interactions between bacillus subtilis early spore coat morphogenetic proteins

R E S E A R C H L E T T E R

InteractionsbetweenBacillus subtilis early spore coatmorphogenetic proteinsDenisa Mullerova, Daniela Krajcıkova & Imrich Barak

Institute of Molecular Biology, Slovak Academy of Sciences, Bratislava, Slovakia

Correspondence: Imrich Barak, Institute of

Molecular Biology, Slovak Academy of

Sciences, Dubravska cesta 21, Bratislava,

Slovakia. Tel.: 1421 2 593 074 18; fax: 1421

2 593 074 16; e-mail: [email protected]

Received 1 June 2009; accepted 13 July 2009.

Final version published online 24 August 2009.

DOI:10.1111/j.1574-6968.2009.01737.x

Editor: Ezio Ricca

Keywords

Bacillus subtilis ; spore coat; protein–protein

interactions; yeast two-hybrid assay; pull-down

assay.

Abstract

When challenged by stresses such as starvation, the soil bacterium Bacillus subtilis

produces an endospore surrounded by a proteinaceous coat composed of 4 70

proteins that are organized into three main layers: an amorphous undercoat,

lightly staining lamellar inner coat and electron-dense outer coat. This coat

protects the spore against a variety of chemicals or lysozyme. Mutual interactions

of the coat’s building blocks are responsible for the formation of this structurally

complex and extraordinarily resistant shell. However, the assembly process of

spore coat proteins is still poorly understood. In the present work, the main focus

is on the three spore coat morphogenetic proteins: SpoIVA, SpoVID and SafA.

Direct interaction between SpoIVA and SpoVID proteins was observed using a

yeast two-hybrid assay and verified by coexpression experiment followed by

Western blot analysis. Coexpression experiments also confirmed previous findings

that SpoVID and SafA directly interact, and revealed a novel interaction between

SpoIVA and SafA. Moreover, gel filtration analysis revealed that both SpoIVA and

SpoVID proteins form large oligomers.

Introduction

The sporulation process in Bacillus subtilis is accomplished

by formation of a proteinaceous spore coat that grants the

cell protection against oxidizing agents, lytic enzymes and

toxic molecules (Setlow, 2000, 2003) and enables the dor-

mant cell to endure for long periods of time (Nicholson

et al., 2000). This protein complex is composed of 4 70

species and creates a double-layered structure visible under

electron microscope: the inner coat, which is formed by

three to six fine, lightly staining lamellae in juxtaposition to

each other and the outer coat, thicker and darker than the

inner layer, coarsely striated (Driks, 1999; Henriques &

Moran, 2000, 2007; Kim et al., 2006).

Although the spore coat consists of large number of

proteins, only a small group of them plays a crucial role in

coat morphology. Hence, these proteins are referred to as

morphogenetic (Driks & Setlow, 2000; Driks, 2002; Henriques

et al., 2004; Kim et al., 2006). The first essential morphoge-

netic protein engaged in spore coat assembly is SpoIVA.

Transcription of the spoIVA gene commences early, 2 h after

the onset of sporulation, under control of sE transcription

factor from two closely spaced promoters. spoIVA mutant

produces some coat material but this material is misassembled

as swirls and accumulates in the mother cell cytosol (Roels

et al., 1992). The peptidoglycan cortex layer, which lies just

underneath the coat, is also misformed in mutant cells,

indicating that SpoIVA is necessary for proper formation of

both the cortex and the coat (Coote, 1972; Piggot & Coote,

1976). Catalano et al. (2001) predicted that these two func-

tions of SpoIVA are not genetically separable and are not

encoded by distinct domains of the protein. Deposition of

SpoIVA protein is connected to, and serves as a marker for, the

septation and engulfment process, because SpoIVA protein

tracks along the enveloping membrane surrounding the fore-

spore and creates a shell adjacent to this membrane (Pogliano

et al., 1995). Price & Losick (1999) revealed that the extreme

C-terminal portion of SpoIVA is critical for its targeting to the

forespore and depends on small peptide SpoVM (Levin et al.,

1993). These authors (Price & Losick, 1999) also predicted an

oligomerization domain outside the C terminus of SpoIVA

protein, which might be responsible for interaction between

SpoIVA molecules. Further study showed that such a domain

does indeed exist (Ramamurthi & Losick, 2008). SpoIVA

possesses a canonical Walker A box that binds and hydrolyzes

ATP, which is needed for multimerization and assembly of

FEMS Microbiol Lett 299 (2009) 74–85c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

MIC

ROBI

OLO

GY

LET

TER

S

mailto:[email protected]

SpoIVA into filamentous structures forming a shell encasing

the forespore (Ramamurthi & Losick, 2008).

SpoIVA forms a basement layer on top of which other spore

coat proteins are deposited. Proper assembly of SpoIVA is a

prerequisite for the recruitment of another morphogenetic

and structural component of the coat – CotE. Expression of

the cotE gene is switched on early in the mother cell and is

under control of sE transcription factor. CotE protein assem-

bles in very much the same fashion as SpoIVA, as a coating

around the forespore, but the formation of CotE shell is

delayed compared with SpoIVA and is separated from the

forespore surface by a 75-nm-wide gap. This space is called a

matrix and it is where infiltration of the inner coat compo-

nents takes place (Driks et al., 1994; Pogliano et al., 1995).

Thus, CotE sits at the edge of the matrix, between the inner

and outer coat layer, and from this position guides the correct

formation of the latter. In cotE mutant cells, the outer coat is

missing (Zheng et al., 1988).

Apart from SpoIVA, another protein is involved in the

attachment of CotE to the forespore. This protein is a product

of the spoVID gene, which is transcribed by sE-containing

RNA polymerase and codes for acidic, 575-residue-long

protein (Beall et al., 1993). SpoVID is not responsible for the

initial targeting of CotE to the forespore but for the continued

attachment of CotE and the coat in the later stages of

sporulation. In spoVID null mutant, a defect similar to that

of spoIVA mutant was observed; the coat material accumu-

lated in the mother cell cytoplasm as swirls instead of shell

around the forespore. However, spoVID mutant cells possess

normal-looking cortex (Beall et al., 1993; Driks et al., 1994).

The SpoVID protein sequence contains a cell wall-binding

LysM motif, facilitating its deployment to the cortex–coat

boundary (Ozin et al., 2000; Costa et al., 2006). The same

motif was observed in the N-terminal part of another protein

– SafA (SpoVID-associated factor A) (Kodama et al., 1999).

SpoVID and SafA accumulate early in the sporulation

process and localize to the matrix region (Ozin et al., 2000).

Localization of SafA to the pre-engulfed forespore is an

early, SpoVID- and SpoIVA-dependent event. Yeast two-

hybrid experiments as well as in vitro pull-down assays

revealed that SpoVID and SafA proteins interact directly

(Ozin et al., 2001). The interaction is mediated by two

motifs present in SafA protein sequence: the PYYH motif in

the C-terminal half of SafA, and a region just downstream of

the LysM domain consisting of 13 residues. In SpoVID

protein sequence, amino acids 1–202 are involved in contact

with SafA. Besides SafA, other interacting partners were

suggested for SpoVID protein, among them SpoIVA (Ozin

et al., 2001; Costa et al., 2006). SafA mutant spores are

susceptible to lysozyme and form spores with abnormal

coats that lack several coat protein components, an impact

not as severe as that of spoVID null mutant (Takamatsu

et al., 1999; Ozin et al., 2000).

In this study, the potential direct protein–protein inter-

actions between three major morphogenetic proteins

SpoIVA, SpoVID and SafA were examined using yeast two-

hybrid assay and by coexpression followed by an in vitro pull-

down experiment. Also investigated were the portions of the

proteins responsible for this interaction. Further on, isolated

SpoIVA and SpoVID were subjected to gel filtration analysis

to gain a better insight into their oligomerization properties.

Materials and methods

Strains and cultivation media

The Escherichia coli strain MM294 (endA1 hsdR17 supE44

thi-1 recA1) (Backman et al., 1976) was used for cloning and

amplification of all recombinant plasmids. Escherichia coli

strain BL21(DE3) [F� ompT hsdSB (rB�mB

�) gal dcm (DE3)]

(Novagen) was used for expression and overproduction of

histidine-tagged fusion proteins. Escherichia coli strain

AD202 was used for expression and overproduction of the

glutathione-S-transferase (GST) fusion SpoIVA protein.

Luria–Bertani (LB) medium with appropriate antibiotics

was used for maintenance and growth of E. coli strains.

Bacillus subtilis strain PY79 (Youngman et al., 1984) was

cultivated in LB media and its genomic DNA served for

amplification of genes encoding spore coat proteins.

Saccharomyces cerevisiae strain MaV203 (Vidal, 1997)

(MATa , leu2-3, 112, trp1-901, his3D200, ade2-101, gal4D,

gal80D, SPAL10<URA3, GAL1<lacZ, HIS3UAS GAL1<

HIS3@LYS2, can1R, cyh2R) was used for the yeast two-hybrid

assay. Yeasts were cultivated in media recommended by the

manufacturer (Invitrogen). Rich YPAD medium was used

for routine growth of yeasts, and synthetic complete (SC)

medium, omitting specific amino acids according to selec-

tion requirements, was used for examining protein–protein

interactions.

Construction of yeast plasmids

The ProQuestTM Two-Hybrid system with Gateways tech-

nology (Invitrogen) was used. Coding regions of spoIVA,

spoVID and safA genes were amplified by PCR using

Y2HspoIVA50, Y2HspoVID50 and Y2HsafA50 as sense primers

and Y2HspoIVA30, Y2HspoVID30 and Y2HsafA30 as antisense

primers. Primers were flanked by attB cloning sites necessary

for fragment insertion into pDONR221 vector by BP reaction,

generating an entry clone. In the next step, genes from the

entry clones were transferred into yeast destination vectors

pDEST22 and pDEST32 via LR reaction. Site-specific recom-

bination generates in-frame fusions with the GAL4 DNA-

binding domain (in pDEST32) or the GAL4 activation

domain (in pDEST22). In pDONR221 vector, the kanamycin

resistance gene serves as a selection marker. Vector pDEST32

includes the LEU2 gene for selection in yeast on medium

FEMS Microbiol Lett 299 (2009) 74–85 c� 2009 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

75Interactions of early spore coat proteins

lacking the leucine and gentamicin resistance gene for main-

tenance in E. coli. Vector pDEST22 contains a TRP1 gene to

compensate yeast’s tryptophan auxotrophy, and an ampicillin

resistance gene enabling E. coli carrying this plasmid to grow

in media containing ampicillin.

Truncated mutants of the spoIVA gene were prepared via

PCR amplification using two sets of primers: Y2HspoIVA50 and

TDspoIVA30, respectively, thus creating spA2 (1200 bp) trun-

cated mutant; a second set of primers, lTDspoIVA50 and

Y2HspoIVA30, respectively, generated spA4 (1173 bp) truncated

mutant of spoIVA. All primers were flanked by attB cloning sites.

PCR-generated truncated mutants were cloned into pDONR221

and pDEST32/pDEST22 vectors as described above.

Truncated mutants of the spoVID gene were also amplified

by PCR using two sets of primers: spD2 truncated version

(1194-bp) of spoVID was amplified by PCR using primers

Y2HspoVID50 and spoVID39930; 1128-bp truncated mutant of

the spoVID gene, named spD3, was prepared via PCR with

primers spoVID201–57550 and Y2HspoVID30, respectively. All

primers were flanked by attB cloning sites. PCR-generated

truncated mutants were cloned into pDONR221 and

pDEST32/pDEST22 vectors as described above.

In all PCR amplifications, chromosomal DNA of B. sub-

tilis PY79 was used as a template. PCR products were

purified using QIA quick Gel Extraction Kit (Qiagen). New

plasmid constructs were verified by restriction analysis and

sequencing.

Construction of expression plasmids

DNA manipulations were carried out according to Sambrook

et al. (1989). The entire spoVID coding region (1728 bp) and

a 1200-bp-long fragment of spoIVA (1479 bp) were ampli-

fied by PCR using sense primers SpoVID50 and SpoIVA50,

respectively, and antisense primers SpoVID30 and SpoIVA30,

respectively (Table 1). PCR products were digested with

NdeI and XhoI restriction enzymes and cloned between the

same sites of pET28a expression vector (Novagen), yielding

expression plasmids pETspoIVA and pETspoVID, respec-

tively. Inserted genes carry a six-histidine-tag fused to their

N terminus.

For coexpression and pull-down experiments, full-length

spoIVA and spoVID genes were amplified by PCR. For

amplification of spoIVA, sense primer duetSpA50, carrying

BglII restriction site, and antisense primer duetSpA30,

carrying XhoI restriction site, were used. Primers duetSpD-

his50 and duetSpD-his30 containing BamHI and PstI restric-

tion sites were used to amplify the spoVID gene (Table 1).

Table 1. Oligonucleotides used for cloning

Primers Sequence 50–30

SpoIVA50 AGGAGGAGGCATATGGAAAAGGTCGATATTTTCAAGG

SpoIVA30 AGGAGGAGGGCTCGAGTCAGATCGACGGAGCGAC

SpoVID50 GGAGGAGGACATATGCCGCAAAATCATCGATTG

SpoVID30 TGGTGGTGGCTCGAGTTACGCATGGCTATTTTTATATTG

DuetSpA50 AGGAGGAGGAGATCTCGAAAAGGTCGATATTTTCAAGG

DuetSpA30 AGGAGGAGGCTCGAGTTACAGGATGATGGCGATTAAG

DuetSpD50 GGAGGAGGACATATGCCGCAAAATCATCGATTG

DuetSpD30 TGGTGGTGGCTCGAGTTACGCATGGCTATTTTTATATTG

DuetSpD-his50 GGAGGAGGAGGATCCGCCGCAAAATCATCGATTGC

DuetSpD-his30 TGGTGGTGGCTGCAGTTACGCATGGCTATTTTTATATTG

SafA50 Duet CATCATCATGGATCCGAAAATCCATATCGTTCAAAAAGG

SafA30 Duet CATCATCATCTGCAGTTACTCATTTTCTTCTTCCGGAC

spA(GEX)50 AGGAGGAGGGGATCCGAAAAGGTCGATATTTTCAAGG

spA(GEX)30 TGGTGGTGGCTCGAGTTACAGGATGATGGCGATTAA

Y2HspoIVA50 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAAAGGTCGATATTTTCAAGGATATC

Y2HspoIVA30 GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACAGGATGATGGCGATTAAGC

Y2HspoVID50 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCCGCAAAATCATCGATTGCAATTTTC

Y2HspoVID30 GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACGCATGGCTATTTTTATATTGAGG

Y2HsafA50 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAAAATCCATATCGTTCAAAAAGG

Y2HsafA30 GGGGACCACTTTGTACAAGAAAGCTGGGTCTTACTCATTTTCTTCTTCCGGAC

ITDspoIVA50 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGTGCCCGGCGCTAAAGG

TDspoIVA30 GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAATGGATCGACGGAGCGAC

SpoVID201–57550 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCTCCGTGAAGAACTGGAGAC

SpoVID39930 GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAATTGAAATGGAAATGTAAATCGGCATTG

Restriction enzymes sides are underlined. Sites required by Gateway cloning are double underlined.


76 D. Mullerova et al.

PCR products were digested with corresponding enzymes

and ligated into pETDuet-1 vectors (Novagen), digested

with the same enzymes, thus creating pETDuet(spoIVA) and

pETDuet(his-spoVID) expression plasmids where the

spoVID gene was N-terminally tagged with His tag. Further

on, pETDuet(his-spoVID) plasmid was digested with BglII

and XhoI restriction enzymes and the PCR-amplified

spoIVA gene, digested with the same enzymes, and cloned into

it to form pETDuet(spoIVA1his-spoVID) plasmid, coexpres-

sing both proteins (SpoIVA and SpoVID, respectively).

For coexpression and triple pull-down assay, the gene-

encoding spoIVA was cut out from pETDuet(spoIVA) using

restriction enzymes BglII and XhoI and recloned into

pACYCDuet-1 vector (Novagen) digested with the same

enzymes, thus generating pACYC(spoIVA). Genes for safA

and spoVID were both cloned into the same pETDuet-1

vector with safA carrying the N-terminal His tag. Primer

pair SafA50 Duet and SafA30 Duet (Table 1) was used to

PCR-amplify the coding region of safA (1164 bp). The

resulting PCR product was digested with restriction en-

zymes BamHI and PstI, respectively, and ligated with

pETDuet-1 vector cleaved with corresponding enzymes,

thus creating pETDuet(his-safA). The coding sequence of

spoVID was generated by PCR using primers duetSpD 50 and

duetSpD 30 (Table 1), respectively. The product was subse-

quently digested with NdeI and XhoI restriction enzymes

and cloned into pETDuet(his-safA), which was digested

accordingly, creating pETDuet(spD1his-safA).

For the in vitro pull-down assay, primer pairs

spA(GEX)50 and spA(GEX)30 (Table 1) were used for PCR

amplification of the coding region of spoIVA gene. The

resulting product was digested with BamHI and XhoI

restriction enzymes and cloned between the same sites of

pGEX-4T-1 vector (Amersham Pharmacia). In this recom-

binant plasmid, named pGEXspA, the spoIVA gene carries

the N-terminal GST tag.

In all PCR amplifications, chromosomal DNA of B.

subtilis PY79 was used as a template. PCR products were

purified using QIA quick Gel Extraction Kit (Qiagen). New

plasmid constructs were verified by restriction analysis.

Expression and purification of proteins andantibody production

Expression plasmids were transformed into E. coli strain

BL21(DE3) and bacteria were cultivated in LB medium

supplemented with appropriate antibiotic at 37 1C until the

cells reached an OD600 nm between 0.5 and 0.7. Then the

expression of recombinant protein was induced by addition

of isopropyl-b-D-1-thiogalactopyranoside (IPTG) at 1 mM

concentration and cells were further incubated with shaking

at 28 1C for 3 h. Bacteria were collected by centrifugation,

resuspended in solubilization buffer (20 mM Tris-Cl pH 8.0,

150 mM NaCl) and lysed by sonication (total time of 2 min,

with 10-s bursts and 35-s cooling periods). The cells with

expressed SpoIVA protein were resuspended in solubiliza-

tion buffer with 8 M urea, as SpoIVA is produced, to a large

extent, as an insoluble protein. Cell debris was removed

by centrifugation for 25 min at c. 73 000 g in a Beckman

centrifuge. Supernatant was applied on 1-mL Ni21-Sephar-

ose HP chelating column (Amersham Biosciences). Proteins

were eluted by a 4-mL concentration step gradient of

100 mM up to 1 M imidazole. Proteins were subsequently

used for antibody production in mice.

Escherichia coli strain AD202 was transformed by GST

fusion plasmid pGEX-4T-1 and cultivated in LB medium

with appropriate antibiotic at 37 1C until OD600 nm reached

0.5–0.7. Expression was then induced with 1 mM IPTG and

cells were further grown at 30 1C with shaking for 3 h before

harvesting by centrifugation. Cells were then processed

according to a GST resin manufacturer’s protocol (bio-

WORLD). Fusion protein was eluted by boiling the GST

Sepharose resin with an equal amount of 2� sodium

dodecyl sulfate (SDS) sample buffer for 1 min.

Pull-down assay of purified GST-SpoIVA andHis-tagged SpoVID

Recombinant His-SpoVID protein expressed from

pET(spoVID) plasmid was produced and purified as de-

scribed in the previous section. Purified His-SpoVID was

subsequently incubated with GST-SpoIVA bound to glu-

tathione Sepharose beads and with beads alone. The mixture

was then washed and proteins were eluted as recommended

by the manufacturer (bioWORLD). Interacting proteins

were resolved by SDS-10% polyacrylamide gel electrophor-

esis (PAGE) and identified by Western blot analysis.

Pull-down assay of coexpressed proteins

Recombinant proteins expressed from pETDuet-1 and

pACYCDuet-1 vectors were produced and purified as described

in the previous section. Interacting proteins were resolved by

SDS-10% PAGE and identified by Western blot analysis.

Western blot analysis

Purified protein samples were boiled for 10 min with

identical volumes of 2� SDS sample buffer and resolved by

SDS-10% PAGE. Fractionated proteins were subsequently

transferred onto nitrocellulose membrane (Hybond ECL,

Amersham Biosciences), which was then blocked in 5%

nonfat milk in TBST buffer to avoid nonspecific protein

binding. Proteins bound to the membrane were detected

by polyclonal antibodies against SpoIVA and SpoVID pro-

teins at 1 : 2000 dilution and by monoclonal anti-His-tag



antibody (Novagen) at 1 : 1000 dilution. As a secondary

antibody, anti-mouse HRP conjugated antibody at 1 : 5000

dilution was used (Promega).

Yeast two-hybrid assay of protein--protein interactions

Saccharomyces cerevisiae strain MaV203 was cotransformed

with both pDEST32 (bait vector) and pDEST22 (prey

vector) yeast plasmids carrying the genes of interest, by the

lithium-acetate method (Gietz & Woods, 2002). Transfor-

mants were grown for 72 h on SC dropout medium lacking

amino acids leucine (Leu) and tryptophan (Trp). Large

colonies were picked up and resuspended in 70 mL of sterile

water and 2 mL droplets were applied on selection plates.

Yeast cells, in which the protein–protein interaction induced

the expression of three reporter genes (HIS3, URA3 and

lacZ), were able to grow on SC-Leu-Trp-His1100 mM 3AT

and SC-Leu-Trp-Ura plates, and their colony color changed

to blue in the presence of X-gal (5-bromo-4-chloro-3-

indolyl-b-D-galactoside). Autoactivation of reporter genes

was excluded by testing the yeast strains after cotransforma-

tion of all bait vectors with pEAXP-AD502 vector and all

prey vectors with pDBLeu vector.

Quantitative b -galactosidase assay inliquid culture

The strength of the interactions was measured by b-galacto-

sidase activity using o-nitrophenol-b-D-galactopyranoside

as a substrate according to the manufacturer’s protocol.

Activity of b-galactosidase was expressed in Miller units

[1 MU = 1000�OD420 nm/(t�V�OD600 nm); where t is the

time in incubation in minutes; V the volume of culture used

in the assay; OD420 nm the absorbance of o-nitrophenol;

OD600 nm the cell density of the culture]. The number of

Miller units (Table 2) represents the average values of at least

five independent isolated colonies and each sample was

assayed in triplicate to reduce variability.

Verification of candidate clones --retransformation assay

Positive interactions between two proteins were reassessed

for false positives by retransformation assay. The cells from

single colony were grown in SC-Leu-Trp (10 mL) at 30 1C

for 24 h. Centrifuged cells were disrupted mechanically

by vortexing with autoclaved acid-washed glass beads

for 2 min and plasmids were isolated using QIAprep Spin

Miniprep Kit (Qiagen) according to a protocol supplied.

Plasmids were transformed into E. coli XL1 Blue and trans-

formants were cultivated on LB plates with 100 mg mL�1

ampicillin to selectively isolate pDEST22 plasmids and

10 mg mL�1 gentamicin to selectively isolate pDEST32 plas-

mids. Isolated plasmids were verified by restriction analysis

and reintroduced into MaV203 yeast strain. Transformants

were grown on selection plates to reproduce the original

phenotype.

Analysis of proteins by size-exclusionchromatography

The Superose 12 column 10/300 GL (Amersham Pharmacia)

was calibrated with low-molecular-weight calibration pro-

teins (Amersham Pharmacia) in 50 mM Tris-HCl, 150 mM

NaCl, pH 8.0. Exclusion limit of this column (Mr) is

approximately 2� 106 proteins and its optimal separation

range (globular proteins) is 1� 103–3� 105. Purified re-

combinant proteins were loaded in total volume of 0.5 mL.

Chromatography was performed at a flow rate of

0.5 mL min�1. The eluted proteins were detected with UV

detector at 280 nm and confirmed by Western blot analysis.

Results

SpoIVA and SpoVID directly interact in the yeasttwo-hybrid system

In our previous work (Krajcikova et al., 2009), the main

focus involved uncovering novel direct protein–protein

interactions between spore coat proteins. Among those

examined by the yeast two-hybrid system and giving a

positive signal were two morphogenetic proteins, SpoIVA

and SpoVID. Additionally, an earlier study carried out by

Costa et al. (2006) showed the localization dependency of

SpoVID on SpoIVA protein and proposed that a direct

interaction may exist between them.

The coding regions of both proteins were fused either to

the GAL4 activation domain (AD) or the DNA-binding

domain (DB) and plasmids were introduced into S. cerevi-

siae strain MaV203. Interaction between proteins of interest

in this study was revealed by reconstitution of active GAL4

transcription factor when screening the combination

SpoIVA-AD and SpoIVD-DB. The expression of three

Table 2. b-Galactosidase activity of interacting proteins expressed in

Miller units, using ONPG as a substrate

Fusion protein DB/AD

b-Galactosidase

(Miller units)

SpoVID/SpoIVA 7.7�2.3

SpoVID201–575/SpoIVA 6.7�2.7

SpoVID/pEAXP-AD502 0.2�0.1

SpoVID201–575/pEAXP-AD502 0.1�0.0

Measured Miller units were averaged and the standard deviations were

calculated. The table lists the levels of lacZ expression in yeasts carrying

vectors with our genes of interest.

ONPG, o-nitrophenol-b-D-galactopyranoside.



reporter genes was activated, allowing the cells to grow on

various selection plates as well as changing the colony color

to blue on X-gal assay (Fig. 1a). However, when SpoIVA was

fused to the DNA-binding domain and SpoVID to the

activation domain the interaction did not occur (Fig. 1a)

or was below the detection limit of this method. One

possible explanation for this bias might be misfolding of

the protein or steric hindrance when combined with a

certain domain of GAL4. Nonetheless, these results suggest

that there may be a direct interaction between these two

morphogenetic proteins. The interaction of SpoIVA with

itself as well as SpoVID with itself was not detected by the

yeast two-hybrid experiment. This observation, however,

does not rule out the possibility of oligomerization of these

proteins. Polymerization of SpoIVA molecules was ob-

served in the work of Price & Losick (1999). In agreement

with previous results mentioned above, Ozin et al. (2001)

also found no evidence of SpoVID self-interaction using

yeast two-hybrid assay.

Positive interaction between SpoIVA and SpoVID was

confirmed by retransformation assay (not shown) and by

measurement of b-galactosidase activity of interacting pro-

teins. The strength of interaction is expressed in Miller units

and in the system used may vary from weak to very strong

(Invitrogen, ProQuestTM Two-Hybrid System with Gate-

ways Technology instruction manual) and was also de-

scribed in the study of Krajcikova et al. (2009). When

compared with control strains carrying interacting pro-

teins, the protein–protein interaction between SpoIVA and

SpoVID is moderately strong (Table 2).

Whole sequence of SpoIVA is necessary forinteraction with SpoVID

To identify regions of SpoIVA protein that might be respon-

sible for its contact with SpoVID, two truncated mutant

versions were prepared. SpoIVA protein consists of 492

amino acid residues and the first SpoIVA mutant, herein

named SpA2, lacking 91 residues on its C terminus

(SpoIVA1–401), was fused with both DB and AD of GAL4

transcription factor and subjected to yeast two-hybrid

analysis with full-length SpoVID protein. The second trun-

cated mutant, SpA4, missing 102 N-terminal amino acids

(SpoIVA103–492), was also analyzed for direct interaction

with full-length SpoVID in S. cerevisiae MaV203 cells. None

of the truncated mutants of SpoIVA was able to interact

Fig. 1. Yeast two-hybrid analysis of protein–

protein interactions. (a) Saccharomyces cerevisiae

MaV203 cells bearing two fusion plasmids, one

with the first gene of interest fused to activation

domain (AD) of GAL4 transcription factor and

another with the second gene of interest fused to

the DNA-binding domain (DB) of GAL4, are able

to grow on the SC-Leu-Trp selection plate. Only

direct interaction between two proteins of

interest enables the yeast cells to grow on media

lacking uracil (SC-Leu-Trp-Ura), lacking histidine

and containing 100 mM 3AT (SC-Leu-Trp-His

1100 mM 3AT) or to give a blue color with

X-gal (see Materials and methods). (b) Mutual

interactions between full-length SpoIVA and

SpoVID, respectively, and their truncated forms:

SpA2–SpoIVA1–401; SpA4–SpoIVA103–492;

SpD2– SpoVID1–399; SpD3–SpoVID201–575.

Fusions with the activation domain (AD) are

placed horizontally, with the binding domain

(DB) vertically (a). (c) Positive control (PC) and

negative control (NC) on selection plates.

The previously identified interaction between

DB(CotE)/AD(CotE) (Krajcikova et al., 2009)

served as a positive control and pDBLeu/

pEXP-AD502 (GAL4 domains in expression

vectors) served as a negative control.



directly with its partner or reconstitute an active GAL4 using

the yeast two-hybrid system (Fig. 1b).

An earlier study examined a set of random point

mutants of spoIVA and concluded that for localization and

coat assembly purposes, regions spread throughout the

whole sequence of SpoIVA are necessary (Catalano et al.,

2001). Therefore, it could also be assumed, as for the

interaction with SpoVID protein, that there is probably not

a specific domain created by adjacent residues of SpoIVA

that is responsible for this specific protein–protein contact.

Rather, a folding process brings together distant amino acids

recognizing interaction patterns on their partner. Another

explanation is that the truncated form of SpoIVA could be

unstable.

C-terminal region of SpoVID is crucial forinteraction with SpoIVA

Previous works (Ozin et al., 2000, 2001; Costa et al., 2006)

revealed that the last 50 residues of the C terminus of

SpoVID represent a cell wall-binding motif responsible for

targeting this protein to the cortex/coat interface. Costa

et al. (2006) also identified a region of 202 residues in the

N-terminal part of SpoVID necessary for interaction with

SafA. Here, the regions of SpoVID crucial for interaction

with SpoIVA were analyzed by creating two truncated

versions of SpoVID protein. First, the deletion mutant,

hereafter named SpD2 (SpoVID1–399), lacks 176 amino acids

from the C-terminal region. Secondly, the mutant, desig-

nated SpD3 (SpoVID201–575), lacks 200 N-terminal amino

acids. Both truncated forms of SpoVID were fused to the DB

and AD domains of GAL4, respectively, and were analyzed

for direct interaction with full-length SpoIVA in MaV203

yeast cells (Fig. 1b). The results from the yeast two-hybrid

experiments with truncated mutants showed that the first

200 amino acids of the N terminus of SpoVID are dispen-

sable for contact with full-length SpoIVA. Thus, some

uncharacterized amino acids in the C-terminal part of

SpoVID protein confer the ability to interact with SpoIVA.

SpoIVA and SpoVID proteins formlarge oligomers

Several previous studies (Price & Losick, 1999; Ramamurthi

& Losick, 2008) showed that SpoIVA molecules self-interact

and multimerize into higher-order structures around the

engulfed forespore. Ozin et al. (2000) detected a form of

SpoVID protein in B. subtilis wild-type extracts whose size

might correspond to that of a dimer. To examine potential

oligomeric forms present in elution samples of His-tagged

SpoIVA and SpoVID, we expressed both proteins in E. coli

cells and isolated them on nickel affinity resin. SpoIVA was

isolated in 8 M urea and therefore needed to be dialyzed

against elution buffer before application onto Superose 12

column (see Materials and methods). Proteins were subse-

quently subjected to gel filtration assay. Both tested proteins

came out of column in the void volume, indicating that

they form large oligomers (Fig. 2). This observation did

not indicate the actual size of the protein or its oligomeric

state, but results support previous findings that SpoIVA

and SpoVID create multimeric structures (Ozin et al.,

2000; Ramamurthi & Losick, 2008). The presence of pro-

teins in eluted fractions was confirmed by Western blot

analysis (not shown).

SpoIVA and SpoVID directly interact incoexpression and pull-down experiments

Encouraged by the results obtained using yeast two-hybrid

assay we decided to confirm direct interaction between

SpoIVA and SpoVID proteins using another method. We

used proteins produced in E. coli for an in vitro pull-down

assay. Both SpoIVA and SpoVID carried a tag fused to their

0 6.0 12.0 18.0 24.0

0.0

1.0

2.0

3.0

4.0

5.0

(b)

Elution volume (mL)

I

0 6.0 12.0 18.0 24.0

0.0

1.0

2.0

3.0

4.0

5.0

6.0

7.0

A 2

80 n

m (

mA

U)

A 2

80 n

m (

mA

U)

(a)

Elution volume (mL)

I

Fig. 2. Gel filtration assays of SpoIVA and

SpoVID proteins on Superose 12 column. (a)

Elution curve of SpoIVA protein. (b) Gel filtration

analysis of SpoVID protein. Proteins were applied

onto Superose 12 immediately after isolation on

Ni21 affinity column; however, SpoIVA was first

dialyzed to get rid of urea (see Materials and

methods). Both proteins came out of column in

the void volume (I), indicating that they form

large oligomers. The presence of proteins was

confirmed by Western blot analysis (not shown).

The small peaks do not represent SpoIVA or

SpoVID, respectively.



N termini: SpoIVA had a GST tag and SpoVID carried a His

tag critical for its purification (see Materials and methods).

The GST-SpoIVA, immobilized on glutathione affinity ma-

trix, was intended to capture His-tagged SpoVID from the

solution incubated on glutathione Sepharose beads. After

several washes, the presence of retained proteins was

detected by Western blot using antibodies against SpoIVA

and SpoVID, respectively, as well as anti-His-tag antibody

(not shown). His-SpoVID was not pulled down by GST-

SpoIVA on glutathione beads. Only GST-SpoIVA fusion

protein was detected, which migrated at approximately

80 kDa (not shown). There are several possible explanations

for why we failed to detect a direct interaction between

SpoIVA and SpoVID using GST pull-down. One explanation

consists in the folding process of fusion proteins GST and

SpoIVA. GST is a relatively large tag (26 kDa) and it might

have disrupted folding of SpoIVA and hampered constitution

of the correct conformation of SpoIVA. Another reason could

be that GST tag shields the site of interaction on SpoIVA

protein sequence, causing a steric barrier. Lastly, either one or

both interacting proteins may undergo a multimerization

process when isolated separately which prevents the sites of

interaction from coming into contact.

To overcome these obstacles, we employed coexpression

of the proteins of interest. Coexpression plasmids are

designed for simultaneous expression of two or more genes,

allowing proteins to interact immediately after the transla-

tion. The gene coding for SpoVID protein was cloned in-

frame with N-terminal His tag, while the second protein,

SpoIVA, carried no tag. After the expression in E. coli, a

pull-down experiment on the Ni21 affinity column and

Western blot, His-tagged SpoVID clearly pulled down

untagged SpoIVA protein (Fig. 3a, lanes 5–8). SpoIVA

protein without His tag bound only slightly to the nickel

affinity matrix (Fig. 3a, lane 2) and was eluted by up to

0.2 M imidazole.

It may be concluded that the direct interaction between

SpoIVA and SpoVID proteins identified by the yeast two-

hybrid system was confirmed by coexpression and subsequent

pull-down experiment.

SpoIVA0.1 0.2 0.3 1.0

SpoIVA+SafA-His0.1 0.2 0.3 1.0 0.1 0.2 0.3 1.0

SpoIVA+SpoVID+SafA-His

5572

(a)

1 2 3 4 5 6 7 8 9 10 11 12

SpoVID SpoVID+SafA-His SpoIVA+SpoVID+SafA-His

95130

1 2 3 4 5 6 7 8 9 10 11 12

(b)

1 2 3 4 5 6 7 8 9 10 11 12

SpoVID+SafA-His SpoIVA+SafA-His SpoIVA+SpoVID+SafA-His0.1 0.2 0.3 1.0

0.1 0.2 0.3 1.0 0.1 0.2 0.3 1.0 0.1 0.2 0.3 1.0

0.1 0.2 0.3 1.0 0.1 0.2 0.3 1.0

55

(c)

130

95

SpoVID-His SpoIVA+SpoVID-His

1 2 3 4 5 6 7 8

(d)

72

55

SpoIVA0.1 0.2 0.3 1.0 0.1 0.2 0.3 1.0

0.1 0.2 0.3 1.0 0.1 0.2 0.3 1.0

SpoIVA+SpoVID-His

1 2 3 4 5 6 7 8

(e)

SpoIVA

SpoVID

SpoVID

SpoIVA

SafA

Fig. 3. Western blots of pull-down analyses

of coexpressed SpoVID, SpoIVA and SafA in

Escherichia coli. The pull-down assays were

performed on Ni21 column: SpoVID was

His-tagged in (a, b) and SafA in (c–e). Proteins

were probed with polyclonal anti SpoIVA

antibody (a, c), polyclonal anti SpoVID antibody

(d) and monoclonal anti-His-tag antibody (b, e).

Above each lane is the concentration of imidazole

(mol L�1) used to elute proteins from the nickel

column. Small amounts of untagged proteins

(a, c, d – lanes 1–4) are retained slightly on Ni21

column, eluted already by 0.1 M (d – lane 1) or

0.2 M (a, c – lane 2) concentrations of imidazole.

On the other hand, untagged SpoIVA and SpoVID

are present in the sample eluted with 0.3 M

imidazole in the presence of His-SafA (c, d – lanes

9–12), indicating that they are pulled-down by

His-SafA protein. In the same way, SpoIVA is

pulled-down by His-SpoVID (a – lanes 5–8).

(b, e) Elution profiles of His-tagged proteins:

SpoVID (b) and SafA (e). Molecular masses (in

kDa) are indicated on the right side of each panel.



SpoIVA as well as SpoVID interact directly withSafA in coexpression and triple pull-down assay

Several previous studies (Ozin et al., 2000, 2001; Costa et al.,

2006) showed that there is a direct contact between two

morphogenetic proteins, SpoVID and SafA. Their mutual

association was observed by coimmunoprecipitation (Ozin

et al., 2000) and the direct contact was confirmed by the

yeast two-hybrid system and in vitro pull-down assay (Ozin

et al., 2001). The same work pointed out the dependency of

SafA on SpoIVA in targeting the forespore. Thus we decided

to include the third morphogenetic protein, SafA, in our

coexpression experiments.

Escherichia coli cells were cotransformed with compatible

vectors pETDuet-1, carrying spoVID and 50 end His-tagged

safA, and with pACYCDuet-1, carrying untagged spoIVA

gene. We also transformed single pETDuet-1 carrying His-

SafA and SpoVID, to confirm their mutual interaction, as

well as a combination of pETDuet(his-safA) and pACYC

(spoIVA). Expression of proteins was followed by pull-down

assay on nickel-conjugated resin and the presence of pro-

teins of interest was probed by Western blot using anti-

His-tag, anti-SpoIVA and anti-SpoVID antibodies (see

Materials and methods). Immunodetection confirmed the

direct interaction between SpoVID and SafA proteins and

revealed a novel, albeit anticipated (Ozin et al., 2001), direct

interaction between SafA and SpoIVA. His-SafA pulled

down both SpoVID and SpoIVA independently (Fig. 3c, d,

lanes 5–8) but also when both were coexpressed in E. coli

(Fig. 3c, d, lanes 9–12). Proteins with no His tag were eluted

early from the column, at 0.1 M concentration of imidazole

(Fig. 3c, d, lane 1). Elution profiles of His-tagged SafA

expressed with either one or both untagged proteins are

shown in Fig. 3e. As shown in Fig. 3c (lanes 1–3) and Fig. 3d

(lanes 1–3), untagged SpoVID and SpoIVA apparently

possess some low innate affinity to nickel resin, as they

remained attached to the column even after several washes.

Although the same amounts of cell extract were used in all

cases, the concentrations of SpoVID and SpoIVA in these

samples were higher than when two or three proteins were

coexpressed. Key to this observation is that the level of

expression of single protein from pETDuet-1 vector is

higher than the level of expression of two or more proteins

(Novagen, Duet vectors manual). Therefore, we would

expect to detect no signals in lanes 1–3 (Fig. 3c, d) if equal

amounts of proteins are loaded onto the column, as for pull-

down samples of a mixture of interacting proteins. All the

results presented here strongly indicate the existence of

mutual interactions between SpoVID, SpoIVA and SafA.

Discussion

Bacillus subtilis spore coat is built up of 4 70 protein

components (Henriques et al., 2004; Kim et al., 2006). Their

mutual direct or indirect interactions lead to formation of

an intricate composite structure whose properties enable

the spore to endure various assaults. From this protein

network, only a small subset of components play a morpho-

genetic role (Driks, 1999; Henriques & Moran, 2000;

McPherson et al., 2005). In this study, we demonstrated that

two morphogenetic spore coat proteins, SpoIVA and

SpoVID, interact directly. For this interaction to occur, the

C-terminal portion of SpoVID and full-length SpoIVA

protein are crucial. We also showed that both SpoIVA and

SpoVID proteins interact with SafA either independently or

simultaneously.

Yeast two-hybrid experiments revealed a positive interac-

tion when full-length SpoIVA was fused to the GAL4

activation domain and full-length SpoVID to the DNA-

binding domain but not vice versa, which is not a rare

observation (Seyler et al., 1997). In the search for domains

of each protein, responsible for their direct interaction,

N-terminal and C-terminal truncated mutants of SpoVID

and SpoIVA were prepared. No truncated mutant of SpoIVA

protein interacted with full-length SpoVID (Fig. 1b), in-

dicating that full-length protein is necessary for direct

contact with SpoVID. On the other hand, 200 residues

of the N-terminal part of SpoVID are dispensable for

interaction with full-length SpoIVA, implying that amino

acids mediating contact with SpoIVA are present in the

C-terminal part of SpoVID.

Previous research (Ozin et al., 2001; Costa et al., 2006)

focused on searching for direct interactions between pro-

teins used GST as a tag in pull-down experiments. Using this

method, these studies confirmed direct interaction between

two morphogenetic proteins, SpoVID and SafA, initially

observed by the yeast two-hybrid system. Similarly, here it

was necessary to confirm the direct interaction between the

proteins of interest, SpoIVA and SpoVID, by the in vitro

pull-down assay. Unfortunately, experiments using GST as a

tag were not successful, GST-SpoIVA failed to pull-down

His-SpoVID. As SpoIVA is an insoluble protein, we believed

that GST tag might enhance its solubility; instead, it

probably prevented SpoIVA from contacting SpoVID. Like-

wise, in the yeast two-hybrid system, SpoVID and SpoIVA

interacted only when fused to a particular domain of GAL4;

it might be possible that GST is not a suitable fusion partner

for SpoIVA and that SpoVID, as in the studies of Ozin et al.

(2001) and Costa et al. (2006), would in fusion with GST,

occupy the correct conformation.

Ozin et al. (2000) detected two forms of SpoVID pro-

tein in B. subtilis wild-type extracts: the 66 and 120 kDa

forms. The predicted weight of the protein monomer is

65 kDa. Our heterologous proteins expressed in E. coli

migrated on Western blots at approximately a mass which

may correspond to a dimer. Results obtained from gel

filtration assay indicate that SpoVID protein may undergo



a multimerization process. The same result was observed

with SpoIVA protein. The denaturing conditions of SDS-

PAGE gel break down the oligomeric structures of SpoVID

and SpoIVA in such a way that they migrate as smaller

species. The predicted weight of SpoIVA is 55 kDa. How-

ever, previous and present results suggest that SpoVID and

SpoIVA proteins may be present in several forms within

the cell. Is the oligomerization process of these proteins

simply the consequence of spore maturation or do their

different forms serve distinct functions? The model of

SpoIVA assembly proposed by Ramamurthi & Losick

(2008) shows that individual SpoIVA molecules are teth-

ered to forespore surface by SpoVM (Price & Losick, 1999)

and oligomerization occurs subsequently upon hydrolysis

of ATP and is an irreversible process. This finding indicates

that only monomeric molecules are capable of recognition

of the assembly site and hence are essential for assembly

initiation. In view of this polymerization evidence, it is

surprising that our yeast two-hybrid screen did not reveal

self-interaction of either SpoIVA or SpoVID. On the other

hand and in agreement with results presented here, Ozin

et al. (2001) also found no evidence of interaction between

SpoVID molecules using the yeast two-hybrid system. It

may be that one limitation of this system is that it is not

able to reveal all existing interactions between tested

proteins. One of them is a steric barrier when protein

is fused to a particular domain of GAL4 transcription

factor. Another limitation may consist in incorrect fold-

ing and instability of such a protein. The last possible

explanation is impaired targeting of heterologous fusion

proteins into the yeast nucleus. Similar problems were

encountered when testing SpoVID–SafA and SpoIVA–SafA

interactions by the yeast two-hybrid system. A direct

interaction of SpoVID and SafA has already been observed

using the yeast two-hybrid system (Ozin et al., 2001), but

in that work they used a different two-hybrid system

(Clontech, Matchmaker) which utilizes high copy vectors

and is therefore more sensitive. Further experiments and/

or other methods need to be employed to elucidate this

obvious discrepancy.

The coexpression experiment followed by pull-down

assay confirmed the direct interaction between SpoVID and

SpoIVA observed by the yeast two-hybrid system and

revealed a potentially novel interaction between SpoIVA

and SafA. Pull-down assay also confirmed a previously

reported direct interaction between SpoVID and SafA

(Costa et al., 2006). Untagged proteins SpoVID and SpoIVA,

in the presence of His-SafA, were retained on nickel affinity

resin at higher concentrations of imidazole than in the

absence of His-SafA. Moreover, it seems that SpoIVA binds

more strongly to SpoVID–SafA complex than to SafA

protein itself, because a higher concentration of imidazole

is needed to elute SpoIVA from the affinity column, and

more protein is eluted.

Fig. 4. Model of the assembly of early spore coat proteins. SpoIVA, SpoVID and SafA are targeted to the OFM. SpoVID and SafA both contain a LysM

domain with peptidoglycan-binding properties. SpoIVA is tethered to OFM via the small amphipathic peptide SpoVM. In the SpoVID protein sequence,

there are two known regions of interaction (depicted as thick-line rectangles): the N-terminal part of SpoVID, comprising the first 202 amino acid

residues, is responsible for contact with regions A and B of SafA (details in text); the C-terminal part between residues 400 and 575 (thick-line rectangle)

contacts unspecified regions of SpoIVA. Walker A box present in the N-terminal part of SpoIVA is responsible for ATP hydrolysis and multimerization of

SpoIVA protein. See text for more details. Solid arrows indicate direct interactions between proteins: full arrowheads mark known regions of interaction;

open arrowheads label putative sites of interaction. Dotted arrows depict mutual dependencies of various proteins.



Based on the latest findings (Costa et al., 2006; Kim et al.,

2006; Henriques & Moran, 2007; Ramamurthi & Losick,

2008) and on results presented here, we propose the follow-

ing model of early spore coat protein assembly (Fig. 4). First,

SpoIVA is recruited via its C terminus to the outer forespore

membrane (OFM) by a small amphipathic peptide called

SpoVM (Price & Losick, 1999). SpoIVA then recruits

SpoVID, whose LysM domain facilitates its deployment to

cortex peptidoglycan beneath the OFM. Results obtained

using yeast two-hybrid assay imply that for this interaction

to occur, the C-terminal part of SpoVID and the whole

sequence of SpoIVA are necessary. In the next step, SafA is

firstly targeted to OFM in a SpoVID-independent event

which probably depends on its LysM domain, and, secondly,

SafA encases the spore upon the direction of SpoVID (Ozin

et al., 2001; Costa et al., 2006). Essential for the interaction

between SafA and SpoVID are regions A (residues 51–63)

and B (PYYH motif, residues 203–206) of SafA and the

N-terminal part of SpoVID (Costa et al., 2006). SafA is

supposed to have an extended conformation ranging from

cortex to outer coat and binding outer coat proteins with its

C terminus (Ozin et al., 2000). However, direct interaction

between SafA and CotE has not been observed yet. SafA

deletion results in loss of several uncharacterized proteins

and also CotG, which is an outer coat component (Taka-

matsu et al., 1999; Kim et al., 2006). From the results

mentioned above and from previous work it may be

suggested that SpoIVA and SpoVID form a complex before

SafA localization to the forespore. Based on the pull-down

results it can be concluded that interaction between SafA and

SpoVID is stronger than that between SafA and SpoIVA. Less

SpoIVA is eluted from the column in comparison with the

amount of SpoVID in the cases when these were separately

coexpressed and pulled down by SafA. It is therefore reason-

able to assume that SpoVID tethers SafA to SpoVID–SpoIVA

complex and the low affinity interaction between SafA and

SpoIVA takes place afterwards. The precise regions of each

protein involved in this interaction still remain to be resolved.

Further studies will reveal more details about how proteins

contact each other and how they polymerize into supramole-

cular structures. This work contributes to the elucidation of

the partial mechanism that enables creation of such an

intricate and endurable structure like the B. subtilis spore coat.

Acknowledgements

The authors gratefully acknowledge Dr Simon Cutting for

preparation of antibodies against SpoIVA and SpoVID

proteins. The work in the author’s laboratory is supported

by grant NMP4-CT-2004-013523 from the EU 6th FP, grant

2/7007/27 from the Slovak Academy of Sciences and grants

from the Slovak Research and Development Agency under

contract No. LPP-0218-06, No. ESF-EC-0106.

References

Backman K, Ptashne M & Gilbert AW (1976) Construction of

plasmids carrying the cI gene of bacteriophage lambda. P Natl

Acad Sci USA 73: 4174–4178.

Beall B, Driks A, Losick R & Moran CP Jr (1993) Cloning and

characterization of a gene required for assembly of the Bacillus

subtilis spore coat. J Bacteriol 175: 1705–1716.

Catalano FA, Meador-Parton J, Popham DL & Driks A (2001)

Amino acids in the Bacillus subtilis morphogenetic protein

SpoIVA with roles in spore coat and cortex formation.

J Bacteriol 183: 1645–1654.

Coote JG (1972) Sporulation in Bacillus subtilis. Characterization

of oligosporogenous mutants and comparison of their

phenotypes with those of asporogenous mutants. J Gen

Microbiol 71: 1–15.

Costa T, Isidro AL, Moran CP Jr & Henriques AO (2006)

Interaction between coat morphogenetic proteins SafA and

SpoVID. J Bacteriol 188: 7731–7741.

Driks A (1999) Bacillus subtilis spore coat. Microbiol Mol Biol R

63: 1–20.

Driks A (2002) Proteins of the spore core and coat. Bacillus

subtilis and its Closest Relatives (Sonenshein AL, Hoch JA &

Losick R, eds), pp. 527–536. American Society for

Microbiology, Washington, DC.

Driks A & Setlow P (2000) Morphogenesis and properties of the

bacterial spore. Prokaryotic Development (Brun YV & Shimkets

LJ, eds), pp. 191–218. American Society for Microbiology,

Washington, DC.

Driks A, Roels S, Beall B, Moran CP Jr & Losick R (1994)

Subcellular localization of proteins involved in the assembly of

the spore coat of Bacillus subtilis. Gene Dev 8: 234–244.

Gietz RD & Woods RA (2002) Transformation of yeast by the

LiAc/SS carrier DNA/PEG method. Method Enzymol 350:

87–96.

Henriques AO & Moran CP Jr (2000) Structure and assembly of

the bacterial endospore coat. Methods 20: 95–110.

Henriques AO & Moran CP Jr (2007) Structure, assembly and

function of the spore surface layers. Annu Rev Microbiol 61:

555–588.

Henriques AO, Costa TV, Martins LO & Zilhao R (2004) The

functional architecture and assembly of the coat. Bacterial

Spore Formers: Probiotics and Emerging Applications (Ricca RE,

Henriques AO & Cutting SM, eds), pp. 65–86. Horizon

Biosciences, Norfolk.

Kim H, Hahn M, Grabowski P, McPherson DC, Otte MM, Wang

R, Ferguson CC, Eichenberger P & Driks A (2006) The Bacillus

subtilis spore coat protein interaction network. Mol Microbiol

59: 487–502.

Kodama T, Takamatsu H, Asai K, Kobayashi K, Ogasawara N &

Watabe K (1999) The Bacillus subtilis yaaH gene is transcribed

by SigE RNA polymerase during sporulation, and its product

is involved in germination of spores. J Bacteriol 181:

4584–4591.



Krajcikova D, Lukacova M, Mullerova D, Cutting SM & Barak I

(2009) Searching for protein–protein interactions within the

Bacillus subtilis spore coat. J Bacteriol 191: 3212–3219.

Levin PA, Fan N, Ricca E, Driks A, Losick R & Cutting S (1993)

An unusually small gene required for sporulation by Bacillus

subtilis. Mol Microbiol 9: 761–771.

McPherson DC, Kim H, Hahn M, Wang R, Grabowski P,

Eichenberger P & Driks A (2005) Characterization of the

Bacillus subtilis spore morphogenetic coat protein CotO.

J Bacteriol 187: 8278–8290.

Nicholson WL, Munakata N, Horneck G, Melosh HJ & Setlow P

(2000) Resistance of Bacillus endospores to extreme terrestrial

and extraterrestrial environments. Microbiol Mol Biol R 64:

548–572.

Ozin AJ, Henriques AO, Yi H & Moran CP Jr (2000) Morpho-

genetic proteins SpoVID and SafA form a complex during

assembly of the Bacillus subtilis spore coat. J Bacteriol 182:

1828–1833.

Ozin AJ, Samford CS, Henriques AO & Moran CP Jr (2001)

SpoVID guides SafA to the spore coat in Bacillus subtilis.

J Bacteriol 183: 3041–3049.

Piggot PJ & Coote JG (1976) Genetic aspects of bacterial

endospore formation. Bacteriol Rev 40: 908–962.

Pogliano K, Harry E & Losick R (1995) Visualization of the

subcellular location of sporulation proteins in Bacillus subtilis

using immunofluorescence microscopy. Mol Microbiol 18:

459–470.

Price KD & Losick R (1999) A four-dimensional view of assembly

of a morphogenetic protein during sporulation in Bacillus

subtilis. J Bacteriol 181: 781–790.

Ramamurthi KS & Losick R (2008) ATP-driven self-assembly of a

morphogenetic protein in Bacillus subtilis. Mol Cell 31: 406–414.

Roels S, Driks A & Losick R (1992) Characterization of spoIVA, a

sporulation gene involved in coat morphogenesis in Bacillus

subtilis. J Bacteriol 174: 575–585.

Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A

Laboratory Manual. Cold Spring Harbor Laboratory Press,

Cold Spring Harbor, NY.

Setlow P (2000) Resistance of bacterial spores. Bacterial

Stress Responses (Storz G & Hengge-Aronis R, eds),

pp. 217–230. American Society for Microbiology,

Washington, DC.

Setlow P (2003) Spore germination. Curr Opin Microbiol 6:

550–556.

Seyler RW Jr, Henriques AO, Ozin AJ & Moran CP Jr (1997)

Assembly and interactions of cotJ-encoded proteins,

constituents of the inner layers of the Bacillus subtilis spore

coat. Mol Microbiol 25: 955–966.

Takamatsu H, Kodama T, Nakayama T & Watabe K (1999)

Characterization of the yrbA gene of Bacillus subtilis, involved

in resistance and germination of spores. J Bacteriol 181:

4986–4994.

Vidal M (1997) The reverse two-hybrid system. The Two-hybrid

System (Bartel P & Fields S, eds), pp. 109–147. Oxford

University Press, New York.

Youngman P, Perkins JB & Losick R (1984) Construction of a

cloning site near one end of Tn917 into which foreign DNA

may be inserted without affecting transposition in Bacillus

subtilis or expression of the transposon-borne erm gene.

Plasmid 12: 1–9.

Zheng L, Donovan WP, Fitz-James PC & Losick R (1988) Gene

encoding a morphogenic protein required in the assembly of

the outer coat of the Bacillus subtilis endospore. Gene Dev 2:

1047–1054.



interactions between bacillus subtilis early spore coat morphogenetic proteins

Documents