isolation, identification, and characterization of a...

Hindawi Publishing CorporationISRNMicrobiologyVolume 2013 Article ID 728134 7 pageshttpdxdoiorg1011552013728134

Research ArticleIsolation Identification and Characterization of a CellulolyticBacillus amyloliquefaciens Strain SS35 from Rhinoceros Dung

Shuchi Singh1 Vijayanand S Moholkar12 and Arun Goyal13

1 Center for Energy Indian Institute of Technology Guwahati Guwahati Assam 781 039 India2Department of Chemical Engineering Indian Institute of Technology Guwahati Guwahati Assam 781 039 India3 Department of Biotechnology Indian Institute of Technology Guwahati Guwahati Assam 781 039 India

Correspondence should be addressed to Vijayanand SMoholkar vmoholkariitgernetin andArunGoyal arungoyliitgernetin

Received 30 March 2013 Accepted 8 May 2013

Academic Editors L Brusetti J Kreth M C Lai and J Maupin-Furlow

Copyright copy 2013 Shuchi Singh et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Cellulose hydrolyzing bacteria were isolated from rhinoceros dung and tested for clear zone formation around the colonies on theagar plates containing the medium amended with carboxymethylcellulose as a sole carbon source Isolates were further screenedon the basis of carboxymethylcellulase production in liquid medium Out of 36 isolates isolate no 35 exhibited maximum enzymeactivity of 0079UmL andwas selected for further identification by using conventional biochemical tests and phylogenetic analysesThis was a Gram-positive spore forming bacterium with rod-shaped cells The isolate was identified as Bacillus amyloliquefaciensSS35 based on nucleotide homology and phylogenetic analysis using 16S rDNA and gyrase A gene sequences

1 Introduction

Cellulose a structural carbohydrate of the plant cell wall is anabundant and ubiquitous polymerThe use of cellulose for thesecond generation biofuel production involves the hydrolysisof cellulosic biomass that is saccharification to form simplesugar monomers for the fermentation into bioethanol [1ndash3]Cellulases are the group of enzymes involved in the con-version of cellulosic substrates to fermentable sugars Mainmembers of this group include endoglucanase (EC 3214)exoglucanase or cellobiohydrolase (EC 32191) and 120573-glucosidase (EC 32121) [4] The endoglucanase hydrolyzes120573-14 bonds in cellulose molecule whereas exoglucanasecleaves the ends to release cellobiose and 120573-glucosidaseconverts cellobiose to glucose [5] Several cellulase produc-ing fungi such as Aspergillus Rhizopus and Trichodermaspecies [6 7] and bacteria such as Bacillus Clostridium Cel-lulomonas Thermomonospora Ruminococcus BacteroidesErwinia and Acetivibrio species [8ndash10] have been identifiedHowever the isolation and characterization of novel cellulosehydrolyzing enzymes from bacteria are still a highly activeresearch area because bacteria have a higher growth rate

than fungi leading to greater production of enzymes [11]Also the habitat of bacteria covers different environmentalniches which favors the existence of versatile strains suchas thermophiles [12] psychrophiles alkaliphiles and aci-dophiles The culturable cellulase producing bacteria havebeen isolated from the variety of sources such as compostingheaps decaying agricultural wastes the feces of cow [13] andelephant gastrointestinal tract of buffalo and horse [14] soiland extreme environments like hot-springs [15] Cellulosedegrading bacteria play an important role in energy supplyfor forage animals Wahyudi et al [14] and Varga and Kovler[16] have reported that the feed fibers were not completelyconverted to animal product in intensive animal farming and20ndash70undigested cellulosewas carried outwith feces Somestudies have explained that the crude fiber degradation in gutis not optimal and the fiber content of feces is still high [17]which can be utilized efficiently by microbes present in thefeces of the herbivores Rhinoceros are presumed to have anefficient system for cellulose digestion as its main food wildgrass primarily consists of cellulose In this study the dung ofthe pachyderm from Kaziranga National Park Assam Indiahas been used as the source of cellulolytic bacteria

2 ISRNMicrobiology

2 Materials and Methods

21 Substrate and Chemicals Carboxymethylcellulose(CMC) (low viscosity 50ndash200 cP) was procured from SigmaAldrich (St Louis Mo USA) Medium components andcongo red (analytical grade) were procured from Hi-MediaPvt Ltd India

22 Sample Collection The dung sample of one-hornedIndian Rhinoceros (Rhinoceros unicornis) was collected fromits natural habitat Kaziranga National Park Assam IndiaPresterilized spatula and plastic bags were used for samplecollection and before bacterial isolation the samples werestored at 4∘C in ice box for approximately 12 h

23 Isolation of Cellulolytic Bacteria Dung sample (05 g)was suspended with 50mL 085 (wv) sterile NaCl solutionin a 250mL conical flask which was shaken at 180 rpm for1 h at 37∘C Serial dilutions from 100 to 10minus7 were preparedusing sterilized saline solution An aliquot of 100 120583L of eachdilution was spread plated onto Bushnell Haas medium(BHM) [18] agar plates amended with carboxymethylcellu-lose (CMC) (pH 70) containing (gL) CMC (100) K

2HPO4

(10) KH2PO4(10) MgSO

4sdot7H2O (02) NH

4NO3(10)

FeCl3sdot6H2O (005) CaCl

2(002) and agar (200) [19 20]The

plates were incubated at 37∘C for 96 h

24 Qualitative Screening of Cellulolytic Bacteria by PlateStaining Method Morphologically dissimilar and discretecolonies were picked from different dilution plates andstreaked on separate BHM-CMC plate with grids drawn overit and incubated at 37∘C for 96 h The replica plates werealso prepared separately for staining [21] The replica plateswere flooded with 03 congo red for 20min The stainwas poured off and the plates were washed with 1M NaCl[22] The isolates showing clear zone around the colonieswere picked from master plate and further used for theenzyme production in liquid medium The selected cultureswere maintained on nutrient agar slants containing (gL)peptone (50) beef extract (10) yeast extract (20) NaCl(50) and agar (200) The culture slants were stored at 4∘Cand subcultured every 10ndash15 days

25 Quantitative Determination of Extracellular Carbox-ymethylcellulase (CMCase) Production The isolates selectedon the basis of plate staining method were grown in50mL enzyme production medium (at pH 70) contain-ing the following components (gL) CMC (100) K

2HPO4


4sdot7H2O (02) NH

4NO3(10)


2(002) and yeast extract (50)

This medium is the same as the previously used mediumduring isolation with the only difference of addition of yeastextractThis addition is to provide additional nitrogen sourceand enhance the growth rate 50mL medium (containing2 inoculum) was taken in 250mL Erlenmeyer flask andincubated at 37∘C at 180 rpm for 72 h After every 6 h theculture was centrifuged at 12000 g for 20min at 4∘CThe cell-free culture broth containing the crude enzyme was used forestimation of CMCase activity Based on the higher CMCase

activity (as described later) an isolate SS35 (named after itscolony number) was selected for further characterization andidentification The enzyme production by the isolate SS35was monitored with cell growth at 600 nm using UV-visiblespectrophotometer (Perkin Elmer Model lambda-45)

26 CMCase Activity Assay The CMCase activity (UmL)was measured by estimation of reducing sugars liberatedfrom CMC The enzyme assay was carried out by incubatingthe enzyme with CMC for 15min at 37∘C The reactionmixture (100 120583L) contained 50 120583L of enzyme and 10 (wv)final concentration of CMC in 50mM phosphate buffer (pH70) The reducing sugar was estimated by the method ofNelson and Somogyi [23 24] The absorbance was measuredat 500 nm using a UV-visible spectrophotometer (PerkinElmer Model lambda-45) against a blank with d-glucose asstandard One unit (U) of cellulase activity is defined as theamount of enzyme that liberates 1 120583mol of reducing sugar(glucose) in 1min at 37∘C and pH 70

27 Morphological and Biochemical Characterizations of theIsolate SS35 Morphological and biochemical properties ofthe isolate were identified evaluated and compared asdescribed in BergeyrsquosManual of Systematic Bacteriology [25]The cell morphology of the selected isolate was observedunder scanning electron microscope (Leo 1430 VP LeoElectron Microscopy Ltd Cambridge UK) at 14 kV Gramstaining endospore staining and urease test were doneas per standard protocol [26] The catalase activity wasdetermined adding few drops of 3 (vv) H

2O2to 5mL

of 18 h grown culture [27] The Nitrate Agar slants (M072HiMedia) were used to test nitrate reducing property ofthe isolate SS35 BHM amended with starch was used foramylase activity determination Triple Sugar Iron (TSI) slants(M021I HiMedia) containing three sugars namely glucoselactose and sucrose were used for acid and H

2S production

test Acid production after carbohydrate fermentation wasdetected by the visible change in color from red to yellowThe temperature tolerance test was performed by growing theisolate in nutrient broth and incubating at the temperaturesranging 20∘ndash50∘C

28 Analyses of 16S Ribosomal DNA (rDNA) and PartialGyrase A (gyrA) Gene Sequences 16S rDNA and partialgyrase A gene sequencing of bacterial culture were donein Xcelris Labs Limited Ahmedabad India The genomicDNA of the isolate SS35 was extracted using Qiagen DNAextraction kit and purified by QIAamp DNA PurificationKit (Qiagen) for nucleotide sequence analysis The universal16S rDNA primer 8F (51015840 AGAGTTTGATCCTGGCTCAG31015840) and 1492R (51015840 ACGGCTACCTTGTTACGACTT 31015840)were used for amplification of genomic DNA by poly-merase chain reaction (PCR) The gyrA region was ampli-fied using the primers p-gyrA-F (51015840 CAGTCAGGAAAT-GCGTACGTCCTT 31015840) and p-gyrA-R (51015840 CAAGGTAAT-GCTCCAGGCATTGCT 31015840) [28] The concentration of eachprimer in 25120583L PCR reaction mixture was 10 pmol and 1XPCR master mix (MBI Fermentas) The PCR reaction was

ISRNMicrobiology 3

run for 30 cycles in a Thermal Cycler (Eppendorf) and thethermal profile used for the PCR was as follows initial denat-uration at 95∘C for 2min final denaturation at 94∘C for 30 sprimer annealing at 52∘C for 30 s and extension at 72∘C for90 s Full extension of the products was ensured by runninga final cycle that included extension for 10min at 72∘C PCRproduct of 5 120583L from each tube was mixed with 1 120583L of 6X gelloading dye and thismixturewas subjected to electrophoresison 12 agarose gel to confirm the targeted PCR amplifica-tion The amplified product was excised from the gel andpurified using QIAamp DNA Purification Kit (Qiagen) Theconcentration of the purified DNA was determined and itwas subjected to automated DNA sequencing on ABI 3730xlGenetic Analyzer (Applied Biosystems USA) The cyclesequencing was carried out using BigDye Terminator v31Cycle sequencing kit following manufacturerrsquos instructionsThe cycle sequencing was carried out in a final reactionvolume of 20 120583L using 200120583L capacity PCR tubeThe cyclingprotocol was designed for 25 cycles as follows denaturationat 96∘C for 10 s annealing at 52∘C for 5 s and extensionat 60∘C for 4min After cycling the extension productswere purified and mixed well in 10 120583L of Hi-Di formamideEluted products were placed in a sample plate heated at95∘C for 5min chilled and loaded into autosampler of theinstrument Both the ends of the sequences were verifiedwith the chromatogram file and the resulted consensussequences were used to carry out Basic Local AlignmentSearch Tool (BLAST) with nr database of NCBI GenBankusingMEGABLAST algorithmMultiple sequence alignmentwas performed by using CLUSTALW [29] and evolutionaryhistory was inferred using the neighbor-joiningmethod [30]The evolutionary distances were computed using the Kimura2-parameters method [31] and phylogenetic analysis wascarried out with MEGA4 [32]

3 Results and Discussion

31 Isolation and Screening of Cellulolytic Bacteria by PlateStaining Method Among 36 isolates 9 cellulose hydrolyzingmicroorganisms were screened on the basis of plate stainingmethod The isolates (no 21 24 25 28 31 32 34 35 and 36)showed clear zone around colonies after staining the plateswith congo red and destaining with 1M NaCl as shown inFigure 1 However plate-screeningmethod is not quantitativebecause of poor correlation between enzyme activity andcolony to clear zone ratio [12] The colonies showing yellow-colored halo zones were picked from replica plate andfurther screened on the basis of CMCase production inliquid medium Out of 9 isolates isolate no 35 exhibitedmaximum CMCase activity of 0079UmL (details givenin Table 1) This value was higher than activity of CMCaseproduced from some known natural isolates (expressed permL of cell-free culture broth) for example Cellulomonas sp(00336UmL isolated from coir retting effluents) Micro-coccus sp (00152UmL isolated from coir retting effluents)Bacillus sp (00197UmL isolated fromcoir retting effluents)Brevibacillus sp JXL (002UmL isolated from swine waste)Brevibacillus sp DUSELG12 (002UmL isolated from gold

Table 1 CMCase activity (UmL cell-free culture broth) of cellulaseproducing isolates (after 48 h at 37∘C 180 rpm andmedium pH 70)

Isolate no CMCase activity (UmL)21 0063 plusmn 000824 0059 plusmn 000325 0072 plusmn 001028 0073 plusmn 000831 0071 plusmn 000632 0067 plusmn 000734 0057 plusmn 000435 0079 plusmn 001136 0049 plusmn 0003lowastValues are mean plusmn SE (n = 3)

mine) Geobacillus sp DUSELR7 (0058UmL isolated fromgold mine)Geobacillus sp (00113UmL isolated from sugarrefinery wastewater) and Bacillus subtilis AS3 (007UmLisolated from cow dung) [33ndash37] Ariffin et al [38] havereportedmaximumCMCase activity of 0079UmL by Bacil-lus pumilus EB3 produced in a 2 L stirred tank reactor whichwas equal to the CMCase activity of the isolate in this studyThus the isolate no 35was revealed to be an efficient CMCaseproducer species andwas designated as SS35 Further analysisof this species was done as described belowThe growth curveof SS35 along with CMCase production profile (Figure 2)revealed that the enzyme production was associated with cellgrowth and reachedmaximum at late log phase Slight reduc-tion in enzyme production after 48 h could be a consequenceof instability of the enzyme at 37∘C or the activity of proteasespresent in the crude enzyme solution

32 Morphological and Biochemical Characterization of theIsolate SS35 The isolate SS35 was found to be rod-shapedcells with a width and length of 05ndash06 120583m and 15ndash16 120583mrespectively as observed under scanning electronmicroscope(Figure 3)The isolate was found to be a Gram-positive sporeforming bacterium and it gave positive test for catalasenitrate reduction and starch hydrolysis whereas negative forurease and hydrogen sulfide productionThe absence of blackprecipitate at the base of the tube indicated that hydrogensulfide was not produced The color of TSI agar slant wasturned from red to yellow which indicated that the bacteriumwas able to ferment the sugars glucose lactose and sucroseThe temperature tolerance test revealed that the isolate wasable to grow at a wide temperature range 20∘ndash50∘C Thesecharacteristics have been summarized in Table 2

33 Identification on the Basis of Phylogenetic Analyses Thephylogenetic tree generated using 16S rDNA gene sequencesof the isolate SS35 showed that the bacterium has the highesthomology with Bacillus amyloliquefaciens NBRC 3035 (Gen-Bank accession no AB6799941) (Figure 4) The bacterialidentification using 16S rDNA gene sequence is a widelypracticed technique although with limitations for the mem-bers of closely related taxa [39] To overcome this limitationseveral studies have been done which concluded that some

4 ISRNMicrobiology

(a1)

(a2)

(b1)

(b2)

(c1)

(c2)

Figure 1 Petri plates containing 1 CMC agar incubated at 37∘C for 96 h (a1) (b1) and (c1) colonies before staining with 03 congo red(a2) (b2) and (c2) colonies after staining

Time (h)0 10 20 30 40 50 60 70 80

CMCa

se ac

tivity

(Um

L)

000

002

004

006

008

010

012

00

02

04

06

08

10

12

14

Cel

l OD600

CMCase activity (UmL)Cell OD600

Figure 2 Enzyme production profile and growth curve of strainSS35

protein-coding genes such as RNA polymerase (rpoB) gene[40] RNA polymerase sigma factor (rpoD) gene Gyrase B(gyrB) gene [41] and gyrase A (gyrA) gene [28] can beused for the identification of closely related taxa because the

Figure 3 SEM micrograph for morphological characterization ofisolate SS35 (inset enlarged micrograph of a single cell)

genetic variation in protein-coding genes are much higherChun and Bae [28] demonstrated that the gyrA sequencescode for DNA gyrase subunit A can be used for accurateidentification of Bacillus amyloliquefaciens and related taxaincluding Bacillus subtilis Bacillus vallismortis Bacillusmojavensis Bacillus atrophaeus and Bacillus licheniformis

ISRNMicrobiology 5

Isolate SS35

Bacillus amyloliquefaciens NBRC 3035


Bacillus amyloliquefaciens Rx-35

Bacillus subtilis PA105


Bacillus methylotrophicus MD70

Bacillus subtilis SP4Bacillus sp BL53

Bacillus sp AEPR21Bacillus vallismortis

17

8

21

12

8

Figure 4 Neighbor-joining tree based on 16S rDNA sequences of Bacillus amyloliquefaciens SS35

7699

87

100

100

10069

96

Bacillus sp NRRL B-23980


Bacillus sp NK-2




Isolate SS35

Bacillus amyloliquefaciens FZB45Bacillus subtilis subsp spizizenii NRRL B-23049

Bacillus licheniformis MY75

Bacillus licheniformis RS-1

Figure 5 Neighbor-joining tree based on partial gyrA gene sequences of Bacillus amyloliquefaciens SS35

Therefore in this study partial gyrA gene sequences havebeen used for the confirmation of the result obtained from16S rDNA sequence analysisThe phylogenetic analysis usingpartial gyrAgene sequences also revealed that the isolate SS35has the highest homology with Bacillus amyloliquefaciensFZB45 (GenBank accession no FN6628401) [42] as shownin Figure 5 Numbers at nodes of the tree are indications ofthe levels of bootstrap support based on a neighbor-joininganalysis of 1500 resampled datasets The isolate SS35 wasidentified as Bacillus amyloliquefaciens and designated asBacillus amyloliquefaciens SS35The 16S rDNA and gyrA genesequences of the isolate B amyloliquefaciens SS35 have beendeposited in the NCBI nucleotide sequence database underthe accession nos JX674030 and KF019284 respectively

4 Conclusions

Cellulose hydrolytic bacteria have been isolated from rhinoc-eros dung and some potent cellulose degrading bacteria havebeen identified Among all cellulolytic bacteria isolate no 35exhibited maximum CMCase production and has been fur-ther characterized by biochemical methods Bacterium hasbeen identified as Bacillus amyloliquefaciens SS35 on the basis

Table 2 Differential characteristics of Bacillus amyloliquefaciensSS35

Characteristicbiochemical test ObservationCell shape RodCell size 05ndash06 120583m times 15ndash16 120583mGramrsquos reaction +Endospore formation +Acid production from

Glucose +Lactose +Sucrose +Catalase test +Urease test minus

NO3 reduction into NO2 +H2S production minus

Starch hydrolysis +Growth between 20 and 50∘C +

+ positive reaction minus negative reaction

of 16S rDNA and partial gyrase A gene sequence analysesThe CMCase production has been observed to be associated

6 ISRNMicrobiology

with cell growth and has maxima at the late exponentialphase of growth Optimization of medium composition andfermentation parameters can further increase the cellulaseproduction from B amyloliquefaciens SS35 These attributesalso make B amyloliquefaciens SS35 a potential candidatein solid state fermentation for CMCase production usingcellulosic biomass

Acknowledgment

Research funding from Department of Biotechnology Gov-ernment of India for this work is gratefully acknowledged

References

[1] Y Sun and J Cheng ldquoHydrolysis of lignocellulosic materials forethanol production a reviewrdquo Bioresource Technology vol 83no 1 pp 1ndash11 2002

[2] C Martın Y Lopez Y Plasencia and E Hernandez ldquoChar-acterisation of agricultural and agro-industrial residues as rawmaterials for ethanol productionrdquo Chemical and BiochemicalEngineering Quarterly vol 20 no 4 pp 443ndash447 2006

[3] O J Sanchez and C A Cardona ldquoTrends in biotechnologicalproduction of fuel ethanol from different feedstocksrdquo Biore-source Technology vol 99 no 13 pp 5270ndash5295 2008

[4] E A Bayer R Lamed and M E Himmel ldquoThe potential ofcellulases and cellulosomes for cellulosic waste managementrdquoCurrent Opinion in Biotechnology vol 18 no 3 pp 237ndash2452007

[5] M K Bhat and S Bhat ldquoCellulose degrading enzymes and theirpotential industrial applicationrdquo Biotechnology Advances vol15 no 3-4 pp 583ndash620 1997

[6] K Murashima T Nishimura Y Nakamura et al ldquoPurificationand characterization of new endo-14-120573-D-glucanases fromRhizopus oryzaerdquoEnzyme andMicrobial Technology vol 30 no3 pp 319ndash326 2002

[7] K Saito Y Kawamura and Y Oda ldquoRole of the pectinolyticenzyme in the lactic acid fermentation of potato pulp by Rhi-zopus oryzaerdquo Journal of Industrial Microbiology and Biotech-nology vol 30 no 7 pp 440ndash444 2003

[8] L M Roboson and G H Chambliss ldquoCelluases of bacterialoriginrdquo Enzyme and Microbial Technology vol 11 no 10 pp626ndash644 1989

[9] Y J Lee B K Kim B H Lee et al ldquoPurification and character-ization of cellulase produced by Bacillus amyoliquefaciens DL-3 utilizing rice hullrdquo Bioresource Technology vol 99 no 2 pp378ndash386 2008

[10] B K Kim B H Lee Y J Lee I H Jin C H Chung and J WLee ldquoPurification and characterization of carboxymethylcellu-lase isolated from a marine bacterium Bacillus subtilis subspsubtilis A-53rdquo Enzyme and Microbial Technology vol 44 no 6-7 pp 411ndash416 2009

[11] L R Lynd P J Weimer W H Van Zyl and I S PretoriusldquoMicrobial cellulose utilization Fundamentals and biotechnol-ogyrdquoMicrobiology andMolecular Biology Reviews vol 66 no 3pp 506ndash577 2002

[12] M Maki K T Leung and W Qin ldquoThe prospects of cellulase-producing bacteria for the bioconversion of lignocellulosicbiomassrdquo International Journal of Biological Sciences vol 5 no5 pp 500ndash516 2009

[13] N Akhtar A Sharma D Deka M Jawed D Goyal and AGoyal ldquoCharacterization of cellulase producing Bacillus spfor effective degradation of leaf litter biomassrdquo EnvironmentalProgress and Sustainable Energy 2012

[14] A Wahyudi M N Cahyanto M Soejono and Z BachruddinldquoPotency of lignocellulose degrading bacteria isolated fromBuffalo and horse gastrointestinal tract and elephant dungfor feed fiber degradationrdquo Journal of the Indonesian TropicalAnimal and Agriculture vol 35 no 1 pp 34ndash41 2010

[15] R H Doi ldquoCellulases of mesophilic microorganisms cellulo-some and noncellulosome producersrdquo Annals of the New YorkAcademy of Sciences vol 1125 pp 267ndash279 2008

[16] G A Varga and E S Kovler ldquoMicrobial and animal limitationto fiber digestion and utilizationrdquo Journal of Nutrition vol 127no 5 pp 819ndash823 1997

[17] DOKrause S EDenmanR IMackie et al ldquoOpportunities toimprove fiber degradation in the rumen microbiology ecologyand genomicsrdquo FEMS Microbiology Reviews vol 27 no 5 pp663ndash693 2003

[18] D L Bushnell and H F Haas ldquoThe utilization of certain hydro-carbons by microorganismsrdquo Kansas Agricultural ExperimentStation vol 199 pp 653ndash673 1941

[19] Y C Lo G D Saratale W M Chen M D Bai and J S ChangldquoIsolation of cellulose-hydrolytic bacteria and applications ofthe cellulolytic enzymes for cellulosic biohydrogen productionrdquoEnzyme and Microbial Technology vol 44 no 6-7 pp 417ndash4252009

[20] R M Atlas Handbook of Microbiological Media CRC PressBoca Raton Fla USA 3rd edition 2004

[21] H J Ruijssenaars and S Hartmans ldquoPlate screening methodsfor the detection of polysaccharase-producing microorgan-ismsrdquoAppliedMicrobiology and Biotechnology vol 55 no 2 pp143ndash149 2001

[22] RM Teather and P JWood ldquoUse of Congo red-polysaccharideinteractions in enumeration and characterization of cellulolyticbacteria from the bovine rumenrdquo Applied and EnvironmentalMicrobiology vol 43 no 4 pp 777ndash780 1982

[23] N Nelson ldquoA photometric adaptation of the Somogyi methodfor the determination of glucoserdquo Journal of Biological Chem-istry vol 153 pp 375ndash380 1944

[24] M Somogyi ldquoA new reagent for the determination of sugarsrdquoJournal of Biological Chemistry vol 160 pp 61ndash68 1945

[25] D R Boone G M Garrity R W Castenholz D J Brenner NR Krieg and J T Staley ldquoGenus Bacillusrdquo in Bergeyrsquos Manualof Systematic Bacteriology The Firmicutes vol 3 pp 21ndash128Springer New York NY USA 2nd edition 2001

[26] J C Cappuccino and N ShermanMicrobiologymdashA LaboratoryManual Pearson Education Publication New Delhi India 7thedition 2004

[27] N Kannan Laboratory Manual in General Microbiology Pan-ima Publishing Incarporation New Delhi India 2002

[28] J Chun and K S Bae ldquoPhylogenetic analysis of Bacillus subtilisand related taxa based on partial gyrA gene sequencesrdquoAntonievan Leeuwenhoek vol 78 no 2 pp 123ndash127 2000

[29] J D Thompson D G Higgins and T J Gibson ldquoCLUSTALW improving the sensitivity of progressive multiple sequencealignment through sequence weighting position-specific gappenalties and weight matrix choicerdquoNucleic Acids Research vol22 no 22 pp 4673ndash4680 1994

[30] N Saitou and M Nei ldquoThe neighbor-joining method a newmethod for reconstructing phylogenetic treesrdquo Molecular biol-ogy and evolution vol 4 no 4 pp 406ndash425 1987

ISRNMicrobiology 7

[31] M Kimura ldquoA simple method for estimating evolutionary ratesof base substitutions through comparative studies of nucleotidesequencesrdquo Journal ofMolecular Evolution vol 16 no 2 pp 111ndash120 1980

[32] K Tamura J Dudley M Nei and S Kumar ldquoMEGA4 Molec-ular Evolutionary Genetics Analysis (MEGA) software version40rdquo Molecular Biology and Evolution vol 24 no 8 pp 1596ndash1599 2007

[33] G Immanuel R Dhanusha P Prema andA Palavesam ldquoEffectof different growth parameters on endoglucanase enzyme activ-ity by bacteria isolated from coir retting effluents of estuarineenvironmentrdquo International Journal of Environmental Scienceand Technology vol 3 no 1 pp 25ndash34 2006

[34] Y Liang J Yesuf S Schmitt K Bender and J Bozzola ldquoStudyof cellulases from a newly isolated thermophilic and cellulolyticBrevibacillus sp strain JXLrdquo Journal of Industrial Microbiologyand Biotechnology vol 36 no 7 pp 961ndash970 2009

[35] G Rastogi G L Muppidi R N Gurram et al ldquoIsolation andcharacterization of cellulose-degrading bacteria from the deepsubsurface of the Homestake gold mine Lead South DakotaUSArdquo Journal of Industrial Microbiology and Biotechnology vol36 no 4 pp 585ndash598 2009

[36] S K Tai H P P Lin J Kuo and J K Liu ldquoIsolation andcharacterization of a cellulolytic Geobacillus thermoleovoransT4 strain from sugar refinery wastewaterrdquo Extremophiles vol8 no 5 pp 345ndash349 2004

[37] D Deka P Bhargavi A Sharma D Goyal M Jawed and AGoyal ldquoEnhancement of cellulase activity from a new strainof Bacillus subtilis by medium optimisation and analysis withvarious cellulosic substratesrdquoEnzymeResearch vol 2011 ArticleID 151656 8 pages 2011

[38] H Ariffin N Abdullah M S U Kalsom Y Shirai and MA Hassan ldquoProduction and characterization of cellulase byBacillus pumilus EB3rdquo International Journal of Engineering andTechnology vol 3 pp 47ndash53 2006

[39] G E Fox J D Wisotzkey and P Jurtshuk ldquoHow close isclose 16S rRNA sequence identity may not be sufficient toguarantee species identityrdquo International Journal of SystematicBacteriology vol 42 no 1 pp 166ndash170 1992

[40] B J Kim S H Lee M A Lyu et al ldquoIdentification ofmycobacterial species by comparative sequence analysis of theRNA polymerase gene (rpoB)rdquo Journal of Clinical Microbiologyvol 37 no 6 pp 1714ndash1720 1999

[41] S Yamamoto and S Harayama ldquoPhylogenetic relationshipsof Pseudomonas putida strains deduced from the nucleotidesequences of gyrB rpoD and 16S rRNA genesrdquo InternationalJournal of Systematic Bacteriology vol 48 no 3 pp 813ndash8191998

[42] E E Idriss O Makarewicz A Farouk et al ldquoExtracellularphytase activity of Bacillus amyloliquefaciens FZB45 contributesto its plant-growth-promoting effectrdquoMicrobiology vol 148 no7 pp 2097ndash2109 2002

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

Hindawi Publishing Corporationhttpwwwhindawicom

GenomicsInternational Journal of

Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y


Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology

2 ISRNMicrobiology

2 Materials and Methods

21 Substrate and Chemicals Carboxymethylcellulose(CMC) (low viscosity 50ndash200 cP) was procured from SigmaAldrich (St Louis Mo USA) Medium components andcongo red (analytical grade) were procured from Hi-MediaPvt Ltd India

22 Sample Collection The dung sample of one-hornedIndian Rhinoceros (Rhinoceros unicornis) was collected fromits natural habitat Kaziranga National Park Assam IndiaPresterilized spatula and plastic bags were used for samplecollection and before bacterial isolation the samples werestored at 4∘C in ice box for approximately 12 h

23 Isolation of Cellulolytic Bacteria Dung sample (05 g)was suspended with 50mL 085 (wv) sterile NaCl solutionin a 250mL conical flask which was shaken at 180 rpm for1 h at 37∘C Serial dilutions from 100 to 10minus7 were preparedusing sterilized saline solution An aliquot of 100 120583L of eachdilution was spread plated onto Bushnell Haas medium(BHM) [18] agar plates amended with carboxymethylcellu-lose (CMC) (pH 70) containing (gL) CMC (100) K

2HPO4


4sdot7H2O (02) NH

4NO3(10)


2(002) and agar (200) [19 20]The

plates were incubated at 37∘C for 96 h

24 Qualitative Screening of Cellulolytic Bacteria by PlateStaining Method Morphologically dissimilar and discretecolonies were picked from different dilution plates andstreaked on separate BHM-CMC plate with grids drawn overit and incubated at 37∘C for 96 h The replica plates werealso prepared separately for staining [21] The replica plateswere flooded with 03 congo red for 20min The stainwas poured off and the plates were washed with 1M NaCl[22] The isolates showing clear zone around the colonieswere picked from master plate and further used for theenzyme production in liquid medium The selected cultureswere maintained on nutrient agar slants containing (gL)peptone (50) beef extract (10) yeast extract (20) NaCl(50) and agar (200) The culture slants were stored at 4∘Cand subcultured every 10ndash15 days

25 Quantitative Determination of Extracellular Carbox-ymethylcellulase (CMCase) Production The isolates selectedon the basis of plate staining method were grown in50mL enzyme production medium (at pH 70) contain-ing the following components (gL) CMC (100) K

2HPO4


4sdot7H2O (02) NH

4NO3(10)


2(002) and yeast extract (50)

This medium is the same as the previously used mediumduring isolation with the only difference of addition of yeastextractThis addition is to provide additional nitrogen sourceand enhance the growth rate 50mL medium (containing2 inoculum) was taken in 250mL Erlenmeyer flask andincubated at 37∘C at 180 rpm for 72 h After every 6 h theculture was centrifuged at 12000 g for 20min at 4∘CThe cell-free culture broth containing the crude enzyme was used forestimation of CMCase activity Based on the higher CMCase

activity (as described later) an isolate SS35 (named after itscolony number) was selected for further characterization andidentification The enzyme production by the isolate SS35was monitored with cell growth at 600 nm using UV-visiblespectrophotometer (Perkin Elmer Model lambda-45)

26 CMCase Activity Assay The CMCase activity (UmL)was measured by estimation of reducing sugars liberatedfrom CMC The enzyme assay was carried out by incubatingthe enzyme with CMC for 15min at 37∘C The reactionmixture (100 120583L) contained 50 120583L of enzyme and 10 (wv)final concentration of CMC in 50mM phosphate buffer (pH70) The reducing sugar was estimated by the method ofNelson and Somogyi [23 24] The absorbance was measuredat 500 nm using a UV-visible spectrophotometer (PerkinElmer Model lambda-45) against a blank with d-glucose asstandard One unit (U) of cellulase activity is defined as theamount of enzyme that liberates 1 120583mol of reducing sugar(glucose) in 1min at 37∘C and pH 70

27 Morphological and Biochemical Characterizations of theIsolate SS35 Morphological and biochemical properties ofthe isolate were identified evaluated and compared asdescribed in BergeyrsquosManual of Systematic Bacteriology [25]The cell morphology of the selected isolate was observedunder scanning electron microscope (Leo 1430 VP LeoElectron Microscopy Ltd Cambridge UK) at 14 kV Gramstaining endospore staining and urease test were doneas per standard protocol [26] The catalase activity wasdetermined adding few drops of 3 (vv) H

2O2to 5mL

of 18 h grown culture [27] The Nitrate Agar slants (M072HiMedia) were used to test nitrate reducing property ofthe isolate SS35 BHM amended with starch was used foramylase activity determination Triple Sugar Iron (TSI) slants(M021I HiMedia) containing three sugars namely glucoselactose and sucrose were used for acid and H

2S production

test Acid production after carbohydrate fermentation wasdetected by the visible change in color from red to yellowThe temperature tolerance test was performed by growing theisolate in nutrient broth and incubating at the temperaturesranging 20∘ndash50∘C

28 Analyses of 16S Ribosomal DNA (rDNA) and PartialGyrase A (gyrA) Gene Sequences 16S rDNA and partialgyrase A gene sequencing of bacterial culture were donein Xcelris Labs Limited Ahmedabad India The genomicDNA of the isolate SS35 was extracted using Qiagen DNAextraction kit and purified by QIAamp DNA PurificationKit (Qiagen) for nucleotide sequence analysis The universal16S rDNA primer 8F (51015840 AGAGTTTGATCCTGGCTCAG31015840) and 1492R (51015840 ACGGCTACCTTGTTACGACTT 31015840)were used for amplification of genomic DNA by poly-merase chain reaction (PCR) The gyrA region was ampli-fied using the primers p-gyrA-F (51015840 CAGTCAGGAAAT-GCGTACGTCCTT 31015840) and p-gyrA-R (51015840 CAAGGTAAT-GCTCCAGGCATTGCT 31015840) [28] The concentration of eachprimer in 25120583L PCR reaction mixture was 10 pmol and 1XPCR master mix (MBI Fermentas) The PCR reaction was

ISRNMicrobiology 3









4 ISRNMicrobiology

(a1)

(a2)

(b1)

(b2)

(c1)

(c2)


Time (h)0 10 20 30 40 50 60 70 80

CMCa

se ac

tivity

(Um

L)

000

002

004

006

008

010

012

00

02

04

06

08

10

12

14

Cel

l OD600






ISRNMicrobiology 5

Isolate SS35









17

8

21

12

8


7699

87

100

100

10069

96



Bacillus sp NK-2




Isolate SS35






4 Conclusions









6 ISRNMicrobiology


Acknowledgment


References































ISRNMicrobiology 7




















Volume 2014

Zoology





Volume 2014


















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

ISRNMicrobiology 3









4 ISRNMicrobiology

(a1)

(a2)

(b1)

(b2)

(c1)

(c2)


Time (h)0 10 20 30 40 50 60 70 80

CMCa

se ac

tivity

(Um

L)

000

002

004

006

008

010

012

00

02

04

06

08

10

12

14

Cel

l OD600






ISRNMicrobiology 5

Isolate SS35









17

8

21

12

8


7699

87

100

100

10069

96



Bacillus sp NK-2




Isolate SS35






4 Conclusions









6 ISRNMicrobiology


Acknowledgment


References































ISRNMicrobiology 7




















Volume 2014

Zoology





Volume 2014


















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

4 ISRNMicrobiology

(a1)

(a2)

(b1)

(b2)

(c1)

(c2)


Time (h)0 10 20 30 40 50 60 70 80

CMCa

se ac

tivity

(Um

L)

000

002

004

006

008

010

012

00

02

04

06

08

10

12

14

Cel

l OD600






ISRNMicrobiology 5

Isolate SS35









17

8

21

12

8


7699

87

100

100

10069

96



Bacillus sp NK-2




Isolate SS35






4 Conclusions









6 ISRNMicrobiology


Acknowledgment


References































ISRNMicrobiology 7




















Volume 2014

Zoology





Volume 2014


















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

ISRNMicrobiology 5

Isolate SS35









17

8

21

12

8


7699

87

100

100

10069

96



Bacillus sp NK-2




Isolate SS35






4 Conclusions









6 ISRNMicrobiology


Acknowledgment


References































ISRNMicrobiology 7




















Volume 2014

Zoology





Volume 2014


















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

6 ISRNMicrobiology


Acknowledgment


References































ISRNMicrobiology 7




















Volume 2014

Zoology





Volume 2014


















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

ISRNMicrobiology 7




















Volume 2014

Zoology





Volume 2014


















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








Volume 2014

Zoology





Volume 2014


















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

isolation, identification, and characterization of a...

Documents