management commentary / welltec · accounting year: january 1, 2013 ... is one of maximizing...

1 MANAGEMENT COMMENTARY / WELLTEC® ANNUAL REPORT 2013

ANNUAL REPORT

Our

late

st t

ool a

dditi

on, t

he a

war

d-w

inni

ng W

ell C

utter®

Gam

e-ch

angi

ng s

olut

ions

for o

ur c

lient

s in

trans

form

ing th

e industry

Safe

r and

mor

e su

stain

able

with higher

recovery

2013Welltec International ApS

Central Business Registration No: 30 69 50 03

2 / MANAGEMENT COMMENTARYWELLTEC® ANNUAL REPORT 2013

Company Welltec International ApS

Gydevang 25

3450 Allerød

Denmark

Phone: +45 48 14 35 14

Fax: +45 48 14 35 18

Website: www.welltec.com

E-mail: [email protected]

Central Business Registration No: 30 69 50 03

Registered in: Allerød

Accounting year: January 1, 2013 – December 31, 2013

Executive Board Jørgen Hallundbæk, Chief Executive Officer

Board of Directors Søren Jørgensen, Chairman

Jørgen Hallundbæk

Johannes K. J. Sikkens

Scott C. Collins

Company auditors Deloitte Statsautoriseret Revisionspartnerselskab

COMPANY DETAILS

our VALUES

DISRUPTIVE INNOVATIONISRU – We move with courage thto challenge conventional thinkinggto c

CLIENT DEDICATIONN – We do what it takes to completelyomaddress our clients’ challengeso

LEADERSHIP – We pride ourselves on taking actions that keep hrus in the forefronth

PROFESSIONALISM – We deliver what we promiseee

PERFORMANCE – We drive results through the dskills and committment of our people


CONTENTS

Company Details 2

Company Profile 4

CEO Letter 5

Consolidated Key Figures 6

Management Commentary 7

Financial Review 7

Outlook 12

Strategy 15

Competitive Strengths 17

Risks 19

Corporate Governance 21

Corporate Social Responsibility 22

Statement by Management on the Annual Report 28

Independent Auditor’s Reports 29

Financial Statements 30

Consolidated Group 30

Parent Company 71

Group Chart 85


COMPANY PROFILE

Welltec® is a leading provider of robotic intervention services

and completion solutions to the oil and gas industry. Our pi-

oneering technology enables operators to optimize the man-

agement and development of their assets throughout their

life-cycle. We address the factors that maximize value creation,

continuously innovating to reduce well construction time,

speed up access to the hydrocarbons and reduce the capital ex-

penditure compared to more conventional methods. The effect

is one of maximizing hydrocarbon production and increasing

total recovery while minimizing operating downtime.

Our lightweight technology also reduces the risk to personnel

and increases many safety aspects of the industry by enabling

smaller work crews and minimizing heavy lifting. Furthermore,

our technology allows operators to avoid the use of rigs, sig-

nificantly reducing the industry’s carbon footprint. Our ability

to operate in extended reach and horizontal wells allows op-

erators to drill multiple wells from the same topside location,

thereby further reducing the environmental footprint.

This is Welltec’s philosophy; to challenge existing conventions

and think laterally in order to develop products and services

which increase oil and gas recovery while improving the sus-

tainable, economic, environmental, and safety aspects of our

industry. In practice we develop, test and manufacture state-

of-the-art technology to enhance the production and recov-

ery rates for our clients, thereby improving their profitability

through a longer term revenue stream, while at the same time

improving upon health, safety and environmental attributes.

Our game-changing solutions allow our customers, some of

the world’s largest national and independent oil companies,

to optimize production through ground-breaking flexible well

completion solutions (WCS) and innovative well intervention

services (WIS). Our disruptive innovation challenges the con-

ventions, maximizing production, increasing oil recovery and

improving well-integrity and safety, with faster and less intru-

sive solutions in environments that are becoming increasingly

complex, remote and hostile.

In an industry characterized by maturing fields and increasing

depletion, the premium attached to technology which aids in

reversing these trends is continuing to gain momentum. Our

value proposition is compelling; our technology enables clients

to unlock more production from their assets and to address res-

ervoir complexities and uncertainties with a greater number of

options, which are cleaner, safer and more sustainable.

WE EMPLOY OVER 1,000 PEOPLE WORLD WIDE

– WITH 47 BASES IN 31 COUNTRIES

,


CEO LETTER

During the past year we decided to change our organizational

structure and implemented a more decentralized set-up that

balances global coordinated management with fast, local de-

cision-making to provide flexibility and strengthen our regional

capabilities.

While this transformation seems logical, the transition has not

been without challenges and a continued effort is needed in

2014. Regional differences, steep learning curves and organi-

zational alignment challenges have all prolonged the adapta-

tion process, and we did not deliver on our high expectations.

However, I remain confident that our efforts in 2014 will pave

the way for continued growth.

We have remained true to our vision of transforming the oil in-

dustry into one that is safer and more sustainable while achiev-

ing a higher recovery.

Our safety records were already well above industry standards

yet in 2013 we have taken this even higher with unprecedent-

ed safety improvements. Being a truly safe company to work

with is not only part of our vision; it is a critical element in posi-

tioning for winning major contracts worldwide.

The industry focus is shifting towards higher recovery and more

sustainable ways of extracting hydrocarbons, but we still have a

major task in driving the adoption of our enabling technology.

All three elements of our vision: safer, sustainable, higher re-

covery, are leading to lower lifting costs and therefore provide

significant value creation and improved margins for our clients.

The conventional wisdom is still, however, that these elements

increase costs, which may be true with the old technologies,

but the application of our technology achieves the best of both

worlds.

Operationally, we have managed to improve on our unparal-

leled levels of service quality. Our technology works, our opera-

tional processes work and our execution works. This provides a

reliable solution in the face of uncertain well conditions. Push-

ing the boundaries isn’t easy and when we look behind the

stats it becomes clear that we don’t improve because we ‘play-

it-safe’; we improve because we constructively learn from our

experiences.

We have a solid base on which to progress. Our clients have

firmly embraced our latest award-winning innovation, the Well

Cutter®, which eliminates the need to use explosives and the

risks and costs involved. Our largest clients’ satisfaction with

their early adoption of our Flex-Well® Completion Concept

proves that Welltec® has an expanding role to play in that mar-

ket too.

We have established the strategic framework to take Welltec®

to the next level in its corporate development. Our vision is

prevailing and our mission is to continue to drive the industry

adoption. The key is how successfully we can implement real

shifts in behaviors both from an internal and an external per-

spective. I believe that a united, refocused organization with a

stronger regional presence, continued technological leadership

and unparalleled service quality, will provide the foundation for

further success in the years to come

Jørgen Hallundbæk, CEO

nued technological leadership

will provide the foundatttiooioioooioiooioioooiooiooooooiooioioooiooiooooioiooioiooooooooooiooooooooooooooiooooooooioooooooooioooooioooooooiooooooooooon nnnnnnnnnnnnnnnnnnnn for

ome

Jørgen Hallundbæk, CEO


CONSOLIDATED KEY FIGURES Welltec International ApS – group

2013Restated

2012 2011 2010 2009

STATEMENT OF COMPREHENSIVE INCOME (USD in millions)

Revenue 321 295 229 164 135

Earnings before interest, tax depreciation and amortization (EBITDA)* 135 140 111 87 78

Operating profit (EBIT) before special items 72 86 57 48 39

Operating profit (EBIT) 68 86 57 46 37

Net financials (26) (38) (24) (16) (22)

Profit before tax 42 48 33 30 16

Net profit for the year 21 24 17 18 8

CASH FLOWS (USD in millions)

Cash flows from operating activities 100 95 84 74 74

Cash flows from investment activities (86) (79) (61) (46) (36)

Cash flows from financing activities (18) 12 (26) (29) (32)

Total cash flows (4) 29 (3) (1) 5

BALANCE (USD in millions)

Trade receivables 83 85 50 36 39

Equity 279 246 315 300 293

Total assets 712 692 596 577 602

Investments in intangible assets** 34 31 28 26 21

Investments in tangible assets** 55 51 36 22 17

Investments in financial assets 0 0 0 0 0

KEY RATIOS (%)

EBITDA-margin 42.1 47.3 48.5 52.7 57.8

EBIT-margin before special items 22.5 29.2 24.9 29.1 28.9

ROIC excl. goodwill 29.2 36.7 33.7 25.9 22.0

Return on equity 7.9 8.6 5.5 6.1 2.8

Number of employees, average 1,055 916 730 590 527

*EBITDA is defined as profits/loss before income taxes, financial expenses, financial income, special items and total depreciation and amortization. Depreciation for these purposes includes

depreciation attributable to development and manufacturing which is capitalized because it is considered a part of the costs that are directly attributable to the manufacturing of our products.

Furthermore, EBITDA has been adjusted for issued warrants (non-cash).

**Investments in intangible and tangible assets are defined as addition of fixed assets including additions from financial leasing and additions through business combinations.

The key figures are prepared in accordance with the Danish Society of Financial Analysts’ “Recommendations & Financial Ratios 2010”.

Change in presentation and functional currency

In the third quarter, Management decided to change the reporting currency of its consolidated financial statements to USD in order, to best represent the core business performance and its un-

derlying exposures. This is both from an operational and a capital structure perspective. In addition this accommodates requests from investors and serves to make the consolidated financial state-

ments more comparable within Welltec’s peer group. At the same, Management reconsidered the group’s functional currency and assessed the USD to be the functional currency for the Danish

operation and operations in some other countries. Management identified the issuance of USD bonds in the beginning of 2012 as the main event triggering the change in functional currency from

DKK to USD, and consequently the change in functional currency is deemed to have taken place at that date.


alternatives. In Europe and Russia CIS, geographic expansion in

the Caspian region has counterbalanced lower activity in the

North Sea and on land Russia earlier in the year. In the Middle

East we have expanded operations in Qatar, Oman and Yemen,

where we set a new record for the 218 Well Tractor® with the

longest distance covered in one descent. The tool string, con-

veying a Production Logging Tool (PLT), was tractored for an im-

pressive 14 kilometers in difficult borehole conditions to depths

and inclinations that conventional methods cannot achieve.

In the Americas, revenues of USD 112 million represented

growth of 5%. In the US new client activity on land and in-

creased subsea activity in the Gulf of Mexico has primarily con-

tributed to the growth. This included two world firsts using

Riserless Light Well Interventions (RLWI). The first to retrieve

Crown Plugs and the second for the clean out of asphaltene.

Welltec’s RLWI capabilities open up the possibility of intervening

Revenue

Revenues increased 9% year on year to USD 321 million. The

growth has been primarily activity driven and a combination of

delivering a wider scope of services to existing clients, acquiring

new clients and commercializing new products and services.

Revenues in Europe, Middle East, Africa & Russia/CIS (EMEAR)

amounted to USD 170 million, an increase of 11% year on

year. The growth has been diverse. In Scandinavia, continued

advances with our largest client, Statoil, have allowed for an

increasing share of their operations and improvements in both

volume and service mix under the first year of our new con-

tract. In Africa, we have successfully demonstrated the strength

of our value proposition with high-complexity intervention

work for major operators in the sub-Sahara region. This in-

cluded a milling operation to retrieve a stuck safety valve that

enabled the operator to avoid having to pull the entire comple-

tion string and saved more than USD 2 million compared to the

(USD in millions) 2013 2012 CHANGE IN %

Revenue 321 295 9

Cost of service provided (156) (128) 21

Gross profit 165 167 (1)

Development and manufacturing costs (0) (0) nm

Administrative and sales costs (82) (70) 17

Amortization of acquired intangibles in a business combination (11) (11) 0

Special items (5) 0 nm

Net financial expenses (26) (38) (32)

Income taxes (21) (24) (13)

Profit for the year 21 24 (13)

MANAGEMENT COMMENTARY

FINANCIAL REVIEW

Development in activities and finances in 2013

Welltec® continued on its path of profitable growth and opera-

tional cash flow generation in 2013 despite falling short of full

year expectations, in a year dominated by corporate develop-

ment and the necessity to change the organizational structure

in order to have a wider impact and better delivery on its mis-

sion. Accordingly, the results are below the latest guidance at

the end of the third quarter.


in subsea wells and actively managing fields that are not eco-

nomically viable with conventional methods. Successes on the

East Coast of Canada have increased our share of operations

with major operators and offset the adverse effects of some

extreme weather conditions in the third quarter. Across Latin

America, Welltec® has grown in all of the markets it operates

in, leveraging on an expanded tool fleet to widen the scope of

services with the region’s national oil companies, particularly in

Mexico and Brazil.

In Asia Pacific, revenues grew 10% to USD 40 million. A high-

light for the region was the completion of seven years with no

lost time incidents (LTI’s), demonstrating utmost dedication to

safety. Financially, India was the main driver following land-

mark direct contract awards with major operators and delivery

of high value mechanical services, such as opening sliding side

doors (SSDs) on wireline, using the Well Stroker® in place of coil

tubing due to its superior depth control, power and precision.

Cost of service provided

The cost of service provision was USD 156 million, an increase

of 21% compared to last year. This was higher relative to the

revenue growth and explained in terms of both the growth and

change in activity mix, geographically and in the type of ser-

vices performed.

The increase in cost of service provision was primarily attribut-

able to increased field staff costs of USD 11 million, with aver-

age operational headcount increasing 20% to support higher

levels of activity. The number of jobs performed increased by

19% over the same period, partly reflecting an increased in-

vestment in operational capacity at the start of the year to sup-

port growth, and partly on account of qualitative changes in

the sales mix.

The service mix is diverse and dynamic, reflecting an ever-

changing-mix of operations across the globe, onshore and off-

shore, in established and emerging markets, and for new and

existing clients. Other direct operational costs have increased

27%, with proportionally higher levels of leasing, freight and

direct material costs, largely reflecting the growth from new

clients and emerging countries that require greater operational

investments. A characteristic of our growth cycle and indeed

strategy is the broadening of the client base within our core

tractor conveyance offerings and leveraging to provide a more

value-adding scope of services. The reduction in gross margin

can partly be explained by this development, with an increased

share of conveyance activity in the full year.

Administrative and sales costs

Administrative and sales costs were USD 82 million, an increase

of 17% compared to last year. The increase was a combination

of the increased scale of operations, through higher premises,

IT and administrative costs, a 16% growth in average head-

count and increased consultancy fees relating to HR strategy

and executive level projects.

Earnings before interest, tax, depreciation, amortization and

special items (EBITDA)

EBITDA reduced by 3% to USD 135 million, representing an

EBITDA margin of 42% against 47% in 2012. This develop-

ment was the combination the change in service mix, with in-

creased conveyance activity, and reduced gross margins with

the expansion of activity.

Operating profit before special items (EBIT)

EBIT decreased by 16% to USD 72 million. The EBIT margin was

23% against 29% in 2012, reflecting the reduction in earnings

and the relative development in depreciations and amortizations.


Special items

Special items of USD 5 million relate the adjustment to head-

count in the second quarter as part of the decentralization

initiative and non-recurring consultancy fees.

Net financial expenses

Net financial expenses were USD 26 million, a decrease of 32%

compared to last year. Interest expenses were 2% higher, re-

flecting the first, full year following the bond offering. This was

countered by gains on the fair value adjustment of derivative

financial instruments and a net reduction in unrealized currency

losses.

Income taxes

Income taxes were USD 21 million, a decrease of 13% year

on year, reflecting the reduced level of operating profit, partly

offset by an increase in the effective tax rate. This increase was

due to the revision of tax provisions on issues addressed during

the year and the adverse effects arising from the non-deduct-

ibility of the higher interest expense and non-deductibility of

withholding taxes.

Profit for the year

Profit was USD 21 million, a decrease of 13% on 2012. This

development was due to the reduction in EBIT and increase in

special items, partly offset by the reduction in net financial ex-

penses and income taxes.

Free cash flows

Welltec® continued to generate strong cash flows from opera-

tions and improved the level of days’ sales outstanding (DSO)

across the year through improved processes and strict working

capital discipline. The cash generated was used to service inter-

est payments, repurchase shares and reinvested in D&E proj-

ects, patents and additional tractors and tools as part of the

cycle of continued growth delivery. Additionally, capital expen-

ditures increased in support of the well completions business,

including the acquisition of Alslev Rustfri Montage and lease-

hold improvements on the new production facility in Esbjerg.

CAPEX % of Revenue

3748

64

8289

28% 29% 28% 28% 28%

2009 2010 2011 2012 2013

CF from operations % of Revenue

74 7484

95 100

55%45%

37% 32% 31%

2009 2010 2011 2012 2013

REVENUE (USD in millions) EBITDA (USD in millions)

CAPEX (USD in millions)CASH FLOW FROM OPERATIONS (USD in millions)

Revenue YOY Growth

135164

229295 321

4%

21%40%

29%

9%

2009 2010 2011 2012 2013

EBITDA Margin

78 87111

140 135

58%53%

49% 47%42%

2009 2010 2011 2012 2013

Branches

Welltec International ApS group has several branches with sales activities in foreign countries. Please see group chart on page 85.


Significant events in 2013

Adjustment to headcount

As part of the initiative to decentralize while ensuring the

right mix of competencies and capabilities, Welltec® reduced

the number of employees at its Danish headquarters by 27 in

April 2013. This mainly related to indirect capacity costs and re-

aligned the business on the underlying growth trajectory.

Capital increase

During the third quarter, Welltec® completed a private place-

ment with PFA, Denmark’s largest pension fund. Gross pro-

ceeds amounted to USD 46 million, securing PFA a minority

interest, and have been designated to strengthen Welltec’s

capital structure and further develop the business.

BID PRICE (USD)

96

98

100

102

104

106

108

110

Jan-13 Feb-13 Mar-13 Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 Nov-13 Dec-13

BID YIELD (%)

5.0

5.5

6.0

6.5

7.0

7.5

8.0

8.5

Jan-13 Feb-13 Mar-13 Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 Oct-13 Nov-13 Dec-13

Bond performance

The Senior Secured Notes have continued to trade above par,

with meaningful demand in the secondary trading. The im-

plied funding cost has been reduced from 8.5% upon issuance

to 6.4% at year end.

,


Development in activities and finances in Q4

The fourth quarter demonstrated sequential growth but was

slightly lower than last year due to the activity mix and adverse

currency developments.

A plateau in the growth rate was recognized earlier in the year

and dedicated efforts to address the underlying challenges

have continued, including several strategic initiatives that have

been set in motion to transition the organization to the next

phase of corporate development and accelerate growth.

Revenues increased sequentially to USD 84 million; represent-

ing a 2% reduction on the fourth quarter last year which was

boosted by the client-sponsored development of our Coil Tub-

ing Well Tractor® and a relatively large sale of our well comple-

tion products.

Adjusting for currency developments, however, underlying

revenues showed continued growth with further operational

successes with our Well Cutter®, RCB Well Cleaner® and Well

Stroker®.

Another operational highlight was the delivery of additional

Well Annular Barriers, WAB® to both existing and new clients,

with multiple qualifications made for more sales and product

releases in 2014. This followed the announcement of an agree-

ment to lease a new dedicated and purpose-built production

facility in Esbjerg, and represents the next step in our expansion

in the Well Completions market. This also contributed to the

increase in CAPEX in the period.

CAPEX % of Revenue

23 26 21 1626

26%35%

25%21%

30%

2012 Q4 2013 Q1 2013 Q2 2013 Q3 2013 Q4

CAPEX (USD in millions)

CF from operations % of Revenue

3329

17 1936

39% 38%

20%25%

42%

2012 Q4 2013 Q1 2013 Q2 2013 Q3 2013 Q4

CASH FLOW FROM OPERATIONS (USD in millions)

Revenue YOY Growth

86 75 84 78 84

39% 16% 23%

2% (2%)

2012 Q4 2013 Q1 2013 Q2 2013 Q3 2013 Q4

REVENUE (USD in millions) EBITDA (USD in millions)

EBITDA Margin

3927

3933 36

46%

36%

47% 42% 43%

2012 Q4 2013 Q1 2013 Q2 2013 Q3 2013 Q4

Quarterly numbers in above graphs are unaudited.


OUTLOOK

While macro-economic factors continue to impact the opera-

tions of our clients, the total potential market that Welltec® can

address far exceeds any boundaries imposed by the capacity of

our organization or short term trends in the industry.

Strong market fundamentals underlie the increasing demand

for our services. With the shale gas revolution and increasing

depletion of maturing oilfields, operating environments are be-

coming increasingly unconventional, remote and hostile. The

strategic focus of the oil and gas industry is shifting towards

the development and optimization of assets with a step change

in complexity and development risk. This is Welltec’s sphere of

expertise.

Our technology offers advantages in all types of wells. As the

absolute leader within robotic well intervention technology,

Welltec® remains in a prime position to benefit from these mar-

ket drivers. However, the industry adoption of robotic technol-

ogy to displace tried-and-tested conventional methods rep-

resents a significant barrier to growth in a conservative and

risk-averse industry. The ability to drive this transformation is a

primary element of the organizational changes implemented in

the second half of 2013.

We expect a decentralized organization with a stronger region-

al presence and a unified approach to gain further traction over

the course of the coming year. Organic growth will result from

increased activity and uptake of all our services, leveraging on

the many contract awards and extensions secured in 2013

as well as building on the operational successes in our wide

portfolio of offerings. This will be predominantly within well

intervention. Continued momentum in our well completions

business will provide an increased contribution, although the

associated lead times will naturally limit this development in the

coming year.

Innovation remains an integral part of our competitive advan-

tage. The release pipeline for 2014 includes the launch of our

next generation tractor, the Well Tractor CR® (compact rig-

up), which will be the shortest, fastest tractor in the market.

This provides value in applications globally with limited rig-up

heights such as small platforms and provides synergies with our

efforts to provide applications supporting RLWI initiatives. Also

planned is the launch of the first of Welltec’s diagnostic tools,

the Welltec® Hardware Scanner, which adds value for our cus-

tomers through its capabilities to provide real-time measure-

ments for correlation as well as hardware position.

Management expects continued growth in revenue in 2014

and an improvement in EBITDA. Revenue is expected to be

around USD 340 million (6% growth) with an EBITDA of USD

140 million, equating to an EBITDA margin around 42% on the

basis of a similar service-mix as delivered in 2013.

Forward-looking statements provide current expectations or

forecasts for events, such as product launches, and financial

performance. Such statements are subject to risks, uncertain-

ties and inaccurate assumptions. Actual results may differ from

expected results. Factors that may affect future results include

fluctuations in exchange rates, oil and gas prices, changes in in-

terest rates, production problems, unexpected contract breach-

es or terminations, market-driven price decreases, introduction

of a competing product, Welltec’s ability to successfully market

both new and existing products, exposure to lawsuits and un-

expected growth in costs and expenses.


ouurrrr VVVVVVVAAAALLLLLLUES

DISRUPTIVE INNOOVVVVAAATAATAA IOOOOONNNN – We move wwiith ccooouuuraagto challennnngggeege cooooonno ventional thhinkinnggggto challennnngggeeg cooooonnventional thhinkingnggg

CLIENT DEDICATIOOONNNNN ––– WeWee ddddo o what it taakkekekeeesss toto ccompletely addrrreeeessssss s ouuur clclieieentnts’ chaallllennne gggegess

LEADERSHIP – We pppprririiriddede oouururseseelvlvlvlvlvvveeeseseses on taakikikkikikikikikingngggngngngngnggg aaaaaaaactctctctctctccc ioioioioi nsn that keep usus iinnnnnnn ttthththe forefront

PROFESSIOOONONNNAAAAAALISSSSM – We deliver wwwwhahahat t wewe pprooromimimimimisesesese

PERFORRRRRMMMMAMAMANNNCE – WeWeWeWeWeWeeWee dddddddddddddddrirrrr ve resullltstsstt tthrough tthehe skskskkkilililillllllsl aaaandndndndnn cccoommmmmmimittmmmmemeeeeeeeem ntnnnnnn of ouuurr r ppeoplee

ge

oououourrrr MMMMMMMIISSSSIIOONNissss tttoooo o dddedevelop and deliver

GAGAAMMMME-CHANGINGGAGAAGGAMMME-C solutions

enable our clients towwwhwhwhicich e

E THE MANAGEMENT OOOOOPTIMIZE

D DEVELOPMENTAND

of their assets.o

VISION, MISSION AND VALUES

our VVVVISIONNNNis too TTRRRRANSFORMMMM the

upupststrereaammmmm oil and gggaas indus-

try suchh,,, ttthht at it beeccoomes SAFER

and mooooorrrere SUSTAAAIAINABLE while

aaaachievinnngg higher

RECCCOOVERY.


STRATEGYWelltec® has a simple, coherent strategic concept and

framework.

Our Vision

Welltec’s unique perspective is to transform the upstream oil

and gas industry such that it becomes safer and more sustain-

able while achieving higher recovery.

Our Mission

Our mission, therefore, is to develop and deliver game-chang-

ing solutions, which allow our clients to optimize the manage-

ment and development of their assets.

Our Values

We hold and adhere to a constant set of values that resonate in

our everyday work:

Disruptive Innovation

We move with courage to challenge conventional thinking

Client Dedication

We do what it takes to completely address our clients’

challenges

Leadership

We pride ourselves on taking actions that keep us in the

forefront

Professionalism

We deliver what we promise

Performance

We drive results through the skills and commitment of our

people

Together, our mission and values create a core guiding philoso-

phy that embodies what Welltec® stands for. This is the corner-

stone of our success and provides the constant unifying ele-

ment as we strive to realize of transforming the oil and gas

industry.

Welltec® is strategically focused on driving the company’s

growth through continued development on four strategic

themes: Growth, Strength, Position and Profitability.

Growth

We believe that challenging conventional solutions will con-

tinue to allow us to deliver disruptive technology that adds

significant value for our clients. Coupled with improved service

delivery and responsiveness to our client’s needs, we will de-

liver growth in several key regions:

• Scandinavia: Welltec® will continue to leverage on the

long-standing relationships with our largest clients, which

provide both the impetus and pathway for introducing

new solution concepts to them as well as their peers in the

Norwegian Sea.

• Americas: Our value proposition allows for continued

growth in the highly competitive onshore markets. The cur-

rent footprint in the conveyance market for unconventional

oil and gas plays in North America provides the platform for

further client penetration with higher-value services such as

milling, cleaning and mechanical services that continue to

be served by conventional technologies. Increased penetra-

tion in the Gulf of Mexico and in offshore Latin America

constitute a potential for significant growth in the majority

of offerings.

• Europe, Russia and CIS (ERC): Welltec® will seek to

MANAGEMENT EXPECTS CONTINUED GROWTH IN REVENUESAND MAINTAINED EBITDA MARGINS IN 2014

GROWTHOour VISION

is to TRANSFORM the up-

stream oil and gas industry such,

that it becomes SAFER and more

SUSTAINABLE while achieving

higher RECOVERY.YY


accelerate the uptake of its services in some of the emerg-

ing territories, such as the Caspian where international

access and production continues to increase. In Continen-

tal Europe and the more established markets, Welltec® will

increase its market share through growth in more complex

services, such as riserless well intervention services (RLWI) in

the North Sea.

• Africa: Continued business development with the region’s

dominant international oil companies will provide the main

driver of growth, leveraging on key direct contract awards

• Middle East: Welltec® remains committed to pursuing con-

tinued collaborations and contracts in Saudi Arabia as well

as further opportunities throughout the region. Many of

the national oil companies continue to express sustained in-

terest in our products, particularly in UAE, Qatar and Oman.

• Asia Pacific: Welltec® plans to capitalize on the considerable

market growth potential, both through increased penetra-

tion of existing clients in Malaysia and India, and further

penetration of new clients the south of the region, adding

new business in Indonesia and Australia.

Strength

We plan to continuously strengthen our business and opera-

tional models to provide better services in a way that endorses

long term relationships with our customers. Working more

closely with our customers over longer periods of time ensures

not only a more stable revenue stream but also allows Welltec®

to develop faster and more accurate solutions to meet our

customers’ challenges; thereby perpetuating the value cycle.

We have begun several projects which support this initiative,

including:

• Expansion of our service offerings and product ranges to

broaden our portfolio and reduce dependency upon any

single service or solution;

• Establishing more direct, contractual ties with our custom-

ers as well as longer duration agreements which secure

more planned, dedicated work;

• Streamlining our organizational structure to reflect our

value chain, and thereby matching a global, company-wide

integration of services where roles, responsibilities and

interactions between different parts of the organization are

being clarified to improve performance;

• Recruiting and retaining engineering and management

talent;

• Introducing scalable structures and procedures across our

organization that support our growth, primarily through le-

veraging our already established IT-driven infrastructure and

ensuring that knowledge is built into the structure of the

organization rather than depending on specific individuals;

• Patenting our technology and protecting our intellectual

property and proprietary know-how.

Position

Welltec® is focused on providing unique solutions and avoiding

those markets where services are effectively commoditized. We

intend to attract and satisfy more reference customers through

a focus on global account management, increasing the skill

sets of our current account managers, maintaining our focus

on direct customer relationships and by accelerating the rate of

technology replacement to our offerings across all geographies.

We pursue and maintain strategic partnerships with other ser-

vice providers, such as selected wireline providers, vessel provid-

ers and technology companies, where our combined offerings

BROADEN OUR PORTFOLIO AND REDUCE DEPENDENCY UPON ANY SINGLE SERVICE OR SOLUTION

STRENGTH &POSITION


can be presented to clients as a complete solution. Welltec® can

therefore leverage on both direct client relationships to act as

lead contractor as well as serve as subcontractor to strategic

partners.

Furthermore we actively engage in developing new solution

concepts that addresses our customer’s largest challenges, such

as RLWI for subsea wells, plug and abandonment of wells and

open-hole intervention services in horizontals that require inte-

grated, specialized solutions and equipment. These solutions

provide significant value to our customers as they enable them

to redefine the manner in which they operate and establish

new industry standards. We believe the value creation this de-

livers for our clients will be rewarded through an increase in our

own business. Overall, Welltec’s goal is to maintain its position

as a top provider of the current offerings while simultaneously

providing unique, new solutions in other segments. Our pipe-

line of new service and product initiatives are aimed at develop-

ing a diversified and growing business in terms of revenues and

margins in 2014 and beyond.

Strong market fundamentals support the increasing demand

for well intervention services. The market remains advanta-

geous and our clients continue to embrace our technology and

the services and solutions we provide. While increased activity

in our segments by large service companies may create short

term challenges, it also brings a welcomed boost in driving the

industry’s adoption of our technology and in doing so signifi-

cantly increases the addressable market. It also represents a sig-

nificant endorsement of the robotic well intervention technol-

ogy we have pioneered.

Profitability

Optimizing on costs is an integral part of creating value for our

clients and we are proactively looking for more effective and ef-

ficient ways to deliver without impairing the exceptionally high

standards of our operations. Cost-consciousness in conjunction

with providing solutions which serve to optimize production se-

cures high margins and ensures financial strength for continued

expansion.

The financial goals for growth and profitability enable continual

investments in line with the company’s strategies to strengthen

Welltec’s position and ultimately deliver its mission.

COMPETITIVE STRENGTHS

Global presence

Over the last decade, operational and capital expenditure by oil

and gas companies has increased. Welltec® expects this trend

to continue given the ongoing efforts to improve production

from existing fields and search for new reserves. Forecast spend

for the major oil and gas companies is up and this trend will

favor companies such as Welltec® that have advanced and dif-

ferentiated technological offerings covering all phases of the

well lifecycle.

From a global perspective, oil fields are maturing and new dis-

coveries are not keeping pace with declines or demand consid-

eration. This combination of increasingly mature fields, reduced

quantity and size of new discoveries and increasing global

WE PURSUE STRATEGIC

PARTNERSHIPS WITH OTHER

SERVICE PROVIDERS, SUCH

AS SELECTED WIRELINE PRO-

VIDERS, VESSEL PROVIDERS AND

TECHNOLOGY COMPANIES, WHERE OUR

COMBINED OFFERINGS CAN BE PRESENTED TO

CUSTOMERS AS A COMPLETE SOLUTION.

our MISSIONis to develop and deliver GAME-

CHANGING solutions which

enable our clients to OPTIMIZE THE

MANAGEMENT AND DEVELOPMENT

of their assets.


demand represents a huge challenge for all. Welltec’s expec-

tations are that our value proposition of developing methods

for increased reservoir optimization will resonate with our cus-

tomer’s around the world as they seek to increase the life span

of existing fields.

New discoveries are increasingly being made in areas present-

ing significant operational complexity for exploration and de-

velopment. Almost half of all newly discovered oil reserves

since 2000 have been made in offshore deep-water or ultra

deep-water. An increasing portion of new supply is also com-

ing from unconventional reserves (such as shale gas or shale oil)

adding further complexity in the form of more horizontal well

designs. The shift in discoveries and resource types have also

increased the technical risk of projects and the requirements

of the equipment and services necessary to handle these more

challenging operating conditions, which have also driven the

need to use advanced technologies in well intervention. It is

our experience that oil and gas companies are becoming more

likely to work with suppliers of high-quality services as they de-

liver a higher long-term value. With the increased complexity

and costs of new discoveries, well interventions have become

an attractive economic proposition compared to exploring for

new reserves. Welltec’s technology, which has a proven record

of successful operations in these environments, will continue to

be in demand.

TECHNOLOGY

Superior offering

The increased focus on enhancing oil and gas recovery rates

and improving well profitability has led to an increasing indus-

try acceptance of Welltec’s robotic technology.

Well intervention services increases well profitability through

increased recovery rates and cash flow from production. Given

the challenges of sustaining oil and gas production to meet de-

mand we expect the well intervention market will grow signifi-

cant in the coming years. Due to its superior performance, we

expect robotic technology to grow even faster than the market

for conventional intervention technologies, and gradually even

replacing older methods. Robotic intervention technology is su-

perior to these conventional methods because it is:

• safer given its smaller footprint and lower number of per-

sonnel involved, leading to significant health and safety

advantages for our customers;

• less intrusive because it requires a smaller set up space and

a more limited amount of equipment to be inserted into

the well, typically resulting in less damage to the well;

• an order of magnitude faster than conventional methods

due to deployment and rig up times; and

• more cost efficient, both in terms of lower direct in-

tervention costs and lower future costs for subsequent

interventions.


Market Leader

We pioneered the well intervention services market with our

robotic technology. Our technological leadership has been rec-

ognized by both customers and industry associations, and we

have been awarded a number of industry awards annually. We

have also accumulated a long list of “firsts” for our intervention

solutions within the industry and hold the majority of World

Records for the operations we perform, including deepest well

intervention, highest deviation well intervention, deepest wa-

ter depth intervention using RLWI, most footage tractored on

one trip to the well site, et al.

To maintain our leading position and further grow our business

we continue to focus on technological innovation. We often

work in conjunction with our clients on developing new ap-

plications and tools in order to solve specific needs of our cus-

tomers. This enables us to develop a deep understanding of

our customers’ business requirements and the challenges they

face while strengthening our relationships with them. We de-

vote considerable time and resources to development and engi-

neering, and are working on several projects to deliver the next

generation of tools and solutions.

Hand-in-hand with our dedicated efforts on technology inno-

vations, we vigorously protect our intellectual property. In 2013

alone, 144 patents were issued and we now have in the region

of 2,500 forecasted patents based on patent families at various

stages of registration or application. Welltec® operates a com-

prehensive program to protect critical intellectual property and

proprietary know-how, comprising the following internal pro-

tective barriers (the list is not exhaustive):

• Physical restrictions on access to and restrictions on record-

ing and photographic activities on Welltec® facilities;

• Application of various encrypting measures and the use of

either specially adapted or internally developed software

• Limited access to view, print and distribute technology blue-

prints and other sensitive documentation, with none, or

distorted, drawing specs on externally distributed drawings;

• Extensive IT-system log on access and security measures,

combined with limited off-site access and remote deletion

of sensitive information on lost IT-hardware;

• Extended use and tracking of non-disclosure agreements,

disclaimers and confidentiality agreements;

• Rigorous patenting of certain technology advances in rel-

evant countries and associated patent prosecution.

These measures are in place to avoid unintended dissemina-

tion of our trade secrets, know-how and sensitive information

in general.

We believe that our leading position will be maintained and

our business will grow as a consequence of our commitment

to quality in execution and customer service. In the oil and gas

service industry, technical reliability and overall service qual-

ity are paramount factors in customers’ purchasing decisions.

Through continuous evolution and improvement of work pro-

cesses, Welltec® offers superior service quality, as reflected in

the achievement of a 96% ratio of runs to misruns, which is

the generally accepted industry measure of service quality.

RISKS

Risks Related to Our Business

Business and industry related risks

While we believe our business to be relatively unaffected by

macro-economic factors, it is ultimately affected by the level of

expenditures of companies engaged in the production, explo-

ration and development of oil and gas.

Cyclical market

The oil and gas industry is cyclical and while demand for

Welltec’s services is primarily dependent on customer’s operat-

ing expenditures, demand for Welltec’s services also depends

somewhat on the capital expenditures of customers. A de-

crease in operating expenditures may have adverse effects on

Welltec’s revenue and profits in the shorter term, while a de-

crease in the capital expenditures may have adverse effects on

Welltec’s revenue and profits in the longer term.

Customers

Welltec’s clients are typically not required to make minimum

purchases under sales contracts and customers can typically

terminate contracts without cause and on short notice. Not-

withstanding our broad customer base, Welltec® have one cus-

tomer that accounted for more than 16% of our revenue, and

loss of the trading relationship with this customer would have

an adverse effect on our revenue and profits. As such, visibility

with respect to future revenues is limited and there can be no

assurance that a trading relationship with important customers

will continue.


Competitors

Welltec® competes with large multinational companies that can

offer integrated services which Welltec® cannot offer. Further,

Welltec are, to some extent, dependent on equipment provided

by our competitors and such competitors could restrict us from

accessing wells using their equipment. In general, competition

can result in pricing pressures, lower sales and reduced mar-

gins that could have an adverse effect on Welltec’s revenue and

profits.

Operational risks

Service quality

Welltec’s ability to provide a high quality product and service

provision is of importance in respect of securing repeat sales

with new and existing clients. Our service quality can be nega-

tively affected by an inability to attract, train and retain highly

skilled and qualified personnel to develop, manufacture and

operate our equipment, with an adverse effect on Welltec’s

revenue.

Supply chain

Welltec® may experience constraints, anomalies or interruptions

in our supply chain, restricting Welltec’s ability to provide the

service or product in alignment with the expectations of the

customers. Such constraints may be due to supply chain bottle-

necks, delays or disruptions in clearing goods from customs or

events restricting Welltec’s ability to procure, develop or manu-

facture new equipment or spare parts or maintain the existing

fleet, and such could negatively affect our results of operations.

Catastrophic events

Welltec’s business operations could be subject to various cat-

astrophic events, including blow outs, explosions, damage to

or loss of third party property, injury to personnel, reputational

damage and oil and hazardous substance spills into the envi-

ronment, both on and off shore. Such events could, if the im-

pact of such event is not covered by Welltec’s insurance or are

not subjected to Welltec’s contractual indemnification protec-

tion, have an adverse effect on Welltec’s revenue and profits.

Financial risks

Financial exposure

Due to Welltec’s foreign activities and credit facilities in foreign

currencies, its profit/loss, cash flows and equity are affected by

changes in exchange rates and interest rates for a number of

currencies.

Foreign exchange fluctuations

The reporting currency of the group is US Dollars and the func-

tional currency for most of the group’s subsidiaries is that of

the country in which the subsidiary is domiciled. The functional

currency of the Danish operation and operations in some other

countries is US dollars. This reflects the revenue and principal

source of financing. A significant proportion of the group’s rev-

enues, expenses and other liabilities are denominated in curren-

cies other than the US Dollar, in particular Norwegian Kroner,

Danish Kroner and Canadian Dollar. Fluctuations in the value of

other currencies as compared with the US Dollar could result in

translation losses or gains.


Taxes

Welltec® files income tax returns in multiple jurisdictions.

Welltec’s effective tax rate could be adversely affected by sev-

eral factors, including changes in the income taxed by or al-

located to the various jurisdictions with differing statutory tax

rates; changing tax laws, regulations and interpretations of

such tax laws in multiple jurisdictions; and the resolution of is-

sues arising from tax audits or examinations together with any

related interest or penalties. The determination of local tax li-

ability is always subject to review or examination by authori-

ties in operating jurisdictions. If a tax authority in any jurisdic-

tion reviews filed tax returns and based on filing proposes an

adjustment, including adjustments of transfer prices and terms

applied, such an adjustment could have a negative impact on

Welltec’s net profit.

Liquidity risk

Welltec’s ability to make payments on and to refinance our in-

debtedness and to fund planned capital expenditures and oth-

er strategic investments will depend on our ability to generate

cash in the future. This, to a certain extent, is subject to gen-

eral economic, financial, competitive, legislative, regulatory and

other factors that are beyond our control. Welltec® expects to

continue making capital investments in order to develop and

purchase additional equipment to expand our services, increase

our capacity and replace existing equipment. Such capital in-

vestments require cash that could otherwise be applied to oth-

er business needs. However, if Welltec® does not incur these

expenditures while our competitors make substantial invest-

ments, our market share may decline and our business may be

adversely affected.

Legal risks

Regulatory

Welltec® conducts business in multiple jurisdictions in a highly

regulated industry. As such, Welltec® is directly or indirectly,

subject to a variety of federal, provincial, state and local laws,

regulations and guidelines, in all such jurisdictions, including

laws and regulations relating to health and safety, the conduct

of operations including business ethics and trade compliance,

taxation, the protection of the environment and the manufac-

ture, management, transportation and disposal of certain ma-

terials used in operations. Accordingly, Welltec® could become

subject to liabilities relating to the violation of such regulations

in multiple jurisdictions, with an adverse effect on the profits.

Technology

Welltec® is a technology company, constantly challenging the

operational boundaries in the industry. However, third parties

may assert that our products, services, solutions and other in-

tellectual property may infringe, on their proprietary rights. Any

such potential future claims, regardless of merit, could result in

multi-jurisdictional litigation, which could result in substantial

expenses, causes significant delays and materially disrupt the

conduct of business and have an adverse effect on our financial

condition and results of operations.

CORPORATE GOVERNANCE

Welltec® aims to establish, maintain and operate a corporate

governance system that is compliant with best practice, rec-

ognized governance principles sufficient to satisfy the require-

ments of a public Danish company.


CORPORATE SOCIAL RESPONSIBILITY

The following statement of Corporate Social Responsibility

(CSR) pursuant to the Danish Financial Statements Act Section

99a is part of the Management’s Commentary in the Annual

Report 2013.

Corporate Social Responsibility Policy

Welltec® focuses its CSR efforts on areas and issues directly af-

fecting our business. We have outlined our responsibility in po-

lices developed to comply with the objectives of CSR and ap-

proved by the Board of Directors. These principles are reviewed

on a regular basis and updated against relevant codes of cor-

porate governance and international standards, including the

UN’s Universal Declaration of Human Rights, the ILO’s Declara-

tion on Fundamental Principles and Rights at Work, the OECD’s

Guidelines for Multinational Enterprises, the Rio Declaration

on Environment and Development, the UN Convention against

Corruption, as well as applicable legislation governing the in-

terest of our stakeholders.

In 2013 the Board has adopted a new code of conduct to sup-

port the CSR initiatives. The areas currently covered by CSR pol-

icies are: (i) Business Ethics, (ii) Anti-Corruption, (iii) Health and

Safety, (iv) Environment, (v) Employment, (vi) Customers, and

(vii) Community.

The responsibility of monitoring overall CSR compliance has

been delegated to the heads of Legal, Human Resources, QHSE

(Quality, Health, Safety, and Environment) and Commercial De-

partments. Key performance indicators are regularly monitored

and appropriate audits are performed and followed up.

The policies have been incorporated into our code of conduct

and continue to be communicated to all employees. It is acces-

sible on both our website and intranet. Moreover, a concert-

ed effort is made to ensure that these are deep rooted in our

thinking and our way of doing business.

Business Ethics

Policy

At Welltec® ‘we say what we do and we do what we say’.

This principle is the back bone of Welltec’s Code of Conduct

and promotes certainty in relation to all our stakeholders that

predictability and reliability are the norm when dealing with

Welltec®. It is our policy to comply with all governmental laws,

rules and regulations applicable to our business and we strive

to follow the course of action leading to the highest degree of

integrity in situations where the law may be permissive.

Implementation

Integrity and ethical conduct is a fundamental part of manage-

ment procedures and Welltec´s Code of Conduct and is an un-

derlying driver in all we do. The methods we employ to attain

results are as important as the results themselves.

Welltec® employees are expected to perform their work with

honesty, truthfulness and integrity, and conduct their business

affairs fairly. All employees are responsible for the immediate

and accurate reporting to higher management of work-relat-

ed information of importance to the governing guidelines. We

strongly encourage dialogue to make each other aware of situ-

ations that give rise to ethical questions and to articulate ac-

ceptable ways of handling those situations.

Key results in 2013 and future plans

Welltec® has performed appropriate internal investigations into

possible non-ethical behavior by employees following internal

controls or whistle-blowing. We have in continuation of the

investigative findings applied consequences towards the em-

ployees when relevant and further strengthened internal com-

munication in respect of compliance programs.

To improve our efforts to facilitate sound business ethics, we

applied in August 2012 for permission from the Danish author-

ities to establish a formalized whistle-blower program, which

we expected to launch in 2013. In January 2014 the Danish

authorities have issued permission to establish a formalized

whistle-blower program.

Anti-Corruption

Policy

Our conviction to uphold ethical standards in all our corporate

activities is a common mind-set of all our employees and we

strive to do business with customers and suppliers of sound

business character and reputation. We have strict guidelines

covering facilitation payments, bribery, entertainment and

gifts, and our screening processes provide full transparency to

mitigate the risk of corruption.


Implementation

Welltec® maintains a general Partner Screening Program appli-

cable for agents, representatives and joint venture partners in

territories where transparency and corruption are imminent is-

sues. This comprises a questionnaire combined with a review

process under which a potential partner is vetted for undue

relationships and channels of influence.

Furthermore, Welltec® operates a zero-tolerance policy towards

corruptive behavior of employees and representatives. Any indi-

cation implying corruption will immediately trigger an internal

investigation led by the Legal Department and supplemented

by the HR Department.


One screening was performed in 2013 and the partnership is

still being considered.

We have strengthened our screening abilities by the application

of external screening partners and their databases.

We expect to initiate a new Anti-Bribery and Corruption pro-

gram and supplement the implementation with an employee

training program. We will continue to improve the screening

procedures, review processes and further incorporate addi-

tional FCPA (Foreign Corrupt Practices Act) based initiatives.

Furthermore, we continue to monitor the initiatives and guide-

lines issued by OECD (Organization for Economic Cooperation

and Development) and Transparency International to identify

policies and procedures that could improve our anti-corruption

measures.

Health, Safety and Environment (HSE)

Policy

Our paramount concern is the health and safety of our employ-

ees, customers and everyone else that comes into contact with

our activities. This concern reaches far beyond such measures

required under applicable law. Health and safety underpins all

our operations and we continuously monitor HSE performance

and work to identify improvement initiatives. All our employees

are aware that the safety of people and protection of the envi-

ronment is an absolute priority.

Implementation

HSE is an integral part of decision-making, processes and train-

ing. Comprehensive incident reporting systems are in place to

review and address:

• Any injury or near miss in relation to our activities. Perfor-

mance statistics are kept and analyzed to ensure adoption of

best practices protecting the health and safety of individuals.

• Any unintentional discharge into the environment of dam-

aging substances or near misses in relation to one of our

operations. These are carefully analyzed to ensure adoption

of best practices in order to protect the environment to the

benefit of us all.

Weekly corporate management meetings are opened with a re-

view on any health and safety issues which may have occurred.

All locations have an HSE Officer employed to lead the HSE ef-

fort, ensure compliance with Welltec’s policies and local legisla-

tion and conduct monthly meetings where all employees are

required to attend.

All new hires attend an HSE introduction program and we oper-

ate a Safety Card Observation Program (SCOP) to report on and

encourage safe working practices.

As part of Welltec’s commitment to manage climate change

SCOP CARD

DESCRIPTION OF OBSERVATION

DISCUSSION AND AGREED ACTION

FOLLOW-UP / REMARKS

Observer’s Name

Date (Month/year)

Country

Client

Job ID

Place

Unsafe observation Safe Near miss (CA only)

What (code )

Why (code )

Yes No

Follow-up required

All new hires

attend an HSE

introduction

program and we

operate a Safety

Card Observa-

tion Program

(SCOP) to report

on and encour-

age safe working

practices.


impacts, Welltec’s facilities are audited by the relevant Munici-

pality, Nature and Environment Auditor. At any local operation,

we ensure that respect for the environment is applied such

that sustainability and recycling is promoted and secured to

the greatest extent reasonably possible, while at the same time

closely monitoring consumption of chemicals, waste, electric-

ity, heat and water.

The corporate QHSE function performs internal HSE audits at

the headquarters and local bases worldwide in order to assess

the effectiveness of the internal QHSE Management System of

Welltec. The audits are the prime instrument for reviewing the

business interfaces internally between HQ and bases, and ex-

ternally with customers, and create specific action points for

the cycle of continuous improvement.


Only five small environmental accidents occurred, where the

spill is less than 1kg, and four of them were fully recovered.

Respect for and preservation of the environment is a key ele-

ment of our business proposition.

Despite the growth in activity, Welltec® experienced no change

in the total number of Medical Treatments (MTO) and Restrict-

ed Work Case Frequency (RWC/RWCF), and only an incre-

mental increase in Lost Time Incidents (LTI), while Vehicle Ac-

cident Frequency (VA/VAF). This followed an increased focus on

strengthening the vehicle safety culture through training and

the implementation of processes designed to share knowledge

and analyze trends and root causes. There were no Fatalities

(FTL) in 2013 or previously

A worldwide survey of Safety Culture assessing the physical and

psychological work climate did not indicate any major issues,

and subsequent action plans have been drawn up to oversee

improvements in the physical workplace within each sector.

Quality is and has always been deeply ingrained in all processes

at Welltec®. Welltec® is ISO 9001 certified by Det Norske Veritas

(DNV) with periodic re-certification audits every 3 years.

Furthermore, oil operators, service partners and authorities

perform external audits to assess Welltec’s ability to effectively

manage the hazards associated with the services provided. In

2013, Welltec® Denmark was audited by DNV and local bas-

es were audited by Petrobras, BHP, BP, Chevron, and Statoil,

among others. None of these audits resulted in significant

remarks.

2009 2010 2011 2012 20130

2

4

6

8

10

MTO LTI RWC FTL

NUMBERS OF INCIDENTS

INCIDENTS FREQUENCY

2009 2010 2011 2012* 2013*0

1

2

3

4

5

Inci

dent

s pe

r 20

0,00

0 w

orki

ng

hour

s

MTOF LTIF RWCF TRCF

VEHICLE ACCIDENTS

0

5

10

15

20

25

2009 2010 2011 2012* 2013*0.0

0.2

0.4

0.6

0.8

1.0

VA p

r. 2

00.0

00 k

m

VA VAF

Employment

Policy

Welltec® believes that its employees, both as individuals and as

part of a team, are the most important assets of the business.

Hence, and with due consideration to the often challenging

working conditions in the field, applies measures which ‘go

beyond the norm’ to safeguard and maximize the health and

safety aspects of the employees performing their duties.

Welltec® recognizes a shared responsibility on behalf of all em-

ployees to exercise the human rights principles of mutual re-

spect and dignity in all working relationships and consequently

enforces a policy of zero tolerance with regard to harassment

or discrimination.

*All incidents from 2012-2013 have been re-evaluated to align with industry standards


In 2013, as a natural extension of previous practice, the board

of directors adopted a Diversity and Equal Opportunity Employ-

ment Policy. The policy formalizes our commitment to always

choosing the best person for the job regardless of that person’s

race, color, religion, disability, gender, sexual orientation, age or

nationality. Furthermore, Welltec® will actively work to increase

the share of females in management positions, for example, by

putting the needed extra effort into identifying relevant female

candidates when recruiting.

Implementation

Welltec® actively recruits employees from many sources, includ-

ing first-tier academic institutions as well as leading companies

in the industry, depending on the requirements of a given posi-

tion. A variety of objective profiling tools are used to help as-

sess the candidates. Furthermore, we actively encourage mobil-

ity and career progression within Welltec®.

Welltec® operates an extensive in-house training program cov-

ering core operational aspects as well as sales skills and pro-

grams aimed at legal compliance. Participation is registered

and tracked in the HR system, enabling on-going identification

of training needs and supporting work-force planning.

For long-term ill employees, we work closely and actively with

local authorities and community centres in order to define indi-

vidual solutions, including definition of flex jobs (permanently

reduced work time), temporarily reduced work time, redefini-

tion of work area, etc.

Our workforce

The employee population is very diverse with respect to na-

tionalities, reflecting the truly global nature of the company. As

such there are around 50 nationalities employed in Welltec®.

As is common in the oil industry, the share of females is low in

Welltec®. Women make up 12% of the total employee popu-

lation and 8% of management level employees. There are no

women on the Board of Directors.


During the year, more than 200 employees have received in-

ternal training in the areas of Field Engineer courses, special

equipment courses, Project Management courses, sales train-

ing etc.

2013 has seen the launch of several new initiatives on the HR

front. A standardized on boarding program has been launched

for all staff worldwide. A single HR system has been imple-

mented globally. As intended, this enables greater consistency

in data, workforce transparency and supports the continued

implementation of uniform and streamlined processes. Further,

Employee Self Service was launched in late 2013.

All five employees that have been long-term ill during 2013

have benefitted from the individual solutions Welltec® provides.

12 % vs. 88 % of all employees

50NATIONALITIES

EMPLOYED


Welltec® will continue to improve in the area of employment.

Plans for 2014 include implementing a standardized approach

to performance management worldwide and increasing trans-

parency to employee competencies beyond those captured

today.

In 2013 Welltec® saw one incident in violation of the Diversity

and Equal Employment Opportunity Policy. The matter was in-

vestigated and appropriate disciplinary actions and reinforce-

ment of policy were applied.

Also during 2013 Welltec® initiated the Welltec Fellowship

which enables the retention of senior employees at or beyond

age of retirement, which have recognized industry experience

for internal and external training, coaching and marketing in

Welltec´s interests.

Welltec® will also continue to evaluate ways to increase the

share of females in management and expect to report on the

results of this following 2014. Furthermore, the board of direc-

tors has set the goal of having at least one female member of

the board of directors by April 1, 2017.

Customers

Policy

Welltec® views customers as business partners and pursues an

open and transparent relationship characterized by frequent

dialogue and a focus on serving their best interests.

It is our policy to provide solutions that excel in quality, con-

form to industry best practice and adhere to responsible

standards of performance, including taking due care and

consideration to protection of the environment and the health

and safety of all people involved.

We operate an open door policy in situations where a custom-

er or regulatory body wishes to investigate a non-successful

operation or an issue of regulatory non-compliance. All non-

optimal or non-compliant findings from the internal Welltec®

investigation are openly disclosed to achieve maximum trans-

parency and optimal lessons learned.

0

1,000

2,000

3,000

4,000

5,000

6,000

2011 2012 2013

Run Count Misrun - Welltec

SERVICE QUALITY

SERVICE QUALITY

90%

92%

94%

96%

98%

100%

2011 2012 2013


Implementation

In such situations, a failure investigation is initiated to ensure:

• that investigations requested by the clients are performed;

• that conformed and controlled methods are followed when

handling misruns, covering from job planning, equipment,

procedures, communication to human factors;

• lessons learned are properly communicated throughout the

organization in order to minimize the risk of re-occurrence;

• A failure report is prepared on a timely manner for the cli-

ent, prior to officially closing the investigation.


The overall numbers of customer-requested quality investiga-

tions increased in 2013, with Welltec’s corporate QHSE depart-

ment increasingly involved to ensure the highest standards are

applied to match heightened expectations from customers as

the scope and complexity of services increase.

A global training program, as part of the Welltec® Academy,

serves to increase expertise in the use of our operational plan-

ning software to ensure continuous improvement of service

quality on jobs performed. The program underlines the con-

stant focus on maintaining the very highest levels of service

quality and is reflected in the continued service quality delivery

above 95% as compared to a 39% increase in run count with

the growth in activity.

Service Quality (SQ) is derived from the total number of con-

ducted runs as compared to misruns, and defined as:

SQ = (total number of runs – total number of misruns) / total

number of runs.

Welltec® will continue its efforts to minimize the risk of non-

successful operations by communicating lessons learned

throughout the organization and with the customer or regula-

tory body.

The dedication to meeting client objectives and focus on driv-

ing dialogue continues to lead to an increase in the number of

regular customer meetings, with a 25% rise in 2013.

Community

Policy

At Welltec®, we inherently share a responsibility that reaches

beyond our immediate business and has an impact on the in-

terests of all our stakeholders. These encompass not only our

shareholders but also our customers, employees, suppliers,

the local communities in which we operate, as well as the sur-

rounding environment and the human beings occupying it.

Improving the environment in and around our operations is

an integral part of our business. We operate from a significant

number of properties in a variety of countries, and we have re-

sponsibility to our employees, to the people living and working

nearby as well as the environment. It is our policy therefore to

engage with the local community as both a neighbor and resi-

dent and support efforts to improve the local area, for example

by addressing antisocial behavior, crime and vandalism as well

as promoting road safety.

Implementation and future plans

We will actively promote engagement between our staff and

the community, supporting local community-based projects

and charities, including fund-raising and initiatives for the de-

velopment and education of young people in the areas where

we operate.


STATEMENT BY MANAGEMENT ON THE ANNUAL REPORTWe have today considered and approved the annual report

of Welltec International ApS for the financial year January 1,

2013 to December 31, 2013.

The consolidated financial statements and parent financial

statements are prepared in accordance with International

Financial Reporting Standards as adopted by the EU and addi-

tional Danish disclosure requirements for annual reports.

In our opinion, the consolidated financial statements and the

parent financial statements give a true and fair view of the

group’s and the parent’s financial position at December 31,

2013 as well as of their financial performance and their cash

flows for the financial year January 1, 2013, to December 31,

2013.

We also believe that the management commentary contains a

fair review of the development of the group’s and the parent’s

activities and financial position, together with a description

of the principal risks and uncertainties that the group and the

parent face.

We recommend the annual report for adoption at the Annual

General Meeting.

Allerød, February 27, 2014

Executive Board:

Jørgen Hallundbæk

Chief Executive Officer

Board of Directors:

Søren Jørgensen Scott C. Collins

Chairman

Jørgen Hallundbæk Johannes K. J. Sikkens


Copenhagen, 27 February 2014

Deloitte

Statsautoriseret Revisionspartnerselskab

Anders Dons Martin Faarborg State Authorized State Authorized Public Accountant Public Accountant

INDEPENDENT AUDITOR’S REPORTS

To the shareholders of Welltec International ApS

Report on the consolidated financial statements

and parent financial statements

We have audited the consolidated financial statements and

parent financial statements of Welltec International ApS for

the financial year 1 January to 31 December 2013, which

comprise the statement of comprehensive income, statement

of financial position, statement of changes in equity, state-

ment of cash flows, and notes, including the accounting poli-

cies for the group as well as for the parent. The consolidated

financial statements and parent financial statements have

been prepared in accordance with International Financial Re-

porting Standards as adopted by the EU and additional Danish

disclosure requirements for annual reports.

Management’s responsibility for the consolidated

financial statements and parent financial statements

Management is responsible for the preparation of consoli-

dated financial statements and parent financial statements

that give a true and fair view in accordance with International

Financial Reporting Standards as adopted by the EU and dis-

closure requirements of the Danish Financial Statements Act

and for such internal control as Management determines is

necessary to enable the preparation of consolidated financial

statements and parent financial statements that are free from

material misstatement, whether due to fraud or error.

Auditor’s responsibility

Our responsibility is to express an opinion on the consolidated

financial statements and parent financial statements based on

our audit. We conducted our audit in accordance with Inter-

national Standards on Auditing and additional requirements

under Danish audit regulation. This requires that we comply

with ethical requirements and plan and perform the audit to

obtain reasonable assurance about whether the consolidated

financial statements and parent financial statements are free

from material misstatement.

An audit involves performing procedures to obtain audit evi-

dence about the amounts and disclosures in the consolidated

financial statements and parent financial statements. The pro-

cedures selected depend on the auditor’s judgment, including

the assessment of the risks of material misstatements of the

consolidated financial statements and parent financial state-

ments, whether due to fraud or error. In making those risk

assessments, the auditor considers internal control relevant to

the entity’s preparation of consolidated financial statements

and parent financial statements that give a true and fair view

in order to design audit procedures that are appropriate in the

circumstances, but not for the purpose of expressing an opin-

ion on the effectiveness of the entity’s internal control. An au-

dit also includes evaluating the appropriateness of accounting

policies used and the reasonableness of accounting estimates

made by Management, as well as the overall presentation of

the consolidated financial statements and parent financial

statements.

We believe that the audit evidence we have obtained is suffi-

cient and appropriate to provide a basis for our audit opinion.

Our audit has not resulted in any qualification.

Opinion

In our opinion, the consolidated financial statements and

parent financial statements give a true and fair view of the

group’s and the parent’s financial position at 31 December

2013, and of the results of their operations and cash flows

for the financial year 1 January to 31 December 2013 in ac-

cordance with International Financial Reporting Standards as

adopted by the EU and additional Danish disclosure require-

ments for annual reports.

Statement on the management commentary

Pursuant to the Danish Financial Statements Act, we have read

the management commentary. We have not performed any

further procedures in addition to the audit of the consolidated

financial statements and parent financial statements.

On this basis, it is our opinion that the information provided in

the management commentary is consistent with the consoli-

dated financial statements and parent financial statements.

30 WELLTEC® ANNUAL REPORT 2013 / FINANCIAL STATEMENTS

FINANCIAL STATEMENTS

WELLTEC® ANNUAL REPORT 2013 FINANCIAL STATEMENTS / 31

For the years ended December 31, 2013, 2012 and 2011 (USD in thousands)

NOTE 2013Restated

2012 2011

Revenue 3 321,165 295,387 229,223

Cost of services provided (155,668) (128,326) (97,032)

Gross profit 165,497 167,061 132,191

Development and manufacturing costs 4, 5 (99) (45) (128)

Administrative and sales costs 4, 5 (82,379) (70,162) (64,397)

Amortization of acquired Intangibles in a business combination 5 (10,616) (10,705) (10,657)

Operating profit (EBIT) before special items 72,403 86,149 57,009

Special items 6 (4,698) 0 0

Operating profit (EBIT) 67,705 86,149 57,009

Financial income 7 23,236 1,068 4,628

Financial expenses 8 (49,411) (39,329) (28,778)

Profit before tax 41,530 47,888 32,859

Income taxes 9 (20,887) (23,537) (16,093)

Profit for the year 20,643 24,351 16,766

Other comprehensive income for the year

Items that will be reclassified subsequently to the income statement,

when specific conditions are met:

Unrealized exchange rate adjustments of foreign subsidiaries and

branches (9,342) (3,551) 62

Total comprehensive income 11,301 20,800 16,828

Distribution of profit/loss for the year

Profit for the year attributable to:

Welltec International ApS shareholders’ share of profit 20,654 24,193 17,165

Non controlling interests share of profit / (loss) for the period (11) 158 (399)

20,643 24,351 16,766

Total comprehensive income attributable to:

Welltec International ApS shareholders’ share of comprehensive income 11,312 20,642 17,259

Non controlling interests share of comprehensive income / (loss) (11) 158 (431)

11,301 20,800 16,828

CONSOLIDATED STATEMENT OF COMPREHENSIVE INCOME


As of December 31, 2013 and 2012(USD in thousands)

NOTE 2013Restated

2012

Non-current assets

Intangible assets

Goodwill 242,340 242,340

Technology 61,227 65,927

Customer relationship 18,752 24,499

Brand 13,924 13,924

Completed development projects 56,362 51,117

Development projects in progress 33,784 27,912

Patents and licences 8,737 5,693

Total intangible assets 12 435,126 431,412

Tangible assets

Land and buildings 3,062 2,502

Leasehold improvements 2,786 2,013

Plant equipment and fleet 84,139 59,083

Other fixtures and fittings, tools and equipment 12,994 14,059

Plant equipment and fleet under construction 25,467 27,337

Total tangible assets 13 128,448 104,994

Financial assets

Tax receivables 9 1,382 1,321

Deferred tax assets 20 2,856 2,959

Other receivables 1,764 3.318

Total financial assets 6,002 7,598

Total non-current assets 569,576 544,004

Current assets

Inventories 16 2,476 1,733

Receivables

Current portion of non-current assets 2,120 2,120

Trade receivables 17 83,361 85,329

Tax receivables 9 2,070 1,924

Other receivables 6,630 9,902

Prepayments 18 7,151 5,150

Total receivables 101,332 104,425

Cash and cash equivalents 38,812 41,985

Total current assets 142,620 148,143

Total assets 712,196 692,147

CONSOLIDATED STATEMENT OF FINANCIAL POSITION


As of December 31, 2013 and 2012(USD in thousands)

NOTE 2013Restated

2012

Equity

Share capital 19 824 787

Currency translation reserve (12,835) (3,493)

Retained earnings 291,351 249,842

Equity attributable to equity holders of the parent 279,340 247,136

Non-controlling interest (725) (714)

Total equity 278,615 246,422

Non-current liabilities

Deferred tax liabilities 20 55,045 51,328

Finance lease commitments 21 1,561 1,072

Issued bonds 21 309,786 308,063

Other non-current liabilities 420 5,231

Total non-current liabilities 366,812 365,694

Current liabilities

Current portion of non-current liabilities 21 1,349 2,165

Payables to affiliates 354 1,186

Trade payables 15,414 18,897

Current tax liabilities 6,865 11,943

Other payables 22 42,787 45,840

Total current liabilities 66,769 80,031

Total liabilities 433,581 445,725

Total equity and liabilities 712,196 692,147

CONSOLIDATED STATEMENT OF FINANCIAL POSITION


For the years ended December 31, 2013, 2012 and 2011

(USD in thousands)

Share capital

Currency translation

reserveRetained earnings

Non-control-ling interest Total

Equity at 31 December, 2011 817 58 314,630 (872) 314,633

Profit/loss for the year 0 0 24,193 158 24,351

Unrealized exchange rate adj. of foreign subsidiaries and branches 0 (3,551) 0 0 (3,551)

Total comprehensive income for the year 0 (3,551) 24,193 158 20,800

Purchase of own shares 0 0 (62,207) 0 (62,207)

Sale of own shares 0 0 4,676 0 4,676

Dividend 0 0 (34,500) 0 (34,500)

Capital increase 30 0 821 0 851

Capital decrease (60) 0 60 0 0

Share-based payment to executives 0 0 2,169 0 2,169

Other transactions (30) 0 (88,981) 0 (89,011)

Equity at 31 December, 2012 - Restated 787 (3,493) 249,842 (714) 246,422

Profit/loss for the year 0 0 20,654 (11) 20,643

Unrealized exchange rate adj. of foreign subsidiaries and

branches 0 (9,342) 0 0 (9,342)

Total comprehensive income for the year 0 (9,342) 20,654 (11) 11,301

Sale of own shares 0 0 1,416 0 1,416

Purchase of own shares 0 0 (33,202) 0 (33,202)

Capital increase 37 0 45,928 0 45,965

Capital increase cost 0 0 (1,884) 0 (1,884)

Share-based payment to executives 0 0 2,710 0 2,710

Tax credit related to share option scheme 0 0 5,887 0 5,887

Other transactions 37 0 20,855 0 20,892

Equity at 31 December, 2013 824 (12,835) 291,351 (725) 278,615

CONSOLIDATED STATEMENT OF CHANGES IN EQUITY


For the years ended December 31, 2013, 2012 and 2011 (USD in thousands)

NOTE 2013Restated

2012 2011

Operating profit (EBIT) 67,705 86,149 57,004

Non-cash adjustments 10 55,149 46,606 50,043

Changes in working capital 11 (7,554) (30,376) (11,873)

Income taxes paid (16,465) (13,291) (12,279)

Other receivables, long-term 1,554 1,390 1,601

Other payables, long-term (249) 4,334 (590)

Cash flows from operating activities 100,138 94,812 83,905

Investments in intangible assets (33,818) (28,603) (28,116)

Investments in tangible assets (52,020) (43,839) (33,009)

Sale of tangible assets 442 229 (88)

Financial income received 1,241 1,004 557

Acquisition of activities (1,797) (7,464) 0

Cash flows from investing activities (85,952) (78,673) (60,656)

Financial expenses paid (30,849) (15,387) (9,311)

Other financial expenses (1,455) (10,616) (3,823)

Derivative financial instruments 0 (6,226) (1,268)

Dividend paid out to shareholders 0 (34,500) 0

Purchase of own shares (33,202) (62,207) 0

Sale of own shares 5,377 752 0

Proceeds from issued bonds 0 316,583 0

Proceeds from non-current debt 14,976 0 0

Installments on current and non-current debt (17,419) (176,850) (12,093)

Capital increase 45,965 851 0

Costs related to capital increase (1,884) 0 0

Cash flows from financing activities (18,491) 12,400 (26,494)

Increase / (decrease) in cash and cash equivalents (4,305) 28,538 (3,244)

Cash and cash equivalents at beginning of period 41,985 13,447 16,691

Exchange rate adjustment at beginning of period 1,132 0 0

Cash and cash equivalents at 31 December 38,812 41,985 13,447

CONSOLIDATED STATEMENT OF CASH FLOWS


TABLE OF CONTENTS, NOTES – GROUP

1. Accounting policies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37

2. Critical accounting judgments and key sources of estimation uncertainty . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44

Statement of comprehensive income

3. Revenue. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44

4. Staff costs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45

5. Depreciation, amortization and impairment losses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

6. Special items . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48

7. Financial income . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49

8. Financial expenses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49

9. Income taxes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50

Statement of cash flows

10. Non-cash adjustments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51

11. Changes in working capital . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51

Statement of Financial position

12. Intangible assets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52

13. Tangible assets . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54

14. Investments in subsidiaries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55

15. Investments in associates . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56

16. Inventories . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56

17. Trade receivables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57

18. Prepayments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58

19. Share capital . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58

20. Deferred tax assets and liabilities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59

21. Current and non-current financial liabilities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60

22. Other payables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63

Other

23. EBITDA reconciliation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63

24. Fees to auditor appointed at the Annual General Meeting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63

25. Assets charged and contingent liabilities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64

26. Operating lease commitments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64

27. Financial instruments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65

28. Related parties . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68

29. Business combinations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69

30. Events after the balance sheet date . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70


NOTES

Basis of accounting

The consolidated financial statements for 2013 are presented in ac-

cordance with International Financial Reporting Standards (‘IFRS’) as

adopted by the EU and additional Danish disclosure requirements

for annual reports of reporting class C (large) enterprises. Please see

the Danish Executive Order on IFRS adoption issued in accordance

with the Danish Financial Statement Act.

The consolidated financial statements are presented in thousands

of US dollar (USD), which is regarded as the primary currency in

relation to the group’s activities and the functional currency of the

parent company.

The consolidated financial statements have been prepared on the

historical cost basis, except for certain derivative financial instru-

ments which are measured at fair value. The principal accounting

policies adopted are set out below.

The consolidated financial statements are presented in accordance

with the new and revised standards (IFRS/IAS) and Interpretations

(IFRIC) which apply for the financial year

Future IFRS changes

At the date of the publication of these consolidated financial state-

ments, a number of new and amended standards and interpreta-

tions have not yet entered into force or have not yet been adopted

by the EU. Therefore, they are not incorporated in the consolidated

financial statements.

None of the new standards or amendments of existing standards

are expected to have a material impact on future consolidated fi-

nancial statements.

Change in accounting policies as a result of change in presen-

tation currency

Management has decided to change the presentation currency of

its consolidated financial statements to USD in order to best repre-

sent the core business performance and its underlying exposures.

This is both from an operational and a capital structure perspective.

In addition this accommodates requests from investors and serves

to make the consolidated financial statements more comparable

within Welltec’s peer group.

Restatement as a result of change in functional currency

At the same time, Management has reconsidered the group’s func-

tional currency. For most of the foreign operations the functional

currency continues to be the local currency. However, for the Danish

operation and operations in some other countries our assessment is

that USD is the functional currency.

In evaluating the functional currency of the Danish operation, rev-

enue and the principal source of financing have been considered

the determining factors, whereas historically the cost base was con-

sidered the most significant factor. On that basis Management has

assessed that USD is the functional currency of the Danish opera-

tion and the operations in some other countries. Management has

identified the issuance of USD bonds in the beginning of 2012 as

the main event triggering the change in functional currency from

DKK to USD, and consequently the change in functional currency

is deemed to have taken place at that date. All financial statements

in 2012 and 2013 for the relevant operations have been restated to

USD effective 1 January 2012.

Effect of the changes in presentation and functional currency

The primary effect of the changes is elimination of significant vola-

tility in the income statement due to unrealized foreign exchange

gains or losses related to revenue and USD denominated bond debt,

as these are now denominated in the functional currency of relevant

operations and bonds issued.

1. ACCOUNTING POLICIES

2012 2013 Development in %

(Amounts in thousands) DKK USD DKK USD DKK USD

Operating profit (EBIT) before special items 492,251 86,149 383,010 67,705 (22.2) (21.4)

Profit before tax 263,421 47,888 311,805 41,530 18.4 (13.3)

Net profit for the year 128,783 24,351 196,682 20,643 52.7 (15.2)

Equity 1,442,523 246,422 1,496,555 278,615 3.7 13.1

Return on equity 13.38% 7.86%

The main changes can be disclosed as the following:

NOTES


Recognition and measurement

Assets are recognized in the statement of financial position if it is

probable that future financial benefits will flow to the group and

the value of the asset can be measured reliably.

Liabilities are recognized in the statement of financial position if

they are probable and can be measured reliably. On initial recogni-

tion assets and liabilities are measured at cost or fair value. Sub-

sequently assets and liabilities are measured as described for each

item bellow.

Income is recognized in the statement of comprehensive income

as earned and includes value adjustments of financial assets and

liabilities measured at fair value or amortized cost.

Consolidated financial statements

The consolidated financial statements comprise the parent com-

pany and the group enterprises (subsidiaries) that are controlled

by the parent company, see group chart on page 85. Control is

achieved where the parent company, either directly or indirectly,

holds more than 50% of the voting rights or in any other way pos-

sibly or actually exercises controlling influence over a subsidiary. If

the parent company holds less than 50% of the share capital, con-

trol exists when the parent company under agreement has more

than 50% of the voting rights, has the power to govern financial

and operating policies of the subsidiary, to appoint members of the

Board of Directors or to cast the majority of votes at meetings of

the Board of Directors of the subsidiary.

Basis of consolidation

The consolidated financial statements are prepared on the basis of

the financial statements of the parent company and its subsidiar-

ies, which are all prepared in accordance with the group’s account-

ing policies. Upon consolidation, intra group income and expenses,

balances, investments and dividends as well as profits and losses on

transactions between the consolidated enterprises are eliminated.

Subsidiaries’ financial statement items are recognized in full in the

consolidated financial statements. Non-controlling interests’ pro

rata share of profit/loss and equity is shown as separate line items

in the statement of comprehensive income and in the group’s eq-

uity, respectively.

Business combinations

Newly acquired or newly established enterprises are recognized in

the consolidated financial statements from the date of acquisition.

The date of acquisition is when the parent company obtains control

of the company. Divested or wound-up enterprises are recognized

in profit or loss up to the time of their divestment or winding-up.

The purchase method is applied to the acquisition of new enterpris-

es. According to this method, identifiable assets, including separa-

ble intangible assets, liabilities and contingent liabilities of acquired

enterprises are measured at fair value at the acquisition date. Non-

current assets acquired for the purpose of resale, however, are mea-

sured at fair value less anticipated selling costs. Restructuring costs

are only recognized in the pre-acquisition statement of financial po-

sition if they constitute a liability for the acquired enterprise. If there

is a tax effect, a corresponding asset or liability is booked. If the final

determination of the consideration is conditional upon one or sev-

eral future events, the value thereof will be recognized at fair value

at the date of acquisition. Changes to contingent considerations

are recognized in the profit or loss. Costs directly attributable to the

business combination are recognized in the profit or loss.

Positive differences (goodwill) between cost of the enterprise ac-

quired and the fair value of the assets, liabilities and contingent li-

abilities acquired are recognized as an asset under intangible assets

and are tested for impairment at least once a year. If the carrying

amount of goodwill is higher than its recoverable amount, it is writ-

ten down to this lower recoverable amount.

Foreign currency translation

On initial recognition, transactions denominated in foreign curren-

cies are translated at the transaction date exchange rate. Receiv-

ables, payables and other monetary items denominated in foreign

currencies that have not been settled at the end of the reporting

period are translated using the exchange rate at the end of the re-

porting period. Exchange differences that arise between the rate at

the transaction date and the exchange rate effective at the payment

date or the exchange rate at the end of the reporting period are

recognized in statement of comprehensive income as financial in-

come or financial expenses. Property, plant equipment fleet, intan-

gible assets, inventories and other non-monetary assets purchased

in foreign currencies and measured on the basis of historical cost are

translated at the transaction date exchange rate. If non-monetary

items are restated at fair value, they are translated using the ex-

change rate at the date of restatement.

When foreign subsidiaries that use a functional currency different

from USD are recognized in the consolidated financial statements,

the statement of comprehensive income is translated at average ex-

change rates on a monthly basis unless such rates vary significantly

from the actual exchange rates at the transaction dates. In the latter


NOTES

case, the actual exchange rates are used. Statement of financial po-

sition items is translated using the exchange rates at the end of the

reporting period. Goodwill is considered to belong to the relevant

entity acquired and is translated using the exchange rate at the end

of the reporting period.

Exchange differences resulting from the translation of foreign enti-

ties’ equity at the beginning of the year using the end of the report-

ing period exchange rates and by translating statements of com-

prehensive income from average exchange rates to the exchange

rates at the end of the reporting period are recognized in other

comprehensive income. Similarly, exchange differences resulting

from changes made in a foreign entity’s other comprehensive in-

come are also taken to other comprehensive income.

Exchange adjustments on receivables from, or payables to, subsid-

iaries that are considered part of the parent company’s total invest-

ment in the subsidiary in question, are also recognized in other

comprehensive income.

When foreign subsidiaries that use USD as their functional curren-

cy but present their financial statements in another currency are

recognized in the consolidated financial statements, monetary as-

sets and liabilities are translated using the end of the reporting pe-

riod exchange rate. Non-monetary assets and liabilities measured

on the basis of historical cost are translated using the transaction

date exchange rate. Non-monetary items measured at fair value

are translated at the exchange rate at the time of the last fair value

adjustment.

The items in profit or loss are translated at average exchange rates

on a monthly basis, with the exception of items deriving from non-

monetary assets and liabilities, which are translated using the his-

torical rates applicable to the relevant non-monetary assets and

liabilities.

Derivative financial instruments

On initial recognition, derivative financial instruments are measured

at fair value. Directly attributable expenses related to the purchase

or issue of a derivative financial instrument are expensed.

Subsequent to initial recognition, derivative financial instruments

are measured at fair value at the end of the reporting period with-

changes in fair value recognized directly in profit or loss as financial

income or financial expenses.

The group does not apply hedge accounting to its derivatives finan-

cial instruments

Share-based payment

Share based incentive arrangements under which employees can

only opt to receive new shares in Welltec International ApS (equity

arrangements) are measured at the equity instruments’ fair value

at the grant date and are recognized in profit or loss under staff

costs over the vesting period. The related set-off entry is recog-

nized in equity.

Income taxes and deferred tax

The Welltec group’s Danish subsidiaries are jointly taxed with the

principal shareholder JH Holding Allerød, ApS. The current Danish

income tax is allocated among the jointly taxed companies in por-

tion to their taxable income (full allocation subject to reimburse-

ment in respect of tax losses).

Tax for the year consists of current tax for the year and changes in

deferred tax. The portion of tax attributable to profit is recognized

in the income statement, and the portion of tax attributable to en-

tries directly in other comprehensive income is recognized in other

comprehensive income. The portion of tax attributable to equity

transactions is recognized in equity.

The current tax payable or receivable is recognized in the state-

ment of financial position, computed as tax calculated on the tax-

able income for the year, adjusted for prepaid tax.

The current tax charge for the year is calculated based on the tax

rates and tax legislation in each country applicable at the balance

sheet date.

Deferred tax is recognized on all temporary differences between

carrying values and tax-based values of assets and liabilities, except

from deferred tax on all temporary differences on initial recogni-

tion of goodwill or on initial recognition of a transaction that is not

a business combination, and for which the temporary difference

found at the time of initial recognition neither affects profit nor

loss for the year nor taxable income.

Deferred tax is calculated based on the expected use of each asset

and the settlement of each liability, respectively.

Deferred tax is measured at the tax rates that are expected to ap-

ply to the period when the asset is realized or the liability settled,

based on the tax rates and tax legislation that have been enacted

or substantively enacted in the respective countries on the bal-

ance sheet date. Changes in deferred tax resulting from changed

tax rates or tax rules are recognized in profit or loss, unless the

NOTES


deferred tax is attributable to items previously recognized in other

comprehensive income or in equity. If so, such changes are also rec-

ognized in other comprehensive income or in equity.

Exchange adjustments on deferred tax are recognized as part of the

year’s adjustment in deferred tax.

Changes in local tax rates, affecting deferred tax, are used and thus

affecting the value of the calculated deferred tax asset, alterna-

tively deferred tax liability at year end.

Deferred tax assets, including the tax base of tax loss carry for-

wards, are recognized in the statement of financial position at their

estimated realizable value, either as a set-off against deferred tax

liabilities or as net tax assets for set-off against future positive tax-

able income. At the end of each reporting period, it is reassessed

whether sufficient taxable income is probable to arise in the future

for the deferred tax asset to be used.

Balances calculated according to the rules on interest deductibility

limitations in the Danish Corporate Income Tax Act are allocated

according to a joint taxation agreement between the companies

that are subject to deductibility limitation in proportion to their

share of the total limitation. Deferred tax liabilities in respect of

these balances are recognized in the statement of financial posi-

tion; whereas deferred tax assets are recognized only of the criteria

for recognition of deferred tax assets are met.


Revenue

The group provides multiple solutions to oil and gas companies

around the world at their onshore and offshore locations using pro-

prietary remote control precision robotic equipment that Welltec®

designs and manufactures.

Provision of services is recognized in revenue when the work is

performed or when the agreed service is provided. Revenue from

sales of products is recognized in the income statement if delivery

and transfer of risk to the buyer have taken place before year end,

and if the income can be reliably measured and is expected to be

received.

Revenue is measured at fair value of the consideration received

or receivable. If an interest-free credit has been arranged for pay-

ment of the consideration receivable that is longer than the usual

credit period, the fair value of the consideration is determined by

discounting future payments receivable. The difference between fair

value and nominal amount of the consideration is recognized as

financial income in profit or loss by applying the effective interest

method.

Revenue is recorded net of VAT, duties, etc. collected on behalf of

a third party.

In addition, income from the sale of development projects is con-

sidered part of the group’s activities and therefore is recognized as

revenue.

Cost of services provided

Cost of services provided comprises direct and indirect expens-

es incurred to realize revenue including salaries, depreciation and

amortization.

Development and manufacturing costs

Development and manufacturing costs comprise all development

and engineering costs that are not capitalized.

Administrative and sales costs

Administrative and sales costs comprise costs required to sustain the

business including finance, IT, legal, HR and other overhead.

Special items

Special items consist of costs of a special nature in relation to the ac-

tivities of the group, including costs of structural changes and oth-

er significant amounts of a one-off nature. These items are shown

separately to facilitate the comparability of the profit or loss and

provide a better picture of the operational results.

Financial income and expenses

These items comprise interest income and expenses, the interest

portion of finance lease payments, realized and unrealized capital

gains and losses on payables and transactions in foreign currencies,

amortization premium/allowance on mortgage debt, etc. as well as

tax interest.

Statement of financial position

Intangible assets

Goodwill

Upon initial recognition, goodwill is recognized in the statement of

financial position and measured as the difference between cost of

the enterprise acquired and the fair value of the assets, liabilities and


NOTES

contingent liabilities acquired.

When goodwill is recognized, the goodwill amount is distributed

on those of the group’s activities generating separate payments

(cash-generating units). Determination of cash-generating units

follows the management structure and internal finance manage-

ment and reporting of the group.

Subsequently, goodwill is measured at cost less accumulated write

downs. There is no amortization of goodwill but the carrying value

of goodwill is tested for impairment at least once a year togeth-

er with the other long-term assets in the cash-generating unit to

which the goodwill is allocated. It is written down to recoverable

amount in profit or loss if the accounting value exceeds the recov-

erable amount, this representing the higher of the fair value of the

asset less expected disposal costs and the value in use. The recov-

erable amount is generally determined as the present value of the

expected future net cash flows from the cash-generating unit to

which the goodwill is allocated. Impairment losses of goodwill are

stated in profit or loss under amortization and impairment losses of

intangible assets.

Development projects

Development projects on clearly defined and identifiable service

equipment and processes are recognized as intangible assets if it is

probable that the service equipment or process will generate future

financial benefits for the group, and the development costs of each

asset can be measured reliably. Other development costs are recog-

nized as costs in the profit or loss as incurred.

On initial recognition, development costs are measured at cost.

The cost of development projects comprises costs such as salaries,

amortization/depreciation and other indirect costs that are directly

attributable to the development projects (e.g. field tests) and are

needed to complete the project, calculated from the time at which

the development project first meets the specific criteria for being

recognized as an asset.

Completed development projects are amortized on a straight-line

basis using the estimated useful lives of the assets. The amortiza-

tion period is usually 5 years, but in certain cases it may be up to

20 years if the longer amortization period is considered to better

reflect the group’s benefit from the developed product, etc. For

development projects protected by intellectual property rights, the

maximum amortization period is the remaining duration of the rel-

evant rights, however, no more than 20 years.

Development projects and other intangible assets are written

down to recoverable amount. Development projects in progress

are tested at least once a year for impairment. Borrowing costs to

finance the investments in development projects are recognized in

cost of these assets if such expenses relate to qualifying assets for

which their development period last longer than 12 months. Other

borrowing costs are included in finance expenses in the statement

of comprehensive income.

Other intangible assets

Acquired intellectual property rights in the form of patents and

licenses are measured at cost less accumulated amortization and

impairment losses. Patents are amortized over their remaining du-

ration, usually 5 years, and licenses are amortized over the term of

the agreement. If the actual useful life is shorter than the remain-

ing duration and the term of the agreement, respectively, amorti-

zation is made over such shorter useful life.

Separable intangible assets acquired through business combina-

tions are brand, customer relationship and technology. Brand is not

amortized as the useful life is considered indefinite. Customer rela-

tionship is amortized on a straight-line basis over its estimated use-

ful life of 10 years. Technology is amortized on a straight-line basis

over its estimated useful life of 10 to 20 years.

Tangible assets

Land and buildings, plant and machinery as well as other fixtures

and fittings, tools and equipment are measured at cost less ac-

cumulated depreciation and impairment losses. Land is not

depreciated.

Cost comprises the acquisition price, costs directly attributable to

the acquisition and preparation costs of the asset until the time

when it is ready to be put into operation. For assets manufactured

and owned by the group, cost comprises expenses directly attrib-

utable to the manufacture of the asset, including materials, com-

ponents, sub-suppliers and labor costs. In the year when the tool

is completed and ready to generate income for the company, it

is recognized under ‘Plant equipment and fleet’. During construc-

tion, the asset is recognized under ‘Plant equipment and fleet un-

der construction’.

Interest expenses on loans to finance the investments in tangible

assets are recognized in cost of these assets if such expenses relate

to qualifying assets for which their production period lasts longer

than 12 months. Other borrowing costs are taken to finance ex-

penses in the statement of comprehensive income.

NOTES


For assets held under finance leases, cost is measured as the lower

of the asset’s fair value or present value of future lease payments.

The basis of depreciation is cost less estimated residual value after

the end of useful life. The residual value is the estimated amount

that would be earned if selling the asset today net of selling costs if

the asset is of an age and a condition that is expected after the end

of useful life Straight-line depreciation is made on the basis of the

following estimated useful lives of the assets:

Buildings: 50 years

Leasehold improvements: 3-10 years

Plant equipment and fleet: 3-10 years

Other fixtures and fittings, tools and equipment: 3-5 years

Depreciation methods, useful lives and residual amounts are reas-

sessed annually.

Property, plant equipment and fleet are written down to the lower

of recoverable amount and carrying amount.

Impairment of property, plant equipment and fleet and intangible

assets

The carrying amounts of property, plant equipment and fleet and

intangible assets with definite useful lives are tested at the end of

the reporting period for any indication of impairment. If impaired,

the recoverable amount of the asset is estimated to determine the

need for any write-down and the extent thereof.

The recoverable amount of intangible assets with indefinite use-

ful lives, development projects in progress, brand and goodwill

is estimated annually irrespective of any recorded indications of

impairment.

If the asset does not generate cash flows separately from other as-

sets, an estimate is made of the recoverable amount of the smallest

cash-generating unit of which the asset forms part.

The recoverable amount is calculated as the higher of the asset’s

and the cash-generating unit’s fair value less selling costs and net

present value. When the net present value is determined, estimat-

ed future cash flows are discounted at present value using a dis-

count rate that reflects current market estimates of the value of

money in terms of time, as well as the particular risks related to the

asset and the cash-generating unit, respectively, and for which no

adjustment is made in the estimated future cash flows.

If the recoverable amount of the asset or the cash-generating unit is

estimated to be lower than the carrying amount, the asset is written

down to this lower recoverable amount. For cash-generating units,

write-down is allocated in such a way that goodwill amounts are

written down first and then any remaining need for write-down is

allocated to other assets of the unit, however, the individual asset is

not written down to an amount that is lower than its fair value net

of estimated selling costs.

Impairment losses are recognized in the profit or loss. In case of any

subsequent reversals of impairment losses resulting from change in

assumptions of the estimated recoverable value, the carrying values

of the asset and the cash-generating unit, respectively, are increased

to the adjusted estimate of the recoverable value, however, no more

than the carrying value which the asset or the cash-generating unit

would have had if the write-down had not been performed. Impair-

ment losses of goodwill are not reversed.

Profits or losses from the sale of property, plant equipment and fleet

are calculated as the difference between selling price less selling

costs and carrying value at the time of sale. Profits or losses are

recognized in the statement of comprehensive income if the selling

price differs from the carrying amount.

Financial assets

Other receivables

Other receivables with a fixed maturity are measured at amortized

cost, less any impairment.

Current assets

Inventories

Inventories are measured at cost according to the FIFO method. The

cost of finished goods and work in progress includes direct and indi-

rect production costs. Inventories are written down to net realizable

value if it is lower than the cost price.

Trade receivables

On initial recognition, trade receivables are measured at fair value

and subsequently at amortized cost, which usually equals nominal

amount less bad debt provisions.

Prepayments

Prepayments comprise incurred costs relating to subsequent finan-

cial years. Prepayments are measured at cost.


NOTES

Liabilities

Other provisions

Other provisions are recognized when the group has a legal or con-

structive obligation as a result of past events in the financial year or

prior years, and it is probable that settlement of such obligation will

lead to an outflow of the company’s financial resources.

Lease commitments

Lease commitments relating to assets held under finance leases are

recognized in the statement of financial position as liabilities other

than provisions, and, at the time of inception of the lease, mea-

sured at the lower of the lease asset’s fair value and the present

value of future lease payments. Subsequent to initial recognition,

lease commitments are measured at amortized cost. The difference

between the present value and nominal amount of the lease pay-

ments is recognized in profit or loss as a financial expense over the

term of the leases.

Lease payments on operating leases are recognized on a straight-

line basis in profit or loss over the term of the lease.

Other financial liabilities

On initial recognition, other liabilities, including issued bond loans,

bank loans and trade payables, are measured at fair value. Subse-

quently, these liabilities are measured at amortized cost applying

the effective interest method to the effect that the difference be-

tween proceeds and nominal amount is recognized in profit or loss

as a financial expense over the term of the loan.

Pension obligations

The group has entered into pension agreements with certain

groups of employees, which are classified as defined contribution

pension plans.

Periodical payments to defined contribution pension plans are rec-

ognized in profit or loss at the due date, and any contributions

payable are recognized in the statement of financial position under

liabilities.


The group’s statement of cash flows is presented using the indi-

rect method and shows cash flows from operating, investing and

financing activities as well as the group’s cash and cash equivalents

at the beginning and end of the financial year.

Cash flows from operating activities are calculated as EBIT adjusted

for non-cash operating items, working capital changes and income

taxes paid. In the adjustment for non-cash operating items, depre-

ciations and amortizations capitalized on tangible and intangible

assets are included.

Cash flows from investing activities comprise payments in connec-

tion with the acquisition and divestment of enterprises, tangible

fixed asset investments, and purchase, development, improvement

and sale, etc. of intangible assets, and property, plant equipment

and fleet. Depreciations and amortizations capitalized on tangi-

ble and intangible assets are included in cash-flow from investing

activities.

If any, cash flows from acquired and divested enterprises are shown

as separate line items within cash flows from investing activities.

Cash flows related to acquired enterprises are recognized in the

statement of cash flow from their date of acquisition, and cash

flows from divested enterprises are recognized up to the date of

sale.

Cash flows from financing activities comprise financial expenses

paid and changes in the size or composition of the parent com-

pany’s share capital and related costs, the raising of loans, instal-

ments on interest-bearing debt, purchase of treasury shares, and

payment of dividends.

Cash and cash equivalents comprise cash.

Ratios

The following ratios are compiled in accordance with Recommen-

dations & Ratios 2010 issued by the Danish Society of Financial

Analysts and generally accepted calculation formulas.

EBIT margin before

special items = Operating profit/loss [EBIT] before special items x 100

Revenue

EBITDA margin = Operating profit before depreciation and amortization x 100

Revenue

Return on equity = Net profit/loss for the year x 100

Average equity

ROIC excl. goodwill EBITA

Average capital investment excl. goodwill

* See definition on page 6

NOTES


Geographical information

The group’s revenue is divided into the following geographic areas:

3. REVENUE

3.1 Segment information

Based on IFRS 8 Operating Segment, it is considered if the group has more than one operating segment. The internal monthly manage-

ment reporting follows the group’s accounting policies. The management group of Welltec International ApS constitutes the chief operat-

ing decision maker of Welltec International ApS.

The internal monthly management reporting is focused on group level as a whole, including revenue divided into geographical areas. It

has been determined that Welltec International ApS only has one reporting segment.

2. CRITICAL ACCOUNTING JUDGMENTS AND KEY SOURCES OF ESTIMATION UNCERTAINTY

The determination of carrying values and preparation of the annual report build upon estimates made by Management of the likely effect

of future events on the value of plant equipment and fleet and development projects. In addition Management has determined fair value

of separable intangible assets acquired through business combination, including impairment test of goodwill and other intangible assets.

The estimates used build upon assumptions which, in the opinion of Management, are valid albeit inherently uncertain and unpredictable.

An assessment is made of the possibility of recovering the carrying value of intangible and tangible assets. The assessment of recoverable

amounts is based upon estimated returns generated by those assets in the cash-generating unit. Refer to the additional information and

amounts disclosed in the notes to the consolidated financial statements.

Only an insignificant part of the group’s revenue is generated in Denmark.

Information on major customers:

Out of total revenue for 2013, USD 52 million (2012: USD 51 million, 2011: USD 48 million) is derived from one customer.

Non-current assets

The group’s non-current assets are divided into the following geographic areas:

(USD in thousands)2013

Restated 2012 2011

Europe, Middle East, Africa and Russia/CIS (EMEAR) 169,523 152,308 124,166

Americas 111,925 107,051 85,188

Asia Pacific 39,717 36,028 19,869

Total revenue 321,165 295,387 229,223


Restated 2012 2011

Denmark 546,358 519,325 499,223

Other countries 23,038 24,679 14,631

Total non-current assets 569,396 544,004 513,854


NOTES

Defined contribution plans

The group operates pension schemes that cover certain groups of employees in Denmark and abroad. Those pension schemes take the

form of defined contribution plans. Welltec® arranges for the regular payment (e.g. a fixed amount or a fixed percentage of the salary)

of premiums to independent insurers who are responsible for the pension commitments. Once Welltec® has made payments of the con-

tribution under the defined contribution pension plans, Welltec® has no further pension commitments related to employees or former

employees.

Remuneration to members of the Executive Board, Board of Directors and other Key management personnel

The total remuneration of the Executive Board and Board of Directors of the Welltec International ApS group, including bonus, pension,

other security costs and share based payments can be specified as follows:

The total remuneration of other Key management personnel of Welltec International ApS group, including bonus, pension, other social

security costs and share based payments can be specified as follows:

(USD in thousands)

2013Restated

2012 2011

Short-term staff benefits 905 866 843

Pension benefits 89 95 101

Share-based payments 16 104 2,057

Total remuneration to Executive Board and Board of Directors 1,010 1,065 3,001


Restated 2012 2011

Breakdown of staff costs:

Wages and salaries 122,165 105,250 84,514

Share-based payment to executives 2,710 2,169 6,251

Payment to defined contribution pension plans 3,448 2,758 2,589

Other social security costs 6,258 6,090 4,820

Total staff costs 134,581 116,267 98,174

Recognition of staff costs:

Cost of services provided 72,274 61,257 47,676

Development and manufacturing costs capitalized 20,026 15,908 15,133

Administrative costs 42,281 39,102 35,365

Total staff costs 134,581 116,267 98,174

Number of employees:

Average number of employees 1,055 916 730

4. STAFF COSTS

(USD in thousands)

2013Restated

2012 2011

Short-term staff benefits 4,775 5,598 2,661

Pension benefits 90 89 57

Share-based payments 623 1,020 1,122

Total remuneration to other Key management personnel 5,488 6,707 3,840

NOTES


Incentive programs

The group operates incentive schemes in the form of warrants (Equity-settled) to the Board of Directors of Welltec International ApS,

Executive Board of Welltec A/S, certain senior executives (VPs) and other key personnel in the Welltec group. The purpose is to retain and

motivate the said persons. The schemes are based on the shares of Welltec International ApS, and the warrants have no voting rights

attached.

In 2005, Welltec Holding ApS issued 80,080 warrants to the Executive Board of Welltec A/S. The issued warrants were exercised in 2012.

In 2006, Welltec Holding ApS issued 105,820 warrants to senior executives (VPs) in the Welltec group. The warrants vested over an em-

ployment period until 2009. If employment ceased before a warrant is vested, the warrant would be reduced proportionally. The warrant

scheme is exercisable not earlier than 1 year (for warrants that vest first), and not later than 9 years, after the grant date.

In 2007, Welltec International ApS took over from Welltec Holding ApS 185,900 warrants issued to the Executive Board of Welltec A/S

and senior executives (VPs) in the Welltec group. This number of warrants was converted to 400,052 warrants in Welltec International ApS

and the exercise price was adjusted accordingly.

In 2009 a new warrants scheme to Key management personnel was granted. The warrant scheme consists of 68,000 warrants vested over

an employment period until 2012. The warrants are exercisable not earlier than 3 years and not later than 6 years after the grant date.

The total fair value of these warrants was at grant date USD 229 thousand of which USD 115 thousand was recognized in the statement

of comprehensive income in 2009, USD 84 thousand in 2010 and USD 30 thousand in 2011.

In November 2011, new warrants schemes to the Board of Directors, the Executive Board of Welltec group and Key management person-

nel were granted. The warrant schemes consist of 290,850 warrants of which 50,000 warrants did not have any vesting conditions, and

the remaining warrants vest over an employment period between one and four years until the end of 2014. The total fair value of these

warrants was at grant date USD 8.5 million of which USD 5.9 million was recognized in statement of comprehensive income in 2011, USD

2.3 million was recognized in the statement of comprehensive income in 2012 and USD 0.3 million in 2013. The fair value of the war-

rants schemes at grant date was calculated on the basis of the Black-Scholes model. The calculation for the 2011 schemes is based on an

expected volatility of 33%, a risk-free interest rate at 0.85%, a share price of USD 143 before deducting an estimated illiquidity discount,

the exercise price, an average option life of 60 month and no annual payment of dividends. The expected volatility has been determined

using a historical volatility for a five-year period for comparable listed companies adjusted for a small-cap factor.

In September 2013 warrants schemes to the Key management personnel was granted. The warrant schemes consist of 50,800 warrants

and vest over an employment period between one and four years until the end of 2016. The total fair value of these warrants was at grant

date USD 3.7 million of which USD 2.4 million was recognized in the statement of comprehensive income in 2013. The fair value of the

warrants schemes at grant date was calculated on the basis of the Black-Scholes model. The calculation for the 2013 schemes is based on

an expected volatility of 45%, a risk-free interest rate at 0.01%, a share price of USD 174-309, the exercise price, an average option life

of 36 month and no annual payment of dividends. The expected volatility has been determined using a historical volatility for a five-year

period for comparable listed companies adjusted for a small-cap factor.

In the event of an IPO or certain changes in the ownership structure (e.g. listing or sale of the company) all warrants will vest and become

exercisable.

As a result of the dividend distribution in 2012, the exercise prices of outstanding warrant schemes from 2011 and before, were adjusted

in 2012 to avoid a dilution of the fair values of those warrants. The new exercise prices were adjusted to ensure that the fair values before

and after the dividend pay-out were the same. Therefore these adjustments had no effect on the consolidated financial statements in

2012.

The following schemes were in existence during the current and prior year:


NOTES

The following reconciles the warrants outstanding at the beginning and at the end of the year:

NUMBER OF WARRANTSBoard of Directors

of Welltec Interna-

tional ApS

Executive Board of

Welltec A/S

Senior executives

and key management

personnel Total

Weighted average exercise

price USD 3)

Balance at 01.01.2011 0 172,331 264,948 437,279 13

Granted 10,000 50,000 230,850 290,850 123

Balance at 31.12.2011 10,000 222,331 495,798 728,129 56

Forfeited 0 0 (1,800) (1,800) 175

Exercised 0 (172,331) (55,537) (227,868) 6

Balance at 31.12.2012 10,000 50,000 438,461 498,461 69

Granted 0 0 50,800 50,800 239

Forfeited 0 0 (4,000) (4,000) 171

Balance at 31.12.2013 10,000 50,000 485,261 545,261 88

Exercisable at 31.12.2011 3,333 222,331 315,731 541,395 29

Exercisable at 31.12.2012 6,666 50,000 327,612 384,278 50

Exercisable at 31.12.2013 10,000 50,000 416,859 476,859 69

3) The exercise prices in 2012 are adjusted for the dilution impact from dividend paid in 2012. The weighted average remaining contractual life and range of exercise price of outstanding warrants was 30 months and a price of USD 0,18 - 295 (adjusted for dilution impact) at December 31, 2013, 39 months and a price of USD 0,18-181 at December 31, 2012 and 48 months and a price of USD 0,18 -181 at December 31, 2011.

The total expense recognized in the statement of comprehensive income for all warrants schemes amounted to USD 2,710 thousand for 2013 from all warrants schemes. The total expense recognized in the statement of comprehensive income for all warrants schemes amounted to USD 2,169 thousand in 2012 and USD 6,251 thousand in 2011.

Warrant schemeNumber

exercisedExercise

date

Weighted average

share price at exercise

date USD

Granted in 2005 172,331 Mar. 2012 143

Granted in 2006 30,773 Aug. 2009 143

Granted in 2006 49,237 Dec. 2012 143

Granted in 2011 6,300 Dec. 2012 143

Warrant scheme Number1) Grant date Vesting date Expiry date

Exercise price per warrant

USD 2)

Fair value per warrant

at grant date USD

Outstanding at

31.12.2013

Granted in 2005 172.331 Dec. 2005 2005 Apr. 2015 5 0.6 0

Granted in 2006 227.721 Feb. 2006 2007 - 2009 Apr. 2015 0.18 0.9 147,711

Granted in 2009 68.000 Sept. 2009 2010 - 2012 Sep. 2015 41 3.7 68,000

Granted in 2011 290.850 Nov. 2011 2011 - 2014 Nov. 2016 41 - 181 29.7 278,750

Granted in 2013 50.850 Sep. 2013 2013 - 2016 Jun. 2020 180 - 295 73.5 50,800

545,261

1) The numbers for the 2005 and 2006 grant are after the conversion to warrants on shares in Welltec International ApS. 2) The exercise prices are adjusted for the dilution impact from dividend paid in 2012.

NOTES


5. AMORTIZATION, DEPRECIATION AND IMPAIRMENT LOSSES


Restated

2012 2011

Completed development projects 18,682 14,609 11,262

Patents and licenses 477 379 487

Customer relationship 5,661 5,374 5,637

Technology 4,955 4,539 5,020

Total amortization of intangible assets 29,775 24,901 22,406

Other fixtures and fittings, tools and equipment 4,596 4,034 3,070

Land and buildings 74 79 53

Plant equipment and fleet 20,927 17,070 16,662

Leasehold improvements 567 511 513

Gain/loss from disposal of plant equipment and fleet (54) (228) (88)

Total depreciation of tangible assets 26,110 21,466 20,210

Total depreciation and amortization 55,885 46,367 42,616

Write-down of development projects 461 1,435 1,673

Write-down of plant equipment and fleet 3,609 3,246 4,015

Total impairment losses 4,070 4,681 5,688

Recognition of amortization, depreciation and impairment by function

Cost of service provided 42,315 34,270 31,020

Development and manufacturing costs capitalized 1,077 1,127 2,133

Administrative and sales costs 5,947 4,946 4,495

Amortization of acquired intangible assets in a business combination 10,616 10,705 10,657

Total depreciation, amortization and impairment losses 59,955 51,048 48,305

6. SPECIAL ITEMS


Restated

2012 2011

Salary cost related to resigned employees and special bonus 1,517 0 0

Non-recurring consultancy fees 3,181 0 0

Total special items 4,698 0 0


NOTES

7. FINANCIAL INCOME


Restated

2012 2011

Interest income 1,241 1,047 536

Interest from subsidiaries and affiliates 0 0 21

Interest income from financial assets that are not measured at fair value through profit or loss

1,241 1,047 557

Fair value adjustment of derivative financial instruments 3,717 0 0

Exchange rate gains 18,278 21 4,071

Total financial income 23,236 1,068 4,628

8. FINANCIAL EXPENSES


Restated

2012 2011

Interest expenses (29,440) (26,853) (12,535)

Redemption fee* 0 0 (2,547)

Other financial expenses (3,815) (4,685) (1,492)

Interest expenses from financial liabilities that are not measured at fair value through profit or loss

(33,255) (31,538) (16,574)

Exchange rate loss (16,156) (5,779) (4,511)

Fair value adjustment of derivative financial instruments 0 (2,012) (7,693)

Total financial expenses (49,411) (39,329) (28,778)

*Redemption fee consists of costs related to refinancing of earlier credit facilities.

Borrowing costs capitalized on development projects are calculated based on the incurred costs and a weighted average capitalization rate of 8.8% (7.5% in 2012). The amount capitalized in 2013 is USD 0.8 million (USD 0.5 million in 2012 and USD 0.4 million in 2011).

The impact at group level of derivative financial instruments measured at fair value through profit or loss amounted to a gain of USD 3,717 thousand at December 31, 2013 (a net loss of USD 2,012 thousand in 2012 and a net loss of USD 7,693 thousand in 2011).

The net exchange rate loss at December 31, 2013 was USD 2,122 thousand (a net exchange rate loss of USD 5,758 thousand in 2012 and a net exchange rate loss of USD 440 thousand in 2011).

NOTES


9. INCOME TAXES


Restated

2012 2011

Current tax 14,931 17,671 11,488

Adjustment in corporation tax previous years 4,550 (355) 55

Current tax incl. Adj. in corporation tax previous years 19,481 17,316 11,543

Adjustment in deferred tax previous years (363) 1,836 709

Change in deferred tax 1,969 482 (795)

Effect from change in tax rate, deferred tax (4,651) 0 0

Tax effect from tax provision 4,370 257 3,493

Other taxes 81 3,646 1,143

Income taxes 20,887 23,537 16,093

A breakdown of tax:

Profit before tax 41,530 47,888 32,859

41,530 47,888 32,859

Reconciliation of tax rate USD (%)

Danish corporation tax rate 25 25 25

Effect of exchange rate adjustment in USD and DKK on Danish corporation tax 8 0 0

Effect of difference between tax rate for subsidiaries outside Denmark and Danish tax rate 0 2 4

Tax effect from tax provision 10 1 11

Non-taxable income and non-deductible expenses 4 1 (1)

Interest limitation, thin capitalization etc 4 11 5

Withholding taxes non deductible 4 4 0

Change in Corporate income Tax rate, current and coming years (11) 0 0

Other taxes, including adjustment to previous years 6 5 5

50 49 49

Management has decided to change the functional and presentation currency of its consolidated financial statements to USD, however, tax returns for the Danish companies are still submitted in DKK with numbers based on consolidation in DKK.

The reconciliation of tax rate is presented both to the USD result and DKK result, the latter to reflect the reconciliation in the tax return currency.

Difference in tax rates illustrated is caused by the exchange rate adjustments between USD and DKK in the USD account. Reference is made to note 1. Accounting Policies.

Reconciliation of tax rate DKK (%)

Danish corporation tax rate 25 25 25

Effect of difference between tax rate for subsidiaries outside Denmark and Danish tax rate

0 2 4

Tax effect from tax provision 8 1 11

Non-taxable income and non-deductible expenses 3 1 (1)

Interest limitation, thin capitalization etc 3 11 5

Withholding taxes non deductible 3 4 0

Change in Corporate income Tax rate, current and coming years (8) 0 0

Other taxes, including adjustment to previous years 4 7 5

38 51 49


NOTES

11. CHANGES IN WORKING CAPITAL


Restated

2012 2011

Change in receivables and prepayments 393 (34,535) (21,641)

Change in inventories (743) 115 (1,837)

Change in trade payables (3,482) 811 4,551

Change in other payables (2,203) 2,201 7,004

Change in other receivables (687) 0 0

Change in working capital from acquisition of companies 0 153 0

Change in payables to affiliates (832) 879 50

Total changes in working capital (7,554) (30,376) (11,873)

10. NON-CASH ADJUSTMENTS


Restated

2012 2011

Depreciation of intangible and tangible assets 55,938 46,595 42,704

Disposal and write down 4,070 4,681 5,688

Exchange rate adjustment on depreciation and fixed assets (1,255) (273) 60

Currency adjustments, other (5,888) (7,158) (2,770)

Write-down on trade receivables (426) 592 167

Special items 0 0 (1,659)

Share-based payments 2,710 2,169 5,853

Total non-cash adjustments 55,149 46,606 50,043

No income tax has been recognized directly in other comprehensive income in 2011 and 2012. In 2013 USD 5,887 thousand is recognized directly in equity related to tax credit from the warrant scheme.

Norway – allocation of income between Norwegian branch and Danish parent

In 2007, the Norwegian tax authorities adjusted the taxable income related to income years 2001-2004 resulting in an additional payment of taxes equal USD 1,382 thousands. The company has paid the outstanding amount, which has been recognized as a receivable in the consolidated financial statements.

Welltec® has in 2009 and in 2013 requested a Mutual Agreement Procedure (MAP) in order to settle the principles for allocation of income between Welltec’s Norwegian branch and the Danish parent, Welltec A/S.

Welltec® believes that subsequent income years will be subject to the final agreement entered into by the Norwegian and the Danish tax authorities.

Final closure of MAP proceedings with the Danish and the Norwegian tax authorities agreeing on the principles for distribution of income is expected in 2014. Expectations are based on the ongoing dialogue with both the Danish and Norwegian tax authorities.

Denmark – credit for taxes paid abroad

The Danish tax authorities have for the income year 2008 adjusted the tax payable due to non-recognition of credit relief calculated on witholding taxes paid abroad. The additional tax payable is USD 1,658 thousand and has been paid.

The decision is appealed to the National Tax Tribunal.

NOTES


12. INTANGIBLE ASSETS

(USD in thousands) Goodwill

Other

intangible

assets*

Completed

development

projects

Patents

and

licenses

Development

projects in

progress Total

Restated

Costs at 01.01 2012 242,340 154,228 69,719 5,754 28,080 500,121

Additions 0 713 0 1,890 24,781 27,384

Additions through business combinations 0 3,150 0 0 0 3,150

Transfer 0 0 24,362 0 (24,362) 0

Exchange rate adjustment 0 0 0 33 0 33

Costs at 31.12 2012 242,340 158,091 94,081 7,677 28,499 530,688

Amortization and impairment losses at 01.01 2012 0 43,833 26,920 1,597 586 72,936

Amortization for the year 0 9,913 14,609 379 0 24,901

Write-down for the year 0 0 1,435 0 0 1,435

Exchange rate adjustment 0 (5) 0 8 1 4


Carrying value at 31.12 2012 242,340 104,350 51,117 5,693 27,912 431,412

Costs at 01.01 2013 242,340 158,091 94,081 7,677 28,499 530,688

Additions 0 0 0 3,558 30,261 33,819

Additions through business combinations 0 230 0 0 0 230

Transfer 0 0 24,388 0 (24,388) 0

Exchange rate adjustment 0 (90) 0 (53) 0 (143)

Costs at 31.12 2013 242,340 158,231 118,469 11,182 34,372 564,594


Amortization for the year 0 10,616 18,682 477 0 29,775

Write-down for the year 0 0 461 0 0 461

Exchange rate adjustment 0 (29) 0 (16) 1 (44)



* Please see specification below.


NOTES

Other intangible assets:

(USD in thousands) Technology

Customer

relationship Brand Total

Restated

Costs at 01.01 2012 88,640 51,664 13,924 154,228

Additions 449 264 0 713

Additions through business combinations 1,796 1,354 0 3,150

Costs at 31.12 2012 90,885 53,282 13,924 158,091

Amortization and impairment losses at 01.01 2012 20,419 23,414 0 43,833

Amortization for the year 4,539 5,374 0 9,913

Exchange rate adjustment 0 (5) 0 (5)


Carrying value at 31.12 2012 65,927 24,499 13,924 104,350

Costs at 01.01 2013 90,885 53,282 13,924 158,091

Additions 0 0 0 0

Additions through business combinations 230 0 0 230


Costs at 31.12 2013 91,140 53,167 13,924 158,230


Amortization for the year 4,955 5,661 0 10,616



Carrying value at 31.12 2013 61,227 18,752 13,924 93,903

Goodwill

Goodwill from the acquisitions is related to Welltec Holding ApS of USD 242,340 thousand. The goodwill amount is allocated to the group’s cash-generating unit Welltec International ApS group. It is the opinion of management that the carrying amount for goodwill does not exceed its recoverable value based on an estimate of present value of expected future net cash flows from Welltec International ApS group. The estimate is based on a risk-adjusted after tax discount rate (weighted average cost of capital) of 10.6%, applied to expectations about future earnings based on approved budget for 2014 and management’s forecasts for the period 2015-2022. In the terminal period ending after 2022 management uses a terminal value growth of 2.5%. The weighted average cost of capital before tax is 11.1%.

In 2012 weighted average cost of capital used was 11.1% which equals a before tax discount rate of 12.0%.

Impairment of other intangible assets

Impairment of development projects amounted to USD 0.4 million (2012: USD 1.4 million), which has been recognized in the statement of comprehensive income under cost of services provided as the projects are closed. The recoverable amount was calculated on the basis of

management’s re-assessed estimate of the value in use of the assets.

NOTES


13. TANGIBLE ASSETS

(USD in thousands)Land andbuildings

Leasehold improvement

Plantequipment

and fleet

Other fixtures,fittings, tools

and equipment

Plant equipment

and fleetunder

construction Total

Restated

Costs at 01.01 2012 1,563 3,992 118,585 18,849 21,405 164,394

Additions 12 467 970 5,688 37,944 45,081

Additions through business combinations

1,167 0 0 4,792 0 5,959

Reclassification 0 (7) 0 (59) 0 (66)

Transfer 0 0 32,033 0 (32,033) 0


Disposals 0 (12) (8,457) (897) 0 (9,366)

Costs at 31.12 2012 2,791 4,716 143,141 28,697 27,337 206,682

Depreciation and impairment losses at 01.01 2012 177 1,950 72,192 11,250 0 85,569

Reclassification 0 (7) 0 (59) 0 (66)

Depreciation for the year 79 511 17,070 4,034 0 21,694



Depreciation of disposals 0 (10) (8,457) (724) 0 (9,191)



Costs at 01.01 2013 2,791 4,716 143,141 28,697 27,337 206,682

Additions 809 1,415 2,665 4,331 45,676 54,895

Additions through business combinations 0 0 0 0 0

Reclassification 0 0 0 (127) 0 (127)

Transfer 0 0 47,092 385 (47,477) 0

Exchange rate adjustment (197) (119) (43) (1,967) (54) (2,379)

Disposals 0 (74) (1,166) (3,131) (15) (4,387)

Costs at 31.12 2013 3,403 5,938 191,689 28,187 25,467 254,684


Reclassification 0 0 (2) 0 0 (2)

Depreciation for the year 74 567 20,927 4,596 0 26,164


Exchange rate adjustment (22) (72) (1) (1,128) 0 (1,223)

Disposals 0 (46) (1,041) (2,912) 0 (3,999)




NOTES

Write-downs in 2013 and in 2012 related to scrapped tools and tools lost in the wells.

(USD in thousands)

2013

Restated

2012

The carrying amount includes:

Assets held under finance leases 2,999 2,074

14. INVESTMENTS IN SUBSIDIARIES

The group has investments in the following subsidiaries:

NameRegistered

officePrincipalactivity

Year /currency Capital Share

Pt. Welltec Oilfield Services Indonesia* Indonesia Sales Company 2005 / USD 500,000 95%

Welltec Oilfield Services (Malaysia) Sdn. Bhd* Malaysia Sales Company 2005 / MYR 350,000 49%

Welltec (UK) Ltd. * Scotland - UK Sales Company 2002 / GBP 1 100%

Welltec Canada Inc. * Canada Sales Company 2001 / CAD 6,000,001 100%

Welltec Inc. * USA Sales Company 2000 / USD 100,000 100%

RS 2001 ApS* Denmark Sales Company 2001 / DKK 125,000 100%

Welltec Oilfield Services Pty. Ltd.* Australia Sales Company 2005 / AUD 10 100%

Welltec Latinamerica ApS* Denmark Sales Company 2005 / DKK 475,000 100%

Welltec Africa ApS* Denmark Sales Company 2005 / DKK 125,000 100%

Welltec Venezuela, C.A.** Venezuela Sales Company 2005 / VEF 1,000 100%

Welltec do Brasil Ltda.** Brasil Sales Company 2006 / BRL 423,790 100%

Welltec Angola Lda.*** Angola Sales Company 2006 / USD 5,000 49%

Welltec Oilfield Services (Nigeria) Ltd. *** Nigeria Sales Company 2006 / NGN 25,000,000 30%

Welltec Oilfield Services (RUS) LLC.* Russia Sales Company 2007 / RUB 100,000 100%

Welltec Oilfield Services (Azerbaijan) Ltd.* Azerbaijan Sales Company 2007 / USD 5,000 100%

Welltec Oilfield Services Mexico S.A.** Mexico Sales Company 2007 / MXN 50,000 100%

Welltec Oilfield Services (India) Private Limited * India Sales Company 2008 / INR 100,000 100%

Welltec Oilfield Services (Saudi Arabia) Ltd* Saudi Arabia Sales Company 2008 / SAR 500,000 75%

Welltec A/S**** Denmark Manufacture 1989 / DKK 292,005,743 100%

Welltec Holding ApS Denmark Holding Company 2005 / DKK 254,865,743 100%

High Pressure Innovation AS* Norway Sales Company 2009 / NOK 1,500,000 100%

HPI Technology AS* Norway Sales Company 2009 / NOK 500,000 100%

Welltec Oilfield Services (Proprietary) (South Africa) Limited*** South Africa Sales Company 2010 / ZAR 1,000 100%

Welltec Oilfield Services (Kazakhstan) LLP* Kazakhstan Sales Company 2011 / KZT 151,200 100%

Welltec Oilfield Services (Uganda) Limited* Uganda Sales Company 2012 / USD 10,000 100%

Welltec Oilfield Services (Ghana) Limited*** Ghana Sales Company 2013 / GHC 40,818 49%

Welltec Oilfield services (Ukraine) LLC* Ukraine Sales Company 2013 / UAH 1,000 100%

* Held by Welltec A/S, ** Held by Welltec Latinamerica ApS, ***Held by Welltec Africa ApS, ****Held by Welltec Holding ApS

Even though Welltec A/S only holds a 49% and 30% ownership interest in four subsidiaries, Welltec A/S controls the four subsidiaries through holdings of more than half of the voting power.


15. INVESTMENTS IN ASSOCIATES

Alslev Rustfri Montage A/S is considered to be an associated company due to the holding of warrants by Welltec A/S. Welltec A/S can exercise the warrants at any time and this will result in an ownership share up to 33%. As no warrants have been exercised during 2013 no share of profit or equity is recognized in the consolidated financial statements. As of December 31, 2013 the warrant agreement was terminated due to the purchase of assets from Alslev Rustfri Montage (see note 29. Business combinations).

Key financial figures

(USD in thousands)

2013*

Restated

2012

Gross profit - 5,875

Profit for the year - 229

Assets - 7,297

Liabilities - 5,654

*2013 figures are not shown above as per December 31 2013 Alslev Rustfri Montage A/S is no longer an associated company

16. INVENTORIES


Restated

2012

Raw materials 2,184 1,733

Finished goods 292 0

Total inventories 2,476 1,733

NOTES

Investments in associates

Name

Registered

country

Principal

activity Year/currency Capital

% of share

and voting

rights

Alslev Rustfri Montage A/S Denmark Production 2011/DKK 2,862,000 0


17. TRADE RECEIVABLES


Restated

2012

Trade receivables before allowance for doubtful accounts 83,870 86,264

Write-downs (509) (935)

Total trade receivables 83,361 85,329

Trade receivables – average fixed time of credit (days) 90 91

Development in write-downs of trade receivables

Write-downs at 01.01 (935) (343)

Reversed, unrealized write-downs 667 13

Amounts written off during the year as uncollectible 24 (137)

Write-down in profit or loss (265) (468)

Write-downs at 31.12 (509) (935)

Specification of trade receivables by due date

Not due 55,630 55,531

Up to 30 days 12,933 13,748

30-60 days 2,094 2,917

60-90 days 5,147 7,172

90-120 days 4,930 1,708

120+ days 2,627 4,253

Total trade receivables 83,361 85,329

NOTES

In 2013 the write-downs on receivables of USD 509 thousand are all related to trade receivables due by 120+ days.

Credit risk management

The group’s credit risk on liquid funds and derivative financial instruments is limited because the counter parties are banks with high credit ratings assigned by the international credit-rating agencies.

The group’s services are provided to a variety of contractual counter parties and are therefore subject to the risk of non payment for services or non reimbursement of costs. Receivables consist of a relatively small number of customers, but the customers are large cor-porations in the oil industry. Companies with high credit ratings and the group’s loss on trade receivables are historically immaterial. There is an ongoing centralized follow-up on out-standing trade receivables in accordance with the group’s dunning procedures. If there is uncertainty of a customer’s ability or will to pay, and if the management assess that the receivables is doubtful, the receivables will be written down to avoid this risk.

The maximum credit risk related to financial assets corresponds to the carrying amount. In case where there may be a risk of loss, a write-down will be made based on individual assessment.


18. PREPAYMENTS

(USD in thousands)

2013

Restated

2012

Prepaid insurance 617 219

Prepaid lease 173 590

Prepaid rent 1,016 453

Prepaid creditors 2,901 2,188

Other prepayments 2,444 1,700

Total prepayments 7,151 5,150

19. SHARE CAPITAL

The share capital consists of 4,724,519 units of DKK 1 / USD 0.18. All shares are fully paid.

(USD in thousands) Class A Shares

Class B Shares

2013 Total

Class A Shares

Class B Shares

2012 Total

Share units 01.01 550 237 787 535 282 817

Capital increase 08.03.12 0 0 0 30 0 30

Capital decrease 30.05.12 0 0 0 (15) (45) (60)



Share units 31.12 587 237 824 550 237 787

Both the Class A and Class B Shares are considered to be equity instruments as they do not include any unconditional contractual obligations to deliver cash to the shareholders. Class A and Class B shares have equal voting rights. The Class A shares issued on 26 September 2013 are preferences shares as they within a certain time frame have certain preference rights over the other Class A shares if Welltec does not complete an IPO. Class B shares are also preference shares as they within a certain time frame have certain preference rights over Class A shares when distributions are made by Welltec.

In 2007 Welltec International ApS issued 71,601 warrants to Jørgen Hallundbæk as owner, which can be exercised as of December 31, 2011. The total fair value of these warrants is USD 18,794 thousand as at December 31, 2013 (December 31, 2012: USD 7,338 thousand).

No dividend was paid out in 2013 and no dividend is proposed related to the financial year 2013. Dividend of USD 34,300 thousand was paid in March 2012, corresponding to USD 7.30 in average per share

NOTES

Number of

sharesNominal

value in DKK

Share of capital

in %

Own shares 01.01.2012 0 0 0

Purchase of shares 96,238 96,238 2.1

Sale of shares (27,741) (27,741) (0.6)

Own shares 31.12.2012 68,497 68,497 1.5

Purchase of shares 120,928 120,928 2.6

Sale of shares (9,800) (9,800) (0.3)

Own shares 31.12.2013 179,625 179,625 3.8


20. DEFERRED TAX ASSETS AND LIABILITIES


Restated

2012

Deferred tax 01.01 48,369 45,817

Exchange rate adjustments 2,495 (22)

Adjustment in deferred tax previous years (363) 1,836

Change in deferred tax for the year 6,339 738

Effect of change in income tax rate, current year (1,046) 0

Effect of change in income tax rate, coming years (3,605) 0

Deferred tax assets (-)/liabilities 31.12 52,189 48,369

Deferred tax breakdown:

Intangible assets 50,942 46,844

Tangible assets (2,124) (1,347)

Current and non-current liabilities 10,670 (586)

Current assets (1,890) 397

Change in tax rate, coming years (3,681) 0

Tax contingencies 0 4,759

Tax loss carried forward (1,728) (1,698)



Deferred tax assets, not recognized:

Value of deferred tax assets, not recognized 168 136

Deferred tax liability, not recognized:

Value of deferred tax liability, not recognized 0 0

Deferred tax is recognized in the statement of financial position with:

Deferred tax assets (2,856) (2,959)

Deferred tax liabilities 55,045 51,328


The group does not recognize deferred tax losses that are unlikely to be realized or otherwise exposed to major risk or uncertainty.

NOTES


21. CURRENT AND NON-CURRENT FINANCIAL LIABILITIES


Restated

2012

Issued bonds 309,786 308,063

Finance lease commitments 2,910 3,237

312,696 311,300

Due within 1 year 1,349 2,165

Due within 1-2 years 676 841




Due after 5 years 309,786 308,063

312,696 311,300

Recognition of short-term and long-term financial liabilities in the statement of financial position:

Non-current financial liabilities — lease commitments 1,561 1,072

Non-current financial liabilities — issued bonds 309,786 308,063

Current financial liabilities 1,349 2,165

312,696 311,300

NOTES

Restated 2012

Currency Expiry

Fixed or floating interest

Effective interest rate

%

Carrying amount local

(thousands)

Carrying amount USD

(thousands)

DKK 2014 floating 0.19-6.69 17,289 3,055

USD 2019 fixed 8.5 308,063 308,063

RUB 2014 floating 0-5 1,181 39

GBP 2016 floating 5 6 10

CAD 2012 floating 1.37-7.44 132 133

311,300

2013

Currency Expiry

Fixed or floating interest

Effective interest rate

%

Carrying amount local

(thousands)

Carrying amount USD

(thousands)

DKK 2018 floating 0.29-9.98 15,522 2,910

USD 2019 fixed 8.5 309,786 309,786

312,696


21.1 Finance lease obligations

Finance lease relates to manufacturing equipment with lease terms of 3-5 years. The group has options to purchase the equipment for a

nominal amount at the end of the lease agreements. The group’s obligations under finance leases are secured by the lessors’ title to the

leased assets.

2013 Restated 2012

(USD in thousands)Minimum lease

payments

Present value of minimum

lease paymentMinimum lease

payments

Present value of minimum

lease payment

Maturity of finance lease obligations:

Within 1 year 1,396 1,349 2,241 2,165

Between 1 and 5 years 1,623 1,561 1,103 1,072

Over 5 years 0 0 0 0

Total finance lease obligations 3,019 2,910 3,344 3,237

(USD in thousands)

2013

Restated

2012

Interest from finance lease, expensed (175) (133)

The fair value of the finance lease liabilities is approximately equal to their carrying amount as of December 31, 2013 and December 31, 2012

NOTES

Issued bonds

In February 2012 Welltec A/S issued bonds of a value of USD 325 million. The bonds have a fixed interest of 8% and an effective rate of 8.5%. The bonds are repayable in full in February 2019.

The fair value of issued bonds at December 31, 2013 is USD 347 million (December 31, 2012 USD 347 million).

The fair value is based on the quoted market price (106.75 USD per note) (level 1) on Bourse Luxembourg.


21.2 Maturity dates for financial liabilities

Restated 2012

(USD in thousands)Less than 1

yearBetween 1 and

5 yearsLater than 5

years Total

Finance lease commitments 2,165 1,072 0 3,237

Issued bonds 0 0 308,063 308,063

Other non-current liabilities 0 5,231 0 5,231

Payables to affiliates 1,186 0 0 1,186

Trade payables 18,897 0 0 18,897

Other payables 45,840 0 0 45,840

Total financial liabilities 68,088 6,303 308,063 382,454

All debt is measured at amortized cost, except from derivative financial instruments of USD 4,747 thousand that are measured at fair value through profit or loss. Derivative financial instruments are included in ‘Other non-current liabilities’. The amounts in the table above are exclusive of interest.

Interest on issued bonds mature on an annual basis with USD 26 million until maturity on February 1, 2019.

2013

(USD in thousands)Less than 1

yearBetween 1 and

5 yearsLater than 5

years Total

Finance lease commitments 1,349 1,561 0 2,910

Issued bonds 0 0 309,786 309,786

Other non-current liabilities 0 420 0 420

Payables to affiliates 354 0 0 354

Trade payables 15,414 0 0 15,414

Other payables 42,787 0 0 42,787

Total financial liabilities 59,904 1,981 309,786 371,671

All debt is measured at amortized cost, except from derivative financial instruments of USD 1,030 thousand that are measured at fair value through profit or loss. Derivative financial instruments are included in ‘Other payables’. The amounts in the table above are exclu-sive of interest.

Interest on issued bonds mature on an annual basis with USD 26 million until maturity on February 1, 2019.

NOTES


24. FEES TO AUDITOR APPOINTED AT THE ANNUAL GENERAL MEETING


Restated

2012 2011

Statutory audit services 620 588 584


Non-audit services:

Opinions 22 2 4

Tax advisory services 1,226 551 310

Other 1,044 469 901

Non-audit services 2,292 1,022 1,215

Total fees to auditor 2,912 1,610 1,799

22. OTHER PAYABLES


Restated

2012

Wages and salaries, personal income taxes, social security costs, etc. payable 7,541 9,361

Holiday pay obligation 8,671 7,467

Derivative financial instruments 1,030 0

Earn out related to HPI (see note. 29 Business combinations) 0 1,796

VAT and duties 29 3,468

Accrued interests 11,596 12,484

Other costs payable 13,920 11,264

Total other payables 42,787 45,840

23. EBITDA RECONCILIATION


Restated

2012 2011

EBITDA 135,122 139,594 111,254

Depreciations and impairment losses (29,773) (24,940) (24,313)

Amortizations and impairment losses (30,236) (26,336) (24,079)

Issued warrants (2,710) (2,169) (5,853)

EBIT 72,403 86,149 57,009

NOTES


26. OPERATING LEASE COMMITMENTS

(USD in thousands)

2013

Restated

2012 2011

Rental and leasing obligations

Due within 1 year 6,452 5,817 4,664

Due within 1-5 years 10,044 12,910 10,982

Over 5 years 8,592 10,474 0

Total rental and leasing obligations 25,088 29,201 15,646

Rental and leasing expenses for the year 10,418 5,817 5,445

The group has entered into operational leasing agreements regarding house rental, office furniture and company cars.

In 2013 the group has issued bank guarantees to third parties in the amount of USD 3,780 thousand. In 2012 guarantees to third par-

ties were USD 5,416 thousand.

Welltec International ApS is part of a Danish joint taxation scheme with JH Holding, Allerød ApS and its Danish subsidiaries. As from

the 2013 financial year, the company has partly a joint and several liability and partly a secondary liability with respect to income taxes

etc. for the jointly-taxed companies. As from 1 July 2012 it also has partly a joint and several liability and partly a secondary liability with

respect to any obligations to withhold tax on interest, royalties and dividends for these companies. However, in both cases the second-

ary liability is capped at an amount equal to the share of the capital of the company directly or indirectly owned by the ultimate parent

company.

The debt established under the bond program is guaranteed by Welltec International ApS, Welltec Holding ApS, Welltec Canada Inc.,

Welltec Africa ApS, Welltec Latinamerica ApS, RS 2001 ApS, Welltec (UK) Ltd, Welltec Inc. and Welltec Oilfield Services (RUS) LLC. Sub-

ject to certain exceptions and permitted liens, the debts established under the bond program are secured, by (i) all of the issued shares

of the Issuer and each of the Guarantors (other than Welltec International ApS, Welltec (UK) Ltd and Welltec Oilfield Services (RUS) LLC),

(ii) certain intercompany loans and receivables of the Issuer and the Guarantors, (iii) the bank accounts of the Issuer and certain of the

Guarantors and (iv) certain other assets of certain of the subsidiary Guarantors, including receivables and intellectual property rights.

The bonds and the bond guarantees are secured by first-ranking liens over the same property and assets that will secure the obligations

outstanding under the Revolving Credit Facility, certain hedging obligations and certain other indebtedness.

Welltec International group is involved in legal proceedings in a number of countries against businesses and individuals. It is the opin-

ion of management that the outcome of these proceedings will not have a material impact on the group’s financial position, results of

operations or cash flows.

NOTES

25. ASSETS CHARGED AND CONTINGENT LIABILITIES


The carrying amounts of the group’s foreign currency denominated monetary assets and monetary liabilities at the end of the report-

ing period are as follows stated in the material currencies affecting the group:

Assets Liabilities

(USD in thousands) 2013 Restated

2012 2013 Restated

2012

DKK 132,447 171,338 (83,313) (165,141)

GBP 10,062 7,535 (949) (472)

NOK 23,770 71,431 (16,380) (24,362)

NOTES

27.1 General capital structure

The group is financed partly through equity and partly through long-term debt. Management assesses on a regular basis whether the

group’s capital structure is in accordance with the group’s and Shareholders’ interests. The overall objective is to ensure a capital struc-

ture that supports long-term growth and also maximizes returns to the shareholders of the group by optimizing the debt to equity ratio.

The group’s overall objective remains the same as previously.

27.2 Market risk

Due to the group’s foreign activities and credit facilities in foreign currencies, its profit/loss, cash flows and equity are affected by chang-

es in exchange rates and interest rates for a number of currencies.

A significant part of this change in exchange rates has been eliminated by changing functional currency for the Danish companies to

USD.

27.2.1 Foreign currency risk management

The reporting currency of the group is US dollars. The functional currency of the Danish companies is considered to be US dollars, and

the rest of the group’s subsidiaries have the functional currency of the country in which the subsidiary is domiciled. A proportion of the

group’s revenues, expenses and other liabilities are denominated in currencies other than US dollars, in particular Danish kroner, Norwe-

gian kroner and British pounds. Exchange rate exposures are managed within approved policy parameters.

27. FINANCIAL INSTRUMENTS


NOTES

27.2.2 Foreign currency sensitivity analysis

The following table details the group’s sensitivity to a 10% increase and decrease in DKK, GBP and NOK against the relevant foreign

currencies. The percentage used is the sensitivity rate and is representing Management’s assessment of the reasonably possible change

in foreign exchange rates. The sensitivity analysis includes only outstanding foreign currency denominated monetary items and adjusts

their translation at the period end for a change in foreign currency rates. The sensitivity analysis includes external loans as well as loans

to foreign operations within the group where the denomination of the loan is in a currency other than the currency of the lender or the

borrower. A positive number below indicates an increase in profit and equity where the currency strengthens 10% against the relevant

currency. For a 10% weakening of the currency against the relevant currency, there would be a comparable impact on the profit and

other equity, and the balances below would be negative:

Currency DKK impact Currency GBP impact Currency NOK impact


Restated 2012 2013

Restated 2012 2013

Restated 2012

Profit/(Loss) 4,913 620 911 706 739 4,707

Equity 0 0 933 828 1,193 5,144

27.2.3 Fair value of interest swaps

Restated 2012

(USD in thousands) Principal Market value

Exchange gain recognized in the

P/L Maturity period

Interest swap

DKK 445,000 (3,125) 826 2014

EUR 31,000 (1,622) 25 2014

Total swap contracts (loss) (4,747) 851

2013

(USD in thousands) Principal Market value

Exchange gain recognized in the

P/L Maturity period

Interest swap

DKK 445,000 (680) 2,445 2014

EUR 31,000 (350) 1,272 2014

Total swap contracts (loss) (1,030) 3,717


NOTES

27.2.4 Fair value hierarchy of derivative financial instruments that are measured at fair value in the statement of financial

position

Restated 2012

(USD in thousands) Quoted prices level 1

Observable input level 2

Non-observable input level 3 Total

Derivative financial instruments 0 (4,747) 0 (4,747)

Total financial liabilities 0 (4,747) 0 (4,747)

2013

(USD in thousands) Quoted prices level 1

Observable input level 2

Non-observable input level 3 Total

Derivative financial instruments 0 (1,030) 0 (1,030)

Total financial liabilities 0 (1,030) 0 (1,030)

Financial instruments measured at fair value are classified using the following fair value hierarchy:

Listed prices in active markets of identical assets or liabilities (Level 1).

Listed prices in active markets of similar assets or liabilities, or other valuation methods where all material input is based on observable market data (Level 2).

Valuation methods under which any material input is not based on observable market data (Level 3).

The valuation of derivative financial instruments in 2013 and 2012 is based on Mark to Market (MTM) values from financial institutions (level 2).

27.2.5 Interest rate risk management

From the beginning of 2012 the group’s interest rate risk relates to the group’s interest bearing debt to bondholders. The interest is fixed at an effective rate of 8.5%.

As the interest rate is fixed the group does not apply hedge accounting to its derivative financial instruments. Thus changes in fair value are recognized directly in statement of comprehensive income as financial income or financial expenses.

22.7.2.6 Interest rate sensitivity analysis

The group’s interest-bearing debt for 2013 is fixed to 8.5% due to the bond loan.

Previously the group held loans with a floating interest. At that time a 250 basis point increase or decrease represented Management’s assess-ment of the reasonably possible change in interest rate.

If interest rates had been 250 basis points higher/lower and all other variables were held constant, the group’s:

Profit for the year and equity as of December 31, 2013 would be unaffected (2012: Unaffected).

The effect of derivative financial instruments has not been included in the calculation.

27.3 Liquidity risk management

It is the group’s policy that capital raising and distribution of cash are managed centrally by the group’s finance department to the extent it is

deemed appropriate. The group manages liquidity risk by maintaining adequate reserves, banking facilities and reserve borrowing facilities, by

continuously monitoring forecast and actual cash flows.


NOTES

Welltec’s related parties

The ultimate parent company of the group is JH Holding, Allerød ApS, Haregabsvej 15, 3230 Græsted, Denmark

1. The parent company’s principal shareholder (control), JH Holding. Allerød, ApS, Haregabsvej 15, 3230 Græsted, Denmark, which is

wholly owned by Jørgen Hallundbæk

2. Summit Partners WT-A S.a.r.l., Rue du Plébiscite 5, L-2341 Luxembourg, Luxembourg (owns more than 5%)

3. Summit Partners WT-B S.a.r.l., Rue du Plébiscite 5, L-2341 Luxembourg, Luxembourg (owns more than 5%)

4. Companies in which the principal shareholder exercises control, i.e. Haregabgaard ApS and Tinkerbell ApS, Haregabsvej 15, Esbønd-

erup Skovhuse, 3230 Græsted

5. Members of the parent company’s Executive Management and Board of Directors as well as close relatives of these members

6. Subsidiaries of Welltec International ApS – see note. 14 Investments in subsidiaries in the consolidated financial statements

7. Alslev Rustfri Montage A/S (associated company)

Balances and transactions between the Company and its subsidiaries, which are related parties of the Company, have been eliminated on

consolidation in accordance with the accounting policies and are not disclosed in this note, but in note 18 to the financial statements of

the parent company. Details of transactions between the group and other related parties are disclosed below.

28. RELATED PARTIES

27.4 Categories of financial instruments


Restated

2012

Other receivables (non-current) and current portion of non-current assets 3,884 5,438

Trade receivables 83,361 85,329

Other receivables 6,630 9,902

Prepayments 7,151 5,150

Cash and cash equivalents 38,812 41,985

Receivables and loans 139,838 147,804

Derivative financial instruments 1,030 4,747

Financial liabilities measured at fair value through profit or loss 1,030 4,747

Finance lease commitments 2,910 3,237

Issued bonds 309,786 308,063

Other non-current liabilities 420 484

Payables to affiliates 354 1,186

Trade payables 15,414 18,897

Current tax liabilities 6,865 11,943

Other payables 41,757 45,840

Financial liabilities measured at amortized cost 377,506 389,650

The group is adjusting centrally the cash outflow in investments in intangible assets and property, plant and equipment in Denmark.

Please see note 21.2. Maturity dates for financial liabilities.


NOTES

28.1 Related parties transactions

During the year, group entities entered into the following trading transactions with related parties that are not members of the group:

(USD in thousands)

Restated 2012 Affiliates*Key

managementBoard of Directors Associates

Dividend paid to shareholders 31,955 979 0 0

Raw materials and finished goods 0 0 0 4,371

Share buyback 45,226 15,644 0 0

Legal services 0 0 701 0

Total transactions 77,181 16,623 701 4,371

2013 Affiliates*Key

managementBoard of Directors Associates

Raw materials and finished goods 0 0 0 3,778

Purchase of activities 0 0 0 942

Share buyback 30,062 0 0 0

Legal services 0 0 1,397 0

Total transactions 30,062 0 1,397 4,720

*The parent company’s principal shareholder(s) are defined as affiliates.

The following balances were outstanding at the end of the reporting period:

(USD in thousands)Amounts owed by related parties Amounts owed to related parties

2013 2012 2013 2012

JH Holding. Allerød, ApS 0 0 (354) (1,185)

Alslev Rustfri Montage A/S 0 356 (329) (1,006)

Board of Directors 0 0 (125) 0

Total balances 0 356 (808) (2,191)

See note 4. Staff costs – remuneration to members of the Executive Board, Board of Directors and other Key management personnel.

2012

Asset Acquisition of Endeavor E-line Services

On February 1, 2012, Welltec® announced that the company, through its wholly owned subsidiary Welltec Canada Inc., grew its opera-tions with the acquisition of Endeavour E-line Services, the wireline portion of Essential Energy Services, Ltd. in Calgary, Alberta. The total payment for the business combination was agreed at USD 7.5 million.

The group has incurred acquisition-related expenses totaling USD 157 thousand which have been included in administrative and sales costs in the consolidated statement of comprehensive income for 2012.

As a consequence of fully integrating Endeavour E-Line Services with Welltec Canada Inc.’s other activities immediately after the acquisi-tion, the group has not been able to quantify and thus disclose the impact on the group’s revenue and net profit for the year as a result of the acquisition. Additionally, based on lacking registrations, the group has not been able to quantify and thus disclose the impact on the group’s revenue and net profit for the year if the acquisition had taken place with effect from January 1, 2012.

29. BUSINESS COMBINATIONS


2013Asset Acquisition of Alslev Rustfri MontageOn December 31, 2013, Welltec® announced that the company, through its wholly owned subsidiary Welltec A/S, grew its operations with the acquisition of certain assets and key employees of Alslev Rustfri Montage, Esbjerg.

The group has not incurred acquisition-related expenses and the group’s revenue and net profit has not been impacted by the acquisition in 2013. Based on lacking registrations, the group has not been able to quantify and thus disclose the impact on the group’s revenue and net profit for the year if the acquisition had taken place with effect from January 1, 2013.

The preliminary purchase price allocation can be specified as follows:

Alslev Rustfri Montage

(USD in thousands)

Total opening balance

at fair value

Technology 230

Plant, equipment and fleet 758

Other payables (46)

Net assets 942

Cost of business combination consist of:

Other non-current liabilities 185

Other payables 757

942

NOTES

The purchase price allocation can be specified as follows:

Endeavor E-line Services HPI Technology AS

(USD in thousands)Carrying amount*

Fair value adjustment

Carrying amount*

Fair value adjustment

Total opening

balance at fair

value

Customer relationship 0 1,354 0 0 1,354

Technology 0 0 0 1,796 1,796

Land and buildings 1,167 0 0 0 1,167

Other fixture and fittings, tools and equipment 4,792 0 0 0 4,792

Prepayments 151 0 0 0 151

Net assets 6,110 1,354 0 1,796 9,260

Cost of business combination consist of:

Cash paid 7,464

Other payables 1,796

9,260

No significant events regarding the group’s activities have occurred since December 31, 2013.

30. EVENTS AFTER THE BALANCE SHEET DATE

Earn out regarding HPI Technology AS

On April 1 2009 Welltec® acquired HPI Technology AS. In 2012 a second and final earn-out milestone was reached and an additional earn out provision was triggered resulting in an earn-out of USD 1.8 million, which has been capitalized as technology in accordance with IFRS 3 (Business Combination 2004). The earn-out has been settled in 2013


FINANCIAL STATEMENTS

2013


FINANCIAL STATEMENTS PARENT COMPANY



(USD in thousands)NOTE 2013

Restated

2012 2011

Administrative costs 3 (365) (485) (489)

Operating loss (EBIT) (365) (485) (489)

Financial income 4 53 140,175 220

Financial expenses 5 (11,687) (20,637) (12,060)

Profit/(loss) before tax (11,999) 119,053 (12,329)

Income taxes 6 (1,021) 1,300 939

Profit/(loss) for the year (13,020) 120,353 (11,390)

Total comprehensive income/(loss) (13,020) 120,353 (11,390)

Allocation of total comprehensive income/(loss)

Transferred to retained earnings (13,020) 120,353 (11,390)

PARENT STATEMENT OF COMPREHENSIVE INCOME


As of December 31, 2013 and 2012


Restated

2012

Non-current assets

Financial assets

Investments in subsidiaries 9 392,576 346,319

Total financial assets 392,576 346,319

Total non-current assets 392,576 346,319

Current assets

Receivables

Tax receivables 958 2,499

Receivables from subsidiaries and affiliates 68,670 65,088

Other receivables 1 6

Total receivables 69,629 67,593

Cash and cash equivalents 815 788

Total current assets 70,444 68,381

Total assets 463,020 414,700

PARENT STATEMENT OF FINANCIAL POSITION


As of December 31, 2013 and 2012


Restated

2012

Equity

Share capital 10 824 787

Retained earnings 310,779 277,044

Total equity 311,603 277,831

Non-current liabilities

Deferred tax liabilities 11 0 0

Total non-current liabilities 0 0

Current liabilities

Loan from subsidiaries 12 146,535 125,077

Payables to subsidiaries 12 4,294 11,713

Other payables 588 79

Total current liabilities 151,417 136,869

Total liabilities 151,417 136,869

Total equity and liabilities 463,020 414,700

PARENT STATEMENT OF FINANCIAL POSITION



(USD in thousands)Share capital

Retained earnings Total

Equity at 31 December, 2011 817 236,864 237,681

Profit for the year 0 120,353 120,353

Total comprehensive income for the year 0 120,353 120,353

Purchase of own shares 0 (49,500) (49,500)

Sale of own shares 0 777 777

Dividend 0 (34,500) (34,500)

Capital increase 30 821 851

Capital decrease (60) 60 0

Share-based payment to executives 0 2,169 2,169

Other transactions (30) (80,173) (80,203)


Loss for the year 0 (13,020) (13,020)

Total comprehensive loss for the year 0 (13,020) (13,020)

Capital increase 37 45,928 45,965

Costs related to capital increase 0 (1,884) (1,884)

Share-based payment 0 2,710 2,710

Other transactions 37 46,755 46,792


PARENT STATEMENT OF CHANGES IN EQUITY




Restated

2012 2011

Operating loss (EBIT) (365) (485) (489)

Non-cash adjustments 7 (4,323) (313) 656

Changes in working capital 8 (7,776) 82,793 13,512

Income taxes received (paid) 520 283 880

Other receivables, long-term 0 0 483

Other payables, long-term 0 0 (63)

Cash flows from operating activities (11,944) 82,278 14,979

Financial income received 53 38 220

Capital increase in subsidiary (46,257) 0 0

Loan from affiliates 21,458 0 0

Dividend received from subsidiaries 0 140,035 0

Cash flows from investing activities (24,746) 140,073 220

Financial expenses paid (7,364) (11,995) (7,286)

Other financial expenses 0 (2,083) (2,723)

Dividend paid out to shareholders 0 (34,500) 0

Purchase of own shares 0 (49,500) 0

Sale of own shares 0 777 0

Capital increase 45,928 851 0

Costs related to capital increase (1,884) 0 0

Installments on current and non-current debt 0 (125,133) (5,227)

Cash flows from financing activities 36,680 (221,583) (15,236)

Increase/decrease in cash and cash equivalents (10) 768 (37)

Exchange rate adjustment at beginning of period 37 0 0

Cash and cash equivalents at beginning of period 788 20 57

Cash and cash equivalents at 31 December 815 788 20

PARENT STATEMENT OF CASH FLOWS


TABLE OF CONTENTS, NOTES – PARENT

1. Accounting policies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79

2. Critical accounting judgments and key sources of estimation uncertainty . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79


3. Staff costs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79

4. Financial income . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79

5. Financial expenses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80

6. Income taxes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80


7. Non-cash adjustments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81

8. Changes in working capital . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81

Statement of Financial position

9. Investments in subsidiaries . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81

10. Share capital . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82

11. Deferred tax assets and liabilities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82

12. Current and non-current financial liabilities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82

Other

13. Fees to auditor appointed at the Annual General Meeting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83

14. Assets charged and contingent liabilities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83

15. Financial instruments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84

16. Related parties . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84

17. Events after the balance sheet date . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84


NOTES

Basis of accounting

The annual report for 2013 of the parent company Welltec Interna-

tional ApS is presented in accordance with International Financial

Reporting Standards (‘IFRS’) as adopted by the EU and additional

Danish disclosure requirements for annual reports of reporting class

C (large) enterprises. Please see the Danish Executive Order on IFRS

adoption issued in accordance with the Danish Financial Statements

Act.

The annual report is presented in thousands of US dollar (USD),

which also is the functional currency of the parent company.

The accounting policy has been changed compared to 2012.

See Note 1. Accounting policies in the consolidated financial state-

ments for further information.

Differences compared to the group’s accounting policies

The parent company’s accounting policies for recognition and mea-

surement are in accordance with the group’s policies with the ex-

ceptions stated below:

Investments in subsidiaries

Investments in subsidiaries are measured at cost in the parent com-

pany’s financial statements. Where the recoverable amount of the

investments is lower than cost, the investments are written down to

this lower value.

1. ACCOUNTING POLICIES 2. CRITICAL ACCOUNTING JUDGMENTS AND KEY SOURCES OF ESTIMATION UNCERTAINTY

The determination of carrying values and preparation of the annual

report build upon estimates made by Management of the likely ef-

fect of future events on the value of investments and receivables in/

from subsidiaries.

The estimates used build upon assumptions which, in the opinion

of Management, are valid albeit inherently uncertain and unpre-

dictable. An assessment is made of the possibility of recovering the

carrying value of intangible and tangible assets. The assessment of

recoverable amounts is based upon estimated returns generated by

those assets in the cash-generating unit.

3. STAFF COSTS

There have been no employees in the parent company for the finan-

cial years 2011-2013.

See note 4. Staff costs in the consolidated financial statement for

information on remuneration for management

4. FINANCIAL INCOME


Restated

2012 2011

Interest income 0 38 36

Interest from subsidiaries and affiliates 53 102 184

Interest income from financial assets that are not measured at fair value through profit or loss

53 140 220

Dividend from subsidiary 0 140,035 0

Total financial income 53 140,175 220

NOTES


6. INCOME TAXES


Restated

2012 2011

Current tax (896) (1,200) (1,600)

Adjustment in corporation tax previous years 1.917 (99) 32

Current tax incl. Adj. in corporation tax previous years 1,021 (1,299) (1,568)

Adjustment in deferred tax previous years 0 0 628

Change in deferred tax 0 (1) 1

Income taxes 1,021 (1,300) (939)

A breakdown of tax:

Profit/(loss) before tax (11,999) 119,053 (12,329)

(11,999) 119,053 (12,329)

No income tax has been recognized directly in other comprehensive income (loss) or in equity in 2011, 2012 and 2013.

5. FINANCIAL EXPENSES


Restated

2012 2011

Interest expenses (25) (659) (9,614)

Interest expenses to subsidiaries and affiliates (7,339) (11,438) 0

Redemption fee* 0 0 (2,193)

Other financial expenses 0 (2,083) 0

Interest expenses from financial liabilities that are not measured at fair value through profit or loss

(7,364) (14,180) (11,807)

Exchange rate loss (4,323) (6,457) (253)

Total financial expenses (11,687) (20,637) (12,060)

*Redemption fee consists of costs related to refinancing of earlier credit facilities.

The net exchange rate loss at December 31, 2013 was USD 4,323 thousand (a net exchange rate loss of USD 6,457 thousand in 2012 and a net exchange rate loss of USD 253 thousand in 2011).


NOTES

8. CHANGES IN WORKING CAPITAL


Restated

2012 2011

Change in receivables and prepayments 5 (6) 103

Change in receivables from subsidiaries and affiliates (net) (8,290) 82,849 13,350

Change in other payables 509 (50) 59

Total changes in working capital (7,776) 82,793 13,512

7. NON-CASH ADJUSTMENTS


Restated

2012 2011

Currency adjustments, other (4,323) (313) 656

Total non-cash adjustments (4,323) (313) 656

9. INVESTMENTS IN SUBSIDIARIES


Restated

2012

Acquisition cost 01.01 346,319 346,319

Additions 46,257 0

Acquisition cost 31.12 392,576 346,319

The carrying amount of the investment in the subsidiary is pledged as security for issued bonds.

The parent company has an investment in the following subsidiary:

Name

Registered

country 2013 2012

Welltec Holding ApS Denmark 100%* 100%*

* Welltec Holding ApS was acquired on July 27, 2008


11. DEFERRED TAX ASSETS AND LIABILITIES


Restated

2012

Deferred tax 01.01 0 (1)

Adjustment in deferred tax previous years 0 6

Change in deferred tax for the year 0 (5)

Deferred tax assets (-)/liabilities 31.12 0 0


Current and non-current liabilities 0 0

Deferred tax assets (-)/liabilities 31.12 0 0

Deferred tax are recognized in the balance with:

Deferred tax assets 0 0

Deferred tax liabilities 0 0

The parent company does not recognize deferred tax losses that are unlikely to be realized or otherwise exposed to major risk or uncertainty.

NOTES

See note 19. Share capital in the consolidated financial statements.

The parent company Welltec International ApS holds no own shares. All own shares bought in 2012 were cancelled

10. SHARE CAPITAL

12. CURRENT AND NON-CURRENT FINANCIAL LIABILITIES

12.1 Maturity dates for financial liabilities

Restated 2012

(USD in thousands)

Less than 1 year

Between 1 and 5 years

Later than 5 years

Total

Payables to subsidiaries 11,713 0 0 11,713

Loan from subsidiary 125,077 0 0 125,077

Other payables 79 0 0 79

Total financial liabilities 136,869 0 0 136,869

All liabilities shown in the table above are measured at amortized cost. The amounts are exclusive of interest.


NOTES

13. FEES TO AUDITOR APPOINTED AT THE ANNUAL GENERAL MEETING

(USD in thousands)

2013

Restated

2012 2011



Non-audit services:

Opinions 0 0 0

Other 0 0 0

Non-audit services 0 0 0

Total fees to auditors 23 22 22

See note 25. Assets charged and contingent liabilities in the consolidated financial statements.

The debt established under the bond program is guaranteed by Welltec International ApS, Welltec Holding ApS, Welltec Canada Inc.,

Welltec Africa ApS, Welltec Latinamerica ApS, RS 2001 ApS, Welltec (UK) Ltd, Welltec Inc. and Welltec Oilfield Services (RUS) LLC. Sub-

ject to certain exceptions and permitted liens, the debts established under the bond program are secured, by (i) all of the issued shares

of the Issuer and each of the Guarantors (other than Welltec International ApS, Welltec (UK) Ltd and Welltec Oilfield Services (RUS) LLC),

(ii) certain intercompany loans and receivables of the Issuer and the Guarantors, (iii) the bank accounts of the Issuer and certain of the

Guarantors and (iv) certain other assets of certain of the subsidiary Guarantors, including receivables and intellectual property rights.

The bonds and the bond guarantees are secured by first-ranking liens over the same property and assets that will secure the obligations

outstanding under the Revolving Credit Facility, certain hedging obligations and certain other indebtedness.

14. ASSETS CHARGED AND CONTINGENT LIABILITIES

2013

(USD in thousands)

Less than 1 year

Between 1 and 5 years

Later than 5 years

Total

Payables to subsidiaries 4,294 0 0 4,294

Loan from subsidiary 146,535 0 0 146,535

Other payables 588 0 0 588

Total financial liabilities 151,417 0 0 151,417

All liabilities shown in the table above are measured at amortized cost. The amounts are exclusive of interest.


NOTES

For group overview please see note 27. Financial instruments in the consolidated financial statements.

15. FINANCIAL INSTRUMENTS

See note 28. Related parties in the consolidated financial statements.

16. RELATED PARTIES

16.1 Related party transactions

During the year, group entities entered into the following transactions with related parties that are not members of the parent company:

2013 Restated 2012

(USD in thousands) Subsidiaries Affiliates Subsidiaries Affiliates

Purchase of own shares 0 0 0 (45,226)

Dividend 0 0 140,035 (31,955)

Interest income/-expenses (-) (7,339) 53 (11,438) 102

Total transactions (7,339) 53 128,597 77,079

The following balances were outstanding at the end of the reporting period:

(USD in thousands) Amounts owed by related parties Amounts owed to related parties

2013 Restated 2012 2013 Restated 2012

JH Holding. Allerød, ApS 3,724 2,019 0 0

Subsidiaries 64,946 63,069 (150,829) (136,790)

Total balances 68,670 65,088 (150,829) (136,790)

See note 30. Events after the balance sheet date in the consolidated financial statements.

17. EVENTS AFTER THE BALANCE SHEET DATE

Currency risks

The parent company is affected by currency risks on its Intercompany balances with other group companies

The carrying amounts of the foreign currency denominated monetary assets and monetary liabilities at the end of the reporting period

are as follows stated in the material currencies affecting the company:

Assets Liabilities

(USD in thousands) 2013 Restated

2012 2013 Restated

2012

DKK 69,486 65,882 (151,417) (136,869)


*Welltec’s ownership of shares is held by more than one Welltec holding company

GROUP CHART

Welltec GabonBranch

Welltec AS GhanaBranch

Welltec Oilfield Services (Uganda) Limited

(100% Ownership)*

Welltec Oilfield Services (Kazakhstan) LLP

(100% Ownership)*

RS 2001 ApS(100% Ownership)

Welltec Africa ApS(100% Ownership)

Welltec Oilfield Services (Malaysia) Sdn. Bhd.(49% Ownership)

Welltec (UK) Ltd.(100% Ownership)

Welltec Canada Inc.(100% Ownership)

Welltec Oilfield Services Pty. Ltd.

(100% Ownership)

Welltec Latinamerica ApS(100% Ownership)

Pt. Welltec Oilfield Services Indonesia

(95% Ownership)

Welltec Inc.(100% Ownership)

Welltec Oilfield Services (RUS) LLC

(100% Ownership)*

Welltec Oilfield Services (Azerbaijan) Limited(100% Ownership)*

Welltec Oilfield Services (India) Private Limited(100% Ownership)

Welltec Oilfield Services (Saudi Arabia) Ltd.(75% Ownership)

Welltec Angola Lda.(49% Ownership)

Welltec Oilfield Services (Nigeria) Ltd.

(30% Ownership)

Welltec do Brasil Ltda(100% Ownership)

Welltec Venezuela C.A.(100% Ownership)

Welltec Oilfield Services (Mexico) S.A.

(100% Ownership)*

Welltec Latin America ApS Sucursal

Columbiana Branch

Welltec Africa G.E. Branch

WelltecInternational ApS

Welltec Holding ApS(100% Ownership)

Welltec A/S(100% Ownership)

High Pressure Innovation AS

(100% Ownership)

HPI Technology AS (100% Ownership)

Welltec Oilfield Services(South Africa)

(Proprietary) Ltd.(100% Ownership)

Welltec IndiaBranch

Welltec AzerbaijanBranch

Welltec NorwayBranch

Welltec AS Abu DhabiBranch

Welltec Oilfield Services (Congo) S.A.R.L.

Welltec Oilfield Services (Ghana) LLC

(49% Ownership)

Welltec Oilfield Services (Argentina) S.A.

(100% Ownership)*

Welltec Oilfield Services (Ukraine) LLC

(100% Ownership)

management commentary / welltec · accounting year: january 1, 2013 ... is one of maximizing...

Documents