insights into the biosynthesis and assembly of cryptophycean phycobiliproteins

and Nicole Frankenberg-DinkelKock, Christian Herrmann, Eckhard Hofmann Kristina E. Overkamp, Raphael Gasper, Klaus of Cryptophycean PhycobiliproteinsInsights into the Biosynthesis and AssemblyProtein Structure and Folding:

doi: 10.1074/jbc.M114.591131 originally published online August 5, 20142014, 289:26691-26707.J. Biol. Chem.

10.1074/jbc.M114.591131Access the most updated version of this article at doi:

.JBC Affinity SitesFind articles, minireviews, Reflections and Classics on similar topics on the

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/289/39/26691.full.html#ref-list-1

This article cites 71 references, 30 of which can be accessed free at

at Colum

bia University on Septem

ber 29, 2014http://w

ww

.jbc.org/D

ownloaded from

at C

olumbia U

niversity on September 29, 2014

http://ww

w.jbc.org/

Dow

nloaded from

http://affinity.jbc.org/

http://proteinsf.jbc.org

http://plant.jbc.org

http://www.jbc.org/lookup/doi/10.1074/jbc.M114.591131

http://affinity.jbc.org

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;289/39/26691&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/289/39/26691

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=289/39/26691&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/289/39/26691

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/289/39/26691.full.html#ref-list-1

http://www.jbc.org/

http://www.jbc.org/

Insights into the Biosynthesis and Assembly ofCryptophycean Phycobiliproteins�

Received for publication, June 23, 2014, and in revised form, July 31, 2014 Published, JBC Papers in Press, August 5, 2014, DOI 10.1074/jbc.M114.591131

Kristina E. Overkamp‡1, Raphael Gasper§, Klaus Kock¶, Christian Herrmann¶, Eckhard Hofmann§,and Nicole Frankenberg-Dinkel‡2

From the ‡Physiology of Microorganisms, Faculty for Biology and Biotechnology, §Protein Crystallography, Faculty for Biology andBiotechnology, and ¶Physical Chemistry I, Protein Interactions, Faculty for Chemistry and Biochemistry, Ruhr University Bochum,44780 Bochum, Germany

Background: Cryptophytes like Guillardia theta utilize soluble phycobiliproteins for light-harvesting.Results: Guillardia theta adopted phycoerythrobilin biosynthesis from cyanobacteria, and the phycobiliprotein lyase GtCPESprovides structural requirements for transfer of this chromophore to a specific cysteine residue of the apophycobiliprotein.Conclusion: Phycobiliprotein synthesis in Guillardia theta combines proven and novel components.Significance: Results provide a better understanding of the evolution and function of unusual phycobiliproteins incryptophytes.

Phycobiliproteins are employed by cyanobacteria, red algae,glaucophytes, and cryptophytes for light-harvesting and consistof apoproteins covalently associated with open-chain tetrapyr-role chromophores. Although the majority of organisms assem-ble the individual phycobiliproteins into larger aggregatescalled phycobilisomes, members of the cryptophytes use a singletype of phycobiliprotein that is localized in the thylakoid lumen.The cryptophyte Guillardia theta (Gt) uses phycoerythrinPE545 utilizing the uncommon chromophore 15,16-dihydro-biliverdin (DHBV) in addition to phycoerythrobilin (PEB). Boththe biosynthesis and the attachment of chromophores to theapophycobiliprotein have not yet been investigated for crypto-phytes. In this study, we identified and characterized enzymesinvolved in PEB biosynthesis. In addition, we present the firstin-depth biochemical characterization of a eukaryotic phyco-biliprotein lyase (GtCPES). Plastid-encoded HO (GtHo) wasshown to convert heme into biliverdin IX� providing thesubstrate with a putative nucleus-encoded DHBV:ferredoxinoxidoreductase (GtPEBA). A PEB:ferredoxin oxidoreductase(GtPEBB) was found to convert DHBV to PEB, which is the sub-strate for the phycobiliprotein lyase GtCPES. The x-ray struc-ture of GtCPES was solved at 2.0 Å revealing a 10-stranded�-barrel with a modified lipocalin fold. GtCPES is an S-typelyase specific for binding of phycobilins with reduced C15�C16double bonds (DHBV and PEB). Site-directed mutagenesisidentified residues Glu-136 and Arg-146 involved in phycobilinbinding. Based on the crystal structure, a model for the interac-

tion of GtCPES with the apophycobiliprotein CpeB is proposedand discussed.

Cryptophytes, cyanobacteria, red algae, and glaucophytesperform oxygenic photosynthesis using chlorophyll-containingantenna complexes and additional light-harvesting proteins,termed phycobiliproteins (PBP)3 (1, 2). PBPs allow the organ-isms to efficiently absorb light in regions of the visible spectrumthat are absorbed poorly by chlorophylls. In contrast to the(��)3 trimeric or hexameric PBPs of cyanobacteria (2– 4), thecryptophycean PBPs are (��)(��) heterodimers and are notorganized in phycobilisomes but occur as soluble proteins inthe thylakoid lumen (1, 5). In the phycobilisomes of a givencyanobacterial species, the PBPs allophycocyanin and phy-cocyanin and additionally species-specific phycoerythrin(PE) and/or phycoerythrocyanin are present (6 – 8). In contrast,each cryptophyte species uses a single modified PBP-type (5, 9).All PBPs are associated with open-chain tetrapyrrole chro-mophores, the phycobilins. Cyanobacterial PBPs use the phy-cobilins phycocyanobilin (PCB), phycoerythrobilin (PEB),phycoviolobilin, and phycourobilin as light-harvesting chro-mophores. Interestingly, in cryptophycean PBPs the uncom-mon chromophores 15,16-dihydrobiliverdin (DHBV), 181,182-dihydrobiliverdin, bilin 584, and bilin 618 occur in addition toPCB and PEB (8, 10, 11).

The cryptophyte Guillardia theta utilizes a PE with anabsorption maximum at 545 nm (PE545) as a PBP (12). In theholoprotein, one molecule of DHBV is covalently linked to each�-subunit, and each �-subunit is associated with three mole-cules of PEB (13, 14). The biosynthesis of the phycobilin cofac-

� This article was selected as a Paper of the Week.The atomic coordinates and structure factors (code 4TQ2) have been deposited in

the Protein Data Bank (http://wwpdb.org/).The nucleotide sequences reported in this paper have been submitted to the Gen-

BankTM/EBI Data Bank with accession numbers KJ676834, KJ676835, andKJ676836.

1 Supported by a Ph.D. scholarship from the Studienstiftung des DeutschenVolkes e.V.

2 Supported by a grant from the Deutsche Forschungsgemeinschaft. Towhom correspondence should be addressed: Physiology of Microorgan-isms, Ruhr University Bochum, Universitaetsstrasse 150, 44780 Bochum,Germany. Tel.: 49-234-3223101; Fax: 49-234322314620; E-mail: [email protected].

3 The abbreviations used are: PBP, phycobiliprotein; BV IX�, biliverdin IX�; DHBV,15,16-dihydrobiliverdin; FDBR, ferredoxin-dependent bilin reductase; FABP,fatty acid-binding protein; HO, heme oxygenase; P�B, phytochromobilin;PCB, phycocyanobilin; PE, phycoerythrin; PEB, phycoerythrobilin; SeMet,selenomethionyl; TES, 2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acid; PDB, Protein Data Bank; ITC, isothermal titrationcalorimetry.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 39, pp. 26691–26707, September 26, 2014© 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

SEPTEMBER 26, 2014 • VOLUME 289 • NUMBER 39 JOURNAL OF BIOLOGICAL CHEMISTRY 26691

at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

tors and their assembly with the PBP apoprotein has been stud-ied extensively in cyanobacteria (15). Generally, phycobilinbiosynthesis starts with the oxygenolytic cleavage of heme byferredoxin-dependent HO yielding the first open-chain tet-rapyrrole biliverdin IX� (BV IX�) (16 –18). Further reductionof BV obtaining PCB, PEB, and phytochromobilin (P�B) is cat-alyzed by ferredoxin-dependent bilin reductases (FDBR) (16,19, 20). In cyanobacteria, PEB biosynthesis is performed by15,16-DHBV:ferredoxin oxidoreductase (PebA) converting BVIX� to the intermediate DHBV, which is subsequently reducedto PEB by the second FDBR PEB:ferredoxin oxidoreductase(PebB) (16, 21). Interestingly, PebS from the cyanophageP-SSM2 is capable of performing a four-electron reduction ofBV IX�, directly yielding PEB (20).

Once synthesized, the phycobilin is bound by a specific PBPlyase, which then facilitates the ligation of the chromophore toa specific cysteine residue within the apo-PBP (22–24). PBPlyases are distinguishable in the clades of E/F-, S/U-, and T-typelyases, and some members of the E/F-type have an additionalisomerase function (25–27).

Because of their evolution by secondary endosymbiosis,cryptophytes are extraordinary organisms. They are derivedfrom a eukaryotic ancestor host cell that engulfed a red algalcell. The red alga was reduced to a complex plastid within thecryptophyte cell (28, 29). Hence, cryptophytes possess the fol-lowing four genomes: the endosymbiont-derived plastidial andnucleomorph genomes and the mitochondrial and host nucleargenome. Many of the endosymbiotic genes involved were trans-ferred to the host nucleus during evolution (30). Cryptophytesretained the capability of performing oxygenic photosynthesislike red alga or cyanobacteria, but their light-harvestingmachinery has been extensively modified as demonstrated bytheir unusual PBPs. Hence, biosynthesis and assembly of PBPsare largely unexplored in cryptophytes. With the release of theG. theta nuclear genome sequence in 2011, a wealth of informa-tion has been made available to study these processes (31).About 51% of the nucleus-encoded proteins are unique, and49% have homologs in other organisms. For instance, the cryp-tophycean PBP �-subunits share no homology to those of cya-nobacteria or any other known proteins (32). In this study, weinvestigated the similarities and differences of PBP synthesisand assembly in cryptophytes compared with cyanobacteria.With the help of BLAST analyses of the different genomes of G.

theta, we found several genes encoding proteins potentiallyinvolved in phycobilin biosynthesis and PBP assembly. We givefirst insights into cryptophycean PEB biosynthesis, whichseems to be adopted from cyanobacteria. Moreover, we presentthe first crystal structure of a eukaryotic PBP lyase, the CpeSlyase from G. theta (GtCPES). This lyase was also characterizedin terms of phycobilin specificity, affinity, and binding kinetics.GtCPES belongs to the clade of S/U-type lyases and is restrictedto binding of DHBV and PEB.

EXPERIMENTAL PROCEDURES

Materials—All chemicals were American Chemical Societygrade or better unless specified otherwise. All assay compo-nents were purchased from Sigma. PreScission protease andexpression vector pGEX-6P-1 were obtained from GE Health-care; pASK-IBA7� was from IBA, and pGro7 was fromTaKaRa. Protino� glutathione-agarose 4B from Macherey-Nagel, Strep-Tactin�-Sepharose from IBA, and TALON�metal affinity resin from Clontech were used. HPLC-grade ace-tone, acetonitrile, formic acid, and spectroanalytical grade glyc-erol were obtained from Mallinckrodt Baker. Sep-Pak car-tridges were obtained from Waters. BV was obtained fromFrontier Scientific, Carnforth, Lancashire, UK.

Construction of Expression Vectors and Site-directed Muta-genesis—For construction of most plasmids, synthetic genesthat had been codon-optimized for Escherichia coli K12(GENEius algorithm, MWG Eurofins Operon) were employed.The synthetic genes were PCR-amplified from vectors sup-plied by MWG Eurofins Operon containing the appropriatesequence with primers encompassing selected recognition sitesfor cloning into an appropriate host vector. The plastid-en-coded HO from G. theta was PCR-amplified from total genomicDNA, and the corresponding PCR product was also cloned intoa host vector. Expression plasmids, the corresponding primers,recognition sites, the host vectors, and GenBankTM accessionnumbers of the used synthetic genes are summarized in Table 1.All site-directed variants of GtCPES were generated frompGtCPES using the QuikChange� site-directed mutagenesis kit(Stratagene) with help of primers listed in Table 1 (shown isonly the forward primer; the reverse primer is the complement,and introduced base pair changes are underlined). The result-ing plasmids were verified by sequencing. The construction ofthe plasmid pho1pebS was described before (20).

TABLE 1Constructed expression plasmids

Plasmid Host vectorRecognition

sites Primers (5� to 3�)GenBankTM;

synthetic gene

pGtHo pASK-IBA7� (IBA) EcoRI CGAATTCATGTCAAATAATTTAGCTATXhoI CCTCGAGTTAACTAAAATTTAGCATTA

pGtPEBA pGEX-6P1 (GE Healthcare) EcoRI GCGAATTCTTCCCGGAAGGCTT KJ676828NotI ATGCGGCCGCTCATTCGGCTTT

pGtPEBB pGEX-6P1 (GE Healthcare) EcoRI GGAATTCTTTCAGCTCGGGACTCCCG KJ676830NotI TGCGGCCGCTCAGAGGGGCGTGG

pGtCPES pASK-IBA7�(IBA) BsaI ATGGTAGGTCTCAGCGCATGTCGGTGGAAGAGTTCTTTGAG KJ676836BsaI ATGGTAGGTCTCATATCATTTGCTTTTGTCGCGTACTTCGG

pC149A pGtCPES CGGATTTACGCATGCGTGCCAGCATCATCAAGACACpE136A pGtCPES CGTGCTGCAGCCGAAGCACGCATTTGGTTTGCGpR146A pGtCPES GCGACACCGGATTTAGCCATGCGTTGCAGCATCpR148A pGtCPES CGACACCGGATTTACGCATGGCTTGCAGCATCATCAAGpET-GtCPES pETDuet (Novagen) NdeI ATACATATGTCGGTGGAAGAG KJ676836

XhoI TCCTCGAGTTTGCTTTTGTCGC

Cryptophyte Phycobiliprotein Biosynthesis

26692 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 289 • NUMBER 39 • SEPTEMBER 26, 2014

at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Production and Purification of Recombinant Proteins—A cul-ture of E. coli BL21 (DE3) carrying the respective expressionplasmid was incubated at 37 °C and 150 rpm in LB medium(GtHo and GtPEBA, supplemented with 100 mM sorbitol and2.5 mM betaine) to an A578 nm of 0.6. For production of GtCPESco-expression of chaperones, GroEL and GroES (pGro7;TaKaRa) were induced by addition of 0.5 mg/ml L-arabinose,and cells were grown to an A578 nm of 0.7– 0.8. Subsequently,cells were induced with isopropyl �-D-thiogalactopyranoside(0.5 mM; pGEX-6P1 derivatives) or anhydrotetracycline (200ng/ml; pASK-IBA7� derivatives) and incubated overnight at17 °C (GtPEBA and GtCPES) or 30 °C (GtHO and GtPEBB).Cells were harvested by centrifugation, resuspended in lysisbuffer (50 mM Tris-HCl, pH 7.5, 100 mM NaCl, 10% glycerol),and disrupted by two passages through a Constant Systems CellDisruptor at 35,000 p.s.i. (GtHo, GtPEBA, and GtPEBB) or twotimes with a 2.5-min sonication (GtCPES). After separation ofcell debris, the supernatant was loaded onto a column contain-ing Protino� glutathione-agarose 4B (Macherey & Nagel;GtPEBA and GtPEBB) or a Strep-Tactin-Sepharose� (IBA;GtCPES).Purificationwascarriedoutaccordingtothemanufac-turer’s instructions based on sodium phosphate buffer (60 mM

sodium phosphate, 300 mM NaCl, pH 7.5; GtCPES), potassiumphosphate buffer (100 mM potassium phosphate, 100 mM NaCl,pH 7.2; GtHo) or TES/KCl buffer (25 mM TES, 100 mM KCl, pH7.5; GtPEBA and GtPEBB). If required, purified GST-GtPEBBwas incubated with PreScission protease (GE Healthcare) anddialyzed against cleavage buffer (50 mM Tris-HCl, pH 7.5, 150mM NaCl, 1 mM EDTA, 1 mM DTT). Tag-free GtPEBB was thenobtained by a second affinity chromatography. Purified pro-teins were dialyzed three times against appropriate buffersmentioned above and concentrated using Vivaspin 6 concen-trators (molecular mass cutoff 10,000 Da; Sartorius Stedim).Concentrations of proteins were determined using the calcu-lated molar extinction coefficient �280 (33).

Selenomethionine-GtCPES Preparation for CrystallizationStudies—For crystallization experiments, StrepII-GtCPES wasproduced and purified as described above, but transferred intocrystallization buffer (20 mM HEPES, 25 mM NaCl, pH 7.5) viasize exclusion chromatography (Superdex 200 10/300 GL). Sel-enomethionyl (SeMet)-GtCPES was produced and purified asdescribed for GtCPES with modifications according to VanDuyne et al. (34). Cells were grown in M9 medium supple-mented with 1 mg/ml vitamins (riboflavin, niacinamide, pyri-doxine, and thiamine) and trace element mixture. An aminoacid mixture (lysine, threonine, and phenylalanine: 0.1 g/li-ter; leucine, isoleucine, valine, and L(�)-selenomethionine:0.05 g/liter) was added 30 min prior to induction. All buffersused during purification were supplemented with 10 mM

�-mercaptoethanol.Co-expression Experiments—Heterologous co-expression of

GtCPES and PEB biosynthesis enzymes was performed inE. coli BL21(DE3) containing pET-GtCPES and pho1pebS. Cul-tures were grown in LB medium supplemented with 100 mM

sorbitol and 2.5 mM betaine at 37 °C, 150 rpm to an A578 nm of0.6 prior to induction with 0.5 mM isopropyl �-D-thiogalacto-pyranoside and incubated overnight at 17 °C (16 h). Afterwards,cells were harvested, and the blue-colored cells were disrupted

by sonication, and the supernatant was separated from celldebris by centrifugation. The His6-GtCPES�PEB complex waspurified by affinity chromatography using TALON� metalaffinity resin (Clontech). The purification was carried outaccording to the manufacturer’s instructions based on sodiumphosphate buffer, pH 7.5.

Preparation of Phycobilins—BV IX� was obtained fromFrontier Scientific. The preparative production of DHBV wasperformed in vitro under anaerobic conditions as describedbefore (21, 35, 36). 3(E)-PCB was isolated from Spirulina cellsas described previously (37). For preparation of 3(E)- and 3(Z)-PEB, the plasmids pET-GtCPES and pho1pebS were co-ex-pressed in E. coli BL21(DE3), and the His6-GtCPES�PEB com-plex was purified as described above. The dark blue elutionfraction was immediately diluted 10-fold in 0.1% TFA to pre-cipitate proteins. PEB was extracted using a Sep-Pak Plus C18cartridge, concentrated, and dried with help of a SpeedVac con-centrator. The isolated PEB/isomer mixture was analyzed andseparated into 3(E)- and 3(Z)-PEB via HPLC using a Ultracarb5� ODS C18 column (Phenomenex) as described previously(21). Separated 3(E)- and 3(Z)-PEB fractions were collected,pooled, evaporated until dryness with a SpeedVac concentra-tor, and stored at �20 °C. Phycobilins were resuspended in anappropriate amount of DMSO immediately before use. Con-centrations were determined using �571 � 46.9 mM�1 cm�1

(3(E)-PEB) (38) and �685 � 37.15 mM�1 cm�1 (3(E)-PCB) (39).Because of the absence of a reported extinction coefficient for3(Z)-PEB and DHBV, �571 and �564 of the related 3(E)-PEBswere used.

Analysis of HO and FDBR Activity—After expression ofGtHo in E. coli BL21 (DE3), the green-colored cells were dis-rupted using a Constant Systems Cell Disrupter at 35,000 p.s.i.,and cell debris and supernatant were separated by centrifuga-tion. The supernatant was diluted 1:10 in 0.1% TFA to precipi-tate proteins. Pigments were extracted using a Sep-Pak LightC18 cartridge, concentrated, and dried with help of a SpeedVacconcentrator. The isolated phycobilins were analyzed via HPLCas described previously (21).

Anaerobic bilin reductase assays were performed utilizing anAgilent 8453 UV-visible spectrophotometer as describedpreviously (35) with the following modifications. Reactionmixtures were incubated at 20 °C for 10 min, and the reactionwas followed spectroscopically every 30 s. Phycobilins wereextracted using a Sep-Pak Light C18 cartridge, concentrated,and dried with the help of a SpeedVac concentrator. The iso-lated phycobilins were analyzed via HPLC.

GtCPES-Phycobilin Binding Studies—Equimolar amounts(10 �M) of PBP lyase and phycobilin were mixed in sodiumphosphate buffer, pH 7.5. Absorption spectra (Agilent 8453UV-visible spectrophotometer) of the mixture and free phyco-bilins in the same buffer were compared.

Stopped Flow Kinetics—For stopped flow experiments, anSFM-400 apparatus with MOS-200 optics was used (Bio-Logic). Measurements were performed at 20 °C in sodiumphosphate buffer, pH 7.5. Different concentrations of GtCPESwere rapidly mixed with a constant amount (2 �M) of DHBV,3(E)-PEB, or 3(Z)-PEB, and the increase in the absorption max-imum was detected at 600 nm (PEB) or 610 nm (DHBV). Six to



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

eight time traces were accumulated and averaged, and an expo-nential equation was fitted to the experimental data yielding thekobs value for each concentration. All experiments wererepeated twice.

Isothermal Titration Calorimetry—Isothermal titration calo-rimetry (ITC) for analyzing GtCPES/PEB interaction was per-formed at 20 °C in sodium phosphate buffer, pH 7.5, usingan isothermal titration microcalorimeter (MicroCal Auto-iTC200, GE Healthcare). The temperature-controlled samplecell contained 40 �M 3(E)- or 3(Z)-PEB, respectively, andGtCPES (400 �M) was injected in 1.7-�l steps, whereupon thechange in heating power was recorded over 180 s until equilib-rium was reached after each injection. Background heat gener-ation from dilution of PEB or GtCPES in buffer was subtractedand fitted to each measurement. Measurements with 3(E)-PEBwere averaged over two ITC experiments.

Size Exclusion Chromatography—The oligomerization stateof proteins was determined using a GE Healthcare Superdex200 HR10/300 GL size exclusion column. The column wasequilibrated in appropriate buffer at a flow rate of 0.5 ml/min.Standards with known molecular weight (i.e. alcohol dehydro-genase, 150,000; bovine serum albumin, 66,000; carbonicanhydrase, 29,000; cytochrome c, 12,400) were applied to thecolumn, and their elution volumes were determined spectro-scopically at 280 nm. For chromatography of GtCPES sodiumphosphate buffer, pH 7.5, of GtHo potassium phosphate buffer,pH 7.2, and of GtPEBA and GtPEBB, TES-KCl buffer at pH 7.5was used.

Crystallization of GtCPES—StrepII-GtCPES was concen-trated to 10 mg/ml in 20 mM HEPES, 25 mM NaCl, pH 7.5.Crystallization conditions were screened by the sitting dropvapor diffusion method applying 200/100- and 100/100-nl mix-tures of the protein solution/reservoir solution incubated at18 °C. Crystals were obtained in 0.01 M CoCl2, 0.085 M sodiumacetate, pH 4.6, 0.98 M 1,6-hexanediol, 15% glycerol and directlyfrozen in liquid N2 using no additional cryoprotection.

Phases were determined experimentally by single-wave-length anomalous dispersion. GtCPES substituted with SeMetwas screened, and crystals were obtained in 0.015 M CoCl2,0.085 M sodium acetate, pH 4.6, 0.85 M 1,6-hexanediol, 7% glyc-erol. Prior to freezing in liquid N2, crystals were soaked in res-ervoir solution supplemented with 15% glycerol.

Data Collection and Structure Determination—The x-raydiffraction data of native GtCPES and SeMet-GtCPES were col-lected at the Swiss Light Source (SLS) in Villigen, Switzerland,on beamline X10SA. All data were processed and scaled usingXDS and XSCALE (40). Phenix.autosol (41) was used to obtainphases, searching for four selenium positions up to a resolution of4.3 Å with phase extension to 1.95 Å using the native dataset. Phe-nix.autobuild calculated an initial model that was manuallyimproved using Coot (42). The structure was refined using phe-nix.refine (41) against experimental phases and the native dataset.Refinement included individual B-factors and hydrogens. Data,model, and refinement statistics are given in Table 2. Although thedata between 2.0 and 1.95 Å still improve model refinement, butfall below the classically used criteria for resolution limits, we use2.0 Å as the resolution of the structure throughout this work.

RESULTS

Phycobilin Biosynthesis in the Cryptophyte G. theta—Toobtain insights into phycobilin biosynthesis in the crypto-phyte G. theta, the potentially involved plastid encodedheme oxygenase GtHo,4 and the nucleus-encoded FDBRsGtPEBA and GtPEBB were heterologously produced inE. coli and subsequently examined with regard to their enzy-matic activity.

The plastid-encoded GtHo shares 51% identity with HO1from Synechocystis sp. PCC6803, but only 12% identity with

4 The nomenclature used is as follows: proteins encoded on prokaryotederived genomes (plastid, mitochondrion), 1st letter is capitalized and thefollowing letters are in lowercase; proteins encoded on eukaryoticgenomes (nucleomorph, nucleus): all capitals.

TABLE 2X-ray data quality and structure refinement statistics

Native data set(Lys-22)

Anomalous data set(SeMet; Lys-15)

Beamline SLS X10SA SLS X10SASpace group C 2 2 21 C 2 2 21Cell dimensions a, b, c (Å) 80.83, 116.58, 58.75 80.75, 117.13, 58.69Wavelength (Å) 0.97794 0.97856Resolution (Å) 1.95 (2.00–1.95) 2.5 (2.56–2.5)Rmeas (%) 5.2 (217.6) 14.2 (168.6)I/�(I) 24.26 (1.42) 10.68 (1.3)Correlation coefficient 100.0 (59.3) 99.7 (46)No. of reflections, observed 266,849 (20319) 129,810 (9941)No. of reflections, unique 20,588 (1496) 18,581 (1402)Phasing

Selenium sites 4Figure of merit 0.303

RefinementPDB code 4TQ2Rwork/Rfree 20.1 / 22.9Root mean square deviation bond length (Å) 0.015Root mean square deviation angles (°) 1.544Ramachandran favored (outliers) 96.49 (0)isotropic B-factor (range) 66.43 (32.81–211.18)

No. of atoms in model (without riding hydrogens)Protein 1467Water 281,6-Hexanediol 8



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

HY1 and HO3 from Arabidopsis thaliana. Heterologously pro-duced recombinant GtHo was found to bind heme but wasinactive in in vitro HO assays (data not shown). Gel permeationexperiments indicated that inactivity of GtHo was likely due toaggregation of the protein, which was presumably caused byincorrect protein folding. Based on these results, intensiveefforts to optimize the production of recombinant GtHOwere made. Expression of StrepII-tagged GtHo in E. coli inLB medium supplemented with the osmolytes betaine andsorbitol led to green-colored cells, indicating that StrepII-GtHo was able to convert heme produced by E. coli yieldingthe green-colored open-chain tetrapyrrole BV IX� in vivo.To confirm the identity of BV IX�, the cells were disrupted,and open-chain tetrapyrroles were extracted and analyzedvia HPLC (Fig. 1). The extracted pigment eluted with a reten-tion time of 37.8 min, which resembles that of commerciallyavailable BV IX�. Therefore, GtHo is an �-meso carbon-specific HO.

The PBP PE545 uses DHBV associated with the �-subunitsand PEB attached to the �-subunits as light-harvesting chro-mophores. We therefore presumed the presence of at least onegene encoding an FDBR. In fact, two genes encoding putativeFDBRs were identified in the nuclear genome of the crypto-phyte G. theta. Because of their eukaryotic origin, syntheticgenes adapted to the codon usage of E. coli K12 (GENEius,MWG Eurofins Operon) were used for construction of expres-sion plasmids. The corresponding proteins were designatedGtPEBA and GtPEBB due to tBLASTn searches and sequenceidentities of 31.5% to PebA and 29% to PebB of Synechococcussp. WH8020, respectively. Both proteins were heterologouslyproduced in E. coli as GST fusion proteins. GST-GtPEBA wasfound to form inactive aggregates, and GST-GtPEBB was puri-fied to homogeneity after removal of the GST tag. To probetheir catalytic activities, these putative FDBRs were analyzedusing an anaerobic bilin reductase assay as described for otherFDBRs (36). GtPEBB did not bind or reduce BV IX�, and onlyunspecific degradation of the bilin was observed (Fig. 2A). Incontrast, GtPEBB was able to bind DHBV as indicated by a shift

of the absorption maxima of 335 and 561 nm of free DHBV to340 and 606 nm after a short incubation time (Fig. 2B, UV-Vis).Immediately after starting the reaction, an increase of absorb-ance at �670 nm was observed, which disappeared in thecourse of the reaction and is probably due to the formation ofthe substrate radical intermediate as shown for other FDBRenzymes (35, 36, 43). The absorbance of bound DHBVdecreases during the reaction concomitant with the formationof a product with an absorption maximum at 535 nm. In sub-sequent HPLC analysis, the reaction product was identified as amixture of 3(E)- and 3(Z)-PEB (Fig. 2B, HPLC), confirming theenzyme’s PEB:ferredoxin oxidoreductase activity.

PebA from cyanobacteria is thought to transfer the interme-diate DHBV to PebB without releasing it to the solvent via met-abolic channeling (21). As no active PebA-like enzyme from G.theta was available, PebA from Synechococcus sp. WH8020(SynPebA) was used to perform a coupled anaerobic bilinreductase assay employing GtPEBB (Fig. 2C). Addition of theNADPH-regenerating system to start the reaction resulted in adecrease of absorbance at �690 nm followed by an increase ofabsorbance at �590 nm due to conversion of BV IX� to DHBVby SynPebA. GtPEBB was added to the reaction mixture aftercomplete production of DHBV and the formation of a substrateradical intermediate, and subsequently, PEB was observed (Fig.2B). Hence, GtPEBB is able to functionally replace its cyanobac-terial counterpart and act together with SynPebA in PEBformation.

These results give first insights into phycobilin biosynthesisin cryptophyte algae. The plastid-encoded GtHO provides theopen-chain tetrapyrrole BV IX� as a substrate for furtherreduction steps by two FDBRs. Although an additional functionof GtPEBA cannot be ruled out, it is most likely that GtPEBAconverts BV to DHBV, the substrate of GtPEBB. GtPEBBreduces DHBV to PEB, the chromophore attached to the�-subunits of PE545.

PBP Lyase Homologs in G. theta—The covalent attachment ofphycobilin chromophores to apo-PBPs in cyanobacteria ismediated by PBP lyases. Although spontaneous binding of phy-cobilins to the apo-PBPs can be observed, the lyases ensure thecorrect binding of the chromophore with regard to the specificattachment site and stereospecificity (24, 44, 45). As of 2014,only one eukaryotic lyase has been studied in detail. The openreading frame orf222 of chromosome 1 of the nucleomorphgenome of G. theta was found to encode a T-type lyase(GtCPET), which is able to complement the function of itshomolog slr1649 from Synechocystis sp. PCC 6803 by attachingPCB to Cys-�155 of phycocyanin (46). Because G. theta doesnot use PCB in its PE545, the PBP lyase GtCPET seems to havea low substrate specificity. Expressed sequence tags (EST)encoding two additional putative PBP lyases were mentioned inthe literature as follows: a phycocyanin �:PCB-like lyase(GtCPCX: GenBankTM accession number CAH25359.1 andKJ676834) and a CpeZ-like lyase (GtCPEZ: GenBankTM acces-sion number CAJ73184.1 and KJ676835) (47, 48). GtCPCXshows low homology to any characterized lyase but possesses aHuntington, elongation factor (EF3), protein phosphatase 2A(HEAT)-repeat domain typical for E/F-type lyases and a pre-dicted Armadillo-type fold. The putative lyase GtCPEZ can be

FIGURE 1. Heme cleavage activity of GtHo in E. coli. HPLC elution profiles ofan open-chain tetrapyrrole isolated from E. coli BL21 (DE3)-pGtHo and BV IX�(Frontier Scientific) as a standard. HPLC analyses were performed using C18reverse-phase column Luna 5 � (Phenomenex). BV IX� was detected at 650nm with subsequent whole spectrum analysis of elution peaks. The insetshows a picture of E. coli cells expressing StrepII-GtHo in LB medium supple-mented with betaine and sorbitol.



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

classified into the CpeZ family, which also belongs to the E/F-type lyases (49). However, GtCPEZ shares only 18% identitywith the only characterized member of this family (50). Fur-thermore, GtCPEZ lacks the HEAT-repeat domain, but anArmadillo-type fold can also be predicted. In 2011, the nucleargenome data of G. theta were released by the Department ofEnergy Joint Genome Institute (31). tBLASTn searches con-firmed the localization of genes encoding GtCPCX andGtCPEZ in the nuclear genome. In addition, with GtCPES(GenBankTM accession numbers EKX47022.1 and KJ676836),we were able to identify a fourth putative PBP lyase, which wasassigned to the clade of S/U-type lyases.

Purification and Co-expression of Recombinant PBP Lyases ofG. theta—To investigate the attachment of light-harvestingchromophores to the PBPs of the cryptophyte alga G. theta,synthetic genes adapted to the codon usage of E. coli K12(GENEius, MWG Eurofins Operon) encoding the putativelyases were used to construct appropriate (co-)expression vec-tors. GtCPCX, GtCPEZ, and GtCPET fusion proteins werefound to be insoluble, but StrepII-GtCPES was purified almostto homogeneity (Fig. 3A). Moreover, the co-expression of His6-

tagged GtCPES with PEB biosynthesis enzymes in E. coliyielded intensely blue-colored cells, indicating the formation ofHis6-GtCPES:PEB. Indeed, a blue protein complex was purifiedby affinity chromatography. However, the elution fraction con-tained two proteins, namely His6-GtCPES (22.1 kDa) and co-purified His6-PebS, which could not be removed by size exclu-sion chromatography (28 kDa; PEB biosynthesis enzyme PebSfrom co-expression) (Fig. 3A). One may assume that the bluecolor of the protein fraction is due to binding of PEB to PebS,but the absorption spectrum of the blue fraction (Fig. 3B)shared no similarity with the spectrum of the PebS�PEB com-plex (51), but rather to the Prochlorococcus marinus MED4CpeS�PEB complex (52). The bilin was separated from GtCPESvia simple denaturing of the protein by dilution in 0.1% TFA,indicating a noncovalent binding of the bilin. HPLC analysis ofthe isolated bilins confirmed the bilin as PEB (Fig. 3C). Thisprovides an improved method for preparing large amountsof PEB isomers. Compared with the conventional PEB isola-tion after Glazer and Hixson (53) and Terry (37), co-expres-sion of GtCPES and PEB biosynthesis enzymes in E. coli andsubsequent preparation by denaturing the GtCPES�PEB

FIGURE 2. Recombinant GtPEBB is a catalytically active PEB:ferredoxin oxidoreductase. Anaerobic bilin reductase assays of GtPEBB with BV, DHBV, and incombination with SynPebA and BV IX� followed spectroscopically (A–C) and subsequent HPLC analysis of reaction products (D–F). Equimolar amounts of FDBRand bilin (10 �M) were incubated for 5 min, and the reaction was started by addition of an NADPH-regenerating system. The course of the reaction wasmonitored spectroscopically for 10 min every 30 s. In the case of combined assay with SynPebA, GtPEBB was added 3 min after addition of NADPH-regeneratingsystem. A, decrease of BV IX� absorption at 685 nm and lack of increasing absorption due to product formation indicate unspecific bilin degradation. B, DHBVreduction results in decrease of absorption at 580 and 606 nm results, and PEB absorption at 535 nm increases. C, BV IX� conversion results in decrease ofabsorption at 692 nm and increase of absorption at 589 nm indicates DHBV formation. After addition of GtPEBB, this absorption decreases due to conversionto PEB (538 nm). Asterisks indicate absorption of substrate radical intermediates. After the reaction was stopped, reaction products were analyzed via HPLCusing C18 reverse-phase column Luna 5 � (Phenomenex). Bilins were detected at 560 and 650 nm with subsequent whole spectrum analysis of elution peaks(D–F).



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

complex and PEB isomer separation via HPLC is muchfaster, easier, and cheaper. Moreover, this procedure over-comes the use of harmful substances like acetone, methanol,and mercury.

GtCPES Binds DHBV, 3(E)-PEB, and 3(Z)-PEB in Vitro—Because of the presence of hemO, PEBA, and PEBB genes, G.theta shows all prerequisites for direct synthesis of the phyco-bilins DHBV and PEB. GtCPES binds PEB co-produced inE. coli. S/U-type lyases are known to exhibit a low apoproteinand bilin specificity but a high specificity for attachment ofchromophores to positions homologous to Cys-84 (24, 45, 52,54 –56). GtCPES shares equal values of sequence identity tocharacterized PCB and PEB transferring S-type lyases (data notshown). Hence, we tested the bilin stereoselectivity with abroad range of bilins. Absorption spectra of free bilins werecompared with those after addition of equal amounts (10 �M) ofGtCPES. Bilins are found to reside in a cyclic, helical conforma-tion in solution resulting in characteristic absorption proper-ties. Upon binding to a protein, the conformation and therebythe absorption properties of the bilin change (57, 58). Forinstance, a shift to longer wavelength in combination with amore distinct absorption maximum indicates a more stretchedconformation of the bilin (59). Incubation of BV IX� and PCBwith GtCPES caused no change of the absorption properties ofthese bilins (data not shown). In contrast, addition of GtCPESto free DHBV (559 nm), 3(E)-PEB (538 nm), and 3(Z)-PEB (536nm) resulted in a higher and more distinct absorption maxi-mum at a longer wavelength as follows: GtCPES�DHBV 611 nm;GtCPES�3(E)-PEB 603 nm; and GtCPES�3(Z)-PEB, 600 nm (Fig.

3, D–F). The GtCPES�bilin complexes were nonfluorescent andno zinc-induced fluorescence was detectable suggesting a non-covalent binding of the bilin (data not shown). Comparison ofthe absorption maxima of the GtCPES�PEB complex after co-expression (Fig. 3B) is in agreement with those of the in vitroreconstituted GtCPES�3(Z)-PEB complex (Fig. 3F). This resultidentified 3(Z)-PEB as the bilin bound by GtCPES under nativeconditions, which is in agreement with findings for CpeS fromP. marinus MED4 (52).

Dimeric GtCPES Binds DHBV and PEB with Similar BindingKinetics and High Affinity—S-type lyases are found to functionas monomers, homodimers, or heterodimers (52, 55, 56, 60).Size exclusion chromatography of both apo-GtCPES andGtCPES�bilin complexes revealed comparable elution profileswith deducible relative molecular masses of about �42 kDa,and it coincides with the calculated molecular mass of GtCPEShomodimers (�43 kDa). Titration experiments of GtCPES withDHBV, 3(E)-PEB, and 3(Z)-PEB indicated that two bilin mole-cules were bound by dimeric GtCPES (data not shown). Bindingkinetics and thermodynamics of the rapid GtCPES�bilin com-plex formations were further investigated by stopped flow andITC experiments. A constant amount of bilin was mixed withstepwise increasing concentrations of GtCPES, and increase ofabsorption was monitored at 611 nm (DHBV) or 600 nm (PEBisomers). The observed rate constant kobs was obtained by fit-ting a single exponential function to the experimental data andplotted against the protein concentration (Fig. 4A). The associ-ation rate constant kon is represented by the slope of the linearregression. The results were averaged over two independent

FIGURE 3. Bilin binding to the PBP lyase GtCPES. A, SDS-PAGE analysis of purified StrepII-GtCPES (21.6 kDa) and His6-GtCPES�PEB complex (22.1 kDa) afterco-expression with PEB biosynthesis enzymes in E. coli. The asterisk indicates co-purified His6-PebS (28 kDa). B, absorption spectra of 3(Z)-PEB (solid line) andpurified His6-GtCPES�PEB (dashed line). The inset shows the blue-colored His6-GtCPES�PEB elution fraction after purification. C, HPLC analysis of PEB producedby co-expression of GtCPES and PEB biosynthesis enzymes in E. coli using C18 reverse-phase column Ultracarb 5 � ODS C18 (Phenomenex). Bilins weredetected at 560 nm with subsequent whole spectrum analysis of elution peaks. Absorption spectra of free DHBV (D), 3(E)-PEB (E), and 3(Z)-PEB (F) (solid lines)compared with absorption spectra after addition of equimolar amounts (10 �M) of StrepII-GtCPES (dashed lines).



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

experiments, and the standard errors were in a range of 5% forthe PEB isomers and 20% for DHBV. In case of the PEB isomers,similar kon values were observed (3(E)-PEB, 2.1 �M�1 s�1; 3(Z)-PEB, 2.6 �M�1 s�1; see Table 3), whereas association withDHBV (1.3 �M�1 s�1) was slightly slower. However, the asso-ciation rate constants were in a similar range, and the lower konvalue of DHBV can only be a vague indication for a faster bind-ing of PEB in vivo.

The thermodynamics of the GtCPES�bilin complex forma-tion was analyzed by ITC. Because of insufficient DHBVamounts, the binding affinity of GtCPES to DHBV could not bedetermined. ITC measurements were performed in duplicatewith 3(E)-PEB and once with 3(Z)-PEB. The averaged thermo-dynamic parameters are summarized in Table 3. A representa-tive ITC measurement with 3(E)-PEB is shown in Fig. 4B. TheKD values of GtCPES�3(E)-PEB (0.6 �M) and GtCPES�3(Z)-PEB(0.6 �M) complexes were nearly identical, indicating tight bind-ing of both isomers. These KD values are in line with findings forother PBP lyases (52, 61, 62). The stoichiometry value N (3(E)-PEB, 0.6) indicates binding of one molecule PEB per GtCPESmonomer.

GtCPES Crystal Structure—GtCPES is the first biochemicallycharacterized eukaryotic PBP lyase. To obtain insights into sub-strate binding and reaction mechanism of this S-type lyase with

high specificity toward DHBV and PEB, the x-ray crystal struc-ture was determined at 2.0 Å resolution. Data, model, andrefinement statistics are given in Table 2. The atomic structureof GtCPES displays a 10-stranded, antiparallel �-barrel with acentral internal cavity (Fig. 5A). The bottom of the �-barrel isclosed off by the N-terminal �-helix �1, whereupon helix �0 isformed by the N-terminal StrepII-tag. A third �-helix isinserted between strands �2 and �3 near the open side of the�-barrel. Strands �5 and �6 are relatively short. Because of flex-ibility of some loop regions, the GtCPES atomic structure lacksresidue Phe-25 and residues 104 –108. Generally, loop regions,particularly toward the opening of the �-barrel and around themissing amino acids, show considerably higher B-factors thanthe average B-value. GtCPES belongs to the structural family ofFABP within the superfamily of calycins (15, 63). Members ofthis widely distributed superfamily are known to bind small,hydrophobic molecules in the barrel interior (15, 64). Forinstance, they are involved in diverse transport and signal trans-duction processes and serve as a protein matrix for pheromonesor coloring substances (65, 66).

GtCPES was found to form homodimers in gel permeationexperiments as well as in the crystal (Fig. 5B). The crystal struc-ture revealed a disulfide bond between the Cys-149 residues oftwo GtCPES monomers. This cysteine residue intercepts

FIGURE 4. Kinetics and thermodynamics of GtCPES:bilin binding. A, stopped flow experiments were performed by mixing 2 �M bilin with increasingconcentrations of GtCPES. Increase in absorption at 611 nm (GtCPES�DHBV; triangles) and 600 nm (GtCPES�3(E)-PEB, filled circles; and GtCPES�3(Z)-PEB,circles) was exponentially fitted to obtain the observed rate constant (kobs). kobs was plotted against the GtCPES concentration. B, ITC of GtCPES�3(E)-PEBbinding. GtCPES (black squares) and buffer control (black squares) was titrated into a temperature-controlled sample cell containing 3(E)-PEB, andchange in heating power was detected (upper panel). The generated heat was obtained by integration and plotted against the GtCPES/3(E):PEB ratio incombination with the one-site fit isotherm. Values for stoichiometry (N), binding constant (Ka), enthalpy (�H0), and entropy change (�S0) were obtainedfrom this fit.



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

strand �9 by forming a �-bulge within the strand. To testwhether this disulfide bond is essential for dimer formation, gelpermeation experiments were repeated under reducing condi-tions and with a C149A protein variant. In both cases, theelution behavior was unchanged (data not shown), demonstrat-ing that the disulfide bond is not essential for dimerization.Furthermore, the C149A variant fully retained its phycobilin-binding ability (Table 4). Interface analysis using PDB ePISA(67) ranked the dimer contact around the disulfide bond firstwith an interaction area of 1077 Å2. Two additional interfacesobserved in the crystal between the openings of the funnels oftwo molecules (1012 Å2) and between �-helices �0 and �1 of

one and �2 of a second molecule (496 Å2) are classified with alower score. In addition, GtCPES superposes well with theother structurally known PBP lyase TeCpcS (PDB code 3BDR(68)) both on the monomer level (root mean square deviation of1.32 Å for 106 superposed C� atoms), but also on the level of theproposed biologically active dimers (root mean square devia-tion of 1.90 Å for 284 aligned C� atoms).

Based on the classification as a member of the FABP familyand the functional data available for TeCpcS, the actual bindingsite of PEB can be expected to lie within the funnel of GtCPES.The crystal structure showed additional density within thisregion, which was modeled as 1,6-hexanediol from the crystal-

TABLE 3Kinetic and thermodynamic parameters of GtCPES�bilin complex formationAssociation rate constant (kon) was obtained by stopped flow experiments and stoichiometry value (N), association constant (Ka), enthalpy (�H0), and entropy change (�S0)via ITC measurements. From those values, Kd � 1/Ka and koff � kon Kd were calculated. ITC results with 3(E)-PEB were averaged over two measurements; ITC with3(Z)-PEB was performed once due to insufficient amounts of bilin. ND means not determined.

Bilin kon Ka Kd koff �H0 �S0 N

�M�1 s�1 106 M�1 �M s�1 kcal mol�1 cal mol�1 K�1

DHBV 1.3 0.3 ND ND ND ND ND ND3(E)-PEB 2.1 0.1 1.7 0.9 0.6 0.3 1.5 �4.2 2 13.4 7.7 0.6 0.33(Z)-PEB 2.6 0.1 1.7 0.6 1.5 �3.2 17.5 1. 3

FIGURE 5. Crystal structure of the eukaryotic PBP lyase GtCPES (2.0 Å) from the cryptophyte G. theta and amino acid residues involved in PEB binding.A, single GtCPES molecule in the asymmetric unit of the crystal. �-Helices are colored cyan, �-strands green, and loop regions blue. Missing residues areindicated by a dotted line. B, homodimeric GtCPES covalently connected by a disulfide bond in the center of the largest predicted interaction site (1077 Å2). Thedimer is formed by two molecules related by a crystallographic symmetry operation. Sulfur atoms of Cys-149 are shown in yellow. The alternative conformationwith free –SH groups is likely due to x-ray damage. C, top view of GtCPES turned 90° compared with A with co-crystallized 1,6-hexanediol (HEZ) and potentialcoordinating amino acids. 1,6-Hexanediol (HEZ) is colored black, nitrogen atoms blue, and oxygen atoms red. D, detail of potential ligand-binding site. Glu-136and Arg-146 were experimentally shown to be involved in PEB binding but Cys-149 and Arg-148 are not.



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

lization buffer. Interestingly, 1,6-hexanediol is coordinated bythe side chains of amino acid residues Arg-146, Glu-136, andArg-148, which are highly conserved among S-type lyases (Fig.5, C and D). To verify their role in phycobilin binding, GtCPESvariants E136A, R146A, and R148A were generated and ana-lyzed. Indeed, absorption spectra of free DHBV, 3(E)-PEB, and3(Z)-PEB did not change significantly after incubation with theGtCPES variants E136A and R146A (Table 4), indicating a lossof binding capability of phycobilins in these two variants. Incontrast, variant R148A showed absorption shifts comparablewith those of wild type complexes.

DISCUSSION

PEB Biosynthesis in G. theta Adopted from Cyanobacteria—In addition to chlorophyll a and c2-containing antenna com-plexes, the cryptophyte G. theta uses the PBP PE545 for light-harvesting. The �-subunits of PE545 are associated with thechromophore DHBV, whereas the �-subunits carry three mol-ecules of PEB (14). In cyanobacteria, DHBV represents theintermediate of PEB biosynthesis, but it has not yet been iden-tified as a protein-bound chromophore. Although the crystalstructure and the identity of the bound chromophores of PE545have been known since 1999, phycobilin biosynthesis and theassembly of PBP in cryptophytes are poorly understood. Here,we provide the first insights into PEB biosynthesis in the cryp-tophyte G. theta. We identified an enzymatically active, plastid-encoded HO, specific for cleavage of the �-meso carbon bridgeof heme. GtHo provides the substrate BV IX�, which is furtherreduced to PEB by two nucleus-encoded FDBRs. The enzy-matic activity of the first FDBR, GtPEBA, could not be shownexperimentally, but the second FDBR, GtPEBB, was found toreduce DHBV to PEB exclusively. Like other FDBRs (35, 36),GtPEBB seems to act via a substrate radical mechanism. Fur-thermore, GtPEBB is able to bind and convert DHBV producedby SynPebA in vitro indicating the capability to perform meta-bolic channeling (21). Although another or an additional func-tion of GtPEBA cannot be ruled out, a DHBV:ferredoxin oxi-doreductase function for conversion of BV IX� to DHBV ismost likely, because DHBV is the sole substrate of GtPEBB, and

no genes encoding other FDBRs were found in the completelysequenced genome of G. theta. Taken together, even though thecryptophyte G. theta utilizes a modified PBP distinct from cya-nobacterial ancestors, it apparently has retained the PEB bio-synthesis machinery from cyanobacteria.

PE545 Assembly in G. theta—The attachment of phycobilinsto apo-PBPs is usually mediated by PBP lyases that in generalhave high attachment site specificity (24). Although cyanobac-terial PBP lyases have been investigated for some time, those ofcryptophytes are largely unexplored.

Overall, the PBP PE545 of G. theta has to be assembled withfour bilin chromophores, each of which is covalently linked toone or two specific cysteine residues (Fig. 6). Although the�-subunit harbors three PEB molecules at position Cys-�50/61,Cys-�82, and Cys-�158, the �-subunit carries only one chro-mophore (DHBV) at position Cys-�19. Prior to this study, theonly identified PBP lyase of G. theta is encoded by orf222 on thenucleomorph genome and is the T-type lyase GtCPET (46).This lyase has a low substrate specificity and is involved in theattachment of PEB to position Cys-�158 (46). GtCPES investi-gated in this study is likely involved in the chromophorylationof Cys-�82. Unfortunately, due to insoluble recombinant apo-GtCPEB protein, we were unable to show this transfer directly(data not shown).

Thus far, the lyase(s) involved in the attachment of thedoubly linked PEB molecule at position Cys-�50/61 is thusfar unknown. The likely candidate would be GtCPCX and/orGtCPEZ. Furthermore, one of these lyases (or even both)might be involved in the chromophorylation of the �-subunitGtCPEA. Alternatively, this attachment could be autocatalytic(Fig. 6).

Eukaryotic PBP Lyase GtCPES—With GtCPES, we identifiedthe first cryptophycean S/U-type lyase and provided not onlybiochemical but also structural insights into the function of thiseukaryotic PBP lyase. Cyanobacterial S/U-type lyases occur inmonomeric, homo-, or heterodimeric forms and show highpositional specificity for ligation of phycobilins to homologs ofthe residue Cys-84 (50, 52, 55, 56, 60). At the same time, theirapoprotein specificity is low, because they mediate the chro-mophore transfer to this position of PBP �- or �-subunits, withthe exception of �-phycocyanin, which requires CpcEF lyases.Substrate specificity for different phycobilins varies amongS/U-type lyases (50, 52, 55, 56, 60). For instance, the CpcS lyasefrom T. elongatus (TeCpcS) binds PCB and PEB as well as P�B(68), whereas PmCpeS from P. marinus is specific for binding ofDHBV and PEB (52).

GtCPES was found to be homodimeric and to exclusivelybind DHBV, 3(E)-, and 3(Z)-PEB. Neither BV IX� nor PCB wasbound by GtCPES. The KD values (0.6 �M) for the complexformation with both PEB isomers were similar and suggest atight binding of the substrate, which is in line with findings forother PBP lyases (23, 45, 52, 54, 62). Based on our results, acovalent binding of the phycobilins by GtCPES comparablewith TeCpcS (68) is unlikely. The slightly lower association rateconstants for the formation of the GtCPES�DHBV complexcompared with those of the GtCPES�3(E)-/3(Z)-PEB complexformation indicate PEB and the co-expression experiments inparticular 3(Z)-PEB as the naturally bound substrates of

TABLE 4Absorption maxima of phycobilin before and after incubation withdifferent GtCPES variants

Absorption maximaPhycobilin

binding

nmDHBV 335 558

GtCPES 338 566 611 YesGtCPES-C149A 341 565 611 YesGtCPES-E136A 340 565 NoGtCPES-R146A 337 563 NoGtCPES-R148A 341 566 612 Yes

3(E)-PEB 319 538GtCPES 334 558 603 YesGtCPES-C149A 333 558 602 YesGtCPES-E136A 320 541 NoGtCPES-R146A 319 536 NoGtCPES-R148A 329 558 605 Yes

3(Z)-PEB 316 536GtCPES 330 554 600 YesGtCPES-C149A 328 553 598 YesGtCPES-E136A 317 540 NoGtCPES-R146A 316 538 NoGtCPES-R148A 325 554 600 Yes



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

GtCPES. In E. coli, only PEB is bound by GtCPES, and theabsorption properties of the GtCPES�PEB complex are similarto the in vitro reconstituted GtCPES�3(Z)-PEB complex. Thiscorrelates with the observation that PmCpeS can transfer both3(E)- and 3(Z)-PEB to the apoprotein CpeB, but only the attach-ment of 3(Z)-PEB results in stereochemically correct reconsti-tuted PEB�Cys-�84-PE (52). Notably, FDBRs are known to pro-duce predominantly the 3(Z)-phycobilin isomers in vivo (35).Therefore, it is likely that in G. theta, GtPEBB provides the3(Z)-PEB isomer for attachment to the CpeB apoprotein byGtCPES and other lyases as well.

GtCPES Exhibits a Lipocalin-like Fold—The x-ray structureof the S-type lyase GtCPES from the cryptophyte G. theta con-sists of a 10-stranded antiparallel �-sheet displaying a modifiedlipocalin fold. Based on this structure, GtCPES is assigned to bea member of the FABP family within the structural superfamilyof calycins. Calycins generally bind small hydrophobic mole-cules and carry out diverse functions (15, 64). For instance, theyact as transport molecules or play a role in olfaction or color-ation of insects by binding and enhancing features of appropri-ate ligands (69, 70). One example is the bilin-binding protein ofthe butterfly Pieris brassicae that binds biliverdin IX� leading to

FIGURE 6. Proposed PE545 assembly in G. theta. 1, transcription of the nucleus encoded genes GtPEBA, GtPEBB, GtCPEAs, GtCPCX, GtCPEZ, and GtCPESand co-translational transport of unfolded proteins into the endoplasmic reticulum (ER) via a size exclusion chromatography translocon. 2, transportinto the periplastidial space is presumably carried out using an ERAD-like system. 3, transcription of the nucleomorph-encoded GtCPET and transportof all unfolded proteins into the plastid stroma via an unknown transporter in the outer plastidial membrane (OPM) and a TIC-translocon in the innerplastidial membrane (IPM). 4, location of chromophore biosynthesis and PBP assembly. 5, GtHo and GtCpeB are plastid-encoded and translated by 70 Sribosomes. 6, translocation of the assembled PE545 into the thylakoid lumen via a twin arginine translocase (TAT) and the RR-signal peptide of theGtCPEA� subunit. Abbreviations used are as follows: rER, rough endoplasmic reticulum; SEC, Sec-translocon; PPM, periplastidial membrane; ERAD,endoplasmic reticulum-associated degradation system; OPM, outer plastidial membrane; IPM, inner plastidial membrane; TIC, translocator of the innermembrane of chloroplasts; TAT, twin arginine transporter; RR, twin arginine transporter-translocation signal; TM, thylakoid membrane; 80S, eukaryotic80 S-ribosome; 70S, prokaryotic 70 S ribosome.



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

the blue color of the insect (66). Additionally, there are threemore bilin-binding members of the calycin superfamily, whosecrystal structures were recently published. UnaG originatesfrom the Japanese eel Anguilla japonica, and its green fluores-cence is based on a bound bilirubin molecule (71). Further-more, the structure of the PBP lyase TeCpcS was determinedwithin the National Institutes of Health Protein Structure Ini-tiative in 2007 and published by Kronfel et al. (68). TeCpcS is ahomodimeric universal PBP lyase capable of binding a widerange of phycobilins like PCB, PEB, and P�B, transferring themto residue Cys-84 of diverse � and � apo-PBPs (68). Utilizingthe similarity to UnaG, which has been crystallized with boundbilirubin, a docking model for an extended PCB molecule inTeCpcS was described, which buries the bilin’s D-ring in thebarrel and exposes the A-ring on the barrel mouth. GtCPESshows 36% sequence identity with TeCpcS (Fig. 7A) and sharesa similar overall structure (Fig. 8A). Furthermore, an identicalhomodimerization was observed for both lyases, but in the caseof GtCPES, this interaction is not only formed by a large hydro-phobic interaction site but is also strengthened by a disulfidebond. The third solved crystal structure is that of the PCB-specific PBP lyase CpcT from the cyanobacterium Nostoc sp.PCC7120 (72). Thus far, this is the first crystal structure of aPBP lyase with a bound chromophore. The overall structure ofCpcT is similar to that of CPES and is also retained upon chro-mophore binding. However, arginine residues located at theopening of the binding pocket undergo major rearrangementswhen PCB is bound. The crystal structure furthermore revealedthat PCB adopts a ZZZsss geometry in an M-helical conformation(72). Our spectroscopic data on the CPES�PEB complex would,however, rather suggest a more extended chromophore confor-mation. We therefore will have to await the crystal structure of theCPES�PEB complex to get an insight into PEB binding of CPES.

Glu-136 and Arg-146 of GtCPES Are Involved in BilinBinding—To get a glimpse of the location of the PEB-bindingsite in the barrel interior, we exchanged conserved residuesclose to the bound artificial ligand 1,6-hexanediole. Bindingstudies with these GtCPES variants and different phycobilinsrevealed a participation of Glu-136 and Arg-146 in phycobilinbinding. The importance of Arg-146 or homologous amino acidresidues for phycobilin binding has previously been confirmedfor TeCpcS and NCpcS-III (where N is Nostoc) (23, 68). Inter-estingly, the TeCpcS-R151G variant still bound enough PCB toconfer transfer to the apoprotein CpcB in E. coli (68). For Glu-136, the carboxylic function might be involved in positioning ofthe substrate by interaction with the tetrapyrrole nitrogens, asfound for bilin-binding in FDBRs (51, 73, 74).

In the case of NCpcS-III, several other residues have beenshown to be involved in PBP lyase activity (23). Two conservedtryptophan residues are noteworthy. Replacement of the con-served Trp-69 (homolog to GtCPES Trp-69, see Fig. 7) by amethionine residue resulted not only in a reduced bindingcapacity of NCpcS-III but also in a stereochemically incorrectattachment of PCB to the apoprotein CpcB (23). As Trp-69 isfacing the ligand binding pocket, this suggests a participation inPEB binding by forming �-� interactions with ring B or C of thetetrapyrrole. Presumably, the �-� stacking may be responsiblefor the stabilization of the ligand conformation and therefore

the position of ring A, resulting in a stereochemically correctattachment to the apoprotein. NCpcS-III Trp-75 (homologousto GtCPES Trp-75) has been found to be only indirectlyinvolved in activity (23). Although it is disordered in theTeCpcS structure, in our GtCPES structure Trp-75 is placed atthe upper side of the GtCPES barrel, pointing toward the barrelcenter (Fig. 7B). Here, it might play a role during interactionwith PE545 and could provide a kind of greasy slide for transferof the substrate during the reaction.

Previous studies focused on PBP lyases like TeCpcS andNCpcS-III, which bind and transfer a broad range of phycobi-lins (PCB, PEB, and P�B) (23, 68). In contrast, GtCPES is onlycapable of binding phycobilins with a reduced C15�C16 dou-ble bond (DHBV and PEB). The resulting single bond betweenC15 and C16 allows rotation of the D-ring and therefore a bet-ter adaptation to a tight binding pocket. In contrast, ring D ofPCB is restrained to the tetrapyrrole plane by the C15�C16double bond. When comparing the two barrel pockets ofGtCPES and TeCpcS, two main differences are striking (Fig. 8).The general barrel diameter at the mouth is much narrowerfor GtCPES (21.3 Å versus 26.1 Å in diameter, Fig. 8B).Although the diameter at the bottom of the barrel is nearlyidentical on the basis of the main chain (Fig. 8B), the bulkierhydrophobic side chains of residues Phe-123, Leu-89, Ile-65,and Met-67 of GtCPES lead to a restriction at the proposedposition of the D-ring in the region of the critical residues Glu-136 and Arg-146 (Fig. 8C). The equivalent amino acid residuesof TeCpcS (Leu-128, Pro-92, Ala-69, and Val-71) have substan-tially smaller side chains (Fig. 8D). These data would supportthe requirement of a flexible D-ring of the tetrapyrrole for effi-cient binding to the smaller binding pocket. In contrast, themore open binding pocket of TeCpcS would support the bind-ing of a wider range of bilins. Manual docking of PEB into theGtCPES structure with energy minimization was unsuccessful,because residues Arg-148 and Met-67, for instance, restrictaccess to residue Arg-146, whose importance for PEB bindingwas demonstrated experimentally. Therefore, an induced fit ofGtCPES upon ligand binding is likely.

GtCPES Structure Provides Requirements for Bilin Transfer toCys-�82—The bathochromic shift of the absorption spectrumand the formation of a more distinct absorption peak uponbinding of PEB to GtCPES suggest a more or less stretchedconformation (57, 58) of the bound phycobilin in accordancewith a binding mode similar to the model of PCB in TeCpcS.Phycobilins are usually linked to the apoprotein via a thioetherbond between the ethylidene group of ring A of the phycobilinand a conserved cysteine residue of the apoprotein (24). There-fore, it is likely that ring A of PEB is exposed at the upper side ofthe ligand-binding site of GtCPES. The surface electrostatics ofGtCPES and the �-subunit of PE545 from Rhodomonas sp.CS24 (which shares 94% sequence identity with the respectiveG. theta homolog) (14) suggested a potential docking site forthe upper side of the GtCPES molecule to an area aroundCys-82 of the PE545 �-subunit (Fig. 9). Indeed, a docking modelconsistent with this proposal was ranked first by theGRAMM-X Protein-Protein Docking Web Server (75). Hence,the area around PE545-Cys-�82, particularly made up by posi-tively charged and neutral amino acids (Fig. 9C), is likely to bind



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

the negatively charged part of the upper site of GtCPES (Fig.8D). In contrast, all conserved cysteine residues of the �-sub-unit are especially surrounded by negatively charged and neu-tral amino acids, and thus they would not provide an ideal bind-ing surface for the negatively charged patches of GtCPES. Thisis indicative of a strong selection of Cys-82 by the S-type lyaseGtCPES. However, we expect a considerable structural change in

PE545, as Cys-82 is not directly accessible and needs to be exposedto the attachment of the chromophore by GtCPES. In the case ofcyanobacterial PBP chromophorylation and assembly, it is postu-lated that the PBP subunits are folded prior to chromophorylationand subsequent assembly of the PBP oligomers (76). Therefore, itis likely that the tertiary structure of the PBP subunit is importantfor recognition by and docking of PBP lyases.

FIGURE 7. Proposed amino acid residues involved in phycobilin binding and PBP lyase activity in different S-type lyases. A, sequence alignment ofdifferent S-type lyases. Gt, G. theta; Pm, P. marinus MED4; Fd, Fremyella diplosiphon; N, Nostoc sp. PCC7120; Te, T. elongatus (PDB code 3BDR). Identical residuesand those with 60% similarity are shown with colored background. Consensus: identical (*); conserved substitution (:); semi-conserved substitution (.). Residuesinvolved in phycobilin binding in GtCPES, black arrows; residues involved in phycobilin binding and PBP lyase activity in NCpcS-III (red arrows); and TeCpcS (grayarrows). Corresponding homolog residues in GtCPES are blue, NCpcS-III red, and TeCpcS gray. B, GtCPES structure with residues essential for phycobilin binding(black) and homologs (blue) to important residues in NCpcS-III (red) and TeCpcS (gray).



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

FIGURE 8. Overlay of known Calyx-shaped bilin-binding proteins. A, structural alignment of GtCPES in green, TeCpcS (3BDR) in blue, and UnaG (4I3B) inmagenta. Ligands are indicated. B, structural alignment of GtCPES and TeCpcS in top view. C, surface representation of GtCPES to show the central pocket (black)surrounded by hydrophobic residues. D, surface representation of TeCpcS (3BDR) exhibiting a less restricted ligand binding pocket.

FIGURE 9. Proposed protein-protein interaction model of GtCPES and PE545-CpeB. Protein-protein docking model of GtCPES and a single PE545 �-subunit(PDB code 1XG0) predicted with GRAMM-X Protein-Protein Docking Web Server version 1.2.0. The corresponding vacuum electrostatic surface models weregenerated with PyMOL. A, schematic illustration of interaction model. Dimeric GtCPES, green/cyan; PE545-CpeB, violet; conserved Cys-82 associated with asingle bonded PEB molecule, red circle; sulfur atom, yellow. B, electrostatic surface representation of interacting proteins. Negatively charged areas, red;positively charged areas, blue; neutral/hydrophobic areas, white. C, PE545-CpeB turned 90° counterclockwise; interaction site is facing toward the observer. D,GtCPES turned 90° clockwise; interaction site is facing toward the observer.



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Acknowledgments—Crystallographic experiments were performed onprotein crystallography beamlines at the Swiss Light Source (Villigen,Switzerland) and the European Synchrotron Radiation Facility(Grenoble, France). We acknowledge the help of local contacts and ofour colleagues from the Max Planck Institute of Molecular Physiologyduring data collection.

REFERENCES1. Gantt, E., Edwards, M. R., and Provasoli, L. (1971) Chloroplast structure of

the Cryptophyceae. Evidence for phycobiliproteins within intrathylakoi-dal spaces. J. Cell Biol. 48, 280 –290

2. Grossman, A. R., Schaefer, M. R., Chiang, G. G., and Collier, J. L. (1993)The phycobilisome, a light-harvesting complex responsive to environ-mental conditions. Microbiol. Rev. 57, 725–749

3. Tandeau de Marsac, N. (2003) Phycobiliproteins and phycobilisomes: theearly observations. Photosynth. Res. 76, 193–205

4. Samsonoff, W. A., and MacColl, R. (2001) Biliproteins and phycobilisomesfrom cyanobacteria and red algae at the extremes of habitat. Arch. Micro-biol. 176, 400 – 405

5. Glazer, A. N., and Wedemayer, G. J. (1995) Cryptomonad biliproteins–anevolutionary perspective. Photosynth. Res. 46, 93–105

6. Colyer, C. L., Kinkade, C. S., Viskari, P. J., and Landers, J. P. (2005) Analysisof cyanobacterial pigments and proteins by electrophoretic and chro-matographic methods. Anal. Bioanal. Chem. 382, 559 –569

7. Hess, W. R., Partensky, F., van der Staay, G. W., Garcia-Fernandez, J. M.,Börner, T., and Vaulot, D. (1996) Coexistence of phycoerythrin and achlorophyll a/b antenna in a marine prokaryote. Proc. Natl. Acad. Sci.U.S.A. 93, 11126 –11130

8. Sidler, W., and Bryant, D. (1994) in The Molecular Biology of Cyanobacte-ria, Advances in Photosynthesis (Bryant, D. A., ed) Vol. 1, pp. 139 –216,Kluwer Academic Publishers, Dordrecht, Netherlands

9. Hill, D. R., and Rowan, K. S. (1989) The biliproteins of the Cryptophyceae.Phycologia 28, 455– 463

10. Glazer, A. N. (1985) Light harvesting by phycobilisomes. Annu. Rev. Bio-phys. Biophys. Chem. 14, 47–77

11. MacColl, R., and Guard-Friar, D. (1987) Phycobiliproteins, CRC Press,Inc., Boca Raton, FL

12. Hoef-Emden, K. (2008) Molecular phylogeny of phycocyanin-containingcryptophytes: evolution of biliproteins and geographical distribution. J.Phycol. 44, 985–993

13. Doust, A. B., Marai, C. N., Harrop, S. J., Wilk, K. E., Curmi, P. M., andScholes, G. D. (2004) Developing a structure-function model for the cryp-tophyte phycoerythrin 545 using ultrahigh resolution crystallography andultrafast laser spectroscopy. J. Mol. Biol. 344, 135–153

14. Wilk, K. E., Harrop, S. J., Jankova, L., Edler, D., Keenan, G., Sharples, F.,Hiller, R. G., and Curmi, P. M. (1999) Evolution of a light-harvesting pro-tein by addition of new subunits and rearrangement of conserved ele-ments: crystal structure of a cryptophyte phycoerythrin at 1.63-A resolu-tion. Proc. Natl. Acad. Sci. U.S.A. 96, 8901– 8906

15. Overkamp, K. E., Frankenberg-Dinkel, N. (2014) in The Porphyrin Hand-book (Ferreira, G., Kadish, K. M., Smith, K. M., and Guilard, R., eds) pp.187–226, World Scientific Publishing Co., Singapore

16. Frankenberg, N., Mukougawa, K., Kohchi, T., and Lagarias, J. C. (2001)Functional genomic analysis of the HY2 family of ferredoxin-dependentbilin reductases from oxygenic photosynthetic organisms. Plant Cell 13,965–978

17. Frankenberg-Dinkel, N. (2004) Bacterial heme oxygenases. Antioxid. Re-dox Signal. 6, 825– 834

18. Wilks, A. (2002) Heme oxygenase: evolution, structure, and mechanism.Antioxid. Redox Signal. 4, 603– 614

19. Chen, Y. R., Su, Y. S., and Tu, S. L. (2012) Distinct phytochrome actions innonvascular plants revealed by targeted inactivation of phytobilin biosyn-thesis. Proc. Natl. Acad. Sci. U.S.A. 109, 8310 – 8315

20. Dammeyer, T., Bagby, S. C., Sullivan, M. B., Chisholm, S. W., and Fran-kenberg-Dinkel, N. (2008) Efficient phage-mediated pigment biosynthesisin oceanic cyanobacteria. Curr. Biol. 18, 442– 448

21. Dammeyer, T., and Frankenberg-Dinkel, N. (2006) Insights into phyco-erythrobilin biosynthesis point toward metabolic channeling. J. Biol.Chem. 281, 27081–27089

22. Böhm, S., Endres, S., Scheer, H., and Zhao, K.-H. (2007) Biliprotein chro-mophore attachment: chaperone-like function of the PecE subunit of�-phycoerythrocyanin lyase. J. Biol. Chem. 282, 25357–25366

23. Kupka, M., Zhang, J., Fu, W.-L., Tu, J.-M., Böhm, S., Su, P., Chen, Y., Zhou,M., Scheer, H., and Zhao, K.-H. (2009) Catalytic mechanism of S-typephycobiliprotein lyase chaperone-like action and functional amino acidresidues. J. Biol. Chem. 284, 36405–36414

24. Scheer, H., and Zhao, K. H. (2008) Biliprotein maturation: the chro-mophore attachment. Mol. Microbiol. 68, 263–276

25. Blot, N., Wu, X. J., Thomas, J. C., Zhang, J., Garczarek, L., Böhm, S., Tu,J. M., Zhou, M., Plöscher, M., Eichacker, L., Partensky, F., Scheer, H., andZhao, K. H. (2009) Phycourobilin in trichromatic phycocyanin from oce-anic cyanobacteria is formed post-translationally by a phycoerythrobilinlyase-isomerase. J. Biol. Chem. 284, 9290 –9298

26. Shukla, A., Biswas, A., Blot, N., Partensky, F., Karty, J. A., Hammad, L. A.,Garczarek, L., Gutu, A., Schluchter, W. M., and Kehoe, D. M. (2012) Phy-coerythrin-specific bilin lyase-isomerase controls blue-green chromaticacclimation in marine Synechococcus. Proc. Natl. Acad. Sci. U.S.A. 109,20136 –20141

27. Zhao, K. H., Deng, M. G., Zheng, M., Zhou, M., Parbel, A., Storf, M.,Meyer, M., Strohmann, B., and Scheer, H. (2000) Novel activity of aphycobiliprotein lyase: both the attachment of phycocyanobilin andthe isomerization to phycoviolobilin are catalyzed by the proteins PecEand PecF encoded by the phycoerythrocyanin operon. FEBS Lett. 469,9 –13

28. Bhattacharya, D., Yoon, H. S., and Hackett, J. D. (2004) Photosyntheticeukaryotes unite: endosymbiosis connects the dots. BioEssays 26,50 – 60

29. Stoebe, B., and Maier, U.-G. (2002) One, two, three: nature’s tool box forbuilding plastids. Protoplasma 219, 123–130

30. Douglas, S., Zauner, S., Fraunholz, M., Beaton, M., Penny, S., Deng,L.-T., Wu, X., Reith, M., Cavalier-Smith, T., and Maier, U.-G. (2001)The highly reduced genome of an enslaved algal nucleus. Nature 410,1091–1096

31. Curtis, B. A., Tanifuji, G., Burki, F., Gruber, A., Irimia, M., Maruyama, S.,Arias, M. C., Ball, S. G., Gile, G. H., Hirakawa, Y., Hopkins, J. F., Kuo, A.,Rensing, S. A., Schmutz, J., Symeonidi, A., Elias, M., Eveleigh, R. J., Her-man, E. K., Klute, M. J., Nakayama, T., Oborník, M., Reyes-Prieto, A.,Armbrust, E. V., Aves, S. J., Beiko, R. G., Coutinho, P., Dacks, J. B., Durn-ford, D. G., Fast, N. M., Green, B. R., Grisdale, C. J., Hempel, F., Henrissat,B., Höppner, M. P., Ishida, K., Kim, E., Koreny, L., Kroth, P. G., Liu, Y.,Malik, S. B., Maier, U. G., McRose, D., Mock, T., Neilson, J. A., Onodera,N. T., Poole, A. M., Pritham, E. J., Richards, T. A., Rocap, G., Roy, S. W.,Sarai, C., Schaack, S., Shirato, S., Slamovits, C. H., Spencer, D. F., Suzuki, S.,Worden, A. Z., Zauner, S., Barry, K., Bell, C., Bharti, A. K., Crow, J. A.,Grimwood, J., Kramer, R., Lindquist, E., Lucas, S., Salamov, A., McFadden,G. I., Lane, C. E., Keeling, P. J., Gray, M. W., Grigoriev, I. V., and Archibald,J. M. (2012) Algal genomes reveal evolutionary mosaicism and the fate ofnucleomorphs. Nature 492, 59 – 65

32. Gould, S. B., Fan, E., Hempel, F., Maier, U. G., and Klösgen, R. B. (2007)Translocation of a phycoerythrin � subunit across five biological mem-branes. J. Biol. Chem. 282, 30295–30302

33. Gill, S. C., and von Hippel, P. H. (1989) Calculation of protein extinc-tion coefficients from amino acid sequence data. Anal. Biochem. 182,319 –326

34. Van Duyne, G. D., Standaert, R. F., Karplus, P. A., Schreiber, S. L., andClardy, J. (1993) Atomic structures of the human immunophilin FKBP-12complexes with FK506 and rapamycin. J. Mol. Biol. 229, 105–124

35. Busch, A. W., Reijerse, E. J., Lubitz, W., Hofmann, E., and Frankenberg-Dinkel, N. (2011) Radical mechanism of cyanophage phycoerythrobilinsynthase (PebS). Biochem. J. 433, 469 – 476

36. Tu, S. L., Gunn, A., Toney, M. D., Britt, R. D., and Lagarias, J. C. (2004)



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

Biliverdin reduction by cyanobacterial phycocyanobilin:ferredoxin oxi-doreductase (PcyA) proceeds via linear tetrapyrrole radical intermediates.J. Am. Chem. Soc. 126, 8682– 8693

37. Terry, M. (2002) in Heme, Chlorophyll, and Bilins (Smith, A., and Witty,M., eds) pp. 273–291, Humana Press Inc., Totowa, NJ

38. Gossauer, A., and Klahr, E. (1979) Synthesen von Gallenfarbstoffen, VIII.Total synthese des racem. Phycoerythrobilin-dimethylesters. ChemischeBerichte 112, 2243–2255

39. Weller, J. P., and Gossauer, A. (1980) Synthesen von Gallenfarbstoffen, X.Synthese und Photoisomerisierung des racem. Phytochromobilin-dimethyl-esters. Chemische Berichte 113, 1603–1611

40. Kabsch, W. (2010) XDS. Acta Crystallogr. D Biol. Crystallogr. 66, 125–13241. Adams, P. D., Afonine, P. V., Bunkóczi, G., Chen, V. B., Davis, I. W., Echols,

N., Headd, J. J., Hung, L.-W., Kapral, G. J., Grosse-Kunstleve, R. W., Mc-Coy, A. J., Moriarty, N. W., Oeffner, R., Read, R. J., Richardson, D. C.,Richardson, J. S., Terwilliger, T. C., and Zwart, P. H. (2010) PHENIX: acomprehensive Python-based system for macromolecular structure solu-tion. Acta Crystallogr. D Biol. Crystallogr. 66, 213–221

42. Emsley, P., Lohkamp, B., Scott, W. G., and Cowtan, K. (2010) Features anddevelopment of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486 –501

43. Tu, S. L., Rockwell, N. C., Lagarias, J. C., and Fisher, A. J. (2007) Insight intothe radical mechanism of phycocyanobilin-ferredoxin oxidoreductase(PcyA) revealed by x-ray crystallography and biochemical measurements.Biochemistry 46, 1484 –1494

44. Biswas, A., Vasquez, Y. M., Dragomani, T. M., Kronfel, M. L., Williams,S. R., Alvey, R. M., Bryant, D. A., and Schluchter, W. M. (2010) Biosynthe-sis of cyanobacterial phycobiliproteins in Escherichia coli: chromophory-lation efficiency and specificity of all bilin lyases from Synechococcus sp.strain PCC 7002. Appl. Environ. Microbiol. 76, 2729 –2739

45. Zhao, K. H., Su, P., Böhm, S., Song, B., Zhou, M., Bubenzer, C., and Scheer,H. (2005) Reconstitution of phycobilisome core-membrane linker, LCM,by autocatalytic chromophore binding to ApcE. Biochim. Biophys. Acta1706, 81– 87

46. Bolte, K., Kawach, O., Prechtl, J., Gruenheit, N., Nyalwidhe, J., and Maier,U. G. (2008) Complementation of a phycocyanin-bilin lyase from Syn-echocystis sp. PCC 6803 with a nucleomorph-encoded open reading framefrom the cryptophyte Guillardia theta. BMC Plant Biol. 8, 56

47. Gould, S. B., Sommer, M. S., Hadfi, K., Zauner, S., Kroth, P. G., and Maier,U. G. (2006) Protein targeting into the complex plastid of cryptophytes. J.Mol. Evol. 62, 674 – 681

48. Gould, S. B., Sommer, M. S., Kroth, P. G., Gile, G. H., Keeling, P. J., andMaier, U. G. (2006) Nucleus-to-nucleus gene transfer and protein retar-geting into a remnant cytoplasm of cryptophytes and diatoms. Mol. Biol.Evol. 23, 2413–2422

49. Bretaudeau, A., Coste, F., Humily, F., Garczarek, L., Le Corguillé, G., Six,C., Ratin, M., Collin, O., Schluchter, W. M., and Partensky, F. (2013) Cya-noLyase: a database of phycobilin lyase sequences, motifs and functions.Nucleic Acids Res. 41, D396 –D401

50. Biswas, A., Boutaghou, M. N., Alvey, R. M., Kronfel, C. M., Cole, R. B.,Bryant, D. A., and Schluchter, W. M. (2011) Characterization of the activ-ities of the CpeY, CpeZ, and CpeS bilin lyases in phycoerythrin biosynthe-sis in Fremyella diplosiphon strain UTEX 481. J. Biol. Chem. 286,35509 –35521

51. Dammeyer, T., Hofmann, E., and Frankenberg-Dinkel, N. (2008) Phyco-erythrobilin synthase (PebS) of a marine virus. Crystal structures of thebiliverdin complex and the substrate-free form. J. Biol. Chem. 283,27547–27554

52. Wiethaus, J., Busch, A. W., Kock, K., Leichert, L. I., Herrmann, C., andFrankenberg-Dinkel, N. (2010) CpeS is a lyase specific for attachment of3Z-PEB to Cys82 of b-phycoerythrin from Prochlorococcus marinusMED4. J. Biol. Chem. 285, 37561–37569

53. Glazer, A. N., and Hixson, C. S. (1977) Subunit structure and chro-mophore composition of rhodophytan phycoerythrins. Porphyridiumcruentum B-phycoerythrin and b-phycoerythrin. J. Biol. Chem. 252,32– 42

54. Fairchild, C. D., Zhao, J., Zhou, J., Colson, S. E., Bryant, D. A., and Glazer,A. N. (1992) Phycocyanin �subunit phycocyanobilin lyase. Proc. Natl.Acad. Sci. U.S.A. 89, 7017–7021

55. Saunée, N. A., Williams, S. R., Bryant, D. A., and Schluchter, W. M. (2008)Biogenesis of phycobiliproteins: II. CpcS-I and CpcU comprise the het-erodimeric bilin lyase that attaches phycocyanobilin to CYS-82 of �-phy-cocyanin and CYS-81 of allophycocyanin subunits in Synechococcus sp.PCC 7002. J. Biol. Chem. 283, 7513–7522

56. Zhao, K.-H., Su, P., Tu, J.-M., Wang, X., Liu, H., Plöscher, M.,Eichacker, L., Yang, B., Zhou, M., and Scheer, H. (2007) Phycobilin:cystein-84 biliprotein lyase, a near-universal lyase for cysteine-84-binding sites in cyanobacterial phycobiliproteins. Proc. Natl. Acad. Sci.U.S.A. 104, 14300 –14305

57. Wagnière, G., and Blauer, G. (1976) Calculations of optical properties ofbiliverdin in various conformations. J. Am. Chem. Soc. 98, 7806 –7810

58. Krois, D., and Lehner, H. (1993) Helically fixed chiral bilirubins and biliv-erdins: a new insight into the conformational, associative and dynamicfeatures of linear tetrapyrrols. J. Chem. Soc. 1351–1360

59. Falk, H. (1989) The Chemistry of Linear Oligopyrroles and Bile Pigments,pp. 401– 423, Springer, Wien, New York

60. Shen, G., Schluchter, W. M., and Bryant, D. A. (2008) Biogenesis of phy-cobiliproteins: I. cpcS-I and cpcU mutants of the cyanobacterium Syn-echococcus sp. PCC 7002 define a heterodimeric phyococyanobilin lyasespecific for �-phycocyanin and allophycocyanin subunits. J. Biol. Chem.283, 7503–7512

61. Fairchild, C. D., and Glazer, A. N. (1994) Oligomeric structure, enzymekinetics, and substrate specificity of the phycocyanin � subunit phycocya-nobilin lyase. J. Biol. Chem. 269, 8686 – 8694

62. Zhao, K.-H., Su, P., Li, J., Tu, J.-M., Zhou, M., Bubenzer, C., and Scheer, H.(2006) Chromophore attachment to phycobiliprotein �-subunits: Phyco-cyanobilin:cysteine-�84 phycobiliprotein lyase activity of CpeS-like pro-tein from Anabaena sp. PCC7120. J. Biol. Chem. 281, 8573– 8581

63. North, A. C. (1990) Structural homology in ligand-specific transport pro-teins. Biochem. Soc. Symp. 57, 35– 48

64. Cowan, S. W., Newcomer, M. E., and Jones, T. A. (1990) Crystallographicrefinement of human serum retinol binding protein at 2A resolution. Pro-teins 8, 44 – 61

65. Bianchet, M. A., Bains, G., Pelosi, P., Pevsner, J., Snyder, S. H., Monaco,H. L., and Amzel, L. M. (1996) The three-dimensional structure of bovineodorant binding protein and its mechanism of odor recognition. Nat.Struct. Mol. Biol. 3, 934 –939

66. Huber, R., Schneider, M., Mayr, I., Müller, R., Deutzmann, R., Suter, F.,Zuber, H., Falk, H., and Kayser, H. (1987) Molecular structure of the bilinbinding protein (BBP) from Pieris brassicae after refinement at 2.0 Å res-olution. J. Mol. Biol. 198, 499 –513

67. Velankar, S., Best, C., Beuth, B., Boutselakis, C. H., Cobley, N., Sousa DaSilva, A. W., Dimitropoulos, D., Golovin, A., Hirshberg, M., John, M.,Krissinel, E. B., Newman, R., Oldfield, T., Pajon, A., Penkett, C. J., Pineda-Castillo, J., Sahni, G., Sen, S., Slowley, R., Suarez-Uruena, A., Swamina-than, J., van Ginkel, G., Vranken, W. F., Henrick, K., and Kleywegt, G. J.(2010) PDBe: protein data bank in Europe. Nucleic Acids Res. 38,D308 –D317

68. Kronfel, C. M., Kuzin, A. P., Forouhar, F., Biswas, A., Su, M., Lew, S.,Seetharaman, J., Xiao, R., Everett, J. K., Ma, L. C., Acton, T. B., Montelione,G. T., Hunt, J. F., Paul, C. E., Dragomani, T. M., Boutaghou, M. N., Cole,R. B., Riml, C., Alvey, R. M., Bryant, D. A., and Schluchter, W. M. (2013)Structural and biochemical characterization of the bilin lyase CpcS fromThermosynechococcus elongatus. Biochemistry 52, 8663– 8676

69. Snyder, S. H, Sklar, P. B., and Pevsner, J. (1988) Molecular mechanisms ofolfaction. J. Biol. Chem. 263, 13971–13974

70. Suter, F., Kayser, H., and Zuber, H. (1988) The complete amino-acid se-quence of the bilin-binding protein from Pieris brassicae and its similarityto a family of serum transport proteins like the retinol-binding proteins.Biol. Chem. 369, 497–506

71. Kumagai, A., Ando, R., Miyatake, H., Greimel, P., Kobayashi, T., Hi-rabayashi, Y., Shimogori, T., and Miyawaki, A. (2013) A bilirubin-induci-ble fluorescent protein from eel muscle. Cell 153, 1602–1611

72. Zhou, W., Ding, W.-L., Zeng, X.-L., Dong, L.-L., Zhao, B., Zhou, M.,Scheer, H., Zhao, K.-H., and Yang, X. (2014) Structure andmechanism of the phycobiliprotein lyase CpcT. J. Biol. Chem. 289,26677–26689



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

73. Busch, A. W., Reijerse, E. J., Lubitz, W., Frankenberg-Dinkel, N., and Hof-mann, E. (2011) Structural and mechanistic insight into the ferredoxin-mediated two-electron reduction of bilins. Biochem. J. 439, 257–264

74. Hagiwara, Y., Sugishima, M., Takahashi, Y., and Fukuyama, K. (2006)Crystal structure of phycocyanobilin: ferredoxin oxidoreductase in com-plex with biliverdin IX�, a key enzyme in the biosynthesis of phycocyano-

bilin. Proc. Natl. Acad. Sci. U.S.A. 103, 27–3275. Tovchigrechko, A., and Vakser, I. A. (2006) GRAMM-X public web server

for protein-protein docking. Nucleic Acids Res. 34, W310 –W31476. Anderson, L. K., and Toole, C. M. (1998) A model for early events in the

assembly pathway of cyanobacterial phycobilisomes. Mol. Microbiol. 30,467– 474



at Colum



ww

.jbc.org/D

ownloaded from

http://www.jbc.org/

insights into the biosynthesis and assembly of cryptophycean phycobiliproteins

Documents