mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine...

doi: 10.1152/ajpheart.00533.2012304:H600-H609, 2013. First published 15 December 2012;Am J Physiol Heart Circ Physiol

and Kathrin BanachShwetha Mureli, Christopher P. Gans, Dan J. Bare, David L. Geenen, Nalin M. Kumarupregulation of connexin 43 through paracrine signalingMesenchymal stem cells improve cardiac conduction by

You might find this additional info useful...

for this article can be found at: Supplementary material

33.2012.DC1.htmlhttp://ajpheart.physiology.org/http://ajpheart.physiology.org/content/suppl/2013/02/07/ajpheart.005

59 articles, 25 of which you can access for free at: This article citeshttp://ajpheart.physiology.org/content/304/4/H600.full#ref-list-1

including high resolution figures, can be found at: Updated information and serviceshttp://ajpheart.physiology.org/content/304/4/H600.full

can be found at: PhysiologyAmerican Journal of Physiology - Heart and Circulatory about Additional material and information

http://www.the-aps.org/publications/ajpheart

This information is current as of April 1, 2013.

1522-1539. Visit our website at http://www.the-aps.org/. Rockville Pike, Bethesda MD 20814-3991. Copyright © 2013 the American Physiological Society. ESSN:molecular levels. It is published 24 times a year (twice monthly) by the American Physiological Society, 9650 cardiovascular function at all levels of organization ranging from the intact animal to the cellular, subcellular, andphysiology of the heart, blood vessels, and lymphatics, including experimental and theoretical studies of

publishes original investigations on theAmerican Journal of Physiology - Heart and Circulatory Physiology

at Universidad D

e Santiago on A

pril 1, 2013http://ajpheart.physiology.org/

Dow

nloaded from

http://ajpheart.physiology.org/http://ajpheart.physiology.org/content/suppl/2013/02/07/ajpheart.00533.2012.DC1.html

http://ajpheart.physiology.org/

Mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine signaling

Shwetha Mureli,1,2* Christopher P. Gans,1* Dan J. Bare,1 David L. Geenen,1 Nalin M. Kumar,3

and Kathrin Banach1

1Center for Cardiovascular Research, Department of Medicine, Section of Cardiology, University of Illinois at Chicago,Chicago, Illinois; 2Department of Bioengineering, University of Illinois at Chicago, Chicago, Illinois; and 3Departmentof Ophthalmology and Visual Sciences, University of Illinois at Chicago, Chicago, Illinois

Submitted 13 July 2012; accepted in final form 7 December 2012

Mureli S, Gans CP, Bare DJ, Geenen DL, Kumar NM, BanachK. Mesenchymal stem cells improve cardiac conduction by upregu-lation of connexin 43 through paracrine signaling. Am J Physiol HeartCirc Physiol 304: H600–H609, 2013. First published December 15,2012; doi:10.1152/ajpheart.00533.2012.—Mesenchymal stem cells(MSCs) were shown to improve cell survival and alleviate cardiacarrhythmias when transplanted into cardiac tissue; however, little isknown about the mechanism by which MSCs modify the electrophys-iological properties of cardiac tissue. We aimed to distinguish theinfluence of cell-cell coupling between myocytes and MSCs from thatof MSC-derived paracrine factors on the spontaneous activity andconduction velocity (�) of multicellular cardiomyocyte preparations.HL-1 cells were plated on microelectrode arrays and their spontane-ous activity and � was determined from field potential recordings. Inheterocellular cultures of MSCs and HL-1 cells the beating frequencywas attenuated (t0h: 2.26 � 0.18 Hz; t4h: 1.98 � 0.26 Hz; P � 0.01)concomitant to the intercellular coupling between MSCs and cardio-myocytes. In HL-1 monolayers supplemented with MSC conditionedmedia (ConM) or tyrode (ConT) � significantly increased in a time-dependent manner (ConT: t0h: 2.4 cm/s � 0.2; t4h: 3.1 � 0.4 cm/s),whereas the beating frequency remained constant. Connexin (Cx)43mRNA and protein expression levels also increased after ConM orConT treatment over the same time period. Enhanced low-densitylipoprotein receptor-related protein 6 (LRP6) phosphorylation afterConT treatment implicates the Wnt signaling pathway. Suppressionof Wnt secretion from MSCs (IWP-2; 5 �mol/l) reduced the efficacyof ConT to induce phospho-LRP6 and to increase �. Inhibition of�-catenin (cardamonin; 10 �mol/l) or GSK3-�/� (LiCl; 5 mmol/l)also suppressed changes in �, further supporting the hypothesis thatMSC-mediated Cx43 upregulation occurs in part through secretedWnt ligands and activation of the canonical Wnt signaling pathway.

mesenchymal stem cells; connexin 43; conditioned media; Wnt;microelectrode array

IN CLINICAL TRIALS BONE MARROW -derived mesenchymal stemcells (MSCs) are transplanted into cardiac infarct regions as apotential mechanism for cell replacement (55). Numerous invivo and in vitro studies demonstrate a beneficial effect ofMSC transplantation including reduced infarct size, preservedsystolic function, and reduced left ventricular remodeling (5,27, 53, 56). A significant portion of the transplanted MSCsdisappears from the infarct shortly after transplantation (32).However, it was demonstrated that the remaining MSCs ex-press connexin 43 (Cx43) (50), the gap junction isoform that

predominates in the cardiac muscle, and establish intercellularcoupling within the adult myocardium (9, 22, 46).

When nonexcitable cells such as fibroblasts establish inter-cellular coupling with cardiomyocytes through gap junctionchannels, they reduce the spontaneous activity and conductionvelocity of the cardiac tissue by increasing the myocytescapacitive load (18, 28). By bridging the conduction betweenspatially separated cardiomyocytes (7, 19), they can furtherincrease the heterogeneity of the excitation wave-front andincrease the propensity for cardiac arrhythmia (54). Theseconsequences suggest that MSC transplantation into the myo-cardium is proarrhythmic. However, MSCs have also beenshown to preserve impulse conduction (37), reduce the induc-ibility of ventricular arrhythmias (54), and improve atrio-ventricular conduction block (57). The preservation of conduc-tion cannot simply be explained by the integration of the MSCsinto the tissue; therefore, we hypothesize that significant ben-efit through MSCs is mediated by paracrine signaling. Thenumber of paracrine factors secreted by MSCs is extensive(29), and some of them were shown to facilitate angiogenesisand cardiomyogenesis, to inhibit cardiac remodeling, and tostimulate endogenous cardiac progenitor cells (45, 55). Modi-fications of the MSC secretome further showed that theircardioprotective effect is sensitive to the composition of sig-naling molecules secreted (11, 20, 40, 44), and the use ofconditioned media alone was shown to exhibit a protectiveeffect during ischemia/reperfusion injury (5). VEGF (30),IGF-1 (23), and secreted frizzled-related protein that is signif-icantly upregulated in the secretome of Akt overexpressingMSCs have been directly linked to cardiac repair (4, 39).Decreased infarct size after ischemia-reperfusion injury fol-lowing MSC transplantation may result from either enhancedmyocyte survival or through a mechanism of replacement bydifferentiated MSCs or endogenous stem cells. However, aspreviously demonstrated, MSC-mediated paracrine signalingsignificantly influences the calcium handling properties of indi-vidual cardiomyocytes and affects their survival (14), therebychanging cellular excitability and contractility. Changes in exci-tation-contraction coupling can modulate excitation spread andthe potential for arrhythmic activity. In addition, componentsof the MSC secretome like VEGF (36) and Wnt1 (33) havebeen reported to modulate cardiac gap junction expression (3,43), further supporting the hypothesis that MSCs can inducechanges in cardiac excitation spread.

Therefore, our aim in the current study was to determinewhether MSCs mediate changes in cardiac excitability and exci-tation spread and identify whether these changes occur throughheterocellular coupling or paracrine signaling.

Address for reprint requests and other correspondence: K. Banach, Sectionof Cardiology, Dept. of Medicine, Univ. of Illinois at Chicago, 840 SouthWood St. (MC 715), Chicago, IL 60612-7323 (e-mail: [email protected]).

Am J Physiol Heart Circ Physiol 304: H600–H609, 2013.First published December 15, 2012; doi:10.1152/ajpheart.00533.2012.

0363-6135/13 Copyright © 2013 the American Physiological Society http://www.ajpheart.orgH600

at Universidad D

e Santiago on A


Dow

nloaded from

mailto:[email protected]


MATERIALS AND METHODS

Mouse bone marrow-derived MSCs were isolated and cultured aspreviously described (8, 14, 21). The use of mice for this study wasfull in compliance with the National Institutes of Health Guide for theCare and Use of Laboratory Animals and approved by the Institu-tional Animal Care and Use Committee of the University of Illinois atChicago. Conditioned medium was obtained from 80% confluentMSCs after overnight culture. Conditioned tyrode (ConT) was ob-tained by overnight incubation (15 h) of 80% confluent MSC culturedishes (10 cm) with tyrode solution (10 ml) at 37°C (in mmol/l)containing 130 NaCl, 5.4 KCl, 1 CaCl2, 1.5 MgCl2, 10 NaHCO3, 10glucose, 25 HEPES, 4 L-glutamine, and 0.1 nonessential amino acids(pH 7.4) (14).

HL-1 cells, a murine cell line with an atrial-like phenotype, wascultured in Claycomb medium (SAFC Bioscience) supplemented withFBS (10%), L-glutamine (2 mmol/l), and norepinephrine (0.1 mmol/l)as previously described (13, 18). To monitor excitation spread inspontaneously active HL-1 monolayers the cells (0.3 � 106 cell/ml)were plated on multi-electrode arrays (MEAs; Multi Channel Sys-tems, Reutlingen, Germany) for field potential recordings (13, 17, 18,24). MEAs consisted of 60 electrodes with a diameter of Ø � 30 �mand an interelectrode distance of 200 �m. Experiments were con-ducted at 37°C, and data acquisition and analysis was performed aspreviously described (17, 18) by using Cardio 2D and Cardio 2Dsoftware (Multi Channel Systems, Reutlingen, Germany), respec-tively. For coculture assays, 0.2 � 106 MSCs were added to the HL-1monolayers, and electrophysiological changes were determined in30-min intervals. For experiments evaluating ConT, the culture me-dium on each MEA was replaced by Ctrl tyrode solution to establishbaseline activity. After 30 min cells were transferred either to Ctrl orConT for the duration of the experiment (4 h). LiCl (5 mmol/l; Sigma-Aldrich), cardamonin (10 �mol/l; EMD-Millipore), and PD98059 (CellSignaling Technology) were used for the inhibition of GSK-3�,�-catenin, and ERK1/2, respectively. Wnt3a, an activator of the canonicalWnt-signaling pathway, was obtained from Wnt3a overexpressing L-cells (49).

Coculture and dye diffusion assay. To determine the time course ofintercellular coupling between HL-1 cells and MSCs, MSCs wereloaded with calcein acetoxymethyl ester (Calcein AM; 2.5 �mol/l; 60min at 37°C; Invitrogen) and Vybrant-DiD (2.5 �mol/l; 30 min at37°C; Invitrogen) in serum free DMEM and 200 �mol/l probenecid(Sigma) (47). Dye loaded MSCs (0.3 � 106) were transferred to HL-1monolayers grown on glass-bottom tissue culture dishes. Dye diffu-sion between MSCs and HL-1 cells was monitored by confocalmicroscopy and analyzed using ImageJ (National Institutes of Health,Bethesda, MD) (18). Data were analyzed as the percentage of MSCscoupled to HL-1 cells per optical field.

Quantitative RT-PCR. Total RNA was isolated from MSCs or HL-1cells using the RNeasy Mini Kit (Qiagen) according to the manufactur-er’s protocol. Total RNA was treated with DNAase I (Fermentas LifeSciences) to remove residual genomic DNA. Treated total RNA was thenused as template for complementary DNA (cDNA) synthesis using theRevertAid First Strand cDNA Synthesis Kit (Fermentas Life Sciences).The cDNA synthesis reaction was performed using random hexamerprimers supplied by the manufacturer. cDNA was used as template inquantitative PCR reactions with gene-specific primers and SYBR Ad-vantage qPCR premix (Clontech). The primer 18S was used for normal-ization (5=AATTGACGGAAGGGCACCAC3=; 5=GTGCAGCCCCG-GACAT CTTAAG3=). A primer set spanning the intron of connexin 46(Cx46) (5=GGTGGTGGTGGTGGTAAAAG3=;5=CTACTGGGG-AGAGCAGGACA3=) served as a negative control for genomic DNAcontamination. Expression of target genes was normalized to expressionof 18S using QGene software (21). Cx43 (5=TCCAAGGAGTTCCAC-CACTT3=; 5=GGACCTTGTCC AGCAGCTT3=) and Cx45 (5=TGGG-TAACAGGAGTTCTGGTG3=; 5=CAAATGTCG AATGGTTGTGG3=)

primer sets were verified to amplify cDNA synthesized from knownpositive tissues (data not shown).

SDS-PAGE and Western blotting. One-hundred percent confluentHL-1 cells plated on 35-mm tissue culture dishes were recoveredfollowing experimental treatment (0.5 or 4 h) with the addition of hot1-X Laemmli sample buffer lacking �-mercaptoethanol (�-ME) andbromophenol blue dye. The samples were then heated to 95°C for 5min and stored at 20°C until further processing. Sample proteindeterminations were made with a BCA protein assay kit (Pierce)followed by the addition of �-mercaptoethanol and dye to the finalconcentrations appropriate for the 1-X sample buffer and heated asbefore. The HL-1 cell lysates were separated for protein analysis usingeither precast 10% or 4–20% Novex tris-glycine gels (Invitrogen)following standard electrophoresis protocols for SDS-PAGE andWestern blotting. Typically, 35 �g of protein was loaded per sample;however, for the detection of phospho-low-density lipoprotein recep-tor-related protein 6 (LRP6) 120 �g of total protein was required.Primary antibodies used for Western blotting were anti-phospho-Akt-Ser473 (No. 4058), phospho-ERK1/2 (No. 4370), phospho-LRP6-Ser1490 (No. 2568), GAPDH (No. 5174) from Cell Signaling Tech-nology, anti-connexin 43 (71-0700; Invitrogen), and anti-�-catenin(C7207; Sigma-Aldrich). Species-specific horseradish peroxidase-conjugated secondary antibodies were used, and visualization wasaccomplished using Western Lighting Plus-chemiluminescence re-agents (PerkinElmer) and Kodak BioMax film.

Statistical analysis. Experimental values were compared with con-trols using the unpaired two-tailed Student’s t-test. Nonlinear regres-sion was performed using GraphPad Prism software. Data are pre-sented as means � SE. Absolute and percent change values for � andbeating frequency are presented in the text. Differences were consid-ered significant at P � 0.05.

RESULTS

MSCs modulate the spontaneous activity of HL-1 cells. It hasbeen demonstrated that nonexcitable cells such as fibroblastschange the spontaneous activity of cardiomyocyte monolayers(18, 38). To determine the influence of MSCs on the electro-physiological properties of multicellular cardiomyocyte prep-arations monolayers of HL-1 cells were established on MEAs.After 1 day in culture HL-1 monolayers exhibited a typicalspontaneous beating frequency of 2.26 � 0.18 Hz (n � 10) anda conduction velocity (�) of 1.5 � 0.15 cm/s (n � 4). At thistime 0.2 � 106 MSCs dissociated in MSC medium were addedto the MEA. In Ctrl MEAs the beating frequency of the HL-1monolayers exhibited a slight increase over time in culture(t5h � 2.92 � 0.34 Hz; n � 4), whereas cultures supplementedwith MSCs exhibited a decrease in beating frequency, starting2 h after coculture (Fig. 1A). After 5 h the frequency decreasedto t5h of 1.98 � 0.26 Hz (n � 7) or 0.82 � 0.09 whennormalized to the frequency at t0 and was significantly reducedcompared with that of time matched homo-cellular HL-1monolayers (t5h: 1.22 � 0.06, n � 4; P � 0.01). The MSC-mediated suppression of the spontaneous activity was alsoreflected in the increased likelihood of cessation of beating inthe cultures (not shown). In HL-1 MEAs at t5h cessation ofspontaneous activity was observed in only 14.8% of the cul-tures. Some HL-1/MSC-MEAs, however, stopped beating al-ready after t3h of coculture, with 71.3% of the cultures quies-cent at t5h.

HL-1 cells and MSCs establish intercellular coupling via gapjunctions. Others and we have previously demonstrated that non-excitable cells like fibroblasts can change cardiomyocyte excit-ability by establishing heterocellular coupling through gap junc-

H601MSC-INDUCED Cx43 EXPRESSION IN CARDIOMYOCYTES

AJP-Heart Circ Physiol • doi:10.1152/ajpheart.00533.2012 • www.ajpheart.org

at Universidad D

e Santiago on A


Dow

nloaded from


tion channels (18, 38). To determine whether and in which timeframe the spontaneous beating rate of HL-1 cells is altered byheterocellular coupling with MSCs, we plated calcein/AM-loadedMSCs onto a monolayer of HL-1 cells. Heterocellular couplingwas identified when calcein fluorescence was detected in HL-1cells and a dye-loaded MSC was identified on top of the mono-layer (see Fig. 1C). Intercellular dye diffusion was detected asearly as 20 min after coculture was established, and the number ofcoupled cells increased over the initial 4 h (Fig. 1D: t4h: 46.23 �2.99%; n � 13 cultures with a total of 570 cells analyzed),whereas only a gradual increase in the number of coupled cellswas determined after that (t24h: 60.07 � 4.8%; n � 13). Dyediffusion between MSCs and HL-1 cells was significantly atten-uated when the coculture was established in the presence of thegap junction inhibitor carbenoxolone (100 �mol/l; t4h: 1.75 �1%; n � 3). The results support the hypothesis that the hetero-cellular coupling established between MSCs and HL-1 cellschanges the spontaneous beating rate of the HL-1 monolayer,thereby demonstrating that it is attributed primarily to heterocel-lular coupling.

Homo- and heterocellular HL-1 monolayers exhibited a gradualincrease in � over time (t5h: HL-1: 1.9 � 0.1 cm/s, n � 4;HL-1/MSC: 1.6 � 0.16 cm/s, n � 6) representing a 1.35- and1.16-fold increase, respectively, over a 5-h period (P � 0.3). Nosignificant difference of � was determined between homo- andheterocellular cultures at any time of the experiment (Fig. 1B).This result was in contrast with our previous experiments usingheterocellular cultures of HL-1 cells and fibroblasts where inter-cellular coupling induced a decrease in � (18). To test the hypoth-esis that paracrine factors secreted by MSCs compensate for the

coupling induced decrease in �, we treated HL-1 monolayers witheither MSC culture media (ConM: Fig. 2A), or tyrode that wasconditioned by mouse or human MSCs (14) (Fig. 2B). NeitherConM (ConM: t0h: 2.41 � 0.11 Hz; t4h: 2.46 Hz � 0.07; n � 17),mouse ConT (ConT: t0h: 3.34 � 0.37 Hz; t4h: 3.93 � 0.27 Hz;n � 13), or human ConT (ConTh: t0h: 2.776 � 0.293 Hz; t4h:2.844 � 0.523 Hz; n � 5) induced a change in the spontaneousbeating of the HL-1 monolayers compared with Ctrl cultures(Ctrl: t0h: 4.13 � 0.19 Hz; t4h: 4.17 � 0.16 Hz; n � 27). However,in contrast with HL-1/MSC cocultures, treatment of HL-1 mono-layers with ConM (ConM: t0h: 1.2 cm/s � 0.05; t4h: 1.9 � 0.1cm/s; n � 17; P � 0.05), ConT (ConT: t0h: 1.84 � 0.57 cm/s;t4h: 2.93 � 0.74 cm/s; n � 13; P � 0.05), or ConTh (ConTh: t0h:1.08 � 0.07 cm/s; t4h: 1.57 � 0.18 cm/s; n � 5; P � 0.05) sig-nificantly increased � over time (Fig. 2, A and B). No significantchange was determined in HL-1 monolayers that were treatedwith media or tyrode alone (HL-1 tyrode: t0h: 1.49 � 0.33cm/s; t4h: 1.72 � 0.49 cm/s; n � 26). The results support thehypothesis that paracrine factors secreted by MSCs modulatecardiac conduction velocity.

An increase in � of cardiomyocyte monolayers can be inducedby enhanced depolarizing currents that drive the upstroke of theaction potential or a decrease in the intercellular resistance due toan increased number of gap junction channels. To determine thecontribution of the voltage-dependent sodium current to changesin � we increased the extracellular potassium [K]o from 4.8mmol/l to 8.5 mmol/l (17) in cultures that were treated with ConMfor 4 h. In Ctrl and ConM-treated HL-1 monolayers (not shown)the increase in [K]o resulted in a decrease of the beating frequencycompared with t0 (Ctrl: t4h: 24.2 � 6.3%, n � 4 ; ConM: t4h:

0 1 2 3 4 5

0.6

0.8

1.0

1.2

1.4 # * *

* p < 0.01 # p < 0.05

time [h] be

atin

g fr

eque

ncy

[nor

m]

0 1 2 3 4 5

0.6

0.8

1.0

1.2

1.4

: HL-1

time [h]

[nor

m]

A B

0 1 2 3 4 5 6 7 24 0

10 20 30 40 50 60 70

time [h] co

uple

d M

SCs

[%]

70 µm

20 µm z axis

HL-1 MSC

MSC

C D

: HL-1 + MSCs

Fig. 1. Mesenchymal stem cells (MSCs) estab-lish intercellular coupling with cardiomyocytesand modify their electrophysiological properties.Addition of MSCs to a monolayer of spontane-ously beating HL-1 cells attenuates their beatingfrequency over time (A), whereas no change in �was determined (B). Three-dimensional recon-struction of z-stack images (C, left) obtained byconfocal microscopy shows calcein/AM-loadedMSCs on top of an HL-1 monolayer (C, right).Dye transfer through gap junction channels wasdetermined between the 2 cell types. Heterocel-lular coupling between MSCs and HL-1 cellsoccurs rapidly over the first hours of coculture(D; solid line) and is suppressed by carbenox-olone (dotted line).

H602 MSC-INDUCED Cx43 EXPRESSION IN CARDIOMYOCYTES


at Universidad D

e Santiago on A


Dow

nloaded from


20.3 � 6.5%, n � 5). Although � was decreased for Ctrlpreparations over time, it remained significantly increased inConM-treated HL-1 monolayers (CtrlK: 0.8 � 0.07 cm/s, n � 4;ConMK: 1.4 � 0.1 cm/s, n � 5; P � 0.01). In addition, nochanges in protein level of Nav1.5 were determined after 4 htreatment with either ConM (Fig. 3C) or ConT (Fig. 3D). Theresult supports the hypothesis that paracrine signaling from MSCsincreases � by a mechanism independent of voltage-dependentsodium current.

To determine whether MSC-secreted factors enhance theintercellular coupling, we determined the expression of cardiacconnexin isoforms in control and ConM-treated HL-1 mono-layers by quantitative RT-PCR. In accordance with their atrialphenotype, mRNA for Cx40, Cx43, and Cx45 was confirmedin HL-1 cells (17). Cx43 was expressed at the highest abun-dance (8-fold higher levels than Cx45). After 4 h treatment ofHL-1 cells with ConM, Cx43 mRNA levels were significantlyincreased compared with Ctrl-treated cells (Cx43: 1.829 �

0 1 2 3 4 0.5

1.0

1.5

2.0

* * *

time [h]

[nor

m]

A

C D

: Ctrl : ConM

B

1 2 3 4 0.5

1.0

1.5

2.0

[nor

m]

: Ctrl : h-ConT : ConT

time [h]

* * *

* &

&

0.5 h 4 h

Fig. 2. Paracrine factors secreted by MSCs in-crease the conduction velocity of HL-1 mono-layers. Conditioned culture medium from MSCs(ConM; A) as well as tyrode conditioned in thepresence of mouse MSCs (ConT; B) and humanMSCs (h-ConT; B) increased � in HL-1 mono-layers in a time-dependent manner (*P � 0.05and &P � 0.05 compared with Ctrl). Contourplots of an HL-1 monolayer at 0.5 h (C) and 4 h(D) after addition of ConT are also shown.

Cx43 Cx45 0.0

0.5

1.0

1.5

2.0

2.5 *

* p<0.05

mR

NA

[Con

M /C

trl]

A

C Ctrl + + + ConM + + +

D Ctrl + + + ConT + + +

0.0

0.2

0.4

0.6

Cx4

3 [a

.u.] *

&: Ctrl

: Ctrl : ConM

: ConT

GAPDH

Cx43

GAPDH

WB

: AB

Cx43

WB

: AB

Nav1.5 Nav1.5

B

Fig. 3. MSC-conditioned medium increasesconnexin (Cx)43 expression in cardiomyocytes.mRNA content of Cx43 and Cx45 determinedby quantitative RT-PCR in HL-1 cells after 4 hof treatment with ConM showed a significantincrease in Cx43 but not Cx45 (A). Densitomet-ric quantitation of Cx43 blots (B) shown (C andD) revealed a significant increase in the ratio ofphosphorylated vs. nonphosphorylated Cx43 inboth ConM- and ConT-treated groups (* and&P � 0.05 compared with respective Ctrl).Western blotting results of ConM (C)- andConT (D)-treated HL-1 cells probed for Cx43and Nav1.5 protein levels are shown. GAPDH isshown as a loading control (n � 3 for eachgroup).



at Universidad D

e Santiago on A


Dow

nloaded from


0.243; n � 3; P � 0.05). The effect was specific to Cx43, andno change in Cx45 mRNA was determined (Cx45: 1.322 �0.115, n � 3; Fig. 3A). The increase in Cx43 mRNA was alsoreflected in the protein level. Immunoblotting of whole celllysates revealed an increase in Cx43 protein after 4-h treatmentof HL-1 cells with either ConM (Fig. 3C) or ConT (Fig. 3D).Densitometric analysis of the Western blots (Fig. 3B) showeda small but significant increase in the ratio of phosphorylatedversus nonphosphorylated Cx43, over the 4-h time period.Induction of Cx43 expression has been described downstreamof the glycogen synthase kinase-3 (GSK-3)/�-catenin signalingcascade (3). To evaluate whether �-catenin signaling is re-quired for the increase in �, we supplemented ConT withcardamonin (10 �mol/l). Cardamonin that was previouslydescribed to stabilize �-catenin in its degradation complex (12)significantly attenuated the ConT-induced increase in Cx43protein expression and � (ConT carda: t4h: 1.52 � 0.20 cm/s,n � 7; ConT: t4h: 2.52 � 0.20 cm/s, n � 8; P � 0.05) (Fig. 4,A and B). In Ctrl cultures supplemented with cardamonin, aslight reduction in Cx43 protein levels was determined, how-ever, without a significant change in �. The results support thehypothesis that ConT regulates Cx43 and concomitant changesin � through stimulation of �-catenin signaling.

ConT-mediated upregulation of Cx43 depends on �-catenin andGSK-3. �-Catenin is a downstream target of GSK3-�, a serine/threonine kinase that phosphorylates and stabilizes �-catenin in its

degradation complex (26). Phosphorylation and consequently theinactivation of GSK3-� is regulated by different signal-transduction pathways, including a phosphatidylinositol 3-kinase(PI3K)/Akt and a Wnt-dependent signaling cascade (6). To de-termine whether inhibition of GSK3-� can mimic the ConT-mediated effect, we supplemented Ctrl solution and ConT withlithium (LiCl; 5 mmol/l), an inhibitor of GSK3-�. Addition ofLiCl to Ctrl solution induced a time-dependent increase in �(Fig. 5B: CtrlLi: t4h: 2.67 � 0.07 cm/s; n � 7; P � 0.05) andincreased Cx43 protein levels (Fig. 5A); the addition of LiCl toConT on the other hand did not have an additive effect (ConTLi:t4h: 2.90 � 0.13 cm/s; n � 10; ConT: t4h: 2.93 � 0.20 cm/s; n �13), indicating that ConT and LiCl converge on the same down-stream signaling mechanism.

We have previously demonstrated that ConT induces GSK3-�phosphorylation through the PI3K/Akt pathway in isolated mouseventricular myocytes (14). Because PI3K/Akt is a downstreamtarget of VEGF signaling, we determined its role in the regulationof Cx43 expression. However, supplementation of ConT with thePI3K inhibitor wortmannin (50–100 nmol/l; Fig. 6A), or supple-mentation of ConT with a VEGF R2/Flk-1 antibody (1 �g/ml)(43) (ConT anti-VEGFR: t4h: 2.33 � 0.13 cm/s; n � 4; ConT:t4h: 2.93 � 0.20 cm/s; n � 13) (Fig. 6C) did not prevent theConT-induced upregulation of Cx43 or an increase of � in HL-1cells, respectively.

GSK3-� phosphorylation is also a downstream target of thecanonical Wnt pathway after stimulation of the frizzled recep-

Ctrl + + + + + +

LiCl - + - + - +

1h 4h

5

20

40

60

80

* *,&

time

*

cha

nge

[%]

Cx43

GAPDH

: Ctrl

: ConT : Ctrl + LiCl

: ConT + LiCl

A

B

WB

: AB

0

Fig. 5. Lithium inhibition of GSK-3� mimicks the effect of ConT on � andCx43 protein expression. Supplementation of Ctrl tyrode with LiCl (4 h) led toan increase in Cx43 protein levels in HL-1 monolayers (A). A concomitantincrease in � (B) was seen in spontaneously beating HL-1 cells. The LiCl-induced increase in � was not additive to the effect of ConT (*P � 0.05compared with Ctrl; &P � 0.05 compared with Ctrl Li).

Ctrl + +

ConT + + + + + +

carda - + - + - + +

1 h 4 h

60

100

time [h]

cha

nge

[%]

*

*

: Ctrl

: ConT : Ctrl + carda

: ConT + carda

A

B

Cx43

-catenin

GAPDH

WB

: AB

-20

20

Fig. 4. �-Catenin inhibition prevents the ConT-mediated increase in Cx43protein levels. Western blotting analysis of Cx43 protein levels (A) after 4 h ofConT or Ctrl treatment in the presence or absence of cardamonin (Carda: 10�mol/l; n � 3 for each) is shown. Cardamonin prevented the ConT-mediatedincrease of � in HL-1 monolayers (B; *P � 0.05 compared with Ctrl).



at Universidad D

e Santiago on A


Dow

nloaded from


tor. To identify whether ConT activates Wnt receptor signal-ing, we determined the phosphorylation levels of LRP6. LRP6is part of the Wnt receptor and becomes phosphorylated uponWnt stimulation (52). In ConT-treated HL-1 cells (30 min) theLRP6 phosphorylation level was increased (Fig. 7A). To sup-press the release of Wnt, MSCs were treated with the smallmolecule inhibitor of the Wnt pathway IWP-2 (5 �mol/l, 24 h)before tyrode was conditioned in their presence (ConTIWP-2).The final concentration of IWP-2 in ConTIWP-2 was 0.5 �mol/l.When HL-1 cells were treated with ConTIWP-2, LRP6 phos-phorylation was significantly reduced compared with that ofConT-treated cells (Fig. 7, A and B). After 4 h of incubation,Cx43 expression was not significantly different from ConT-treated HL-1 cells (Fig. 7C); however, the ConT-inducedincrease in � was attenuated (ConTIWP-2: t4h: 1.80 � 0.05 cm/s,n � 7; ConT: t4h: 2.73 � 0.19 cm/s, n � 16; P � 0.05) (Fig.

7D). It was previously demonstrated by mass spectroscopystudies and RNA expression profiling that Wnt3a is expressedin MSCs (41). To determine whether the effect can be mim-icked by Wnt3a, media from Wnt3a overexpressing L-cells(49) were added to HL-1 monolayers (Fig. 8A, Ctrl Wnt3a).Also in this case an increase in � compared with that ofnontreated Ctrl cultures was determined (Ctrl Wnt3a: t4h:1.88 � 0.18 cm/s, n � 6; Ctrl: t4h: 1.85 � 0.11 cm/s, n � 4;P � 0.05) (Fig. 8A). These results support the hypothesis thatMSC ConT-induced changes are in part through activation ofthe canonical Wnt pathway. However, with significant LRP6phosphorylation remaining in ConTIWP-2 another mechanismof LRP activation remained likely, particularly since the IWP-2concentration used was previously shown to predominatelyblock Wnt secretion (10). Recent evidence indicates the MAPkinases ERK1/2 in an alternative pathway of LRP6 phosphor-ylation (31). We evaluated ERK1/2 activity in HL-1 lysatesand found that both ConM and ConT significantly increasedERK1/2 phosphorylation at 30 min and 4 h of incubation (Fig.6B and 7, A and C). Supplementation of ConT with the ERK1/2inhibitor PD98059 (25 �mol/l) (35) significantly attenuated theConT-mediated increase in � (ConT PD98059: t4h: 2.04 �0.11 cm/s, n � 4; P � 0.05) (Fig. 8B); no change wasdetermined in Ctrl cultures with PD98059 (Ctrl PD98059:t4h: 1.41 � 0.03 cm/s; n � 3). These results strongly suggestthat p-ERK1/2 can contribute to GSK3/�-catenin-mediatedCx43 upregulation.

DISCUSSION

We demonstrated that MSCs modulate the excitability andconduction of multicellular cardiomyocyte preparations by twodifferent mechanisms. They can reduce spontaneous activity ofcardiomyocyte monolayers by establishing intercellular couplingthrough gap junction channels; however, paracrine signaling canalso increase the conduction velocity of the cardiomyocyte mono-layer through upregulation of Cx43 without altering the beatingfrequency. An experimental examination supports an induction ofCx43 expression through the canonical Wnt/GSK3/�-catenin sig-nal transduction pathway in a Wnt and potentially ERK1/2-dependent and -independent manner.

Influence of nonexcitable cells on cardiac excitation spread.Nonexcitable cells like fibroblasts and endothelial cells makeup a significant portion of the ventricular muscle. Research hasfocused on the influence of these cells on the electrophysio-logical properties of the cardiac muscle. In vitro models dem-onstrate that electrotonic coupling of the nonexcitable cells canbridge excitation spread over spatially separated areas of myo-cytes (19, 42) and cause a decrease in � in a dose (cellnumber)-dependent manner (18, 38). In cocultures of MSCsand neonatal cardiomyocytes a �20% decrease in conductionvelocity was reported compared with homocellular cardiomy-ocyte cultures and re-entrant arrhythmias could be more easilyinduced in the vicinity of MSCs clusters (9). In our coculturemodel, although there was a significant decrease in the spon-taneous beat rate of HL-1 cells as a consequence of theintercellular coupling, we did not observe a significant de-crease of � as previously described for HL-1/fibroblast cocul-tures (18). The lack of change in � could be explained by thefact that the direct effect (capacitive coupling) of the MSCs ismasked or compensated by the upregulation of Cx43 through

Ctrl + + ConM + +

ConMWM 50 nM 100 nM

p-Akt

Cx43

GAPDH

A

B

0

20

40

60

80

100

time [4 h]

: Ctrl

: ConT : Ctrl + antiVEGFR

: ConT + antiVEGFR

cha

nge

[%]

*

*

WB

: AB

time [4 h]

Ctrl + + + ConM + + +

C

GAPDH

p-Akt p-ERK

WB

: AB

Fig. 6. A ConM-mediated increase in � does not depend on phosphatidylino-sitol 3-kinase/Akt signaling. Western blotting analysis of ConM-mediated (4 h)changes in p-Akt and Cx43 in the presence and absence of wortmannin (WM;50 and 100 nM; A) is shown. ConM (4 h) also increased p-ERK 1/2 whereaschanges in p-Akt were close to baseline (B). GAPDH is shown as a loadingcontrol for both experiments. The change of � in Ctrl and ConT-treated HL-1cells with and without the addition of an anti-VEGF receptor (VEGF-R)antibody (*P � 0.05 compared with Ctrl; C) is shown.



at Universidad D

e Santiago on A


Dow

nloaded from


paracrine signaling. However, because we were not yet able toisolate the effects induced by MSC/HL-1 intercellular cou-pling, other explanations have to be considered. Coupling ofMSCs could be insufficient to induce changes in �. Because westill see a decrease in beating frequency this would mean that� is less sensitive to heterocellular coupling. This would stillleave us to explain that no increase in � was determined. Theincrease in � could be prevented if 1) the time of coculture isinsufficient to secrete enough active factors to induce Cx43upregulation or 2) coculture could change the MSC secretome.We could previously demonstrate that MSC-mediated increasein cardiomyocyte Akt phosphorylation was readily inducedwhen coculture was established and was unaffected from thepresence of cardiomyocyte (14). However, because Akt sig-naling does not play a role in Cx43 upregulation, we cannotrule out that changes in the secretome occur.

The paracrine effect of MSCs on � described here was notpreviously examined; however, in agreement with our data,MSCs have been shown to preserve impulse conduction (37),reduce the inducibility of ventricular arrhythmias (54), andimprove atrioventricular conduction block (57). The reason for

the discrepancy in the coculture models could be the result ofthe fact that in our cultures MSCs only comprised 10% of totalcell number. This number is lower than the numbers that werepreviously tested in coculture models (9). In addition, in ourcoculture model MSCs were added to an already establishedmonolayer of cardiomyocytes and coculture was monitoredduring the onset of heterocellular coupling. This is in contrastwith other models where a mixture of MSCs and myocytes isplated (9). Under these conditions MSCs spatially separatecardiomyocytes, which can increase the heterogeneity of theexcitation wavefront. Our results would suggest that duringintegration of higher numbers of MSCs in a cardiomyocytepreparation the effect of the capacitive coupling could overridethe effect of the paracrine signaling on the conduction velocity;however, the previously established low retention of MSCsafter transplantation suggests that paracrine signaling may playthe predominate role to affect positive changes in the myocar-dium.

Influence of MSCs on HL-1 cell excitability and beating fre-quency. During coculture of HL-1 cells and MSCs an attenu-ation of the spontaneous beating frequency was determined.

0

1

2

3

4

1

A

B

Ctrl + + ConT + + + + + + IWP-2 + + +

p-LRP6 Cx43

0

20

40

60

80

c

hang

e [%

]

* * *

Ctrl ConT ConT + IWP-2

p-ERK1/2 p-ERK1/2

GAPDH

Ctrl + + ConT + + + + + + IWP-2 + + +

time 4 h time 30 min C

GAPDH

p-LR

P6/G

APD

H

(rel

. den

sity

)

* * *

: Ctrl : ConT : ConTIWP-2

Ctrl ConT ConT + IWP-2

D

WB

: AB

WB

: AB

Fig. 7. ConT-mediated changes depend uponthe activation of low-density lipoprotein re-ceptor-related protein 6 (LRP6) through ago-nists of the canonical Wnt-signaling pathway.Changes in p-LRP6, p-ERK1/2, and Cx43after 30 min (A) or 4 h (C) of incubation withConT that was generated from control MSCsor MSCs treated with IWP-2 (ConTIWP-2) areshown. Densitometric quantitation (B) of theblot shown in A revealed significantly reducedp-LRP-6 (n � 3), without significant reduc-tion in Cx43 protein. At both time pointsp-ERK1/2 was increased well above controllevels (n � 3). GAPDH was used as a loadingcontrol. The ConTIWP-2-treated HL-1 mono-layer showed an attenuated increase in � (D)compared with ConT-treated cultures (*P �0.05 between treatment groups indicated). Rel,relative.

Cytoplasm

Extracellular space

Plasma membrane

Wnts / ConT IWP-2 (5 µM)

GSK3- LiCl (20 mM)

-catenin cardamonin (10 µM)

P

Cx43 expression

Frizzled LRP-6 RTK

Ligand

ERK P

1 h 4 h -20

0

20

40

cha

nge

[%]

: Ctrl + Wnt3a : Ctrl * A

0

20

40

60

80 : Ctrl

: ConT : Ctrl + PD98059

: ConT + PD98059

1 h 4 h time [h]

*,& *,&,#

cha

nge

[%]

B

C

PD98059 (25 µM)

Fig. 8. Canonical Wnt signaling and ERK1/2signaling pathways affect Cx43 expression.Treatment of HL-1 monolayers with media ob-tained from Wnt3a overexpressing L1 cells sig-nificantly increased the � after 4 h (A; *P � 0.05compared with Ctrl). PD98058, an ERK1/2 in-hibitor, attenuated the ConT-mediated increaseof � in HL-1 monolayers (B; *P � 0.05 com-pared with Ctrl; &P � 0.05 compared withCtrl PD98059; #P � 0.05 compared withConT). A schematic summary of the experimen-tal results illustrates the proposed signal trans-duction pathway (C). RTK, receptor tyrosinekinase.



at Universidad D

e Santiago on A


Dow

nloaded from


This change in the rate of diastolic depolarization could be dueto the direct effect of heterocellular coupling on the origin ofexcitation by depolarization of the HL-1 cells or the increase intheir capacitance. Alternatively, the coupling-induced changescould result in a shift of the origin of excitation to an unaf-fected area or an area with increased pacemaker current. Wehave previously demonstrated that fibroblasts under the sameconditions reduce spontaneous beating of HL-1 monolayersthrough depolarization and increase of HL-1 cell capacitance(18). The fact that ConT alone had no impact on the sponta-neous activity indicates that paracrine signaling induced nosignificant changes in HL-1 excitability under the assumptionthat the secretome remained unchanged.

MSC mediated upregulation of Cx43. In cardiomyocyte mono-layers the major factors affecting � are the cellular excitability,which is determined by the availability of Na channels and theintercellular resistance, which depends on the expression ofgap junction channels. Although we have previously describeda ConT-mediated increase in ICa,L in adult ventricular myo-cytes (14), a change in cellular excitability is unlikely to fullyexplain the increase in � determined in this study. The signif-icant upregulation of Cx43 expression over the time periodcombined with no significant change in Na channel expressionlevels makes an increase in intercellular coupling the morelikely explanation for the increase in �. We also determinedthat ConT induced a moderate increase in the phosphorylationof Cx43. Overall the Cx43 phosphorylation levels in HL-1cells are low compared with the cardiac muscle where adecrease in Cx43 phosphorylation is often linked to pathophys-iological remodeling (2). Phosphorylation of Cx43 can regulatechannel assembly and electrical and metabolic coupling as wellas trafficking. We cannot rule out that the observed increase inphosphorylation of Cx43 changes the channels open probabil-ity or its turnover; however, the change is relatively small tothose previously described and likely only contributes slightlyto the overall increase in �.

MSC mediated paracrine signaling. MSCs secrete a broadspectrum of cytokines, chemokines, and growth factors (55).Some of these factors have been described to modulate intercel-lular coupling through Cx43. For VEGF, upregulation of Cx43through the Raf-1 MAPK pathway has been reported (43) and forIGF-1 a PI3K/Akt and ERK-mediated regulation of Cx43 wasdemonstrated (1). Another signaling cascade involved in theregulation of Cx43 protein levels is induced by the secretedpolypeptides of the Wnt family (3, 51). In these cases upregulationof Cx43 is described through the Frizzled receptor via phosphor-ylation of GSK3-� and subsequent increase in �-catenin signaling(3). Interestingly, our experimental results indicate that the PI3K/Akt pathway is not involved in the regulation of Cx43 expression,although we have previously demonstrated that it has a significantrole in the ConT-mediated modulation of excitation-contractioncoupling in adult ventricular myocytes (14). This result underlinesthe complexity of the signaling pathways induced by MSC-conditioned media/tyrode. We used conditioned media as well asconditioned tyrode for our experiments. Because the compositionof media is complex, we switched to tyrode to allow for a morecontrolled composition of the conditioned solution. The effect ofConM and ConT on � and Cx43 expression was comparable;therefore, we decided to present the results together in this article.However, we cannot rule out that the overall composition of

ConM might vary from that of ConT, but regarding the observedchanges, both approaches had the same potency.

MSCs express Wnt proteins that are activators of the canon-ical (e.g., Wnt1, 2, 3, 8, and 8b) or noncanonical (Wnt4, 5a, 5b,6, 7a, and 11) pathway (6, 48). They all play an important rolein the regulation of MSC proliferation and suppression ofdifferentiation (34). In our culture model Wnt-mediated sig-naling is supported by the ConT-induced phosphorylation ofLRP6, the fact that the increase in � can partially be reproducedby Wnt3a conditioned media and by the sensitivity of the changesto pharmacological regulation of GSK3-�/� and �-catenin. Car-damonin reduced Cx43 expression levels and prevented changesin �. In contrast with previous reports, however, no significantchanges in total �-catenin protein levels were determined (12).This likely is explained by the slow turnover time of �-catenin andour in comparison short cardamonin incubation time (25).

Suppression of Wnt formation by IWP-2 attenuated LRP6phosphorylation and the increase of �; however, Cx43 proteinlevels at 4 h of treatment remained elevated compared withCtrl. A potential explanation is that expression and degradationof Cx43 are both modulated by ConT. Even if Cx43 expressionis suppressed, an increased stability of Cx43 in the gap junctionplaques as it is proposed through Akt-dependent phosphoryla-tion (16) could lead to an increase in �. This would still beconsistent with our experimental results that demonstrate nosignificant effect of wortmannin on �, since in that caseexpression of Cx43 would still be increased.

Although we suppressed Wnt release from MSCs by IWP-2treatment, we were not able to completely suppress ConT-mediated LRP6 phosphorylation. Besides the binding of Wntagonists, phosphorylation of LRP6 has been described throughreceptor tyrosine kinases mediated ERK activation in a PI3K/Akt-independent manner (31). The LRP6 activation then could stillinduce �-catenin signaling and subsequently an increase in Cx43expression. A partial involvement of p-ERK1/2 in Cx43 upregu-lation is supported by our experiments (Fig. 8B).

Ischemia-reperfusion injury as well as cardiac hypertrophicgrowth are often related to decreased levels of Cx43 expres-sion, which itself is linked to an increased propensity in cardiacarrhythmia (58). A Wnt-mediated upregulation of Cx43 couldtherefore promote antiarrhythmic activity as it was described ina transgenic cardiomyopathic mouse model (3). It has to bementioned that the enhanced cardioprotective effect of Aktoverexpressing MSCs was linked to their increased secretion ofSfrp (39, 59). Sfrp suppresses Wnt signaling, which underpathophysiological conditions suppresses Wnt-induced apo-ptosis (59). Additionally, it is proposed that the suppression ofWnt promotes stem cell differentiation thereby enhancing cellreplacement and vascularization (4, 15, 39). Whether the Wnt-dependent upregulation of Cx43 or the suppression of Wntsignaling through Sfrp represents the mechanism of cardiopro-tection during transplantation of MSCs will likely depend onthe physiological or pathophysiological phenotype of the car-diac tissue.

Conclusion

We demonstrated that MSCs rapidly establish intercellularcoupling with cardiac myocytes. Although the added capacitanceof the MSCs decreases the excitability of the myocytes, a reduc-tion in the conduction velocity of excitation spread is prevented by



at Universidad D

e Santiago on A


Dow

nloaded from


upregulation of Cx43 protein levels. Changes in Cx43 expressionare induced through paracrine signaling of MSCs involving thestimulation of the canonical Wnt signaling pathway. Conse-quently, during pathophysiological remodeling transplantation ofMSCs or treatment with MSC-conditioned medium could helpmaintain coordinated excitation spread by promoting Cx43 ex-pression.

ACKNOWLEDGMENTS

We thank Dr. Merrill (Department of Biochemistry and Molecular Genet-ics, University of Illinois at Chicago) for providing us with conditioned mediafrom Wnt3 overexpressing L-cells.

GRANTS

This work was supported by Grants from the National Institutes of HealthHL-089617 and HL-089617-03S1 (to K. Banach).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

Author contributions: S.M., C.P.G., D.J.B., and K.B. conception and designof research; S.M., C.P.G., D.J.B., and D.L.G. performed experiments; S.M.,C.P.G., D.J.B., and N.M.K. analyzed data; S.M., C.P.G., D.J.B., N.M.K., andK.B. interpreted results of experiments; S.M., D.J.B., and K.B. preparedfigures; S.M. and K.B. edited and revised manuscript; S.M., C.P.G., D.J.B.,D.L.G., N.M.K., and K.B. approved final version of manuscript; K.B. draftedmanuscript.

REFERENCES

1. Aberg ND, Blomstrand F, Aberg MA, Bjorklund U, Carlsson B,Carlsson-Skwirut C, Bang P, Ronnback L, Eriksson PS. Insulin-likegrowth factor-I increases astrocyte intercellular gap junctional communi-cation and connexin43 expression in vitro. J Neurosci Res 74: 12–22,2003.

2. Ai X, Pogwizd SM. Connexin 43 downregulation and dephosphorylationin nonischemic heart failure is associated with enhanced colocalizedprotein phosphatase type 2A. Circ Res 96: 54–63, 2005.

3. Ai Z, Fischer A, Spray DC, Brown AM, Fishman GI. Wnt-1 regulationof connexin43 in cardiac myocytes. J Clin Invest 105: 161, 2000.

4. Alfaro MP, Pagni M, Vincent A, Atkinson J, Hill MF, Cates J,Davidson JM, Rottman J, Lee E, Young PP. The Wnt modulator sFRP2enhances mesenchymal stem cell engraftment, granulation tissue forma-tion and myocardial repair. Proc Natl Acad Sci USA 105: 18366–18371,2008.

5. Angoulvant D, Ivanes F, Ferrera R, Matthews PG, Nataf S, Ovize M.Mesenchymal stem cell conditioned media attenuates in vitro and ex vivomyocardial reperfusion injury. J Heart Lung Transplant 30: 95–102, 2011.

6. Archbold HC, Yang YX, Chen L, Cadigan KM. How do they do Wntthey do?: regulation of transcription by the Wnt/beta-catenin pathway.Acta Physiol (Oxf) 204: 74–109, 2012.

7. Beeres SL, Atsma DE, van der Laarse A, Pijnappels DA, van Tuyn J,Fibbe WE, de Vries AA, Ypey DL, van der Wall EE, Schalij MJ.Human adult bone marrow mesenchymal stem cells repair experimentalconduction block in rat cardiomyocyte cultures. J Am Coll Cardiol 46:1943–1952, 2005.

8. Boomsma RA, Swaminathan PD, Geenen DL. Intravenously injectedmesenchymal stem cells home to viable myocardium after coronaryocclusion and preserve systolic function without altering infarct size. Int JCardiol 122: 17–28, 2007.

9. Chang MG, Tung L, Sekar RB, Chang CY, Cysyk J, Dong P, MarbanE, Abraham MR. Proarrhythmic potential of mesenchymal stem celltransplantation revealed in an in vitro coculture model. Circulation 113:1832–1841, 2006.

10. Chen B, Dodge ME, Tang W, Lu J, Ma Z, Fan CW, Wei S, Hao W,Kilgore J, Williams NS, Roth MG, Amatruda JF, Chen C, Lum L.Small molecule-mediated disruption of Wnt-dependent signaling in tissueregeneration and cancer. Nat Chem Biol 5: 100–107, 2009.

11. Cho J, Zhai P, Maejima Y, Sadoshima J. Myocardial injection withGSK-3(beta)-overexpressing bone marrow-derived mesenchymal stem

cells attenuates cardiac dysfunction after myocardial infarction. Circ Res108: 478–489, 2011.

12. Cho M, Ryu M, Jeong Y, Chung YH, Kim DE, Cho HS, Kang S, HanJS, Chang MY, Lee CK, Jin M, Kim HJ, Oh S. Cardamonin suppressesmelanogenesis by inhibition of Wnt/beta-catenin signaling. Biochem Bio-phys Res Commun 390: 500–505, 2009.

13. Claycomb WC, Lanson NA Jr, Stallworth BS, Egeland DB, DelcarpioJB, Bahinski A, Izzo NJ, Jr. HL-1 cells: a cardiac muscle cell line thatcontracts and retains phenotypic characteristics of the adult cardiomyo-cyte. Proc Natl Acad Sci 95: 2979–2984, 1998.

14. Desantiago J, Bare DJ, Semenov I, Minshall RD, Geenen DL, WolskaBM, Banach K. Excitation-contraction coupling in ventricular myocytesis enhanced by paracrine signaling from mesenchymal stem cells. J MolCell Cardiol 52: 1249–1256, 2012.

15. Dufourcq P, Descamps B, Tojais NF, Leroux L, Oses P, Daret D,Moreau C, Lamaziere JM, Couffinhal T, Duplaa C. Secreted frizzled-related protein-1 enhances mesenchymal stem cell function in angiogen-esis and contributes to neovessel maturation. Stem Cells 26: 2991–3001,2008.

16. Dunn CA, Su V, Lau AF, Lampe PD. Activation of Akt, not connexin43 protein ubiquitination, regulates gap junction stability. J Biol Chem287: 2600–2607, 2012.

17. Fahrenbach JP, Ai X, Banach K. Decreased intercellular couplingimproves the function of cardiac pacemakers derived from mouse embry-onic stem cells. J Mol Cell Cardiol 45: 642–649, 2008.

18. Fahrenbach JP, Mejia-Alvarez R, Banach K. The relevance of non-excitable cells for cardiac pacemaker function. J Physiol 585: 565–578,2007.

19. Gaudesius G, Miragoli M, Thomas SP, Rohr S. Coupling of cardiacelectrical activity over extended distances by fibroblasts of cardiac origin.Circ Res 93: 421, 2003.

20. Gnecchi M, He H, Melo LG, Noiseaux N, Morello F, de Boer RA,Zhang L, Pratt RE, Dzau VJ, Ingwall JS. Early beneficial effects ofbone marrow-derived mesenchymal stem cells overexpressing Akt oncardiac metabolism after myocardial infarction. Stem Cells 27: 971–979,2009.

21. Grajales L, Garcia J, Banach K, Geenen DL. Delayed enrichment ofmesenchymal cells promotes cardiac lineage and calcium transient devel-opment. J Mol Cell Cardiol 48: 735–745, 2010.

22. Hahn JY, Cho HJ, Kang HJ, Kim TS, Kim MH, Chung JH, Bae JW,Oh BH, Park YB, Kim HS. Pre-treatment of mesenchymal stem cellswith a combination of growth factors enhances gap junction formation,cytoprotective effect on cardiomyocytes, and therapeutic efficacy formyocardial infarction. J Am Coll Cardiol 51: 933–943, 2008.

23. Haider H, Jiang S, Idris NM, Ashraf M. IGF-1-overexpressing mesen-chymal stem cells accelerate bone marrow stem cell mobilization viaparacrine activation of SDF-1alpha/CXCR4 signaling to promote myocar-dial repair. Circ Res 103: 1300–1308, 2008.

24. Halbach M, Egert U, Hescheler J, Banach K. Estimation of actionpotential changes from field potential recordings in multicellular mousecardiac myocyte cultures. Cell Physiol Biochem 13: 271–284, 2003.

25. Hannoush RN. Kinetics of Wnt-driven beta-catenin stabilization revealedby quantitative and temporal imaging. PLos One 3: e3498, 2008.

26. Haq S, Michael A, Andreucci M, Bhattacharya K, Dotto P, Walters B,Woodgett J, Kilter H, Force T. Stabilization of beta-catenin by aWnt-independent mechanism regulates cardiomyocyte growth. Proc NatlAcad Sci USA 100: 4610–4615, 2003.

27. Herrmann JL, Abarbanell AM, Wang Y, Weil BR, Poynter JA,Manukyan MC, Meldrum DR. Transforming growth factor-alpha en-hances stem cell-mediated postischemic myocardial protection. Ann Tho-rac Surg 92: 1719–1725, 2011.

28. Jacquemet V, Henriquez CS. Loading effect of fibroblast-myocytecoupling on resting potential, impulse propagation, and repolarization:insights from a microstructure model. Am J Physiol Heart Circ Physiol294: H2040–H2052, 2008.

29. Kawano S, Otsu K, Kuruma A, Shoji S, Yanagida E, Muto Y,Yoshikawa F, Hirayama Y, Mikoshiba K, Furuichi T. ATP autocrine/paracrine signaling induces calcium oscillations and NFAT activation inhuman mesenchymal stem cells. Cell Calcium 39: 313–324, 2006.

30. Kinnaird T, Stabile E, Burnett MS, Shou M, Lee CW, Barr S, FuchsS, Epstein SE. Local delivery of marrow-derived stromal cells augmentscollateral perfusion through paracrine mechanisms. Circulation 109:1543–1549, 2004.



at Universidad D

e Santiago on A


Dow

nloaded from


31. Krejci P, Aklian A, Kaucka M, Sevcikova E, Prochazkova J, MasekJK, Mikolka P, Pospisilova T, Spoustova T, Weis M, Paznekas WA,Wolf JH, Gutkind JS, Wilcox WR, Kozubik A, Jabs EW, Bryja V,Salazar L, Vesela I, Balek L. Receptor tyrosine kinases activate canon-ical WNT/beta-catenin signaling via MAP kinase/LRP6 pathway anddirect beta-catenin phosphorylation. PLos One 7: e35826, 2012.

32. Leiker M, Suzuki G, Iyer VS, Canty JM Jr, Lee T. Assessment of anuclear affinity labeling method for tracking implanted mesenchymal stemcells. Cell Transplant 17: 911–922, 2008.

33. Leroux L, Descamps B, Tojais NF, Seguy B, Oses P, Moreau C, DaretD, Ivanovic Z, Boiron JM, Lamaziere JM, Dufourcq P, Couffinhal T,Duplaa C. Hypoxia preconditioned mesenchymal stem cells improvevascular and skeletal muscle fiber regeneration after ischemia through aWnt4-dependent pathway. Mol Ther 18: 1545–1552, 2010.

34. Ling L, Nurcombe V, Cool SM. Wnt signaling controls the fate ofmesenchymal stem cells. Gene 433: 1–7, 2009.

35. Liu X, Ma B, Malik AB, Tang H, Yang T, Sun B, Wang G, MinshallRD, Li Y, Zhao Y, Ye RD, Xu J. Bidirectional regulation of neutrophilmigration by mitogen-activated protein kinases. Nat Immunol 13: 457–464, 2012.

36. Markel TA, Wang Y, Herrmann JL, Crisostomo PR, Wang M,Novotny NM, Herring CM, Tan J, Lahm T, Meldrum DR. VEGF iscritical for stem cell-mediated cardioprotection and a crucial paracrinefactor for defining the age threshold in adult and neonatal stem cellfunction. Am J Physiol Heart Circ Physiol 295: H2308–H2314, 2008.

37. Mills WR, Mal N, Kiedrowski MJ, Unger R, Forudi F, Popovic ZB,Penn MS, Laurita KR. Stem cell therapy enhances electrical viability inmyocardial infarction. J Mol Cell Cardiol 42: 304–314, 2007.

38. Miragoli M, Gaudesius G, Rohr S. Electrotonic modulation of cardiacimpulse conduction by myofibroblasts. Circ Res 98: 801–810, 2006.

39. Mirotsou M, Zhang Z, Deb A, Zhang L, Gnecchi M, Noiseux N, MuH, Pachori A, Dzau V. Secreted frizzled related protein 2 (Sfrp2) is thekey Akt-mesenchymal stem cell-released paracrine factor mediating myo-cardial survival and repair. Proc Natl Acad Sci USA 104: 1643–1648,2007.

40. Noiseux N, Gnecchi M, Lopez-Ilasaca M, Zhang L, Solomon SD, DebA, Dzau VJ, Pratt RE. Mesenchymal stem cells overexpressing Aktdramatically repair infarcted myocardium and improve cardiac functiondespite infrequent cellular fusion or differentiation. Mol Ther 14: 840–850, 2006.

41. Okoye UC, Malbon CC, Wang HY. Wnt and Frizzled RNA expressionin human mesenchymal and embryonic (H7) stem cells. J Mol Signal 3:16, 2008.

42. Pijnappels DA, van Tuyn J, de Vries AA, Grauss RW, van der LaarseA, Ypey DL, Atsma DE, Schalij MJ. Resynchronization of separated ratcardiomyocyte fields with genetically modified human ventricular scarfibroblasts. Circulation 116: 2018–2028, 2007.

43. Pimentel RC, Yamada KA, Kleber AG, Saffitz JE. Autocrine regulationof myocyte Cx43 expression by VEGF. Circ Res 90: 671–677, 2002.

44. Psaltis PJ, Paton S, See F, Arthur A, Martin S, Itescu S, Worthley SG,Gronthos S, Zannettino AC. Enrichment for STRO-1 expression en-hances the cardiovascular paracrine activity of human bone marrow-derived mesenchymal cell populations. J Cell Physiol 223: 530–540,2010.

45. Psaltis PJ, Zannettino AC, Worthley SG, Gronthos S. Concise review:mesenchymal stromal cells: potential for cardiovascular repair. Stem Cells26: 2201–2210, 2008.

46. Quevedo HC, Hatzistergos KE, Oskouei BN, Feigenbaum GS, Rodri-guez JE, Valdes D, Pattany PM, Zambrano JP, Hu Q, McNiece I,Heldman AW, Hare JM. Allogeneic mesenchymal stem cells restorecardiac function in chronic ischemic cardiomyopathy via trilineage differ-entiating capacity. Proc Natl Acad Sci USA 106: 14022–14027, 2009.

47. Raaijmakers HG, Van Den Bosch G, Boezeman J, De Witte T,Raymakers RA. Single-cell image analysis to assess ABC-transporter-mediated efflux in highly purified hematopoietic progenitors. Cytometry49: 135–142, 2002.

48. Salazar KD, Lankford SM, Brody AR. Mesenchymal stem cells produceWnt isoforms and TGF-�1 that mediate proliferation and procollagenexpression by lung fibroblasts. Am J Physiol Lung Cell Mol Physiol 297:L1002–L1011, 2009.

49. Shang YC, Wang SH, Xiong F, Zhao CP, Peng FN, Feng SW, Li MS,Li Y, Zhang C. Wnt3a signaling promotes proliferation, myogenic dif-ferentiation, and migration of rat bone marrow mesenchymal stem cells.Acta Pharmacol Sin 28: 1761–1774, 2007.

50. Valiunas V, Doronin S, Valiuniene L, Potapova I, Zuckerman J,Walcott B, Robinson RB, Rosen MR, Brink PR, Cohen IS. Humanmesenchymal stem cells make cardiac connexins and form functional gapjunctions. J Physiol 555: 617, 2004.

51. van der Heyden MA, Rook MB, Hermans MM, Rijksen G, BoonstraJ, Defize LH, Destree OH. Identification of connexin43 as a functionaltarget for Wnt signalling. J Cell Sci 111: 1741–1749, 1998.

52. von Marschall Z, Fisher LW. Secreted Frizzled-related protein-2(sFRP2) augments canonical Wnt3a-induced signaling. Biochem BiophysRes Commun 400: 299–304, 2010.

53. Wang D, Shen W, Zhang F, Chen M, Chen H, Cao K. Connexin43promotes survival of mesenchymal stem cells in ischaemic heart. Cell BiolInt 34: 415–423, 2010.

54. Wang D, Zhang F, Shen W, Chen M, Yang B, Zhang Y, Cao K.Mesenchymal stem cell injection ameliorates the inducibility of ventric-ular arrhythmias after myocardial infarction in rats. Int J Cardiol 152:314–320, 2011.

55. Williams AR, Hare JM. Mesenchymal stem cells: biology, pathophysi-ology, translational findings, and therapeutic implications for cardiacdisease. Circ Res 109: 923–940, 2011.

56. Williams AR, Trachtenberg B, Velazquez DL, McNiece I, Altman P,Rouy D, Mendizabal AM, Pattany PM, Lopera GA, Fishman J,Zambrano JP, Heldman AW, Hare JM. Intramyocardial stem cellinjection in patients with ischemic cardiomyopathy: functional recoveryand reverse remodeling. Circ Res 108: 792–796, 2011.

57. Yokokawa M, Ohnishi S, Ishibashi-Ueda H, Obata H, Otani K,Miyahara Y, Tanaka K, Shimizu W, Nakazawa K, Kangawa K,Kamakura S, Kitamura S, Nagaya N. Transplantation of mesenchymalstem cells improves atrioventricular conduction in a rat model of completeatrioventricular block. Cell Transplant 17: 1145–1155, 2008.

58. Zeevi-Levin N, Barac YD, Reisner Y, Reiter I, Yaniv G, Meiry G,Abassi Z, Kostin S, Schaper J, Rosen MR, Resnick N, Binah O. Gapjunctional remodeling by hypoxia in cultured neonatal rat ventricularmyocytes. Cardiovasc Res 66: 64–73, 2005.

59. Zhang Z, Deb A, Zhang Z, Pachori A, He W, Guo J, Pratt R, Dzau VJ.Secreted frizzled related protein 2 protects cells from apoptosis by block-ing the effect of canonical Wnt3a. J Mol Cell Cardiol 46: 370–377, 2009.



at Universidad D

e Santiago on A


Dow

nloaded from


mesenchymal stem cells improve cardiac conduction by upregulationof connexin 43 through paracrine...

Documents