Experimental Parasitology 120 (2008) 300–305

Contents lists available at ScienceDirect

Experimental Parasitology

journal homepage: www.elsevier .com/ locate /yexpr

Leishmania (Viannia) braziliensis: New primers for identificationusing polymerase chain reaction

V.M. Marcussi a, L.M. Marcussi a, I.P. Barbosa-Tessmann b, M.V.C. Lonardoni c, T.G.V. Silveira c,*

a Master program in Clinical Analyses, Universidade Estadual de Maringá, Maringá, PR, Brazilb Department of Biochemistry, Universidade Estadual de Maringá, Maringá, PR, Brazilc Department of Clinical Analyses, Universidade Estadual de Maringá, Avenida Colombo, 5790, 87020-900, Maringá, PR, Brazil

a r t i c l e i n f o a b s t r a c t

Article history:Received 25 February 2008Received in revised form 6 August 2008Accepted 12 August 2008Available online 26 August 2008

Keywords:LeishmaniasisLeishmania braziliensisDNA primersPolymerase chain reaction

0014-4894/$ - see front matter � 2008 Elsevier Inc. Adoi:10.1016/j.exppara.2008.08.005

* Corresponding author. Fax: +55 44 32614860.E-mail address: tgvsilveira@uem.br (T.G.V. Silveira

The objective of this study was to develop specific primers for Leishmania (Viannia) braziliensis speciesidentification using PCR. The designed primers (LBF1 and LBR1) were evaluated for sensitivity and spec-ificity using various L. (V.) braziliensis serodemes and various Leishmania species and also using Trypano-soma cruzi. A specific fragment of 536 bp was detected from 50 ng of DNA in a crude extract derived fromL. (V.) braziliensis. The DNA fragment was not detected when DNA from other Leishmania species or fromT. cruzi was used as template in the PCR. Furthermore, when tested with DNA from cutaneous leishman-iasis the designed primers and reaction gave positive results. Taking into consideration that the primersLBF1 and LBR1 could specifically identify L. (V.) braziliensis, they could be considered for use in L. (V.) bra-ziliensis diagnosis and epidemiological studies.

� 2008 Elsevier Inc. All rights reserved.

1. Introduction ensis to be classified into seven serodemes (Shaw et al., 1986). L.

The leishmaniases occur throughout the world and constitute apublic health problem in the countries of South and Central Amer-ica (WHO, 2008). They are caused by a protozoon of the genusLeishmania, which are grouped, according to Lainson and Shaw(1987), into two subgenus, Leishmania (Viannia) and Leishmania(Leishmania), which are subdivided into various species.

The infected patient can present symptoms ranging from local-ized forms, such as localized cutaneous and mucocutaneous lesions,to forms that compromise the whole system, known as visceralleishmaniasis. This wide spectrum of clinical manifestations de-pends on the host-parasite relationship and, primarily, on theinfecting species involved (Grimaldi and Tesh, 1993). It is known,for example, that Leishmania (Viannia) braziliensis causes cutaneousand/or mucous ulcers that are generally aggressive and can reoccurafter treatment and cure. Leishmania (Leishmania) amazonensiscauses cutaneous lesions that tend to spontaneously cure them-selves (Passos et al., 1999) and also are responsible for the anergicdiffuse cutaneous leishmaniasis (Gontijo and Carvalho, 2003).

Cutaneous leishmaniasis has been recorded in all the states ofBrazil. It is endemic in the North and Northeast of the Paraná State(Silveira et al., 1996; Lima et al., 2002), where the majority (98.7%)of Leishmania isolates has been identified as L. (V.) braziliensis(Silveira et al., 1999). Monoclonal antibodies have been used inthe Leishmania species identification and have enable L. (V.) brazili-

ll rights reserved.

).

(V.) braziliensis serodeme 1 predominates (63.6%) among thestrains isolated in the Paraná State (Silveira et al., 1999).

The knowledge of the Leishmania species and their clinical formscan help in making decisions about the therapeutic approach to beused, as some species show different responses to chemotherapeutictreatment. For example, cutaneous lesions caused by L. (V.) brazilien-sis should not be treated topically, due to the risk of metastasization,but by systemic chemotherapy (Moskowitz and Kurban, 1999);Leishmania (Leishmania) mexicana is less sensitive to antimonialsthan L. (V.) braziliensis (Koff and Rosen, 1994); Ketoconazole is effec-tive against L. (L.) mexicana, but not against L. (V.) braziliensis(Mimori et al., 1998). Thus, identification of the involved Leishmaniaspecies is crucial for choosing the most appropriate treatment.

Species identification is also important from an epidemiologicalpoint of view, as it allows the determination of the species geo-graphic distribution and helps in the development of appropriatecontrol measures (Grimaldi and Tesh, 1993; Degrave et al., 1994).

In recent years, various techniques such as monoclonal antibod-ies, isoenzyme electrophoresis, and RAPD (randomly amplifiedpolymorphic DNA analysis) have been used for the identificationof Leishmania species and as diagnostic tools (Barker, 1987; Grim-aldi et al., 1987; Le Blancq et al., 1987). However, they presentvarious difficulties, such as arduous procedures, difficulty in thedata interpretation, and the necessity to acquire parasites aliveor in high amount (Mimori et al., 1998).

Techniques based on DNA analysis are increasingly being usedin the diagnosis, characterization, and identification of Leishmaniaspecies (De Bruijn and Barker, 1992; Belli et al., 1998). Polymerase

V.M. Marcussi et al. / Experimental Parasitology 120 (2008) 300–305 301

chain reaction (PCR) has shown itself to be a quick, sensitive, and aspecific alternative in the detection and identification of these pro-tozoa, through the amplification of specific sequences of extra-nu-clear DNA present in the kinetoplast (kDNA) of the parasite (Lopezet al., 1993).

Recent studies have shown the importance of the kDNA use asthe subject of molecular techniques in the detection and classifica-tion of Leishmania species (Degrave et al., 1994; Weigle et al.,2002). Depending on the used primers, the technique allowsamplification of DNA that is specific to the genus, subgenus, or ofa particular species. However, no primers for the specific identifi-cation of L. (V.) braziliensis have been reported in the previous lit-erature. Therefore, the objective of this study was to developprimers specific to the identification of this Leishmania species.

2. Materials and methods

2.1. Parasites

Promastigote forms of Leishmania maintained in nitrogen weredefrosted and cultivated in 199 medium (Invitrogen, USA), con-taining 10% fetal bovine serum (Invitrogen, USA), 1% L-glutamine(Sigma–Aldrich, USA), 1% sterile human urine, and antibiotics(100 IU/mL penicillin G, 100 lg/mL streptomycin) at 25 �C in aB.O.D. chamber (Logen Scientific, Brazil). Table 1 shows the Leish-mania species used in this study.

Epimastigote forms of Trypanosoma cruzi (Y strain) were culti-vated in LIT (liver infusion tryptose) medium containing penicillinG (100 IU/mL) and streptomycin (100 lg/mL), supplemented with10% fetal bovine serum, in a B.O.D. chamber at 28 �C. The parasiteswere observed in an optical microscope until they reached theirstationary growth phase.

2.2. Preparation of samples containing DNA

The parasites (approximately 50 mL of culture) were washedthree times with sterile ice cold phosphate-buffered saline (PBS),

Table 1Used Leishmania and Trypanosoma species and a summary of the PCR results using the LB

Specie Isolate Internacional code

L. (V.) braziliensisSerodeme 1 M11272 MHOM/BR/1987/M112Serodeme 2 M14039 MHOM/BR/1992/444MSerodeme 3 M13108 MHOM/BR/1990/280JMSerodeme 5 M11115 MHOM/BR/1986/024-LSerodeme 6 M11119 MHOM/BR/1986/030-LSerodeme 7 M14006 MHOM/BR/1991/389SM

L. (V.) braziliensis M2903 MHOM/BR/1975/M290L. (V.) braziliensis M2904 MHOM/BR/1975/M290L. (V.) panamensis M4037 MHOM/PA/1967/BOYNL. (V.) panamensis M13144 MHOM/EC/1989/nataliL. (V.) guyanensis M4147 MHOM/BR/1975/M414L. (V.) guyanensis M17343 MHOM/BR1999/M1734L. (V.) naiffi M5533 MDAS/BR/1979/M5533L. (V.) naiffi M12968 IAYR/BR/1990/M12968L. (V.) naiffi M14229 MHOM/BR/1993/M142L. (V.) lainsoni M6426 MHOM/BR/1981/M642L. (V.) lainsoni M14263 MHOM/BR/1993/M142L. (V.) lainsoni M14269 MHOM/BR/1993/M142L. (V.) shawi M8408 MCEB/BR/1984/M8408L. (L.) mexicana M7369 MNYC/BZ/1962/M379L. (L.) chagasi BH46 MHOM/BR/1972/BH46L. (L.) mazonensis M2269 MHOM/BR/1973/M226L. (L.) major LV39 LV39T. cruzi Cepa Y

1, Isolates from patient carriers of American cutaneous leishmaniasis attending the LabMaringá, Maringá, Paraná, identified in the Instituto Evandro Chagas, Belém, Pará; 2, KindStraus, Universidade Federal de São Paulo, São Paulo; 4, Kindly provided by Dr. A. A. A.

by centrifugation (1600g for 10 min), resuspended in a known vol-ume of PBS, and then centrifuged again (1600g for 10 min). Thesupernatant was discarded and the sediment was frozen. The sed-iment was later resuspended in 200 lL of sterile Mili-Q water, washeated to 99 �C for 10 min, in a Thermocycler (Biometra PC, Ger-many), and then was centrifuged at 13,000g for 1 min. After that,the supernatant was stored at �18 �C until use.

Cutaneous border lesions material was collected by scrapping,using a metal scraper free from DNA. Lesions samples were placedin sterile microtubes containing with 100 ll of STE buffer (10 mMTRIS; 1 mM Na2EDTA H2O; 0.1 M NaCl; pH 8.0) and were stored at�18 �C, for posterior DNA extraction. For the DNA extraction, thetubes containing lesion scraping material were incubated at 95 �Cfor 30 min, in a Thermocycler (Biometra PC, Germany), and thencentrifuged at 13,000g for 1 min. After that, the supernatant wastransferred to another tube and stored at �18 �C until use.

To obtain the buffy coat, three milliliters of blood were added toan equal volume of ACD solution (25 mM citric acid, 50 mM so-dium citrate, 81 mM glucose) and submitted to centrifugation at1200g for 10 min. The buffy coat was transferred to a new tubeand was washed with a hypotonic solution (20 mM Tris, pH 8.0,10 mM EDTA) to lysate the erythrocytes, with centrifugation(1200g, 10 min). The obtained pellet was washed three times withPBS, with centrifugation as above. Aliquots of 50 lL were frozen at�18 �C. One aliquot was defrosted, 150 lL of pure dH2O wereadded, and the DNA was extracted as described for the parasites.

The DNA concentration of all samples was estimated by readingthe absorbance at 260 nm.

2.3. Conventional diagnosis methods for cutaneous leishmaniasis

For the parasite direct search (DS), the glass slide containing le-sion material were stained by the Giemsa method, and analyzedfor the presence of Leishmania sp. amastigotes forms. The Monte-negro skin test (MST) was accomplished by inoculation of 0.1 mlof antigen [L. (L.) amazonensis—40 lg/ml proteic nitrogen] on thepatient‘s forearm region. The reaction was evaluated after 48 h,

F1 and LBR1 primers

Source PCR

Host Donor

72 Man 1 +R Man 1 +

Man 1 +1 Man 2 +1 Man 2 +

PP Man 1 +3 Man 2 +4 Man 2 +TON Man 3 �

2 �7 Man 3 �3 2 �

Armadillo 2 �2 �

29 2 �6 Man 2 �63 2 �69 2 �

4 �4 �

Man 3 �9 3 �

3 ��

oratório de Ensino e Pesquisa em Análises Clínicas of the Universidade Estadual dely provided by Dr. J. J. Shaw, Instituto Evandro Chagas; 3, Kindly provided by Dr. A. H.de Souza, Instituto Evandro Chagas.

302 V.M. Marcussi et al. / Experimental Parasitology 120 (2008) 300–305

being considered positive a medium diameter superior or equal to5 mm. The reagent for MST was supplied by Immunobiological Pro-duction and Research Center, Paraná State Health Secretariat. Indi-rect immunofluorescence (IIF) was performed using as antigenspromastigote forms of L. (V.) braziliensis and human anti-immuno-globulin G conjugated with fluorescein (Biolab, Brazil). Serum sam-ples with titers equal to or greater than 40 were consideredpositive.

2.4. Primer design

Complete sequences of kDNA minicircle retrieved from Gen-Bank (www.pubmed.org) from several Leishmania spp. werealigned using the software ClustalW (http://www.ebi.ac.uk/clu-stalw/). The alignment has permitted to choose a kDNA nucleotideregion of L. (V.) braziliensis containing low homology with the otherspecies sequences. As the entire kDNA sequence comprehendsmore than 700 bp in most species, only a portion of the alignmentis shown in Fig. 1. The designed primers were denominated LBF1(50-AAATTCGCGTTTTTTGGCCTCCCCG-30) and LBR1 (50-GCATAAAC-TAGAGACGGAACAGAG-30) and they are 536 bp distant from eachother in the kDNA of L. (V.) braziliensis (Fig. 1). These oligonucleo-tides had a GC content of approximately 50% and were synthesizedby Invitrogen (Brazil).

2.5. PCR

The PCR was carried out in a total volume of 25 lL, containing1 lM of each primer (Invitrogen�, Brazil), 0.2 mM dNTPs (Invitro-gen�, USA), 1 U of Taq DNA Polimerase (Invitrogen�, USA), 1.5 mMmagnesium chloride, 1� enzyme buffer, and 4 lL of the samplecontaining DNA. The reaction amplification was carried out in aThermocycler (Biometra PC, Germany) and consisted of 26 cyclesof 1 min and 30 s at 94 �C, 1 min and 30 s at 58 �C, and 2 min at72 �C. Previously to the cycles, the samples were heated for5 min at 94 �C for an initial denaturation, and after the cycles thesamples were incubated for 10 min at 72 �C for a final extension.After that, the PCR was frozen at �18 �C until analysis. Positivecontrol consisted of the L. (V.) braziliensis promastigote formsDNA obtained as described above. Negative controls (no DNA tem-plate) were used in each experiment to test for the presence of

L. (V.) braziliensis AATGGCATACAGAAACCC-CGTL. (V.) peruviana AATGGCATACAGAAACCC-CGTL. (V.) guyanensis TTTGGCATACAGAAACCC-CGTL. (L.) chagasi ATT---TTTCGGGATTT----TL. (L.) major CAT---TTTTGGCCATT----TL. (L.) donovani AATCG-ATACAGAAACCC-CGTL. (V.) panamensis TATGGCCTCTAAGAGGGT-TGTL. (V.) lainsoni CTCTA-GTGCGGTATAAT-T-TL. (L.) amazonensis GTTGGTGTAAAATAGTG-----L. (L.) mexicana ACTGGCCTCCTAGGGCGTATGG

L. (V.) braziliensis TCTTCTCTCT---ATACGATCTL. (V.) peruviana TATTAGCTAA---AGTGGTTACL. (V.) guyanensis TATAATTTAA---ATTTATTAGL. (L.) chagasi TTTAAGTCAG--AATTCAATATL. (L.) major GGCACCCGAACCATTAAAACACL. (L.) donovani TATTATGTTTAATATAAGCTAAL. (V.) panamensis AATAGGGTCGAAATCGTACCACL. (V.) lainsoni AATTAGGGATAAAATCAACCACL. (L.) amazonensis AAATAGGGACAAAAAACGAAACL. (L.) mexicana AAATGGCCAG--AATTCCAAAC

Fig. 1. ClustalW alignment of some Leishmania kDNA minicircles. A portion of the aLeishmania (Viannia) peruviana (AN 87317), L. (V.) guyanensis (AN M87316), L. (L.) chagasAF399822), L. (V.) panamensis (AN AF118473), L. (V.) lainsoni (AN AF088234), L. (L.) amannealing positions of the LBF1 and LBR1 primers are underlined and highlighted.

DNA contamination of reagents and reaction mixtures. Ten micro-liters of the PCR were analyzed in an 1.2% agarose gel containingethidium bromide (0.25 lg/ml). Molecular weight markers werethe 100 bp markers from Invitrogen (USA). The PCR products werevisualized under UV light in a transiluminator (Macro Vue UV-20Hoefer, USA) and photographed with a digital camera (Canon,Japan).

2.6. Evaluation of the sensitivity and specificity of the LBF1 and LBR1primers

Leishmania (Viannia) braziliensis (M11272) DNA prepared asabove was used in different concentrations to determine the PCRsensitivity using the LBF1 and LBR1 primers. The reactions werecarried out using 400, 200, 100, 50, 25, 12.5, and 0.625 ng of DNAtemplate.

To evaluate the specificity of the primers, 400 ng of DNA fromthe parasites: L. (V.) braziliensis, Leishmania (Viannia) panamensis,Leishmania (Viannia) guyanensis, Leishmania (Viannia) naiffi, Leish-mania (Viannia) lainsoni, Leishmania (Leishmania) chagasi, L. (L.)amazonensis, Leishmania (Leishmania) major, and from T. cruzi wereused in the PCR.

2.7. Clinical samples testing

To evaluate the primers efficiency in detecting L. (V.) braziliesisin clinical samples, 100–400 ng of DNA from normal human buffycoat, from two positives and two negatives cutaneous leishmania-sis lesion material samples were used in the PCR.

3. Results

Initially, the conditions for the PCR as the MgCl2 concentration,the number of cycles, and the primers annealing temperature wereoptimized. The chosen annealing temperature was the one inwhich only one fragment was amplified and was based in theLBF1 and LBR1 primers GC content and length.

With regard to the sensitivity of the PCR, the LBF1 and LBR1primers amplified a DNA segment of 536 bp in the presence ofquantities of DNA template equal to or greater than 50 ng(Fig. 2).

TCAAAAATCCCCCAAAATTCG-CGTTTTTTGGCCTCCCCG 131 TCAAAAATAGCCCGAAAATCG-CGTTTTTTGGCCTCCCCG 132 TCAAAAATCTCCCGAAAATCA-CGTTTTTTGCCCTCCCCG 132 TTCGGGATTTTTCGGATTTTC-ACTCATATTCCAACCACC 104 TCCATCATTTTCCAGAATTTA-CGACACCCCCACAGCCCG 104 TCAAAAATGGGCCAAAAATGC-CGAAAATGGCCTCGGAGG 174 TACGAGCTTATCTAACTATAATCGCGAATAAACTTGGGTG 117 TAGAAACTAAACTTTTATTTGATGTTTGGAGCTTATATGT 119 ---GGGGTGGTGGGGATTTTTATTTTATTTGGAATTGTGA 93 TTGGGGGATCTGGGGTTTTTCCTTTTAATTTTTCCTTTTG 174

CTGT---TCCGTCTCTAGTTTATGCAGTTCAATTATACTT 658 TCTA---TATGCTGCTAGT---TGCACT--GATTACATTC 659 TTAA---TATGATATTTATTATTAACTTGTTATTA-GCTT 663 CTAAATTTAAGAAACCACCAAAA--CAGTGCACTAGGAGG 631 CAAAAACTGCTAGCCCACCCAAAACCAAGCCCCCAACCCC 636 CTTT---GATGACATAGAGAGTGACTTACGTAGTACAACT 753 CCGA---CATGCCTCTGGGTAGGGGCGTTCTGCGAAAACC 667 CCGA---CATGCCTCTGGGTAGGGGCTT--CTCGAAAATG 684 TTTT---CTGCCCGTGGGGGAGGGGCGTTCTGCGAAAATG 639 TTTT----CTGCCGTGGGGGAGGGGCGTTCTGCGGGGAGG 764

lignment of the kDNA minicircle sequence from L. (V.) braziliensis (AN M87315),i (AN AF308682), L. (L.) major (AN AF308685), Leishmania (Leishmania) donovani (ANazonenesis (AN M94090), and from L. (L.) mexicana (AN AY145437) is shown. The

V.M. Marcussi et al. / Experimental Parasitology 120 (2008) 300–305 303

In the evaluation of the primers specificity, a DNA fragment of536 bp was observed in the PCR when DNA from L. (V.) braziliensisserodemes 1, 2, 3, 5, 6, and 7 (Fig. 3A and B) and when DNA fromthe isolates of L. (V.) braziliensis M2903 and M2904 (Fig. 3C) wereused as DNA template. The 536 bp DNA fragment was not observedin the PCR when DNA from L. (V.) panamensis, L. (V.) guyanensis, L.(V.) naiffi, L. (V.) lainsoni, Leishmania (Viannia) shawi, L. (L.) chagasi,L. (L.) amazonensis, L (L.) major, and T. cruzi (Fig. 3C and D) wereused as DNA template. The PCR results are summarized in Table 1.

The utility of the designed primers and reaction for diagnosis ofhuman leishmaniasis was evaluated in human clinical samples, asscraping material collected from border lesions and normal humanbuffy coat. The obtained results are shown in Fig. 4. The obtaineddata has revealed the amplification of only one DNA fragment of536 pb in clinical materials that were confirmed to be positivefor cutaneous leishmaniasis using DS, MST, and IIF. No DNA ampli-fication was achieved when using in the PCR DNA template of nor-mal human buffy coat or negative cutaneous leishmaniasis lesions.

25 ng200 ng

MM100 ng50 ng

12.5 ng

6.25 ng400 ng

600 bp

Fig. 2. Sensitivity of the PCR method with the LBF1–LBR1 primer set. PCR using astemplate a twofold serial dilution of DNA obtained from crude extract ofpromastigote forms L. (V.) braziliensis (M11272). Agarose gel (1.2%) stained withethidium bromide showing the amplification products. MM indicates 100 bpMolecular Marker from Invitrogen (USA).

S1 (M11

272)

S2 (M14

039)

S3 (M13

108)

PC NC MM

PC NC MM

L. (L.

) amaz

onen

sis(M

2269

)

L. (L.)

major

(LV39

)

T. cru

ziL. (

V.)br

azili

ensis

M29

03

L. (V.)

braz

ilien

sisM

2904

600 bp

600 bp

D

A

C

Fig. 3. Specificity of the PCR protocol with the LBF1–LBR1 primer set. PCRs were carriedforms of Leishmania spp. and from epimastigote forms of T. cruzi. (A and B). Reactions usDNA from different species of Leishmania and T. cruzi. Reactions were analyzed in a 1.2%from L. (V.) braziliensis M11272), NC indicates the negative control (reaction mixture), a

These results demonstrate that the pair or primers LBF1–LBR1 canrecognize L. (L.) braziliensis DNA in clinical samples and that theydo not recognize any human DNA sequence.

4. Discussion

The leishmaniases are caused by a group of Leishmania species,each of which has different clinical and epidemiological character-istics. Therefore, the identification of the parasite species is animportant step for the disease diagnosis, making possible the ther-apy establishment and the prognosis (Grimaldi and Tesh, 1993;Koff and Rosen, 1994), as well as being important for disease-con-trol methods (Belli et al., 1998).

The diagnosis of cutaneous lesions is normally carried out by adirect search for the parasite in the lesions, the Montenegro SkinTest, and serology. However, these techniques do not characterizethe parasites to the species level. The advent of molecular methodsof diagnosis, as PCR (Belli et al., 1998; Rodgers et al., 1990; Lopezet al., 1993), has allowed greater sensitivity and faster diagnosis.However, this technique does not identify the L (V.) braziliensis atthe species level.

Recently, other techniques using PCR, as RAPD and SSR-PCR(simple sequence repeat anchored-PCR) have been employed inthe identification of Leishmania at the species level (Noyes et al.,1996; Volpini et al., 2001). RAPD requires purified DNA and highlystandardized conditions in order to be used, as well as being farless sensitive than the standard PCR (Noyes et al., 1996). In addi-tion, both techniques gives good results when using DNA obtainedfrom culture isolates, but they can not be used when using DNAobtained from clinical samples, because it suffers interference fromthe host DNA, which is present in this type of material (Volpiniet al., 2001).

In the present study, a pair of primers, denominated LBF1 andLBR1, were designed targeted to a region of the L. (V.) braziliensis

PC NC

PC NCM

MM

M

S5 (M11

115)

S6 (M11

119)

S7 (M14

006)

L. (V.)

lain

soni

(M64

26)

L. (V.)

pana

mensis

(M40

37)

L. (V.)

guya

nens

is(M

4147

)

L. (L.

) chag

asi (

BH46)

L. (V.)

naiff

i (M

5533

)

600 bp

600 bp

B

out with 100–400 ng of DNA template obtained from crude extract of promastigoteing DNA from different L. (V.) braziliensis serodemes (S). (C and D). Reactions usingagarose gel stained with ethidium bromide. PC indicates the positive control (DNA

nd MM indicates the 100 bp Molecular Marker from Invitrogen (USA).

BC Lesion +

Lesion +

Lesion -

Lesion -

NC PC MM

600 bp

Fig. 4. PCRs with the LBF1–LBR1 primer set with clinical samples. PCR wereaccomplished with 400 ng of DNA template obtained from crude extract of a normalhuman buffy coat (BF), a scrapping of cutaneous lesion border that was confirmedto be positive for cutaneous leishmaniasis using DS, MST, and IIF (Lesion +) and thatwas confirmed to be negative for that disease (Lesion �). Reactions were analyzedin a 1.2% agarose gel stained with ethidium bromide. PC indicates the positivecontrol (DNA from L. (V.) braziliensis M11272), NC indicates the negative control(reaction mixture), and MM indicates the 100 bp Molecular Marker from Invitrogen(USA).

304 V.M. Marcussi et al. / Experimental Parasitology 120 (2008) 300–305

kDNA. A PCR protocol was generated and used with this pair ofprimers to detect and identify this Leishmania species in crude ex-tract of promastigote and in clinical samples. Furthermore, thereaction was evaluated regarding its sensitivity and specificity.

The designed primers have demonstrated to be highly specificfor detection and identification of L. (V.) braziliensis, since theywere able to amplify a 536 bp DNA fragment when DNA from var-ious serodemes and isolates of this species was used in the PCR andwere not able to amplify any DNA fragment when DNA from theother Leishmania species or from T. cruzi was used (Fig. 3, Table1). The negative result obtained when DNA from T. cruzi was usedis important as mixed Leishmania and T. cruzi infections are knownto occur (Chiaramonte et al., 1996) and the serologic methods usedin the leishmaniasis diagnosis presents cross-reactions with T. cruzi(Belli et al., 1998; Weigle et al., 2002; Vexenat et al., 1996).

With regard to the sensitivity of the primers pair designed inthis work, the 536 bp fragment of DNA was detected when usingas low as 50 ng of L. (V.) braziliensis DNA. As this concentrationwas determined by absorbance reading at 260 nm, and we haveworked with cell extracts, some protein contamination may haveincreased this reading. Because of this we also have performedfluorometry using the Quant-iTTM dsDNA BR Assay Kit and the Qu-bitTM fluorometer (Invitrogen, USA) to better estimate the DNA con-centration of this sample. Fifty nanograms of DNA determined byA260 reading is equivalent to 4 ng in the fluorometry method,which only detects DNA. However, this sensitivity is lower thanthe ones reported in the literature as, for example, the one detectedby Lopez et al. (1993), which sensitivity was 0.14 fg of DNA. Evenbeing not too much sensitive, the pair of primers LBF1–LBR1 andthe developed PCR could be used for diagnosis because it hasproved to be specific for the species L. (V.) braziliensis, in oppositionto the others described in the literature that are specific only to thegenus or subgenus.

The clinical results obtained shows that the designed primersand PCR could amplify a DNA fragment from cutaneous lesion withpositive results for cutaneous leishmaniasis using DS, MST, and IIF.In opposition, it could not detect L. (V.) braziliensis from cutaneouslesions that had negative results with the used diagnosis tests andfrom a normal person blood buffy coat. This result agrees with theuse of these primers and reaction for the diagnosis of L. (V.) brazili-ensis in humans, because they detect and identify L. (V.) braziliensisin positive clinical samples and do not recognize the human DNA.

Considering the obtained data, one other use of the primers de-scribed in this work could be in epidemiological studies, contribut-ing to our understanding about the geographic distribution of the

species and, consequently, helping to develop appropriate mea-sures of control. Further studies are required to evaluate the per-formance of the LBF1 and LBR1 primers and reaction in thesestudies.

Acknowledgments

The authors would like to thank Fundação Araucária and Conse-lho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)for their financial support of this work. The authors are also grate-ful to Dr. Mônica Lúcia Gomes, Universidade Estadual de Maringá,Maringá, Paraná, for kindly providing the T. cruzi (Y strain) used inthe study.

References

Barker, D.C., 1987. DNA diagnosis of human leishmaniasis. Parasitology Today 3,177–184.

Belli, A., Rodriguez, B., Aviles, H., Harris, E., 1998. Simplified polymerase chainreaction detection of new world Leishmania in clinical specimens of cutaneousleishmaniasis. American Journal of Tropical Medicine and Hygiene 58, 102–109.

Chiaramonte, M.G., Zwirner, N.W., Caropresi, S.L., Taranto, N.J., Malchiodi, E.L., 1996.Trypanosoma cruzi and Leishmania Spp. Human Mixed Infection. AmericanJournal of Tropical Medicine and Hygiene 54, 271–273.

De Bruijn, M.H., Barker, D.C., 1992. Diagnosis of new world leishmaniasis: specificdetection of species of the Leishmania braziliensis complex by amplification ofkinetoplast DNA. Acta Tropica 52, 45–58.

Degrave, W., Fernandes, O., Campbell, D., Bozza, M., Lopes, U., 1994. Use ofmolecular probes and PCR for detection and typing of Leishmania—a mini-review. Memórias do Instituto Oswaldo Cruz 89, 463–469.

Gontijo, B., Carvalho, M.L.R., 2003. Leishmaniose tegumentar americana. Revista daSociedade Brasileira de Medicina Tropical 36, 71–80.

Grimaldi Jr., G., David, J.R., McMahon-Pratt, D., 1987. Identification and distributionof New World Leishmania species characterized by serodeme analysis usingmonoclonal antibodies. American Journal of Tropical Medicine and Hygiene 36,270–287.

Grimaldi Jr., G., Tesh, R.B., 1993. Leishmaniases of the new world: current conceptsand implications for future research. Clinical and Microbiology Reviews 6, 230–250.

Koff, A.B., Rosen, T., 1994. Treatment of cutaneous leishmaniasis. Journal of theAmerican Academy of Dermatology 31, 693–708.

Lainson, R., Shaw, J., 1987. Evolution, classification and geographical distribution.In: Peters, W., Killick-Kendrick, R. (Eds.), The Leishmaniases in Biology andMedicine. Academic Press, London, pp. 1–120.

Le Blancq, S.M., Lanham, S.M., Evans, D.A., 1987. Comparative isoenzyme profilesof Old and New World Leishmania. In: Peters, W., Killick-Kendrick, R. (Eds.),The Leishmaniases in Biology and Medicine. Academic Press, London, pp. 543–551.

Lima, A.P., Minelli, L., Comunello, E., Teodoro, U., 2002. Distribuição da leishmaniosetegumentar por imagens de sensoriamento remoto orbital, no Estado do Paraná,Brasil. Anais Brasileiros de Dermatologia 77, 681–692.

Lopez, M., Inga, R., Cangalaya, M., Echevarria, J., Llanos-Cuentas, A., Orrego, C.,Arevalo, J., 1993. Diagnosis of Leishmania using the polymerase chain reaction: asimplified procedure for field work. American Journal of Tropical and MedicineHygiene 49, 348–356.

Mimori, T., Sasaki, J., Nakata, M., Gomez, E.A., Uezato, H., Nonaka, S., Hashiguchi, Y.,Furuya, M., Saya, H., 1998. Rapid identification of Leishmania species fromformalin-fixed biopsy samples by polymorphism-specific polymerase chainreaction. Gene 210, 179–186.

Moskowitz, P.F., Kurban, A.K., 1999. Treatment of cutaneous leishmaniasis:retrospectives and advances for the 21st century. Clinics in Dermatology 17,305–315.

Noyes, H.A., Belli, A.A., Maingon, R., 1996. Appraisal of various random amplifiedpolymorphic DNA-polymerase chain reaction primers for Leishmaniaidentification. American Journal of Tropical Medicine and Hygiene 55, 98–105.

Passos, V.M.A., Fernandes, O., Lacerda, P.A.F., Volpini, A.C., Gontijo, C.M.F., Degrave,W., Romanha, A.J., 1999. Leishmania (Viannia) braziliensis is the predominantspecies infecting patients with American cutaneous leishmaniasis in the State ofMinas Gerais, Southeast Brazil. Acta Tropica 72, 251–258.

Rodgers, M.R., Popper, S.J., Wirth, D.F., 1990. Amplification of kinetoplast DNA as atool in the detection and diagnosis of Leishmania. Experimental Parasitology 71,267–275.

Shaw, J.J., Lainson, R., McMahon-Pratt, D., David, J.R., 1986. Serodemes of theLeishmania braziliensis complex. In: Rioux, J. (Ed.), Leishmania Taxonomie etphylogenése. Applications éco-épidémiologiques. Colloque International,IMEEE, Montpellier, pp. 179–183.

Silveira, T.G.V., Teodoro, U., Lonardoni, M.V.C., Guilherme, A.L.F., Toledo, M.J.O.,Ramos, M., Arraes, S.M.A.A., Bertolini, D.A., Spinosa, R.P., Barboza, O.C., 1996.Aspectos epidemiológicos da leishmaniose tegumentar em áreas endêmicas doestado do Paraná, sul do Brasil. Cadernos de Saúde Pública 12, 141–147.

V.M. Marcussi et al. / Experimental Parasitology 120 (2008) 300–305 305

Silveira, T.G.V., Arraes, S.M.A.A., Bertolini, D.A., Teodoro, U., Lonardoni, M.V.C.,Roberto, A.C.B.S., Ramos, M., Sobrinho, A.N., Ishikawa, E., Shaw, J., 1999.Observações sobre o diagnóstico laboratorial e a epidemiologia da leishmaniosetegumentar no Estado do Paraná, sul do Brasil. Revista da Sociedade Brasileirade Medicina Tropical 32, 413–423.

Vexenat, A.C., Santana, J.M., Teixeira, A.R., 1996. Cross-reactivity of antibodies inhuman infections by kinetoplastid protozoa Trypanosoma crui, Leishmaniachagasi and Leishmania (Viannia) braziliensis. Revista do Instituto de MedicinaTropical de São Paulo 38, 177–185.

Volpini, A., Passos, V.A., Romanha, A., 2001. Attempt to differentiate Leishmania(Leishmania) amazonensis, L. (L.) chagasi, Leishmania (Viannia) braziliensis and L.(V.) guyanensis using the SSR-PCR technique. Parasitology Research 87, 1056–1059.

Weigle, K.A., Labrada, L.A., Lozano, C., Santrich, C., Barrer, D.C., 2002. PCR- baseddiagnosis of acute and chronic cutaneous Leishmaniasis caused by Leishmania(Viannia). Journal of Clinical Microbiology 40, 601–606.

World Health Organization (WHO), 2008. Available from: <http://www.who.int/zoonoses/diseases/leishmaniasis/en/>-accessed in Feb. 20/2008.