Intellectual Property Rights and

Collaborative Innovation

Mary-Anne WilliamsInnovation and Enterprise Research Lab

University of Technology, Sydney Australia

Mary-Anne@innovationlawcentre.org

Collaboration

IP Rights

Innovation

Business

Strategy

• Background

• Innovation

• Collaboration

• Intellectual Property Rights

• Trends in Collaborative Innovation

• Challenges Ahead for Intellectual Property Rights

• Discussion

• Examples

– Sony League at RoboCup

– University-Industry Research

– Open Collaboration

Contemporary Business Realities• Organizations seek growth and profits via innovation.• Intellectual Property (IP) is a major intangible asset influencing

corporate performance. IP management is a crucial element of corporate and business strategy.

• Globalization – technology and trade• Drive for lower transaction costs• More Decentralized and Autonomous workforce• Need to pursue collaborative advantage in order to be competitive

Human Networks – Deploy pervasive collaborative technology.– Build shared “representations” – vision, purpose, solutions to problems,

expressions, designs, creative ideas.– Build communities of practice, learning and trust– Encourage teaming and joint creation.

• A new method, idea, product, etc.

• The action or process of innovating.

• Creating new value – crucial for business at all levels and horizons.

• Some key issues– Generating ideas with high potential value

– Creating and sharing social good – knowledge, know how, …

– Sharing the spoils

– Creating rights – to exploitation

• “Strong” IPR is crucially important for business

– Protecting investment in innovation from idea theft, reverse engineering, piracy, loss of revenue (licensing, royalties etc)

– Investment in R & D

– Strong Patent protection leads to increased foreign investment and technology transfer

– Increase in global competitiveness – latest technology leads to lower cost (and greener) products

CollaborationThe action of working with someone to produce or create something.Collaboration stimulates innovationMixing ideas, knowledge, know-how, expertise can generate creativity and invention.High risk, hard to get the right mix, can be costly but demand for new ideas is high

Common Sources of CreationsIndividuals contributing individual components, or integrated creationsGroups within a single organizationGroups across organizationsRandom individuals/complete strangers

ModelsOpen knowledge – free sharingBased on IPR portfolioContracts e.g. licensingShared knowledge, know-how and skillsOpen Innovation - Chesbrough (2003) Crowd sourcing

Studies show that the benefits include:

– Increased sales of exiting products

– More investment and development of new products/business lines

– Business Growth

– Higher productivity

– Improved competitive position

– Market survival

Inventions involving significant design contributions of two or more individuals are "joint inventions" for purposes of United States patent laws.

V. REQUIREMENTS FOR JOINT INVENTORSHIP - USPTOThe inventive entity for a particular application is based on some contribution to at least one of the claims

made by each of the named inventors. "Inventors may apply for a patent jointly even though (1) they did not physically work together or at the same time, (2) each did not make the same type or amount of contribution, or (3) each did not make a contribution to the subject matter of every claim of the patent." 35 U.S.C. 116. "[T]he statute neither states nor implies that two inventors can be 'joint inventors' if they have had no contact whatsoever and are completely unaware of each other"s work." What is required is some "quantum of collaboration or connection." In other words, "[for persons to be joint inventors under Section 116, there must be some element of joint behavior, such as collaboration or working under common direction, one inventor seeing a relevant report and building upon it or hearing another's suggestion at a meeting." Kimberly-Clark Corp.v.Procter & Gamble Distrib. Co., 973 F.2d 911, 916-17, 23 USPQ2d 1921, 1925-26 (Fed. Cir. 1992); Molerv. Purdy, 131 USPQ 276, 279 (Bd. Pat. Inter. 1960) ("it is not necessary that the inventive concept come to both [joint inventors] at the same time").

Each joint inventor must generally contribute to the conception of the invention. A coinventor need not make a contribution to every claim of a patent. A contribution to one claim is enough. "The contributor of any disclosed means of a means-plus-function claim element is a joint inventor as to that claim, unless one asserting sole inventorship can show that the contribution of that means was simply a reduction to practice of the sole inventor's broader concept." Ethicon Inc. v. United States Surgical Corp., 135 F.3d 1456, 1460-63, 45 USPQ2d 1545, 1548-1551 (Fed. Cir. 1998) (The electronics technician who contributed to one of the two alternative structures in the specification to define "the means for detaining" in a claim limitation was held to be a joint inventor.).

• Incentive to share (easily copied high quality ideas) ideas in collaborative environment – copyright not enough, patents too burdensome, other IP means often inappropriate or difficult to take advantage of in open innovation contexts.

• Capture of background IP – many open innovation environments do not provide the opportunity for contributors to declare their background.

• Recognition and assessment of novelty• Ease of access to shared documented material.• Collaborative technologies enable sharing and also theft.• Partners often act under different governance and regulation (IP, business,

accounting, treasury risk) frameworks particularly in global collaborations.• Distribution of power in collaborative relationships• High levels of uncertainty in cross-jurisdictional collaboration – relevant idea and

information can be acquired globally form multiple jurisdictions but mixed, processed and integrated in one jurisdiction.

• Much innovation is currently happening that violates IP law however this is not a sustainable model and this situation will retard its maturity and potential sophistication.

• A key differential in international IP law is research exemption to infringement. Only some countries possess exemptions in IP Law or Common Law and others have narrow statutes governing university (often basic) research.

• IPR insurance in trust relationship

• Lots of ideas left unexploited

• Who owns jointly created ideas

• Who attributes ownership

• Co-creation – ideas at the same time –serially; in parallel; contemporaneously; orchestrated; semi-orchestrated; unorchestrated

• Complex circumstances of discovery and creation.

• Validity – named inventors on patents; authors of works

• Shared representations

• Technology enabled creation and discovery– Computer discovery; computer assisted discovery

• IP Issues– New technologies

– Degree of IP Protection

– Business Strategy• Share it – with low protection

– E.g. Bell Laboratories transistor, licensed their patent to most competitors – they recognized that they should forgo some of their profits to benefit from the extended knowledge produced by spillovers.

– Innovators may optimally choose a low IP protection policy to lock-in partners/competitors or to seek high levels of adoption.

• Before the Bayh-Dole Act and the push to commercialize, “[u]npatentedbiomedical discoveries were freely incorporated in ‘downstream’ products for diagnosing and treating disease.”

• Today, a gene sequence may be patented at the first moment of isolation, even without knowledge of the specific role it will play in a commercial product.

• Upstream protection of basic research tools vastly increases downstream costs to incorporate projects involving diverse and possibly conflicting sets of rights.

• Upstream patents over gene sequences, for example, require complex transactional agreements at each subsequent stage of research. Subsequent protectable inventions could include (1) an organism designed to host the patentable gene, (2) a protein produced by the host organism, (3) research databases, and (4) a marketable drug.

• In effect, “[e]ach upstream patent allows its owner to set up another tollbooth on the road to product development, adding to the cost and slowing the pace of downstream biomedical innovation.” The cost of a downstream product compounds with each toll. The increased price the public pays outweighs the initial gain to the few upstream scientists.

MEGAN RISTAU BACA, Duke Law and Technology Review No 4

• Opportunity costs – the profits sacrificed by halting the research

• The greater the opportunity costs the harder for a firm to enter a research partnership

• The more mature the technology the higher the opportunity costs (e.g. cost of sharing)

• Universities tend to focus on new technologies

• There is a pressing need to reduce the transaction costs of collaboration in scientific research.

• How can the process of sharing be simplified?

• Representation

– an idea

Invention

• Information

– the expression of an idea

Description of a patent.

•red

Blue

Yellow

Red

Describing DNA

ATGCGGCACGAGGGTAAATATGGCATAAGTTAATAACACTTTTCCCCAAAATGGTGCTTTGGATTTGAAAAGGTCTGATGGGGAGAAGGAGAACGTATCATCCTAGCCCTCTCTTAATAAACCTAGAAAAACGGGTAGTAAACTGTGGATAGTCAGGAAAACACCCAGCAAGGGACACAGCGTCAGGAAATGAATCTTCCCCCCAACCC

In order to develop effective and consistent IP law and IP management strategies and practice we need to better understand – Cognitive aspects of an idea

– The process of idea creation

– The notion of a shared idea

– The relationship between information and (shared) representations, i.e. the grounding workflow, such as the idea expression relationship and the idea and patent description.