medaka as a model for human nonalcoholic steatohepatitismacrovesicular fat deposition was widespread...

INTRODUCTIONNonalcoholic fatty liver disease (NAFLD) is the general term forfatty liver diseases that are not the result of a history of alcoholconsumption. NAFLD is the most common cause of human liverdysfunction, and it is estimated that about 30% of the generalpopulation in the USA suffers from excessive fat accumulation inthe liver (Browning et al., 2004). The incidence of NAFLD, whichhas been increasing in recent years, is closely tied to obesity,diabetes, hyperlipidemia and insulin resistance. Indeed, NAFLD isconsidered to be a manifestation of metabolic syndrome in the liver(Powell et al., 1990; Sanyal, 2002). NAFLD can be broadly dividedinto two subgroups: (1) non-progressive simple steatosis, and (2)nonalcoholic steatohepatitis (NASH) with ballooning degenerationand fibrosis (Schaffner and Thaler, 1986; Younossi et al., 1998; Bruntet al., 1999; Matteoni et al., 1999). In cases of progressive chronicliver disease, NASH may progress from steatohepatitis to livercirrhosis, and may eventually lead to hepatocellular carcinoma.

There have been many attempts to create NASH models inrodents through the use of either genetic mutation, or dietary orpharmacological manipulation (Anstee and Goldin, 2006). Themedaka (Oryzias latipes) is a small freshwater fish found in Japanand Asia. This member of the ricefish family has a history of use

as an animal model in Japan and a number of purebred strains exist(Masahito et al., 1989). Medaka compare favorably to rodents asexperimental animals for drug screening because medaka have ahigh reproductive rate, mature rapidly, and cost little in terms ofrearing space and daily maintenance owing to their small size.Sequencing of the medaka genome has been completed andtechniques for producing transgenic and knockout animals havebeen established (Kasahara et al., 2007; Yamauchi et al., 2000).Physiologically, medaka are omnivores and metabolize sugars andlipids in a manner analogous to that of mammals (Sheridan, 1988;Brown and Tappel, 1959). However, despite their metabolicsimilarities to humans, medaka have not been used previously forNASH research. In this study, we fed a HFD to medaka to induceNASH and determined whether the progression of liver disease inthese fish was similar to the progression of human NASH. Inaddition, we used our medaka NASH model to verify the efficacyof the administration of the n-3 polyunsaturated fatty acid (PUFA)eicosapentaenoic acid (EPA) as a NASH therapy. Our results haveshed much-needed light on the mechanisms potentially underlyingNASH in humans, and may point to new avenues of therapy forthis debilitating disorder.

RESULTSGross anatomical and histopathological evidence for NASH inmedakaFor an animal model to be useful for determining the molecularand cellular basis of NASH, it must show the same metabolicabnormalities as the human disease. These anomalies includeobesity and insulin resistance; liver damage owing to ‘fatty liver’and hyperlipidemia; macrovesicular fat deposition in the liver;infiltration by inflammatory cells; and ballooning degeneration ofhepatocytes. Like mammals, medaka have livers, gall bladders,digestive tracts and other internal organs in the peritoneum (Fig.1A,B). In normal medaka liver tissue, the hepatocytes are arranged

RESEARCH ARTICLE

Disease Models & Mechanisms 431

Disease Models & Mechanisms 3, 431-440 (2010) doi:10.1242/dmm.002311© 2010. Published by The Company of Biologists Ltd

Medaka as a model for human nonalcoholicsteatohepatitisToshihiko Matsumoto1, Shuji Terai1,*, Toshiyuki Oishi1, Shinya Kuwashiro1, Koichi Fujisawa1, Naoki Yamamoto1, Yusuke Fujita2,Yoshihiko Hamamoto2, Makoto Furutani-Seiki3, Hiroshi Nishina4 and Isao Sakaida1

SUMMARY

The global incidence of nonalcoholic steatohepatitis (NASH) is increasing and current mammalian models of NASH are imperfect. We have developeda NASH model in the ricefish medaka (Oryzias latipes), which is based on feeding the fish a high-fat diet (HFD). Medaka that are fed a HFD (HFD-medaka) exhibited hyperlipidemia and hyperglycemia, and histological examination of the liver revealed ballooning degeneration. The expressionof lipogenic genes (SREBP-1c, FAS and ACC1) was increased, whereas the expression of lipolytic genes (PPARA and CPT1) was decreased. With respectto liver fatty acid composition, the concentrations of n-3 polyunsaturated fatty acids (PUFAs) and n-6 PUFAs had declined and the n-3:n-6 ratio wasreduced. Treatment of HFD-medaka with the n-3 PUFA eicosapentaenoic acid (EPA) mitigated disease, as judged by the restoration of normal liverfatty acid composition and normal expression levels of lipogenic and lipolytic genes. Moreover, medaka that were fed a diet deficient in n-3 PUFAsdeveloped NASH features. Thus, NASH can be induced in medaka by a HFD, and the proportion of n-3 PUFAs in the liver influences the progress ofNASH pathology in these fish. Our model should prove helpful for the dissection of the causes of human NASH and for the design of new andeffective therapies.

1Department of Gastroenterology and Hepatology, Yamaguchi UniversityGraduate School of Medicine, Minami Kogushi 1-1-1, Ube, Yamaguchi 755-8505,Japan2Department of Computer Science and Systems Engineering, Faculty ofEngineering, Yamaguchi University, Tokiwadai 2-16-1, Ube, Yamaguchi 755-8505,Japan3Centre for Regenerative Medicine, Department of Biology and Biochemistry,University of Bath, Claverton Down, Bath BA2 7AY, UK4Department of Developmental and Regenerative Biology, Medical ResearchInstitute, Tokyo Medical and Dental University, 1-5-45, Yushima, Bunkyo-ku, Tokyo113-8510, Japan*Author for correspondence ([email protected])

Dise

ase

Mod

els &

Mec

hani

sms

D

MM

in sheets that are separated by a sinusoidal mesh. Histologicalexamination of normal medaka liver shows that the portal vein,hepatic artery and bile duct are independent, as they are notorganized in portal triads (Fig. 2A).

To induce NASH in medaka, 8-week-old fish (n14/group) werefed either a control diet or a high-fat diet (HFD) for 12 weeks, andmonitored for gross anatomical and histological changes at 4, 8and 12 weeks after HFD initiation. Control medaka grew normallyover the 12-week period, from 95±17 mg to 241±32 mg. Bycontrast, all 14 fish that were fed the HFD exhibited significantlygreater body weights, reaching 368±80 mg by the end of the 12weeks (P<0.05). HFD-medaka also showed distention of theabdomen, owing to increased fat deposition in the viscera, and thepresence of a white, swollen liver (Fig. 1C-E). Edematousdegeneration of the liver was observed in five out of 14 (36%) HFD-medaka (Fig. 1F). The mean liver weight (Fig. 1G) and the meanliver weight:body weight ratio (Fig. 1H) of HFD-medaka wereincreased by 2.8-fold and 1.8-fold, respectively, compared withcontrols, consistent with the observed hepatomegaly in HFD-medaka. Lastly, the weight of intrahepatic total lipids in the HFD-medaka was 6.2-fold greater than in controls (Table 1).

Compared with medaka that were fed a control diet, medakafed the HFD for 4 weeks exhibited considerably moremacrovesicular fat deposition around the hepatic veins (data notshown). By 8 weeks, fat deposition had spread over the entire liver(Fig. 2B; compare with Fig. 2A). By 12 weeks, focal ballooningdegeneration and inflammatory cell infiltration in the livers of HFD-medaka were prominent (Fig. 2C,D), consistent with the edematousliver degeneration noted upon gross examination (Fig. 1F).Histopathologically, nine out of 14 (64%) and four out of 14 (29%)HFD-medaka displayed steatohepatitis and simple steatosis,respectively. Liver fibrosis (Fig. 2E,F) and fat accumulation (Fig.2G) were also observed in these fish. Electron microscopic

examination of liver cells from HFD-medaka revealed the presenceof lipid droplets (Fig. 2H,I), and the ballooning hepatocytes showedcytoplasmic vacuolation and enlarged lysosomes (Fig. 2H,J).

HFD-medaka show hyperglycemia, hyperlipidemia and alteredexpression of lipogenic genesA two-hit theory has been proposed as the mechanism underlyingthe onset of NASH (Day and James, 1998). The first hit involvesincreased expression of fatty acid transport-related and lipogenicgenes that alter the lipid metabolism inside the liver, such that theliver becomes steatotic. The second hit takes the form ofinflammatory cytokines and oxidative stress that driveinflammation and fibrosis. To determine whether a classical firsthit was occurring in our HFD-medaka, we analyzed serumcomponents of these fish. Triglyceride (TG) levels in HFD-medakaserum were significantly elevated over those in controls by 4 weeks,and were sevenfold greater by 12 weeks (Fig. 3A). When weanalyzed these serum TGs by high-performance liquidchromatography (HPLC), we found that very low-densitylipoprotein triglyceride (VLDL-TG) was increased by 15-fold in theserum from HFD-medaka at 12 weeks (2362 mg/dl) compared withcontrols (160 mg/dl) (Fig. 3B). These results suggested that theHFD-medaka were experiencing an increase in endogenous fattyacid synthesis by hepatocytes. As shown in Fig. 3C, plasma glucoselevels were also significantly elevated in HFD-medaka at 8 weeks,and were fourfold greater than in controls by 12 weeks. Serumalanine aminotransferase (ALT) levels were elevated the most (3.7-fold) in HFD-medaka at 4 weeks, but continued to be significantlyincreased compared with controls at 12 weeks (Fig. 3D). Thesealtered serum parameters parallel our histological examinationsof HFD-medaka, in which steatosis was seen at 4 weeks,macrovesicular fat deposition was widespread at 8 weeks, andballooning degeneration was observed at 12 weeks. Taken together,

dmm.biologists.org432

Medaka as a human NASH modelRESEARCH ARTICLE

Fig. 1. Altered gross phenotype and liver parameters inHFD-medaka. (A,B)Gross appearance of the abdomen (A)and internal organs (B) of medaka that were fed a controldiet for 12 weeks. The abdomen is flat, the liver is brown,and very little visceral fat is observed. Lv, liver; GB, gallbladder; Gut, digestive tract. (C)A comparison of livercolor and size in control medaka (left) and HFD-medaka(right). (D,E)Gross appearance of the abdomen (D) andinternal organs (E) of medaka that were fed a HFD for 12weeks. Distention of the abdomen, swelling andwhitening of the liver, and a clear increase in visceral fatare seen. (F)Edematous degeneration of the liver in HFD-medaka after 12 weeks. (G,H)Medaka were fed the controldiet or the HFD (HFD12w) for 12 weeks, and absolute liverweights (G) and liver weight as a percentage of total bodyweight (LW/BW) (H), were determined (n10/group). Theresults shown in all figure panels are representative of atleast three independent trials.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM

these data suggest that a first hit of hyperlipidemia, hyperglycemiaand hepatic steatosis occurred in HFD-medaka, followed by asecond hit of liver dysfunction owing to ballooning hepatocytedegeneration. Thus, our observations are consistent with the two-hit theory of human NASH development, in which a metabolicabnormality sets the stage for the development of NASH symptoms.

To investigate, at a molecular level, the changes in the fatty acidmetabolism of medaka liver during fatty acid loading periods, weused reverse transcription (RT)-PCR to analyze the mRNAexpression levels of genes associated with fatty acid synthesis andoxidation. These genes included the main regulator of fatty acidsynthesis, sterol regulatory element-binding protein-1c (SREBP-1c);the target genes of SREBP-1c, fatty acid synthase (FAS) and acetyl-CoA carboxylase 1 (ACC1); the main regulator of fatty acidb-oxidation, peroxisome proliferator-activated receptor a(PPARA); the mitochondrial b-oxidation marker carnitinepalmitoyltransferase 1 (CPT1); and the peroxisome b-oxidationmarker acyl-CoA oxidase 1 (ACO1). Compared with controls, themRNA expression levels of SREBP-1c, FAS and ACC1 were allelevated in HFD-medaka liver at 4 weeks (Fig. 3E, left), confirmingthat fatty acid synthesis had accelerated in these animals.

Conversely, we observed decreased expression of PPARA and CPT1,but increased expression of ACO1 (Fig. 3E, right), indicatingdecreased mitochondrial b-oxidation and accelerated peroxisomalb-oxidation in the HFD-medaka liver. Taken together, these datasuggest that HFD-medaka suffer from increased fatty acid synthesisaccompanied by decreased fatty acid b-oxidation and inflammation,accounting for their swollen, fatty livers.

To investigate the abnormal fatty acid deposition observed in theHFD-medaka liver, we compared the composition of the fats incontrol livers with HFD-medaka livers (Table 1). Oleic acid (C18:1n-9) levels in HFD-medaka were clearly higher than in controls, whereaslinoleic acid (C18:2n-6), arachidonic acid (C20:4n-6), a-linolenic acid(C18:3n-3), EPA (C20:5n-3) and docosahexaenoic acid (DHA)(C22:6n-3) levels were lower. Although concentrations of both n-3PUFAs and n-6 PUFAs had declined, the n-3:n-6 ratio was reducedin HFD-medaka because the decrease in n-3 PUFAs was greater thanthe decrease in n-6 PUFAs. These results are consistent with featuresof human NASH, in which PUFA levels and n-3:n-6 PUFA ratios arereportedly low in the liver (Araya et al., 2004; Puri et al., 2007).Interestingly, levels of mead acid (C20:3n-9), a marker of essentialfatty acid deficiency, were increased in HFD-medaka liver.


Medaka as a human NASH model RESEARCH ARTICLE

Fig. 2. Altered histopathology in medaka with HFD-induced steatohepatitis. (A)Hematoxylin and eosin (H&E)-stained section of a normal liver from amedaka that was fed the control diet for 12 weeks. The hepatocytes are arranged in sheets separated by a sinusoidal mesh. The portal vein, hepatic artery andbile duct are independent. Magnification �200. (B)H&E-stained section of a liver from a medaka fed the HFD for 8 weeks. Macrovesicular fat deposition can beseen throughout the entire liver. Magnification �200. (C,D)H&E-stained section of a liver from HFD-medaka after 12 weeks. In addition to macrovesicular fatdeposition, focal ballooning degeneration of hepatocytes accompanied by the infiltration of inflammatory cells can be seen. Magnification �200 (C); �400 (D).(E)Gitter staining of the liver from a control medaka at 12 weeks. Magnification �400. (F)Gitter staining of the liver from a HFD-medaka at 12 weeks. The arrowsindicate sinusoidal fibrosis. Magnification �400. (G)Oil Red O staining of intracellular lipids in the liver of a HFD-medaka at 12 weeks. Magnification �400.(H)Electron microscopic image of the control medaka in A. Black arrows indicate the nucleus; white arrows indicate the lysosomes. (I)Electron microscopic imageof the HFD-fed medaka in B. Arrows indicate hepatocytes loaded with lipid droplets. (J)Electron microscopic image of ballooning degeneration of hepatocytesin the HFD-fed medaka in C. Cytoplasmic vacuolation and enlarged lysosomes can be seen. The black arrow indicates a nucleus; white arrows indicate lysosomes.For A-F, the results shown are representative of 14 medaka examined/group.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM

EPA treatment inhibits NASH development in medakaBecause administration of the n-3 PUFA EPA has been investigatedas a therapy for human NASH, we explored whether EPA treatmentcould slow disease progression in our medaka NASH model.Medaka were fed a HFD with or without EPA for 12 weeks. TheHFD+EPA medaka showed increased fat deposition in the internalorgans and a white, swollen liver similar to that observed in theHFD group (Fig. 4A). However, histological examination revealedthat the degree of fat deposition in the HFD+EPA group appearedto be less than that in the HFD group during the same period (Fig.4B). Indeed, analysis of total lipids showed that the fat levels in theHFD+EPA liver were 48% lower than in the HFD liver (Table 1).Moreover, unlike HFD-medaka, the HFD+EPA medaka were nothyperglycemic after fasting (Fig. 4C). HLPC analysis showed thatserum TG and VLDL-TG levels were 16% (3132 vs 2643 mg/dl)and 21% (2362 vs 1873 mg/dl) lower in HFD+EPA livers comparedwith HFD livers, respectively (Fig. 4D). EPA treatment increasedEPA (C20:5n-3) and DHA (C22:6n-3) levels, as well as the n-3:n-6 PUFA ratio, in the liver (Table 1). Finally, mead acid (C20:3n-9)levels were decreased in HFD+EPA livers compared with HFD livers(Table 1), suggesting that any essential fatty acid deficiencies thatwere present had been mitigated.

With respect to gene expression, the levels of SREBP-1c, FASand ACC1 mRNAs were reduced in HFD+EPA medaka comparedwith HFD-medaka, and the accelerated fatty acid synthesis causedby HFD consumption was abrogated (Fig. 4E, top). By contrast, thelevels of PPARA and CPT1 expression were increased, ACO1expression was decreased, and markers of mitochondrial b-oxidation became predominant in the HFD+EPA liver (Fig. 4E,bottom). Thus, the pattern of gene expression in livers of HFD+EPAmedaka was essentially the same as that in medaka fed the control

diet. These data indicate that de novo fatty acid synthesis in HFD-medaka liver decreases upon EPA treatment, and that normal fatutilization is restored.

n-3 PUFA deficiency induces NASHIt has been reported that liver PUFA levels and n-3:n-6 PUFAratios are low in NASH patients (Araya et al., 2004; Puri et al.,2007). We therefore investigated whether a deficiency in n-3 PUFAcould induce NASH in medaka. We prepared an n-3 PUFA-deficient (n-3PUFA–) diet with about the same energy content asthe control diet, and used it to feed medaka for 8 weeks.Compared with controls, the n-3PUFA– medaka showedmoderate increases in fat deposition in internal organs, and theirlivers, although pink, were swollen (Fig. 5A). By gross observation,five out of ten (50%) n-3PUFA– medaka showed edematousdegeneration of the liver, and histopathological examinationrevealed that steatohepatitis was present in seven out of ten (70%)of these animals (Fig. 5B). The mean serum ALT value in n-3PUFA– medaka was 442±228 IU/l (Fig. 5C), confirming thepresence of liver damage. Thus, NASH is induced in medaka byconditions of n-3PUFA deficiency.

DISCUSSIONMedaka compare favorably to rodents as experimental animals fordrug screening because medaka have a high reproductive rate,mature rapidly, and cost little in terms of rearing space and dailymaintenance owing to their small size. Our results show that NASHcan be induced in medaka by feeding a HFD, and that thedevelopment of NASH can be largely prevented by EPAadministration. Importantly, we have also demonstrated that n-3PUFA deficiency can induce NASH in medaka.



Table 1. Fatty acid composition of total lipids in the livers of control, HFD-medaka and HFD+EPA medakaFatty acid Control (molecule %) HFD (molecule %) HFD+EPA (molecule %)C14:0 3.0±0.7 2.1±0.5* 1.4±0.1†

C16:0 26.7±2.1 15.5±2.5* 18.6±2.9†

C18:0 8.7±0.3 2.7±0.9* 3.7±0.6†#

C16:1n-7 4.6±0.4 9.6±0.6* 6.4±0.1†#

C18:1n-9 16.0±1.7 62.5±4.0* 50.4±2.6†#

C20:3n-9 0.2±0.1 1.2±0.3* 0.1±0.1#

C18:2n-6 4.9±0.8 3.9±0.5* 8.4±1.1†#

C18:3n-6 0.5±0.2 1.1±0.4* 1.8±0.1†#

C20:3n-6 0.6±0.4 0.3±0.1 0.1±0.1†#

C20:4n-6 3.0±0.2 1.3±0.4* 0.2±0.1†#

C18:3n-3 0.7±0.2 0.1±0.1* 0.2±0.1†#

C20:5n-3 1.8±0.2 0.1±0.1* 2.1±0.5#

C22:6n-3 23.7±0.7 0.7±0.3* 4.3±1.0†#

Total SFA 38.9±1.6 21.0±3.2* 23.9±3.6†

Total MUFA 22.0±2.1 70.2±3.0* 57.3±2.7†#

Total PUFA 38.9±0.6 7.6±0.2* 18.7±1.1†#

n-3 PUFA 29.5±0.2 0.7±0.3* 8.0±2.0†#

n-6 PUFA 9.4±0.3 6.9±0.3* 10.7±1.0#

n-3:n-6 ratio 3.1±0.1 0.2±0.1* 1.0±0.1†#

Total lipid (mg/g of tissue) 27±9 167±62* 87±28†#

All values are means (molecule %) ± S.E.M. SFA, saturated fatty acid; MUFA, monounsaturated fatty acid; PUFA, polyunsaturated fatty acid. n=6/group; *P<0.05 versus control,†P<0.05 versus control, #P<0.05 versus HFD.

Dise

ase

Mod

els &

Mec

hani

sms

D

MM

We were able to induce steatohepatitis in medaka throughfeeding, thus creating a NASH model that is easily established ina relatively short period of time. The features of our model includethe efficient induction of ballooning degeneration, a key feature inthe diagnosis of human NASH (Brunt et al., 1999; Matteoni et al.,1999; Neuschwander-Tetri and Caldwell, 2003). The frequency ofballooning degeneration in normal medaka is 10-20% (Bunton,1990; Boorman et al., 1997; Brown-Peterson et al., 1999), whereasour HFD-medaka showed a ballooning degeneration frequency ofgreater than 60%. By contrast, Deng et al. have shown that 46% ofC57BL/6 mice fed a HFD through an implanted gastrostomy tubedevelop steatohepatitis (Deng et al., 2005). Thus, our medaka modelof NASH induction is slightly superior to the mouse model in termsof the efficiency of ballooning degeneration induction (64% vs 46%).

The mechanisms underlying the digestion and absorption oflipids; the transport of exogenous and endogenous lipids; andfatty acid oxidation are almost identical in fish and mammals(Brown and Tappel, 1959; Sheridan, 1988). However, there aresome differences in how fatty acids are released from intestinalepithelial cells into blood vessels or lymph ducts (Sheridan, 1988).In mammals, short chain fatty acids (SCFAs) and medium chainfatty acids (MCFAs) that are absorbed by intestinal epithelial cellsare released directly into the portal vein without esterification.Most long chain fatty acids (LCFAs) are resynthesized into TGsand released into lymph ducts as chylomicron particles, but someare released into the portal vein without esterification. In fish,LCFAs are rapidly processed into free fatty acids (FFAs), and onlylater are resynthesized as TGs and released as chylomicron



Fig. 3. HFD induces hyperglycemia, hyperlipidemia and the expression of lipogenic genes. (A)Increased TGs. After 12 hours of fasting, serum TG levels weremeasured in control and HFD-medaka at 4, 8 and 12 weeks. A significant elevation in serum TGs in HFD-medaka was seen by as early as 4 weeks on a HFD(n10/group). (B)Increased VLDL and high-density lipoprotein (HDL). Serum samples from control (left) and HFD-medaka (right) at 12 weeks were fractionatedby HPLC to detect cholesterol and TG levels (n10/group). A 15-fold increase in serum VLDL-TG was observed in HFD-medaka compared with controls.(C)Increased fasting blood sugar. Plasma glucose was measured in the medaka in A after 12 hours of fasting. Plasma glucose was fourfold higher in the HFD-medaka liver than in controls at 12 weeks (n12/group). (D)Increased ALT. Serum ALT was measured in the medaka in A and was found to be elevated mosthighly after 4 weeks on a HFD (n10/group). (E)Altered expression of lipogenic (left) and lipolytic (right) genes. mRNA levels of the indicated genes in livers fromcontrol and HFD-medaka at 4 weeks were determined by semi-quantitative RT-PCR. SREBP-1c, ACC1 and FAS were all elevated in HFD-medaka compared withcontrol medaka. Conversely, the mRNA levels of PPARA and CPT1 were reduced and ACO1 was increased (n6/group).

Dise

ase

Mod

els &

Mec

hani

sms

D

MM

particles into the blood (Robinson and Mead, 1973; Sheridan,1988). Our medaka NASH model was created by feeding a HFDbased on LCFAs, and we believe that many of the consumedLCFAs arrive in the liver as FFA-albumin complexes. In obesehumans that develop NASH, insulin signaling in adipocytes isdisrupted such that hormone-sensitive lipases hydrolyze TGs intofatty acids (Hotamisligil et al., 1995). These fatty acids aresubsequently released from the adipocytes and enter the liverthrough the portal vein, exacerbating NASH development(Hotamisligil et al., 1995; Day, 2002). We believe that a similarscenario occurs in our HFD-medaka, such that FFAs derived fromconsumed LCFAs flow into the liver. After obesity develops inmedaka, FFAs from fat tissues may also join this flow, perhapsexplaining why NASH develops more easily in medaka than inother animal models.

In contrast to the lipids of terrestrial vertebrates, fish lipidscontain a high proportion of PUFAs, particularly the n-3 PUFAswhose function is to maintain lipid liquidity at low temperature.However, as with terrestrial mammals, fish are unable to synthesizen-6 and n-3 PUFAs, making these molecules essential fatty acidsthat must be consumed. The HFD used in our study included 64.9%oleic acid, 12.8% palmitic acid (C16:0), 7.6% stearic acid (C18:0),10.3% linoleic acid and 0.2% a-linolenic acid. Monounsaturated fattyacids (MUFAs) and saturated fatty acids (SFAs) accounted for mostof the fatty acids, with only an extremely small proportion of a-linolenic acid being present. The synthesis of highly unsaturatedfatty acids (HUFAs), such as arachidonic acid, EPA, DHA and otherfatty acids with a carbon chain length of greater than 20, dependson the action of delta-6 and delta-5 desaturases (Sprecher, 1981).These enzymes preferentially desaturate n-3PUFAs then n-6PUFAs



Fig. 4. EPA treatment inhibits NASH development in medaka. (A)Gross appearance of the abdomen from an HFD+EPA medaka. A white, swollen liver andincreased visceral fat are visible in the HFD+EPA medaka after 12 weeks on a HFD. (B)Ameliorated histopathology. An H&E-stained section of a liver from anHFD+EPA medaka at 12 weeks. Macrovesicular fat deposition can be seen but there is very little ballooning degeneration. (C)Normal fasting blood sugar. After12 hours of fasting, the plasma glucose level of HFD+EPA medaka at 12 weeks was the same as that in controls. The hyperglycemia that was evident in HFD-medaka at 12 weeks was not observed. (D)Decreased TG. Serum samples from control, HFD-medaka and HFD+EPA medaka at 12 weeks were analyzed by HPLCas for Fig. 3B. HFD+EPA medaka showed a 21% decrease in serum VLDL-TG compared with HFD-medaka. For A-D, the results shown are representative of 10-12individuals that were examined/group. (E)Restored gene expression. mRNA levels of the indicated lipogenic and lipolytic genes were examined in control, HFD-medaka and HFD+EPA medaka at 4 weeks by semi-quantitative RT-PCR as for Fig. 3E. Compared with HFD-medaka, the mRNA levels of SREBP-1c, ACC1 and FASwere reduced in HFD+EPA medaka and resembled those in medaka that were fed the control diet. Conversely, the expression levels of PPARA and CPT1 wereincreased in HFD+EPA medaka, whereas the level of ACO1 was decreased. This pattern also resembled that observed in medaka that were fed the control diet(n6/group).

Dise

ase

Mod

els &

Mec

hani

sms

D

MM

and then n-9PUFAs in a process that is controlled by HUFAs (Choet al., 1999). Thus, EPA and DHA levels and n-3:n-6 PUFA ratiosdeclined in our HFD-medaka owing to their greatly reducedconsumption of a-linolenic acid, EPA and DHA. By contrast, thelevels of mead acid increased in HFD-medaka owing to thedesaturation of oleic acid. In HFD-medaka treated with EPA, theincreased levels of EPA and DHA in the liver probably inhibitedthe activity of delta-6 and delta-5 desaturases. As a result, theconversion of linoleic acid to arachidonic acid, as well as that ofoleic acid to mead acid, was inhibited.

The n-3 PUFAs are ligands for PPARa, and PPARa activationincreases the expression of fatty acid oxidation enzymes such thatfatty acid oxidation is promoted (Gottlicher et al., 1992; Formanet al., 1997; Ren et al., 1997). Therefore, when PUFAs are deficient,fatty acid oxidation declines and livers accumulate fat (Fukazawaet al., 1971). In our medaka NASH model, expression of the mRNAencoding the lipogenic transcription factor SREBP-1c was induced,and expression levels of the fatty acid synthesis pathway enzymesACC1 and FAS were increased. Conversely, expression levels ofthe lipolytic transcription factor PPARa, as well as those of CPT1(the rate-limiting enzyme in mitochondrial b-oxidation), werereduced. Concomitantly, the expression of ACO1, which is involvedin peroxisome b-oxidation, was increased. The observed reductionin CPT1 expression may be attributable to the production ofmalonyl CoA, an intermediate product of fatty acid synthesis.Malonyl CoA interferes with CPT1 expression, and it is thoughtthat compensatory peroxisome b-oxidation is induced (McGarryet al., 1977).

In humans, n-3 PUFA deficiency has been linked to neuropathyand immune system impairment (Holman, 1998). Variations in n-

3 PUFA concentrations in the liver may thus indirectly regulate theinflammation associated with NASH. The notion that n-3 PUFAsare involved in the pathology seen in our medaka NASH model issupported by the observation that the expression levels of genesinvolved in fatty acid metabolism were restored to control levelswhen HFD-medaka were treated with EPA.

In conclusion, our study shows that the induction of fatty liverand the reproduction of NASH pathology in medaka can beachieved by feeding a diet that is low in EPA and DHA, but thathas about the same energy content as a control diet. Moreover, ourmodel is easily, cheaply and rapidly established in the laboratory,allowing ample latitude for exploration of its usefulness. Weanticipate that our medaka NASH model will indeed be helpful forclarifying human NASH pathology and for assisting in thedevelopment of novel therapeutics aimed at preventing oralleviating this burgeoning health problem.

METHODSAnimalsHimedaka strain Cab (an orange-red variety of medaka, Oryziaslatipes) fish that were 8 weeks old were used for most experiments.Fish were maintained at a stocking level of ten fish/tank in tap waterwith aeration. The ten fish in a given tank received a daily rationof 200 mg of the diet prescribed for that group, an amount thatwas consumed completely within 14 hours. All fish were maintainedin accordance with the Animal Care Guidelines of YamaguchiUniversity. During experiments, fish were kept in plastic tankscovered with plastic covers and illuminated with fluorescent lightfrom 8:00 a.m. to 10:00 p.m. The tank water temperature wasmaintained at 26±1°C.

DietsThe proportions of protein, fat and carbohydrate, as well as thefatty acid compositions, of the control, HFD and n-3 PUFA-deficient diets that were used in this study are shown in Tables 2and 3. The energy content of the control diet (Hikari Crest; KyorinCo. Ltd, Hyogo, Japan) was 3.3 kcal/g, with 25.3% of the calories



Fig. 5. n-3 PUFA deficiency induces NASH in medaka. (A)Gross appearanceof the abdomen. Edematous degeneration accompanying liver swelling and aslight increase in visceral fat is observed in medaka fed an n-3 PUFA-deficient(n-3PUFA–) diet for 8 weeks. (B)An H&E-stained section of liver from an n-3PUFA– medaka. Macrovesicular fat deposition is visible throughout the liver, asis focal ballooning degeneration. For A and B, the results shown arerepresentative of ten individuals that were examined/group. (C)Serum ALTvalues of the n-3 PUFA– medaka in A and B were twofold to fourfold higherthan those in medaka that were fed the control diet (n10/group).

Table 2. Composition of control, HFD and n-3 PUFA-deficient diets

Diet Grams/100 g Calorie % Kcal/100 g

Control diet

Protein 50.0 62.5 200.0

Fat 9.0 25.3 81.0

Carbohydrates 11.0 13.8 44.0

Total 325.0

n-3 PUFA-deficient diet

Protein 21.5 23.9 86.0

Fat 4.4 11.0 39.6


Total 360.0

HFD diet

Protein 25.5 20.1 102.0

Fat 32.0 56.7 288.0


Total 507.6

Dise

ase

Mod

els &

Mec

hani

sms

D

MM

from fat, 62.5% of calories from protein, and 13.8% of calories fromcarbohydrate, plus vitamins and minerals as recommended. Theenergy content of the high-fat diet (HFD32; CLEA Japan Inc.,Tokyo, Japan) was 5.1 kcal/g, with 56.7% of calories from fat, 20.1%of calories from protein, and 23.2% of calories from carbohydrate,plus vitamins and minerals as recommended. The n-3 PUFA-deficient (EPA- and DHA-deficient) diet, which consisted of fishmeal-free powder (F1 diet; Funabashi Farm Co. Ltd, Chiba, Japan),had an energy content of 3.6 kcal/g, with 11.0% of calories fromfat, 23.9% of calories from protein, and 65.1% of calories fromcarbohydrate, plus vitamins and minerals as recommended. ForEPA treatment, eicosapentaenoic acid ethyl ester (EPA-E, purity>99%; Mochida Pharmaceutical Co. Ltd, Tokyo, Japan) was mixedwith HFD32 to a concentration of 5% by weight.

HistologyEuthanized fish were slit open from the anal vent to the gills, andthe entire body was fixed with 4% paraformaldehyde in 0.1 Mphosphate buffer (Muto, Tokyo, Japan). The liver was dissected,dehydrated in alcohol, and embedded in paraffin according tostandard procedures. Serial sections (3-5 m thick) were cut andstained with hematoxylin and eosin (H&E). Liver fibrosis wasassessed by Gitter staining. Intracellular lipids were stained withOil Red O to analyze fat accumulation in the liver.

Electron microscopyChunks of medaka liver were fixed with 2% glutaraldehyde and 4%paraformaldehyde in 0.1 M phosphate buffer for 30 minutes at 4°C.Fixed liver pieces were washed thoroughly in 0.1 M phosphatebuffer, post-fixed for 30 minutes with 1% osmium tetraoxide in 0.1M phosphate buffer, and then block-stained with 2% aqueous uranylacetate for 30 minutes to enhance the contrast for electronmicroscopy. Samples were dehydrated through a graded ethanolseries, infused with propylene oxide, and embedded in epoxy resin.Ultra-thin sections were collected on copper grids, stained with2% aqueous uranyl acetate for 8 minutes and 0.5% lead citrate for8 minutes, followed by examination under a Hitachi H7500 electronmicroscope.

Blood analysisBlood samples were obtained from medaka following a 12-hourfast. Fish were kept on ice for 1-2 minutes and then bled by cuttinga ventral portion of the tail fin. Blood was collected in amicrocapillary tube and the volume measured. Blood samples werekept at room temperature for 1 hour before centrifugation at 1200� g for 30 minutes at 4°C. Serum ALT concentrations weremeasured using a Fuji Dry-Chem 3500 (Fuji Film Co. Ltd, Tokyo,Japan). Plasma glucose levels were determined using a GlucocardG-meter (Arkray Co. Ltd, Kyoto, Japan). Cholesterol and TG



Table 3. Fatty acid composition of control, HFD and n-3 PUFA-deficient diets

Fatty acid Control (g/100 g) HFD (g/100 g)

n-3 PUFA deficiency

(g/100 g)

Myristic acid C14:0 0.42 0.35 0.02

Myristoleic acid C14:1n-5 0.00 0.10 0.00

Pentadecanic acid C15:0 0.00 0.03 0.00

Palmitic acid C16:0 2.11 4.03 0.66

Palmitoleic acid C16:1n-7 0.50 0.38 0.01

Heptadecanic acid C17:0 0.00 0.13 0.00

Heptadecenic acid C17:1 0.00 0.10 0.01

Stearic acid C18:0 1.03 2.40 0.22

Oleic acid C18:1n-9 1.38 20.50 0.92

Linoleic acid C18:2n-6 0.88 3.26 2.31

-Linolenic acid C18:3n-3 0.13 0.06 0.22

Arachidic acid C20:0 0.02 0.10 0.01

Gondoic acid C20:1n-9 0.19 0.10 0.03

Arachidonic acid C20:4n-6 0.08 0.00 0.00

Eicosapentaenoic acid C20:5n-3 0.93 0.00 0.00

Behenic acid C22:0 0.00 0.06 0.01

Erucic acid C22:1n-9 0.03 0.00 0.00

Docosapentaenoic acid C22:5n-3 0.13 0.00 0.00

Lignoceric acid C24:0 0.02 0.00 0.00

Docosahexaenoic acid C22:6n-3 1.07 0.00 0.00

Nervonic acid C24:1n-9 0.04 0.00 0.00

Total (g/100 g) 8.96 31.60 4.42

Total PUFA (g/100 g) 3.22 3.32 2.53

n-3 PUFA (g/100 g) 2.26 0.06 0.22

n-6 PUFA (g/100 g) 0.96 3.26 2.31

n-3:n-6 ratio 2.35 0.02 0.10

Dise

ase

Mod

els &

Mec

hani

sms

D

MM

profiles in total lipoproteins were analyzed using a dual-detectionHPLC system (Skylight Biotech, Akita, Japan) with two tandem-connected TSKgel LipopropakXL columns (300 � 7.8 mm; Tosoh,Japan).

Fatty acid analysisThe fatty acid composition of homogenized liver tissue (20 mgtissue/ml saline) was determined by capillary gas chromatography.Total lipids were extracted by Folch’s procedure (Folch et al., 1957),and fatty acids were methylated with boron trifluoride andmethanol. Methylated fatty acids were analyzed using a ShimadzuGC-17A gas chromatograph (Shimadzu Co. Ltd, Kyoto, Japan) anda BPX70 capillary column (0.25 mm internal diameter � 30 mm;SGE International Ltd, Melbourne, Australia). Tricosanoic acid(C23:0) was used as the internal standard. The minimum detectablefatty acid concentration detected by this assay is 0.5 g/ml.

Semi-quantitative RT-PCRTo avoid any acute effects of food intake, fish were fasted overnightprior to sacrifice. Livers were isolated and total RNA was extractedand purified using the RNeasy kit (Qiagen, Hilden, Germany).cDNAs were synthesized using purified RNA plus randomhexamers and the Transcriptor First Strand cDNA synthesis kit(Roche, Indianapolis, IN). Semi-quantitative RT-PCR wasperformed using a PCR master mix (Promega, Madison, WI) andthe primers listed in Table 4. Gene expression levels werenormalized against b-actin (endogenous control).

Statistical analysesNumerical data are expressed as the mean ± S.D. The Student’s t-test was performed to assess statistical significance among groupsof medaka. P values less than 0.05 were considered to be significant.ACKNOWLEDGEMENTSThis study was supported by Grants-in-Aid for Scientific Research from the JapanSociety for the Promotion of Science (Nos. 18590737, 18659209, 19590693,19390199, 20659116 and 21659189); the Knowledge Cluster Initiative; the Ministryof Health, Labour and Welfare; and Japan Aerospace Exploration Agency (JAXA).We also thank Dr Masaaki Soma and Dr David Tosh for critical reading of themanuscript.

COMPETING INTERESTSThe authors declare no competing financial interests.

AUTHOR CONTRIBUTIONST.M., S.T. and I.S. conceived and designed the experiments; T.M., S.K., K.F., T.O. andN.Y. performed the experiments; T.M., Y.F. and Y.H. analyzed the data; M.F.-S. andH.N. contributed reagents, materials and analytical tools; T.M. and S.T. wrote thepaper.

Received 25 November 2008; Accepted 29 October 2009.

REFERENCESAnstee, Q. M. and Goldin, R. D. (2006). Mouse models in non-alcoholic fatty liver

disease and steatohepatitis research. Int. J. Exp. Pathol. 87, 1-16.Araya, J., Rodrigo, R., Videla, L. A., Thielemann, L., Orellana, M., Pettinelli, P. and

Poniachik, J. (2004). Increase in long-chain polyunsaturated fatty acid n-6/n-3 ratioin relation to hepatic steatosis in patients with non-alcoholic fatty liver disease. Clin.Sci. (Lond.) 106, 635-643.

Boorman, G. A., Botts, S., Bunton, T. E., Fournie, J. W., Harshbarger, J. C., Hawkins,W. E., Hinton, D. E., Jokinen, M. P., Okihiro, M. S. and Wolfe, M. J. (1997).Diagnostic criteria for degenerative, inflammatory, proliferative nonneoplastic andneoplastic liver lesions in medaka (Oryzias latipes): consensus of a NationalToxicology Program Pathology Working Group. Toxicol. Pathol. 25, 202-210.

Brown, W. D. and Tappel, A. L. (1959). Fatty acid oxidation by carp liver mitochondria.Arch. Biochem. Biophys. 85, 149-158.

Brown-Peterson, N. J., Krol, R. M., Zhu, Y. and Hawkins, W. E. (1999). N-nitrosodiethylamine initiation of carcinogenesis in Japanese medaka (Oryziaslatipes): hepatocellular proliferation, toxicity, and neoplastic lesions resulting fromshort term, low level exposure. Toxicol. Sci. 50, 186-194.

Browning, J. D., Szczepaniak, L. S., Dobbins, R., Nuremberg, P., Horton, J. D.,Cohen, J. C., Grundy, S. M. and Hobbs, H. H. (2004). Prevalence of hepatic steatosisin an urban population in the United States: impact of ethnicity. Hepatology 40,1387-1395.

Brunt, E. M., Janney, C. G., Di Bisceglie, A. M., Neuschwander-Tetri, B. A. andBacon, B. R. (1999). Nonalcoholic steatohepatitis: a proposal for grading and stagingthe histological lesions. Am. J. Gastroenterol. 94, 2467-2474.



TRANSLATIONAL IMPACT

Clinical issueNonalcoholic fatty liver disease (NAFLD) is the most common cause of humanliver dysfunction, and an estimated 30% of the general population of the USAsuffer from excessive fat accumulation in the liver. NAFLD is broadly dividedinto two subgroups: (1) non-progressive simple steatosis, and (2) nonalcoholicsteatohepatitis (NASH) with worsening degeneration and fibrosis. In cases ofprogressive chronic liver disease, NASH may progress from steatohepatitis toliver cirrhosis, and may eventually lead to hepatocellular carcinoma. A lack ofknowledge about the mechanisms that lead to NASH progression preventadvances in drug development.

ResultsThe authors establish a NASH model using the ricefish medaka (Oryziaslatipes), which were fed a high-fat diet (HFD) for 12 weeks (HFD-medaka). HFD-medaka exhibited hyperlipidemia, hyperglycemia and hepatic steatosis, withprogressive hepatocyte degeneration that led to liver dysfunction. Thesefindings are consistent with NASH progression in humans.

Expected genetic changes were also detected in the NASH model, includingincreased expression of lipogenic genes and decreased expression of lipolyticgenes after HFD feeding. The concentrations of n-3 polyunsaturated fatty acids(PUFAs) and n-6 PUFAs declined, and the n-3:n-6 ratio was reduced in HFD-fedanimals, which reflects the biochemistry in humans. Treating HFD-fed medakawith a drug used to treat human NASH [n-3 PUFA eicosapentaenoic acid (EPA)]mitigated disease, restoring normal liver fatty acid composition and normalexpression levels of lipogenic and lipolytic genes. Moreover, medaka that werefed a diet deficient in n-3 PUFAs developed features of NASH. This NASHmodel demonstrates that the proportion of n-3 PUFAs that are present in theliver plays an important role in the progress of NASH pathology.

Implications and future directionsThe medaka genome was recently sequenced, making it amenable to forwardgenetic screens with N-ethyl-N-nitrosourea (ENU), and morpholinoknockdown. These techniques promote the analysis of specific gene mutationsin these fish. Thus, with their high reproductive rate, rapid maturation and lowmaintenance costs, medaka compare favorably with rodents as experimentalanimals. This NASH model is a useful tool to study the unknown mechanismsunderlying human liver disease, and should eventually be useful fortherapeutic screen tests.

doi:10.1242/dmm.005355

Table 4. Primers for seven genes examined in the livers of HFD-

medaka

Gene Forward primer (5 to 3 ) Reverse primer (3 to 5 )

ACC1 GAGTGACGTCCTGCTTGACA ACCTTTGGTCCACCTCACAG

ACO1 GCTCAGCTTTACAGCCTTGG GGACGATTCCCTAACGATCA

CPT1 ATGTCTACCTCCGTGGACGA CAAGTTTGGCCTCTCCTTTG

FAS GACGCTTCAGGAAATGGGTA GGACAGGAACCGGACTATCA

PPARA TCTTGAGTGTCGGGTGTGTG CGGTAGAGCCCACCATCTT

SREBP-1c CCCAACCAGATGAGGAGAAA AGGACTTTTGTGCTGCTCGT

-actin CTGGACTTCGAGCAGGAGAT GCTGGAAGGTGGACAGAGAG

Dise

ase

Mod

els &

Mec

hani

sms

D

MM

Bunton, T. E. (1990). Hepatopathology of diethylnitrosamine in the medaka (Oryziaslatipes) following short-term exposure. Toxicol. Pathol. 18, 313-323.

Cho, H. P., Nakamura, M. T. and Clarke, S. D. (1999). Cloning, expression, andnutritional regulation of the mammalian Delta-6 desaturase. J. Biol. Chem. 274, 471-477.

Day, C. P. (2002). Pathogenesis of steatohepatitis. Best Pract. Res. Clin. Gastroenterol. 16,663-678.

Day, C. P. and James, O. F. (1998). Steatohepatitis: a tale of two “hits”?Gastroenterology 114, 842-845.

Deng, Q. G., She, H., Cheng, J. H., French, S. W., Koop, D. R., Xiong, S. andTsukamoto, H. (2005). Steatohepatitis induced by intragastric overfeeding in mice.Hepatology 42, 905-914.

Folch, J., Lees, M. and Sloane Stanley, G. H. (1957). A simple method for the isolationand purification of total lipides from animal tissues. J. Biol. Chem. 226, 497-509.

Forman, B. M., Chen, J. and Evans, R. M. (1997). Hypolipidemic drugs,polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated receptors alpha and delta. Proc. Natl. Acad. Sci. USA 94, 4312-4317.

Fukazawa, T., Privett, O. S. and Takahashi, Y. (1971). Effect of EFA deficiency on lipidtransport from liver. Lipids 6, 388-393.

Gottlicher, M., Widmark, E., Li, Q. and Gustafsson, J. A. (1992). Fatty acids activate achimera of the clofibric acid-activated receptor and the glucocorticoid receptor. Proc.Natl. Acad. Sci. USA 89, 4653-4657.

Holman, R. T. (1998). The slow discovery of the importance of omega 3 essential fattyacids in human health. J. Nutr. 128, 427S-433S.

Hotamisligil, G. S., Arner, P., Caro, J. F., Atkinson, R. L. and Spiegelman, B. M.(1995). Increased adipose tissue expression of tumor necrosis factor-alpha in humanobesity and insulin resistance. J. Clin. Invest. 95, 2409-2415.

Kasahara, M., Naruse, K., Sasaki, S., Nakatani, Y., Qu, W., Ahsan, B., Yamada, T.,Nagayasu, Y., Doi, K., Kasai, Y. et al. (2007). The medaka draft genome and insightsinto vertebrate genome evolution. Nature 447, 714-719.

Masahito, P., Aoki, K., Egami, N., Ishikawa, T. and Sugano, H. (1989). Life-spanstudies on spontaneous tumor development in the medaka (Oryzias latipes). Jpn. J.Cancer Res. 80, 1058-1065.

Matteoni, C. A., Younossi, Z. M., Gramlich, T., Boparai, N., Liu, Y. C. andMcCullough, A. J. (1999). Nonalcoholic fatty liver disease: a spectrum of clinical andpathological severity. Gastroenterology 116, 1413-1419.

McGarry, J. D., Mannaerts, G. P. and Foster, D. W. (1977). A possible role for malonyl-CoA in the regulation of hepatic fatty acid oxidation and ketogenesis. J. Clin. Invest.60, 265-270.

Neuschwander-Tetri, B. A. and Caldwell, S. H. (2003). Nonalcoholic steatohepatitis:summary of an AASLD Single Topic Conference. Hepatology 37, 1202-1219.

Powell, E. E., Cooksley, W. G., Hanson, R., Searle, J., Halliday, J. W. and Powell, L. W.(1990). The natural history of nonalcoholic steatohepatitis: a follow-up study of forty-two patients for up to 21 years. Hepatology 11, 74-80.

Puri, P., Baillie, R. A., Wiest, M. M., Mirshahi, F., Choudhury, J., Cheung, O.,Sargeant, C., Contos, M. J. and Sanyal, A. J. (2007). A lipidomic analysis ofnonalcoholic fatty liver disease. Hepatology 46, 1081-1090.

Ren, B., Thelen, A. P., Peters, J. M., Gonzalez, F. J. and Jump, D. B. (1997).Polyunsaturated fatty acid suppression of hepatic fatty acid synthase and S14 geneexpression does not require peroxisome proliferator-activated receptor alpha. J. Biol.Chem. 272, 26827-26832.

Robinson, J. S. and Mead, J. F. (1973). Lipid absorption and deposition in rainbowtrout (Salmo gairdnerii). Can. J. Biochem. 51, 1050-1058.

Sanyal, A. J. (2002). AGA technical review on nonalcoholic fatty liver disease.Gastroenterology 123, 1705-1725.

Schaffner, F. and Thaler, H. (1986). Nonalcoholic fatty liver disease. Prog. Liver Dis. 8,283-298.

Sheridan, M. A. (1988). Lipid dynamics in fish: aspects of absorption, transportation,deposition and mobilization. Comp. Biochem. Physiol. B 90, 679-690.

Sprecher, H. (1981). Biochemistry of essential fatty acids. Prog. Lipid. Res. 20, 13-22.Yamauchi, M., Kinoshita, M., Sasanuma, M., Tsuji, S., Terada, M., Morimyo, M. and

Ishikawa, Y. (2000). Introduction of a foreign gene into medakafish using theparticle gun method. J. Exp. Zool. 287, 285-293.

Younossi, Z. M., Gramlich, T., Liu, Y. C., Matteoni, C., Petrelli, M., Goldblum, J.,Rybicki, L. and McCullough, A. J. (1998). Nonalcoholic fatty liver disease:assessment of variability in pathologic interpretations. Mod. Pathol. 11, 560-565.


Medaka as a human NASH modelRESEARCH ARTICLED

iseas

e M

odel

s & M

echa

nism

s

DM

M

medaka as a model for human nonalcoholic steatohepatitismacrovesicular fat deposition was widespread...

Documents