lovastatin in aspergillus terreus

8/9/2019 Lovastatin in Aspergillus Terreus

1/11

Hindawi Publishing CorporationBioMed Research InternationalVolume , Article ID , pageshttp://dx.doi.org/.//

Research ArticleLovastatin in Aspergillus terreus: Fermented RiceStraw Extracts Interferes with Methane Production andGene Expression in Methanobrevibacter smithii

Mohammad Faseleh Jahromi,1 Juan Boo Liang,1 Yin Wan Ho,2 Rosfarizan Mohamad,3,4

Yong Meng Goh,5 Parisa Shokryazdan,2 and James Chin6

Institute o ropical Agriculture, Universiti Putra Malaysia (UPM), Selangor, Serdang, Malaysia Institute o Bioscience, Universiti Putra Malaysia (UPM), Selangor, Serdang, Malaysia Faculty o Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia (UPM), Selangor, Serdang, Malaysia Institute o ropical Forestry and Forest Products, Universiti Putra Malaysia (UPM), Selangor, Serdang, Malaysia Faculty o Veterinary Medicine, Universiti Putra Malaysia (UPM), Selangor, Serdang, Malaysia Faculty o Agriculture and Food Science, University o Queensland, Gatton, QLD , Australia

Correspondence should be addressed to Juan Boo Liang; [email protected]

Received September ; Revised March ; Accepted March

Academic Editor: Fabio Ferreira Perazzo

Copyright © Mohammad Faseleh Jahromi et al. Tis is an open access article distributed under the Creative CommonsAttribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is

properly cited.

Lovastatin, a natural byproduct o some ungi, is able to inhibit HMG-CoA (-hydroxy-methyl glutaryl CoA) reductase. Tis is akey enzyme involved in isoprenoid synthesis and essential or cell membrane ormation in methanogenic Archaea. In this paper,experiments were designed to test the hypothesis that lovastatin secreted by Aspergillus terreus in ermented rice straw extracts(FRSE) can inhibit growth and CH

4 production in Methanobrevibacter smithii (a test methanogen). By HPLC analysis, % o

the total lovastatin in FRSE was in the active hydroxyacid orm, and in vitro studies conrmed that this had a stronger effect inreducing both growth and CH4 production in M. smithii compared to commercial lovastatin. ransmission electron micrographsrevealed distorted morphological divisions o lovastatin- and FRSE-treated M. smithii cells, supporting its role in blocking normalcell membrane synthesis. Real-time PCR conrmed that both commercial lovastatin and FRSE increased ( < 0.01) the expressiono HMG-CoA reductase gene (hmg ). In addition, expressions o other gene transcripts in M. smithii with a key involvementin methanogenesis were also affected. Experimental conrmation that CH

4 production is inhibited by lovastatin in A. terreus-

ermented rice straw paves the way or its evaluation as a eed additive or mitigating CH4 production in ruminants.

1. Introduction

Te ormation o isoprenoid chains is a key component o membrane phospholipid synthesis in Archaea. Tis pathway requires the production o mevalonic acid rom -hydroxy-methyl glutaryl CoA catalyzed by the enzyme HMG-CoAreductase, a critical rate-limiting step sharedin common withcholesterol biosynthesis in humans (Figure ). Lovastatin isa natural polyketide synthesized by Aspergillus terreus andPleurotus ostreatus (oyster mushroom), where it may occurat concentrations as high as .% dry weight []. Lovastatinprescribed at a dosage o mg daily can dramatically reduce

cholesterol levels by % simply through the inhibition o HMG-CoA reductase activity. Trough intererence withmembrane synthesis (Figure ), lovastatin can inhibit thegrowth o methanogenic Archaea in the rumen withoutadverse effects on other cellulolytic bacteria [] and, in thisway, mediates reduction in methane (CH

4) release into the

environment. However, the high cost o lovastatin preemptsits use as a eed additive in the mitigation o ruminal CH

4

production. Another approach that may be economically viable is to incorporate A. terreus as a eed supplement andinhibitor o methanogenic Archaea that produces methane inthe process o methanogenesis (Figure ). Furthermore, since


2/11

BioMed Research International

OPPI

C

C O

C

O P O

O

OHO

Ether L-glycerol

Phosphate

Branched isoprene

Archaeal phospholipid

Thiolase

Mevalonic acid

Mevalonate kinase

Phosphomevalonatekinase

Mevalonate-5-phosphate

Mevalonate-5-pyrophosphate

Isopentenyl-ppisomerase

Mevalonate-5-pyrophosphatedecarboxylase

DimethylallylIsopentenyl-5-pyrophosphate (PP)

Farnesyl-pp synthase

Farnesyl-pp synthaseGeranyl PP

Geranylgeranyl-PP

Geranylgeranyl-PPsynthaseSqualene synthase

Farnesyl-PP

Cell membrane

formation

Squalenemonooxydenase

Squalene

2,3 Oxidosqualene

Squalene epoxidase

19 reactions

Lanosterol

Cholesterol

Acetyl-CoA Acetoacetyl-

3-hydroxy-3-3methylglutaryl-CoA

HMG-CoA synthase

HMG-CoA reductase

H2C

CH2

O

O

O

H

O

H

H

HO

Lovastatin

CH3CH3

H3C

H3C

F : Biosynthesis pathway o cholesterol production in humans (solid-line markers) and phospholipids production in Archaea(dotted-line markers). HMG-CoA reductase is the common enzyme converting HMG-CoA to mevalonic acid in the two pathways.Lovastatin is an inhibitor o HMG-CoA reductase and thus reduces the production o mevalonic acid in both pathways (modied romhttp://ourbiochemistry.blogspot.com///-cholesterol-synthesis.html).

A. terreus is a known producer o cellulolytic enzymes [–], it complements the degradation o lignocellulose compo-nents in the rumen enhance eed conversion efficiency. Tis

paper describes a series o experiments to test the hypothesisthat lovastatin generated by A. terreus ermentation o ricestraw (ungal treated rice straw extracts or FRSE) inhibits thegrowth and methanogenesis by Methanobrevibacter smithii(DSM ), a gastrointestinal methanogen similar to thedominant species in the rumen. Te molecular mechanismor this effect was also elucidated by real-time PCR.

2. Materials and Methods

.. Substrate, Microorganism, and Spore Suspension. Ricestraw (RS) was collected rom the local rice elds in the stateo Selangor, Malaysia. Te material was dried and ground to

uniorm size (No. mesh) and stored in plastic bags at ∘Cor later use as a substrate.

A. terreus ACC , obtained rom American ype

Culture Collection (ACC), was maintained on potato dex-trose agar (PDA) slants at ∘C or days, stored at ∘C, andsubcultured every two weeks. Spore suspension was preparedin .% ween- solution in approximately 7 spores/mLconcentration.

.. Solid-State Fermentation. Solid state ermentation o RSwas carried out in L Erlenmeyer asks. About gramso RS, mL distilled water (containing % urea) wereadded to give moisture content o approximately %. Teasks were plugged with cotton-wool and autoclaved at ∘Cor min prior to inoculate with mL o an A. terreusspore suspension (containing 7 spores/mL). A sample was


3/11


Formyl MFN

Methyl-CoM

Ethanol

MethanolCOR-

PRPRFA-P

Formate

and biosynthesis

CO2

wd

mch

hmd

mer

mtr

mcr

adh and no

mtaB

raS

dh

Acetyl-CoA production

F420H2

5-Formyl H4MPT

Methenyl-H4MPT

Methylene- H4MPT

Methyl- H4MPT

fr

CH4

CH3

F : Methanogenesis pathway in M. smithii. M. smithii is able to use the Methyl H4MP in the middle step o methanogenesis pathway

or production o acetyl-CoA and biosynthesis reactions. Enzymes and genes encode: ormate dehydrogenase ( dh); ormyl-MF dehydro-genase ( wd ); MFN, methanouran; ribouranosylaminobenzene -phosphate (RFA-P); ribouranosylaminobenzene -phosphate synthase(raS); -phospho-a-D-ribosyl--pyrophosphate (PRPP); ormyl-MF: H

4MP ormyltranserase ( fr ); tetrahydromethanopterin (H

4MP);

methenyl-H4MP cyclohydrolase (mch); methylene-H4MP dehydrogenase (hmd ); methylene-H4MP reductase (mer); methyl-H4MP:HS-CoM methyltranserase (mtr ); alcohol dehydrogenase (Adh); F-dependent NADP oxidoreductase ( no); methanol : cobalaminmethyltranserase (mtaB); methyl CoM Reductase (mcr ) (modied rom Hendrickson et al. []).

ermentedat ∘C or days, conditions which hadpreviously been ound to be optimal []. At the end o ermentation, thesample was dried at ∘C or h.

.. Preparation o FRSE. For preparation o FRSE, g o the ermented rice straw was mixed with . L o methanoland shaken or h at room temperature. Te solid sam-

ples were removed rom the suspension by vacuum l-tration (. m pore size, Pall Corporation, Ann Arbor,MI). Methanol was removed by rotary evaporation at ∘C(Eppendor, USA), and the solid residual or FRSE was usedin the urther experiments.

.. Lovastatin Quantication by HPLC. Te concentration o lovastatin in the FRSE was quantied using HPLC (Waters,USA, ) and an ODS column o Agilent (250 × 4.6 mmi.d., m). Te mobile phase consisted o acetonitrile andwater ( : by volume) containing .% acetic acid. TeUV photo diode array (PDA) detection range was set rom to nm, and lovastatin was detected at nm.

Te sampleinjection volume was L, and the running timewas min. Different concentrationso lovastatin(mevinolin,%, HPLC grade, sigma, M) were used as standard.

.. Microorganism and Anaerobic Microbial Culture. Meth-anobrevibacter smithii DSM used in this study wasobtained rom the German Resource Centre or BiologicalMaterial (DSMZ, Germany). Te Balch medium was used

or the growth o M. smithii with some modication on it con-taining . g/L o K2HPO4, . g/L o KH2PO4, . g/L o (NH

4)

2SO

4, . g/L o NaCl, .g/L o CaCl

2⋅H2O, . g/Lo MgSO4⋅H2O, . g/L o NaHCO3, . g/L o rypticase,. g/L o yeast extract, . g/L o sodium acetate, . g/L o sodium ormate, 4.9 × 10−5 g/L o coenzyme M (sodium -mercaptoethane-sulonate), . g/L o cysteine⋅HCl, . g/Lo Na

2S⋅H2O, and . g/L resazurin (pH .). Vitamin

and trace mineral solutions were added according to Balchet al. [], and a VFA mixture was added according toLovley et al. []. Te mixture was ushed with CO2, andapproximately mL o medium was transerred into mLserum bottles under anaerobic conditions. Te bottles were


4/11


: Primers used in gene expression study.

Official symbol Descriptor Primer sequence (5 → 3) Amplication size (bp)

Met S rRNA Forward

ReverseGCCAGAACACGGGCGGGGGCAAGGAG

mcrA Methyl coenzyme-M

reductase, subunit AForwardReverse

CGGGGACDCARAGRGCGBARGCGWAWCCGAGAACC

no F-dependent NADP

reductaseForwardReverse

GGGCAGCAGCAGAAAGGCACACAAGGGCGGA

mta Methanol: cobalamin

methyltranseraseForwardReverse

AGGGGCAAAAGGACCCCAGAGGGCACAAACAGCA

adh Alcohol dehydrogenase Forward

ReverseAAGAAGCCCGGAAGGGCCGAAGCCCCCCAA

hmd Methylene-HMP

dehydrogenaseForwardReverse

ACCCAGGGCGACCGAAAGGAAGCAGACCCGC

mtr Methyl-HMP: coenzyme

M methyltranseraseForwardReverse

AACAAAGCGGCCGGGAACGACACAAGACCCAGCAA

hmg HMG-CoA reductase Forward

ReverseGGCGGAAACCGCAAGGAACGGCCGGCACACCACA

closedby rubber stoppers andaluminumseals andautoclavedin ∘C or min. Lovastatin in nal concentrations o , ,and g/mL and FRSE in nal concentration o , , and g/mL were lter-sterilized using . m sterile syringelters (Pall/Gelman, East Hills, NY, USA) and added into themedium afer autoclaving. Te samples were inoculated with%o a h culture o M. smithii. Te gas phase in eachbottlewas exchanged with an % H2-% CO2 gas mixture at kPa. Te bottles were incubated at ∘C or h. Growthwas monitored rom the optical density at nm.

.. Methane Determination. Te concentration o CH4 inthe headspace gas phase was determined with an Agilent Series Gas Chromatograph (Wilmington, DE, USA).Separation o the gases was achieved using an HP-Plot Qcolumn ( m × . mm × m) (Agilent echnologies,Wilmington, DE, USA) with N

2 as the carrier gas with a

ow rate o . mL/min (MOX, Kuala Lumpur, Malaysia).Te isothermal oven temperature was ∘C, and separatedgases were detected using a thermal conductivity detector.Methane was eluted in min. Calibration used standard gasprepared by Scott Specialty Gases (Supelco, Belleonte, PA,USA), which contain % o CH

4, CO, CO

2, O

2,and H

2 in N

2.

.. RNA Extraction and Gene Expression. Cells rom twomilliliters o culture were harvested by centriugation at,rpmorminat∘C anddirectly used orRNA extrac-tion. RNA was extracted using the RiboPure Bacteria RNAIsolation kit (AMBION, AM, Austin, X, USA) accord-ing to the manuacturer’s protocol and reverse transcribedinto cDNA using First Strand cDNA synthesis Kit accordingto the manuacturer’s instructions (Maxime R-PCR Kit,iNtRON, Germany). In the next step, Real-time PCR wasperormed with the BioRad CFX ouch (Bio-Rad, USA)using optical grade plates. Te PCR reaction was perormedona total volumeo L using the iQSYBR Green Supermix(BioRad, USA). Each reaction included . L SYBR Green

Supermix, L o each Primer, L o cDNA samples, and. L H2O. All real-time PCRs were perormed in duplicate.Primers used in this study are shown in able . S rRNA

was used as reerence gene []. Te 2−ΔΔC method was usedor determination o relative gene expression []. Results o the real-time PCR data were represented as C values o thethreshold cycle number at which amplied product was rstdetected. ΔC is difference in C value o the target generom the C value o the reerence gene (S rRNA). ΔΔCis ΔC o treatment samples (lovastatin and FRSE) minusΔC o the untreated control. Data is presentedas old changeexpression in the target gene o a treatment sample compared

to the normal sample.

.. ransmission Electron Microscopy (EM). Te procedureo sample preparation o Hayat [] with minor modied[] by the Electron Microscopy Unit, Institute o Bioscience,Universiti Putra, Malaysia, was used or the EM study. AHitachi H- (Japan) transmission electron microscopewas used.

.. Statistical Analysis. All o the experiments were per-ormed in triplicate. Data were analyzed as a completely randomized design (CRD) using the general linear model

(GLM) procedure o SAS . []. All multiple comparisonsamong means were perormed using Duncan’s new multiplerange test ( = 0.05).

3. Results

.. Purity o Lovastatin. Te purity o lovastatin in FRSE wascompared with the commercially available orm by HPLC.Figure shows that commercial lovastatin was >% inthe lactone orm. In contrast, the yield o lovastatin was mg/g dry matter in FRSE, and approximately % o thiswas in the bioactive hydroxyacid orm (mg/g DM). Moreinormation about production o lovastatin by A. terreus in


5/11


O

O O

OHOOHOH

CH3CH3

O

O

OHO

CH3

CH3

0.15

0.1

0.05

0

−0.05

−0.1

−0.15

( A U )

1 2 3 4 5 6 7 8 9 10 11 12

Minutes

Hydroxyacid formLactone form

1 0 . 8

9 8

6 . 6

6 8

H3C

H3CH3C

H3C

F : Molecular structure and HPLC chromatogram o lovas-tatin.

0.390

0.284

0.238

0.065

0.284

0.167

0.031

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0.45

C o n t r o

l

O p t i c a

l d e

n s i t y ( 6 2 0 n m

)

L o v a s t a t i n

( 1 g / m L )

L o v a s t a t i n

( 1 0 g / m L )

F R S E

( 1 0 g / m L )

L o v a s t a t i n

( 5 0 g / m L )

g / m L )

F R S E ( 5 0 0

g / m L )

F R S E ( 1 0 0

A

B B

C

D

E

F

F : Te effect o the addition o commercial lovastatin andermentedrice straw extract (FRSE)in the broth culture o M. smithion growth rate afer h o incubation. Te error bar representsone standard deviation. A, B, C, D, E and F indicating differencesbetween means ( < 0.01).

solid state ermentation was published in our previous paper[]. o evaluate the effectiveness o the commercial and FRESlovastatin, dilutions representing , , and g/mL o commercial lovastatin and , , and g/mL o FRSE(contain lovastatin) were used to investigate the biologicalactivity o lovastatin on growth morphology, methane pro-duction, and gene transcript activity.

.. Microbial Growth and CH 4

Production. reatment withcommercial and FRSE lovastatin signicantly ( < 0.01)inhibited the growth o M. smithii (Figure ). Inhibition

by commercial lovastatin at and g/mL was similarto that o and g/mL FRSE, respectively. At thesame concentration o total lovastatin, the growth inhibitory effect o FRSE on M. smithi was much stronger than whencommercial lovastatin was used alone.

Commercial lovastatin and FRSE also inhibited CH4production afer h o incubation (Figure ). At the sameconcentrationo total lovastatin, CH

4production in theFRSE

treatments was lowerthan treatments containing commerciallovastatin. Tere wasno signicant difference in CH

4produc-

tion by g/mL commercial lovastatin and g/mL FRSE(equivalent to g/mL total lovastatin) while CH4 was notdetected in cultures containing g/mL FRSE (Figure ).

8.673

6.896

5.261

0.309

5.66

3.458

0.0000

1

2

3

4

5

6

7

8

9

10

D

C

E

C

B

A

E

C o n t r o

l

L o v a s t a t i n

( 1 g / m L )

L o v a s t a t i n

( 1 0 g / m L )

F R S E

( 1 0 g / m L )

L o v a s t a t i n

( 5 0 g / m L )

g / m L )

F R S E ( 5 0 0

g / m L )

F R S E ( 1 0 0

M e t

h a n e

( % o

f t o t a l

h e a

d s p a c e g a s )

F : Te effect o the addition o commercial lovastatin andermentedrice straw extract (FRSE) in the brothculture o M. smithion methane production (as % o total headspace gas) afer h o incubation. Te error bar represents one standard deviation. A, B,C, D, and E indicate differences between means ( < 0.01).

.. Microbial Morphology. Following growth with com-mercial lovastatin or FRSE, the morphology o M. smithiiwas greatly altered (Figure ). Te lines o cell division in

M. smithii or the control samples (Figures (a) and (b))displayed symmetrical cell division, while mitotic guresin treated samples were off-centered resulting in aberrantdivision gures.

.. Gene Expression. o obtain some insight into the mech-anism o decreased CH

4 production in M. smithii, real-

time PCR was used to analyse the effect o commerciallovastatin and FRSE on expression o some o the key genesinvolved in the methanogenic pathway (Figure ). Since littlegrowth and CH4 are produced by M. smithii in the highconcentration o lovastatin and FRSE and it is not possibleto extract sufficient quantity o RNA in these samples, RNAwas extracted only rom control and two lower levels o treat-ments. Both commercial lovastatin and FRSE signicantly increased the expression o HMG-CoA reductase gene (hmg )( < 0.05). Fold change in expression o this gene in FRSEtreated cells was higher than those treated with commerciallovastatin (Figure (a)), and the maximal change caused by the g/mL FRSE was a -old increase.

Te FRSE treatments, but not commercial lovastatin, alsohad a signicant effect on expression o methylene-H

4MP

dehydrogenase gene (hmd ) that encodes the enzyme or

conversion the methenyl-H4MP into methylene-H4MP(Figure ). Similarly, with commercial lovastatin and FRSEreduced the expression o alcohol dehydrogenase gene (adh),this reduction was not signicant ( > 0.05) (Figure (c)).reatments containing g/mL Lovastatin, g/mL and g/mL FRSE signicantly ( < 0.01) reduced theexpression o F-dependent NADP reductase gene ( no)in M. smithii (Figure (d)). L-lovastatin and FRSE increasedthe expression o methyl-H

4MP : coenzyme M methyl-

transerase gene (mtr ) (Figure (e)). Tis gene producesthe enzyme or the transer o methyl group rom methyl-H

4MP to HS-COM []. Methyl coenzyme-M reductase

(mcr ) is the last enzyme in the methanogenesis pathway.


6/11


Cell dividing at center

200nm

(a)

Cell dividing at center

500nm

(b)

Cell dividing at off-center

200nm

(c)

Cell dividing at irregular

position

500nm

(d)

F : ransmission electron micrograph o M. smithii as affected by commercial lovastatin (c) and ermented rice straw extract (FRSE)(d). Division o normal M. smithii cells (a) and (b) occurred at the middle orming two equal cells. In cultures treated with commerciallovastatin (c) and FRSE (d), cell division was off-center and irregular. Pictures were obtained using a Hitachi H- (Japan) transmissionelectron microscope (EM).

Te effect o lovastatin and FRSE on expression o this gene isshown in Figure (). Te result shows that lovastatin has noeffect on the expression o this gene, but FRSE at both levelsincreased the expression o this gene in M. smithii ( < 0.01).Methanol : cobalamin methyltranserase gene (mta) is thegene or encoding o methanol : cobalamin methyltranserasethat catalyses the conversion o methanol into COR-CH

3 and

production o CH4

in the process o methanogenesis. Bothlovastatin and FRSE signicantly increase the expressiono this gene in M. smithii ( < 0.01) (Figure (g)). Teenhancement effect o FRSE on expression o this gene washigher than L-lovastatin.

4. Discussion

Lovastatin is an effective therapy in the treatment o hypercholesterolemia because o its ability to inhibit HMG-CoA reductase activity, a key enzyme involved in cholesterolsynthesis []. Because o this, it is easy to ignore the actthat generic ungal statins have evolved to allow producerstrains to gain a competitive survival advantage in complexecological communities by interering with the assembly o isoprenoid chains required or membrane phospholipidsynthesis []. In this way, statin-producing ungi can arrestthe growth rates o susceptible strains [] by interering withcell wall ormation and arresting cellular division []. o test

whether such a strategy could be used or the reduction o methane production by ruminants, it was necessary to show rstly that rice straws ermented with a representative statin-producing ungal strain o Aspergillus terreus, was capable o synthesizing biologically active lovastatin. HPLC conrmedthat while commercial lovastatin existed primarily in abiologically inactive lactone (L) orm, the biologically activehydroxyacid or H-orm predominated in FRSE (Figure ).

In the second stage, it was necessary to demonstratethat the lovastatin in FRSE was able to exert a biologicalimpact on growth and cell membrane assembly in thetarget experimental methanogen— M. smithii. As shown inFigure , growth rates o M. smithii were inhibited by both

commercial lovastatin and FRSE. At the same time, electronmicrographs o M. smithii showed abnormal ormation o cellmembranes in mitosis, presumably caused by intererence inthe synthesis o isoprenoid building blocks. Although bothtreatments signicantly ( < 0.01) inhibited the growth o

M. smithii, the growth inhibitory effect o FRSE on M. smithiwas much stronger than when control L-lovastatin was usedalone. It is likely that this could have been the consequenceo having to convert the lactone orm to the hydroxy orm o lovastatin beore the inhibition o HMG-CoA reductase canoccur in M. smithii.

Commercial lovastatin contains % o the active H-orm o lovastatin, so their titrations o , , and ug/mL


7/11


0

2

4

6

8

10

12

F o

l d c

h a n g e i n g e n e

e x p r e s s i o n

C

B

A AA

C o n t r o l

L o v a s t a t i n

( 1 g / m L )

L o v a s t a t i n

( 1 0 g / m L )

F R S E

( 1 0 g / m L )

g / m L )

F R S E ( 1 0 0

(a) Effects o treatments on expression o HMG-CoA reductasegene,hmg ( < 0.01)

0

0.5

1

1.5

2

F

o l d c


e x p r e s s i o n

AA

AB C BC

C o n t r o l

L o v a s t a t i n

( 1 g / m L )

L o v a s t a t i n

( 1 0 g / m L )

F R S E

( 1 0 g / m L )

g / m L )

F R S E ( 1 0 0

(b) Effect o treatments on expression o methylene-H4MP dehydro-genase gene, hmd ( < 0.01)

0

0.20.40.60.8

11.21.4

F o

l d c


e x p r e s s i o n

C o n t r o l

L o v a s t a t i n

( 1 g / m L )

L o v a s t a t i n

( 1 0 g / m L )

F R S E

( 1 0 g / m L )

g / m L )

F R S E ( 1 0 0

(c) Expression o alcohol dehydrogenase gene, adh ( > 0.05)

0

0.2

0.4

0.6

0.8

1

1.2

1.4

F o

l d c


e x p r e s s i o n

BBBA

A

C o n t r o l

L o v a s t a t i n

( 1 g / m L )

L o v a s t a t i n

( 1 0 g / m L )

F R S E

( 1 0 g / m L )

g / m L )

F R S E ( 1 0 0

(d) Effects o treatments on expression o F-dependent NADPreductase gene, no ( < 0.01)

0

1

2

3

4

F o

l d c


e x p r e s s i o n

C o n

t r o

l

L o v a s t

a t i n

( 1 g / m L )

L o v a s t a t i n

( 1 0 g / m L )

F R

S E

( 1 0 g / m L )

g / m L )

F R S E ( 1 0 0

(e) Effects o treatments on expression o methyl-H 4MP: coenzyme Mmethyltranserase gene, mtr ( > 0.05)

0

1

2

3

4

5

6

F o

l d c


e x p r e s s i o n

A

A

BBB

C o n

t r o

l

L o v a s t

a t i n

( 1 g / m L )

L o v a s t a t i n

( 1 0 g / m L )

F R

S E

( 1 0 g / m L )

g / m L )

F R S E ( 1 0 0

() Expression o methyl coenzyme-M reductase gene subunit A, mcrA( < 0.01)

B

ABB

A

AB

0

2

4

6

8

10

12

F o

l d c


e x p r e s s i o n

C

o n t r o

l

L o v

a s t a t i n

( 1

g / m L )

L o v a s t a t i n

( 1 0

g / m L )

F R S E

( 1 0

g / m L )

g / m L )

F R S

E ( 1 0 0

(g) Effects o treatments on expression o methanol:cobalamin methyl-transerase gene, mta ( < 0.05)

F : Effect o lovastatin and FRSE on genes expression in M. smithii. S rRNA was used as reerence gene. Data were normalized by control and reerence genes. Error bar represent standard deviation. Letters on the columns indicating differences between means( < 0.05).

represent ., ., and ug H-orm per mL. Te FRSEcontains .% H-orm o lovastatin and , , and ugDM/mL FRSE are actually ., ., and . ug/mL H-lovastatin. Tus, their lowest concentration o FRSE is similar

in H-orm content with their highest commercial lovastatinconcentration, which was much more inhibitory in the exper-iments shown in both Figures and . Similarly, in Figure , ug/mL o the commercial orm appears to be roughly


8/11


equivalent to ug/mL o FRSE. In Figure , ug/mL o the commercial orm appears to be roughly equivalent to ug/mL o FRSE. Tis would seem to suggest that on a total(H + L-orm) lovastatin basis, the FRSE appears to be roughly equivalent to possibly -old more active.

It is important to note that this activity o lovastatin

against a methanogen operates differently rom its antiproli-erative activity against eukaryote cells. Damage o the humancell division by lovastatin has been reported in a previousstudy [].VandeDonketal.[] showed that lovastatin neg-atively affected membrane structure in the myeloma plasmacells and reduced the plasma cell viability, but this was due tothe induction o apoptosis and inhibition o prolieration andprobably a pleiotropic effect o statins on nuclear receptorsin eukaryote cells []. Lovastatin intererence with nuclearreceptors can act synergistically with its ability to inhibitpolyisoprenylation and subsequent downstream distortiono intracellular matrix reorganization during cell division[, , ]. Te antiprolierative activity o statins had oundincreasing use as anticancer drugs in cancer therapy [, ].

Microbial diversity in the rumen enables ruminants toconvert lignocellulosic materials into useul nutrients suchas VFA and microbial protein or the host animal. Tisis complemented by another group o microorganisms, themethanogenic Archaea which coexists within the rumenecosystem by converting H2 and CO2 into CH4, a greenhousegas which has been a serious contender or global warmingand climate change. Mitigation o rumen CH

4 production

has two advantages: reduction o dietary energy loss, thusimproving the efficiency o nutrient utilization by the hostanimal, and mitigation o enteric CH4 production. Bothcommercial lovastatin and FRSE signicantly inhibited CH

4

production, growth, and cell division o M. smithii. Otherstrategies or mitigation o CH4 production in the rumenecosystem have been extensively researched but with limitedsuccess. Te idea o applying lovastatin to suppress methano-genesis in methanogenic Archaea [] has been tested pre-

viously. Tese authors reported that commercial lovastatininhibited growtho methanogenic Archaea without adversely affecting other cellulolytic bacteria. In practical terms, it issimply uneconomical to use lovastatin as a eed additiveor reduction o methanogenesis in ruminants under armconditions.

A major difference between Archaea and other microor-ganisms lies in the structure o their cell membrane. Te lipidarm o phospholipids in Archaea is made up o branched

isoprenoid, but in other microorganisms, it is atty acid[]. Te process o isoprenoid and phospholipid biosyn-thesis in Archaea (Figure in dotted-line markers) sharesimilarities with cholesterol biosynthesis in eukaryotic cells(Figure in solid-line markers) with HMG-CoA reductaseas a key enzyme in both pathways, primarily to convert -hydroxy--methylglutaryl-CoA (HMG-CoA) to mevalonicacid. Figure (a) showed a signicant increase in HMG-CoAreductase gene (hmg ) transcripts in M. smithii ollowinglovastatin exposure, a result consistent with increased cellularneed or more HMG-CoA reductase enzyme to processa buildup o HMG-CoA because o lovastatin-mediatedcompetitive inactivation o HMG-CoA reductase. It is also

evident rom Figure (a) that H-lovastatin in FRSE wasmore effective than commercial L-lovastatin in generatinga buildup o hmg gene transcripts. Tis is the rst reporto statins on expression o HMG-CoA reductase gene inArchaea and complements other in vitro and in-vivo exper-iments showing increases (seven old afer atorvastatin treat-

ment) and decreases (two-old afersimvastatin treatment) inHMG-CoA reductase gene activation [] in eukaryote cells.As well, enhancement o the relative expression o hmg genesand protein productioninvolved in cholestrol biosynthesis by lovastatin have also been reported or many other systems[–]. Essentially, the mode o action o FRSE lovastatinon HMG-CoA reductase in Archaea is similar to its effect inanimal cells.

While the experimental evidence so ar supports theworking hypothesis that intererence o the isoprenoid syn-thetic pathway by lovastatin inhibition o HMG CoA syn-thetase is primarily responsible or reduced cell growth anddecreased methane production, it is likely that the pleiotropicconsequences o lovastatin on eukaryote cells in terms o itsanti-prolierative and antimetabolic activity may have similareffects on other metabolic pathways in Archaea. For instance,quantitative proteomic analysis has revealed that lovastatininduced perturbation in multiple cellular pathways in HL-cells []. In the case o Archaea, methane production couldalso be affected by lovastatin by intererence in its syntheticpathway. o assess this possibility, the biosynthetic pathway o methanogenesis is summarized in Figure . Methyl H

4MP

is a pivotal component in this pathway because its synthesisis vital or the production o acetyl-CoA, a key element incellular processes and metabolism []. We selected genes—hmd , adh, and no that are involved in the synthesis o MethylH4MP and others responsible or methane synthesis—mtr, mcr, and mta or real-time PCR assays using the sameRNA message transcripts rom cultures sampled or hmg analysis. Te results in Figure show that hmd (B), adh(C), and no (D) gene transcripts were all depressed in M.smithii ollowing exposure to lovastatin. We propose thatlovastatin intererence o isoprenyl precursor synthesis hascaused an increased buildup o acetyl-CoA in the metabolicpool resulting in eedback suppression o genes engaged inthe synthesis o Methyl H4MP. Surprisingly, despite a dropin overall CH

4 production in the cultures, there was an

increased expression in the three genes (mtr, mcr, and mta)responsible or CH4 synthesis. We propose that this anomaly is not spurious but represents the transcriptome o M. smithii

cells that are not dividing because they have been adversely affected by lovastatin. In these cells, mtr, mcr, and mta genetranscripts (Figures (e), (), and (g), resp.) are working incohort to dissipate intracellular pools o Methyl-H

4MP.

In conclusion, we have shown that sufficient levels o biologically active H-lovastatin are produced in rice strawsermented by A. terreus, and ermented rice straw extractsare able to disrupt cell wall ormation in the chosen rumentestmethanogen M. smithii. Tis disruption is associated withdecreased CH4 production drivenin part by intererence withisoprenyl synthesis and also through pleiotropic intererenceo lovastatin in other metabolic pathways. Te incorporationo FRSE as a eed additive or ruminants appears to be an


9/11


economically viable and environmentally sustainable strategy to mitigate CH

4 production.

Acknowledgment

Tis study was supported by the Fundamental Research

Grant Scheme (FRGS / UPM) o the Department o Higher Education, Malaysia.

References

[] J. Alarcón, S. Águila, P. Arancibia-Avila, O. Fuentes, E.Zamorano-Ponce, and M. Hernández, “Production and puri-cation o statins rom Pleurotus ostreatus (Basidiomycetes)strains,” Zeitschrif ur Naturorschung , vol. , no. -, pp. –, .

[] . L. Miller and M. J. Wolin, “Inhibition o growth o methane-producing bacteria o the ruminant orestomach by hydrox-ymethylglutarylSCoA reductase inhibitors,” Journal o Dairy Science, vol. , no. , pp. –, .

[] M. F. Jahromi, J. B. Liang, M. Rosarizan, Y. M. Goh, P.Shokryazdan, and Y. W. Ho, “Efficiency o rice straw lignocel-luloses degradability by Aspergillus terreus ACC in solidstate ermentation,” Arican Journal o Biotechnology , vol. , no., pp. –, .

[] G. S. Lakshmi, C. S. Rao, R. S. Rao, P. J. Hobbs, and R. S.Prakasham, “Enhanced production o xylanase by a newly isolated Aspergillus terreus under solid state ermentation usingpalm industrial waste: a statistical optimization,” Biochemical Engineering Journal , vol. , no. , pp. –, .

[] J. Gao, H. Weng, D. Zhu, M. Yuan, F. Guan, and Y. Xi,“Production and characterization o cellulolytic enzymes romthe thermoacidophilic ungal Aspergillus terreus M undersolid-state cultivation o corn stover,” Bioresource echnology , vol. , no. , pp. –, .

[] M. F. Jahromi, J. B. Liang, Y. W. Ho, M. Rosarizan, Y. M.Goh, and P. Sokryazdan, “Lovastatin production by Aspergillusterreus using agro-biomass as substrate in solid state ermen-tation,” Journal o Biomedicine and Biotechnology , vol. ,Article ID , pages, .

[] W. E. Balch, G. E. Fox, L. J. Magrum et al., “Methanogens:reevaluation o a unique biological group,” Microbiology and Molecular Biology Reviews, vol. , no. , pp. –, .

[] D. R. Lovley, R. C. Greening, and J. G. Ferry, “Rapidly growingrumen methanogenic organism that synthesizes coenzyme Mand has a high affinity or ormate,” Applied and Environmental Microbiology , vol. , no. , pp. –, .

[] Y. Q. Guo, J. X. Liu, Y. Lu, W. Y. Zhu, S. E. Denman, andC. S. McSweeney, “Effect o tea saponin on methanogenesis,microbial community structure and expression o mcrA gene,in cultures o rumen micro-organisms,” Letters in Applied Microbiology , vol. , no. , pp. –, .

[] K. J. Livak and . D. Schmittgen, “Analysis o relative geneexpression data using real-time quantitative PCR and the -[Delta][Delta] C method,” Methods, vol. , no. , pp. –, .

[] M. A. Hayat, Principles and echniques o Electron Microscopy:Biological Applications, vol. , Cambridge University Press,.

[] M. Faseleh Jahromi, J. B. Liang, R. Mohamad, Y. M. Goh, P.Shokryazdan, and Y. W. Ho, “Lovastatin-enriched rice straw

enhances biomass quality and suppresses ruminal methano-genesis,” BioMed Research International , vol. , Article ID, pages, .

[] SAS, SAS OnlineDoc .. SAS Institute Inc., Cary, NC, USA,.

[] E. L. Hendrickson, A. K. Haydock, B. C. Moore, W. B. Whitman,

and J. A. Leigh, “Functionally distinct genes regulated by hydrogen limitation and growth ratein methanogenic Archaea,”Proceedings o the National Academy o Sciences o the United States o America, vol. , no. , pp. –, .

[] B. S. Samuel, E. E. Hansen, J. K. Manchester et al., “Genomicand metabolic adaptations o Methanobrevibacter smithii to thehuman gut,” Proceedings o the National Academy o Sciences o the United States o America, vol. , no. , pp. –,.

[] A. W. Alberts, “Discovery, biochemistry and biology o lovas-tatin,” Te American Journal o Cardiology , vol. , no. , pp.–, .

[] A. Smit and A. Mushegian, “Biosynthesis o isoprenoids viamevalonate in Archaea: the lostpathway,” Genome Research, vol.

, no. , pp. –, .[] M. S. Chinn, S. E. Nokes, and H. J. Strobel, “Inuence o

process conditions on end product ormation rom Clostridiumthermocellum in solid substrate cultivation on paper pulpsludge,” Bioresource echnology , vol. , no. , pp. –,.

[] I. G. Macreadie, G. Johnson, . Schlosser, and P. I. Macreadie,“Growth inhibition o Candida species and Aspergillus umiga-tus by statins,” FEMS Microbiology Letters, vol. , no. , pp.–, .

[] H. Mo and C. E. Elson, “Studies o the isoprenoid-mediatedinhibition o mevalonate synthesis applied to cancerchemotherapy and chemoprevention,” Experimental Biology and Medicine, vol. , no. , pp. –, .

[] N. van de Donk, M. Kamphuis, H. M. Lokhorst, and A. C.Bloem, “Te cholesterol lowering drug lovastatin induces celldeath in myeloma plasma cells,” Leukemia, vol. , no. , pp.–, .

[] K. Howe, F. Sanat, A. E. Tumser, . Coleman, and N. Plant,“Te statin class o HMG-CoA reductase inhibitors demon-strate differential activation o the nuclear receptors PXR, CAR and FXR,as well as their downstream target genes,” Xenobiotica, vol. , no. , pp. –, .

[] M. Jakobisiak, S. Bruno, J. S. Skierski, and Z. Darzynkiewicz,“Cell cycle-specic effects o lovastatin,” Proceedings o theNational Academy o Sciences o the United States o America , vol. , no. , pp. –, .

[] J. E. DeClue, W. C. Vass, A. G. Papageorge, D. R. Lowy, andB. M. Willumsen, “Inhibition o cell growth by lovastatin isindependent o ras unction,” Cancer Research, vol., no. ,pp.–, .

[] K. K. W. Chan, A. M. Oza, and L. L. Siu, “Te statins asanticancer agents,” Clinical Cancer Research, vol., no. ,pp. –, .

[] J. Clendening and L. Penn, “argeting tumor cell metabolismwith statins,” Oncogene, vol. , no. , pp. –, .

[] Z. Konrad and J. Eichler, “Lipid modication o proteins inArchaea: attachment o a mevalonic acid-based lipid moiety to the surace-layer glycoprotein o Haloerax volcanii ollowsprotein translocation,” Biochemical Journal , vol. , part , pp.–, .


10/11


[] K. Conde, S. Roy, H. C. Freake, R. S. Newton, and M. L.Fernandez, “Atorvastatin and simvastatin have distinct effectson hydroxy methylglutaryl-CoA reductase activity and mRNAabundance in the guinea pig,” Lipids, vol. , no. , pp. –, .

[] J. L. Song, C. N. Lyons, S. Holleman, B. G. Oliver, and .C. White, “Antiungal activity o uconazole in combinationwith lovastatin and their effects on gene expression in theergosterol and prenylation pathways in Candida albicans,” Medical Mycology , vol. , no. , pp. –, .

[] M. S. Brown, J. R. Faust, J. L. Goldstein et al., “Inductiono -hydroxy--methylglutaryl coenzyme A reductase activity in human broblasts incubated with compactin (ML-B), acompetitive inhibitor o the reductase,” Te Journal o Biological Chemistry , vol. , no. , pp. –, .

[] M. Nakanishi, J. L. Goldstein, and M. S. Brown, “Multivalentcontrol o -hydroxy--methylglutaryl coenzyme A reductase.Mevalonate-derived product inhibits translation o mRNA andaccelerates degradation o enzyme,” Te Journal o Biological Chemistry , vol. , no. , pp. –, .

[] J. Wong, C. M. Quinn, I. C. Gelissen, and A. J. Brown,“Endogenous (S),-epoxycholesterol ne-tunes acute con-trol o cellular cholesterol homeostasis,” Te Journal o Biological Chemistry , vol. , no. , pp. –, .

[] X. Dong, Y. Xiao, X. Jiang, and Y. Wang, “Quantitative pro-teomic analysis revealed lovastatin-induced perturbation o cellular pathways in HL- cells,” Journal o Proteome Research, vol. , no. , pp. –, .


11/11

Submit your manuscripts at

http://www.hindawi.com

lovastatin in aspergillus terreus

Documents