenfuss, T.J., 1998a. Phyloge-netic relationships among agamid lizards of the Laudakia caucasiaspecies group: testing hypotheses of biogeographic fragmentationand an area cladogram for the Iranian Plateau. Mol. Phyl. Evol. 10,118–131.

Macey, J.R., Schulte II, J.A., Larson, A., Fang, Z., Wang, Y., Tuniyev,B.S., Papenfuss, T.J., 1998b. Phylogenetic relationships of toads inthe Bufo bufo species group from the eastern escarpment of theTibetan Plateau: a case of vicariance and dispersal. Mol. Phyloge-net. Evol. 9, 80–87.

Maddison, D.R., Maddison, W.P., 2000. MacClade 4: Analysis of Phy-logeny and Character Evolution. Version 4.0. Sinauer Associates,Sunderland, MA.

Marko, P., 2002. Fossil calibration of molecular clocks and the diver-gence times of geminate species pairs separated by the Isthmus ofPanama. Mol. Biol. Evol. 19, 2005–2021.

Mazzoldi, C., Scaggiante, M., Ambrosin, E., Rasotto, M.B., 2000. Mat-ing system and alternative male mating tactics in the grass gobyZosterisessor ophiocephalus (Teleostei: Gobiidae). Mar. Biol. 137,1041–1048.

McDowall, R.M., 1973. Relationships and taxonomy of the New Zea-land torrentWsh, Cheimarrichthys fosteri Haast (Pisces: Mugiloidi-dae). J.R. Soc. N.Z. 3, 199–217.

McDowall, R.M., 2000. Biogeography of the New Zealand torrentWsh,Cheimarrichthys fosteri (Teleostei: Pinguipedidae): a distribution drivenmostly by ecology and behaviour. Environ. Biol. Fishes 58, 119–131.

McMillan, W.O., Palumbi, S.R., 1995. Concordant evolutionary pat-terns among Indo-West PaciWc butterXyWshes. Proc. R. Soc. Lond.B 260, 229–236.

Miller, P.J., 1973. The osteology and adaptive features of Rhyacichthysaspro (Teleostei: Gobioidei) and the classiWcation of gobioid Wshes.J. Zool. Lond. 171, 397–434.

Miller, P.J., 1984. The tokology of gobioid Wshes. In: Potts, G.W., Woo-ton, R.J. (Eds.), Fish Reproduction: Strategies and Tactics. Aca-demic Press, London, pp. 119–153.

Miller, P.J., 1992. The sperm duct gland: a visceral synapomorphy forgobioid Wshes. Copeia 2, 253–256.

Miller, P.J., 1998. The west african species of Eleotris and their system-atic aYnities (Teleostei: Gobioidei). J. Nat. Hist. 32, 273–296.

Miya, M., Takeshima, H., Endo, H., Ishiguro, N.B., Inoue, J.G., Mukai,T., Satoh, T.P., Yamaguchi, M., Kawaguchi, A., Mabuchi, K., Shi-rai, S.M., Nishida, M., 2003. Major patterns of higher teleosteanphylogenies: a new perspective based on 100 complete mitochon-drial DNA sequences. Mol. Phylogenet. Evol. 26, 121–138.

Mooi, R.D., Johnson, G.D., 1997. Dismantling the Trachinoidei: evi-dence of a scorpaenoid relationship for the Champsodontidae. Ich-thyol. Res. 44 (2), 143–176.

Nelson, J.S., 1994. Fishes of the World, third ed. Wiley, New York.Pezold, F., Cage, B., 2002. A review of the spinycheek sleepers, genus

Eleotris (Teleostei: Eleotridae), of the western hemisphere, withcomparison to the West African species. Tulane Stud. Zool. Bot. 31,19–63.


Pietsch, T.W., 1989. Phylogenetic relationships of trachinoid Wshes ofthe family Uranoscopidae. Copeia 2, 253–303.

Pietsch, T.W., Zabetian, C.P., 1990. Osteology and interrelationships ofthe sand lances (Teleostei: Ammodytidae). Copeia 1, 78–100.

Shibukawa, K., Iwata, A., Viravong, S., 2001. Terateleotris, a new gobi-oid Wsh genus from the Laos (Teleostei, Perciformes), with com-ments on its relationships. Bull. Nat. Sci. Mus. Tokyo, Ser A 27 (4),229–257.

Smith, W.L., Wheeler, W.C., 2004. Polyphyly of the mail-cheeked Wshes(Teleostei: Scorpaeniformes): evidence from mitochondrial andnuclear sequence data. Mol. Phylogenet. Evol. 32, 627–646.

Sorenson, M.D., 1999. TreeRot, version 2. Boston University, Boston,MA.

Springer, V.G., 1983. Tyson belos, new genus and species of WesternPaciWc Wsh (Gobiidae, Xenisthminae), with discussions of gobioidosteology and classiWcation. Smithson Contrile Zool. 390, 1–40.

Springer, V.G., 1988. Rotuma lewisi, new genus and species of Wsh fromthe southwest PaciWc (Gobioidei, Xenisthmidae). Proc. Biol. Soc.Wash. 101 (3), 530–539.

SwoVord, D.L., 2001. PAUP*: phylogenetic analysis using parsimony* and other methods. Version 4.08b. Sinauer Associates, Sunder-land, MA.

Thacker, C.E., 2003. Molecular phylogeny of the gobioid Wshes. Mol.Phylogenet. Evol. 26 (3), 354–368.

Thacker, C.E., Unmack, P.J., 2005. Phylogeny and biogeography of theeleotrid genus Hypseleotris (Teleostei: Gobioidei: Eleotridae) withredescription of H. cyprinoides. Rec. Aust. Mus. 57, 1–13.

Wang, H.-Y., Tsai, M.-P., Dean, J., Lee, S.-C., 2001. Molecular phy-logeny of gobioid Wshes (Perciformes: Gobioidei) based on mito-chondrial 12S rRNA sequences. Mol. Phylogenet. Evol. 20 (3),390–408.

Watson, R.E., Pöllabauer, C., 1998. A new genus and species of fresh-water goby from New Caledonia with a complete lateral line(Pisces: Teleostei: Gobioidei). Senkenbergiana Biol. 77, 147–153.

Wiesel, G.F., 1949. The seminal vesicles and testes of Gillichthys, amarine teleost. Copeia 1, 101–110.

Winterbottom, R., 1993. Search for the gobioid sister group (Actin-opterygii: Percomorpha). Bull. Mar. Sci. 52 (1), 395–414.

molecular phylogeny of basal gobioid fishes: rhyacichthyidae

Documents