CelI Biology and Toxicology. 1996; 12: 69-78. © 1996 Kluwer Academic Publishers. Printedin the Netherlands

Inhibition of gap junctional intercellular communication in heptachlor- and heptachlor epoxide-treated normal human breast epithelial cells

K. Nomata, K.-S. Kang, T. Hayashi, D. Matesic, L. Lockwood, C.C. Chang and J.E. Trosko Department of Pediatrics~Human Development and Institute of Environmental Toxicology, Michigan State University, East Lansing, M148824, USA

Received 12 March 1995; accepted 6 January 1996

Keywords: gap junctional intercellular communication, heptachlor, heptachlor epoxide, human breast epithelial cells

Abstract

Based on the concern of organochlorides in the environment and in human tissue, this study was designed to determine whether various noncytotoxic levels of heptachlor and heptachlor epoxide could inhibit, reversibly, gap junctional intercellular communication in human breast epithelial cells (HBEC). Cytotoxicity and gap junctional intercellular communication (GJIC) were evaluated by lactate dehydrogenase assay and fluorescence redistribution after photobleaching analysis, respec- tively. Both heptachlor and heptachlor epoxide were noncytotoxic up to 10 gg/ml. At this concentration, heptachlor and heptachlor epoxide inhibited GJIC of normal human breast epithelial cells after 1 h treatment. Within a 24 h treatment with heptachlor and heptachlor epoxide at 10 #g/ml, recovery of GJIC had not returned. GJIC completely recovered after a 12 h treatment of 1 gg/ml heptachlor epoxide, but it did not recover after a 24 h treatment of 1 gg/ml heptachlor. RT-PCR and Western blots were analyzed to determine whether the heptachlor or heptachlor epoxide might have altered the steady-state levels of gap junction mRNA and/or connexin protein levels or phosphorylation state. No significant difference in the level of connexin 43 (Cx43) message between control and heptachlor-treated cells was observed. Western blot analyses showed hypo- phosphorylation patterns in cells treated with 10 gg/ml heptachlor and heptachlor epoxide for 1 h with no recovery within 24 h. Immunostaining of Cx43 protein in normal HBEC indicated that heptachlor and heptachlor epoxide caused a loss of Cx43 from the cell membranes at noncytotoxic dose levels. Taken together, these results suggest that heptachlor and heptachlor epoxide can alter GJIC at the post-translational level, and that, under the conditions of exceeding a threshold concentration in the breast tissue containing 'initiated' cells for a long time and not being counteracted by anti-tumor-promoting chemicals, they could act as breast tumor promoters.

Abbreviations: Cx43, connexin 43, FRAP, fluorescence recovery after photobleaching; GJIC, gap junctional intercellular communications; HBEC, normal human breast epithelial cell; LDH, lactate dehydrogenase, RT-PCR, reverse transcription-polymerase chain reaction; SDS, sodium dodecyl sulfate

70

Introduction

Organochloride contaminants have been asso- ciated with an array of harmful effects on laboratory animals, such as endocrine disrup- tion, immunotoxicity, and carcinogenicity (Colburn et al., 1993). Heptachlor and hepta- chlor epoxide are two cyclodiene organochlor- ines which are recognized as environmentally persistent and among the more toxic pesticides (Melvin, 1987). These two pesticides have been found in elevated concentrations in breast milk in various countries, including Hawaii in the United States (Matuo et al., 1992; Baker et al., 1991).

Recently, studies from several laboratories have indicated that some organochlorines might increase the risk of breast cancer (Mussalo-Rauhamau et al., 1990; Soto et al., 1992; Falck et al., 1992; Davis et al., 1993; Hunter and Kelsey, 1993; Wolff et al., 1993), although some of these studies have been challenged (Acquavella et al., 1993; Krieger et al., 1994; MacMahon, 1994). One of the orga- nochlorines, DDE (1,1-dichloro-2,2-bis(p- chlorophenol)ethylene), has been associated with breast cancer (Wolff et al., 1993). How- ever, the potential of heptachlor and hepta- chlor epoxide to act as breast carcinogens (either as initiators or promoters) is still un- known.

In view of the observations that many non- genotoxic chemical carcinogens and tumor promoters are capable of inhibiting GJIC in vitro, the inhibition of GJIC by heptachlor and heptachlor epoxide may indicate potential tumor-promoting activity (Trosko and Chang, 1988; Yamasaki, 1986). Heptachlor and hepta- chlor epoxide have previously been shown to inhibit GJIC in both rat liver epithelial cells and mouse hepatocytes (Ruch et al., 1990; Matesic et al., 1994), and are nongenotoxic rodent liver carcinogens (Telang et al., 1982; Williams and Numoto, 1984; Moser and Smart, 1989).

We have recently developed a technique to culture two types of normal human breast epithelial cells. One of these two types of cells (type II) is efficient in GJIC and expresses connexin 26 (Cx26) and connexin 43 (Cx43) (Kao et al., 1995; Yang et al., 1993). These studies were designed to test whether hepta- chlor and heptachlor epoxide could specifically inhibit GJIC in normal human breast epithe- lial cells and to investigate various potential mechanisms by which these pesticides might inhibit GJIC.

Materials and methods

Cell culture and chemicals

The procedure for developing the normal human breast epithelial cell culture from re- duction mammoplasty has been described recently (Kao et al., 1995). The cells were plated into 35-mm or 60-mm plastic dishes in 1:1 (v/v) mixture of a modified MCDB 153 and a modified Eagle's minimal essential medium supplemented with recombinant human EGF (0.5 ng/ml), insulin (5 gg/ml), hydrocortisone (0.5 ng/ml), 1713-estradiol (10 nmol/L), and 0.4% bovine pituitary extracts. The cultures were incubated in a 5% CO2 gas incubator at 37°C. The exposure of cells to heptachlor and heptachlor epoxide was done in Petri dishes (Corning, NY, USA). Stock solutions of hepta- chlor, heptachlor epoxide, and TPA were pre- pared in 99.5% ethanol. Control cultures received 0.1% (v/v) 99.5% ethanol.

Cytotoxieity assay

Release of lactate dehydrogenase into the cul- ture medium was assessed as an indicator of cytotoxicity (Hasler et al., 1991). Separate groups of cells were exposed to the chemicals for 24 h at several concentrations of heptachlor and heptachlor epoxide (1-100 ~tg/ml). After

71

exposure, aliquots of the culture media were analyzed for lactate dehydrogenase activity. In addition, identically treated cultures were ex- posed briefly to a 20% Triton X-100 solution to solubilize cell contents. An aliquot of the cell solution was removed for measurement of total lactate dehydrogenase activity. Lactate de- hydrogenase activity was expressed as the amount released from treated cells as a percen- tage of total cellular lactate dehydrogenase.

Fluorescence recovery after photobleaching (FRAP) analysis

The cells grown in 35-mm plastic dishes were washed three times with phosphate-buffered saline (PBS) and loaded with 7 gg/ml 5,6- carboxyfluorescein diacetate in Ca2+/Mg 2÷- PBS for 15 min at 37°C. After extracellular dye was decanted the cells were reimmersed in 2 ml Ca2+/Mg2+-PBS. Dye transfer was mon- itored at room temperature using an ACAS 570 fluorescence spectrometer (Meridian Instruments). Individual cells were bleached with a 488 nm laser and recovery of fluores- cence intensity was monitored at 4-min inter- vals (Wade et al., 1986). Fluorescence intensity was corrected for fluorescence lost in un- bleached controls.

SDS-PAGE and Western blot analysis

Proteins were extracted from 95-100% conflu- ent normal HBEC by treatment with 20% SDS containing 2 mmol/L phenylmethylsulfonyl fluoride (PMSF), 10 mmol/L iodoacetamide, 1 gmol/L leupeptin, 1 gmol/L Antipain, 0.1 gmol/L aprotinin, 0.1 mmol/L sodium ortho- vanadate, 5 mmol/L sodium fluoride, and then sonicated for three 10-s pulses using a probe sonicator.

Protein content was determined with the DC protein assay (Bio-Rad Corp., Richmond, CA, USA), after dilution of samples 1:5 with H20. Proteins were separated on 12.5% SDS poly-

acrylamide gels and transferred to PDVF membranes at 20 V for 16 h. Cx43 was detected using anti-connexin 43-specific mono- clonal antibody (Zymed Inc., San Francisco, CA, USA), followed by incubation with horse- radish peroxidase (HRP)-conjugated second- ary antibody and detection with the ECL chemiluminescent detection reagent (Amer- sham Co., Arlington Heights, IL, USA).

Reverse transcription-polymerase chain reaction (RT-PCR)

RNA was extracted with TRI reagent (Mole- cular Research Center, Inc., Cincinnati, OH, USA) according to the manufacturer's proto- col. Reverse transcription and PCR were per- formed as described (Hayashi et al., 1996). Reverse transcription of 1 gg of total RNA was performed in a final volume of 20 ml for 1 h at 37°C, using 50 U of M-MLV reverse transcriptase (Strata Script RNase H reverse transcriptase, Stratagene, La Jolla, CA, USA) in 50 mmol/L Tris-HC1, pH 8.3, 75 mmol/L KC1, 10 mmol/L dithiothreitol, 3 mmol/L MgClz, 25 U of RNase inhibitor, 1 mmol/L each of dATP, dGTP, dCTP, and dTTP, and 2.5 mmol/L oligo(dT) (Pharmacia AB, Uppsa- la, Sweden). The samples were then heated to 95°C for 5 rain to terminate the reverse trans- cription reaction. The reverse-transcribed cDNA obtained from 0.1 gg of total RNA was added to a reaction mixture that contained a final concentration of 10 mmol/L Tris-HC1, pH 8.3, 50 mmol/L KC1, 1.5 mmol/L MgC12, 0.2 mmol/L each of dATP, dGTP, dCTP, and dTTP, 0.5 mmol/L of each primer (5'-primer: GCGTGAGGAAAGTACCAAAC; 3'-primer: GGGCAACCTTGAGTTCTTCC) and 2.5 U of Taq polymerase (Perkin Elmer-Cetus, Norwalk, CT, USA) in a final reaction volume of 50 ml. The mixture was heated at 95°C for 30 s in a Perkin Elmer DNA thermocycler (Perkin Elmer-Cetus). Amplification was per- formed in 32 sequential cycles at 95°C for 20 s,

72

58°C for 40 s and 72°C for 40 s, followed by incubation for 7 min at 72°C. The PCR pro- ducts were analyzed on a 1.8% agarose gel in 0.5 x Tris borate-EDTA buffer. Gels were stained with ethidium bromide and photo- graphed using Polaroid type 665 film.

Indirect immunofluorescent staining of gap junctions

Immunostaining of connexin 43- (Cx43)-con- taining gap junctions in normal HBEC was performed with a rabbit polyclonal antibody against Cx43 (Dupont et al., 1988). After treatment, the cells were fixed in 4% para- formaldehyde for 20 min; subsequently, non- specific sites were blocked with 10% normal goat serum in PBS with 0.05% Tween 20 for 1 h at room temperature (RT). The cells were incubated with anti-Cx43 polyclonal antibody diluted 1:100 in PBS for 2 h at RT, washed three or four times with PBS containing 1% BSA and 0.05% Tween 20, and then incubated with rhodamine-conjugated goat anti-rabbit IgG Fab2 fraction (Jackson Immuno Research Lab, Inc.) diluted 1:200 in the PBS with 1% BSA and 0.05% Tween 20 for 1 h at RT. The cells were washed extensively with PBS con- taining 1% BSA and 0.05% Tween 20, and coverslips were mounted in poly-aquamount (Polysciences, Inc., Warrington, PA, USA). The cells were viewed and photographed using an Ultima confocal microscope (Meridian Instrument Co., Okemos, MI, USA).

Results

Cytotoxicity of heptachlor and heptachlor epoxide

To determine the cytotoxicity of these chemi- cals, we examined the release of lactate dehy- drogenase into the culture medium. As shown in Figure 1, treatment with 10 gg/ml hepta-

,-, 100

'7~

-- 50 r~ ,d

Heptachlor

20 40 60 80 100

Concent ra t ion (~g/ml)

Figure I. Cytotoxicity in human breast epithelial cells as measured by the LDH assay. Effect of treatment with different concentrations of heptachlor ( 0 ) and beptachlor epoxide (11) was measured by the ratio between released LDH activity in medium and total LDH activity (%).

chlor or heptachlor epoxide caused little re- leased LDH activity. Concentrations above 10 ~tg/ml for heptachlor and heptachlor epoxide did induce significant release of LDH, signify- ing cytotoxicity.

Effect of heptachlor and heptachlor epoxide on GJIC

As shown in Figure 2, normal human mam- mary epithelial cells, which were prepared by our protocol, have functional gap junctional intercellular communication as measured by FRAP. Heptachlor and heptachlor epoxide inhibited GJIC in these normal breast epithe- lial cells in a time-dependent manner (Figure 3). Figure 3 shows that dye transfer was significantly inhibited following 1 h exposure to heptachlor (10 p.g/ml; p<0.01) and hepta- chlor epoxide (10 ~tg/ml; p<0.01). To deter- mine whether the inhibition was reversible, gap junctional intercellular communication was compared at 1, 12, and 24 h of exposure. After 24 h treatments, GJIC appeared to recover slightly in 10 ~tg/ml heptachlor- and 10 ~tg/ml heptachlor epoxide-treated cells.

73

Figure 2. Assay of gap junctional intercellular communication in untreated human breast epithelial cells by fluorescence recovery after photobleaching. Individual cells were bleached with a laser (0 min) and recovery of fluorescence was monitored at 12 min.

Effect of heptachlor on Cx43 messenger RNA levels using RT-PCR

To determine whether treatment with the hep- tachlor and heptachlor epoxide (1 gg/ml, 10 gg/ml) altered the steady-state levels of Cx43 gene transcripts, we analyzed the Cx43 mRNA by RT-PCR in cells treated for 1, 12, and 24 h. The data show no obvious differences between control and heptachlor-treated cells (Figure 4).

Effect of heptachlor on Cx43 protein levels and phosphorylation

We examined the changes in Cx43 protein levels, as well as the degree of phosphorylation following treatment of the cells with hepta- chlor and heptachlor epoxide by Western blot- ting. Two major bands (P0 and P1) and a weak band (P2) were detected in untreated breast epithelial cells (Figure 5). Treatment of breast epithelial cells with 10 gg/ml heptachlor and heptachlor epoxide for 1 h resulted in a reduc-

74

#

._c 6 0

. c

0

m

~so o O .

c E e~3C

2C

o ° 10

Heptachlor Heptachlorepoxide lug/ml lOug/ml lug/ml lOug/ml

T

Figure 3. Effect of treatment with different concentrations (1 and 10 gg/ml) of heptachlor and heptachlor epoxide for 1 h (fine grain bar) or 12 h (coarse grain bar) or 24 h (solid bar) on human breast epithelial cells as assayed by fluorescence recovery after photobleaching. The white bar is the control without treatment. GJIC recovery was measured by subtraction between values at 12 rain and atO min. *p <0.05, **p<O.O1.

e.--hCx43 (506bp)

¢---hGAPDH (600bp)

Figure 4. Effect of heptachlor on the steady state Cx43 mRNA levels by RT-PCR analysis. Total RNA was isolated from untreated breast epithelial cells (control) or from cells treated with 1, 3, or 10 gg/ml heptachlor for 1 h, 12 h or 24 h.

KDa

30-1 2 3 4 5 6 7 8 910 11 12 1314

Figure 5. Western blot analysis of Cx43 protein. Effect of heptachlor and heptachlor epoxide treatment for 1 h, 12 h, or 24 h compared to untreated cells. Lane 1, untreated control; lane 2, heptachlor (1 ~tg/ml) for 1 h; lane 3, heptachlor (1 ~tg/ ml)) for 12 h; lane 4, heptachlor (1 ~tg/ml) for 24 h; lane 5, heptachlor (10 gg/ml) for 1 h; lane 6, heptachlor (10 ~tg/ml) for 12 h; lane 7, heptachlor (10 ~tg/ml)) for 24 h; lane 8, untreated control; lane 9, heptachlor epoxide (1 gg/ml) for 1 h; lane 10, heptachlor epoxide (1 gg/ml) for 12 h; lane 11, heptachlor epoxide (1 gg/ml) for 24 h; lane 12, heptachlor epoxide (10 gg/ml) for 1 h; lane 13, heptachlor epoxide (10 gg/ml) for 12 h; lane 14, heptachlor epoxide (I0 ~tg/ml) for 24 h.

Indirect immunofluorescent staining of Cx43 proteins

Membrane-localized gap-junctional plaques were readily apparent in control cells (Figures 6A and 7A). In cells treated with heptachlor epoxide (1 gg/ml and 10 gg/ml) for 1, 12, and 24 h, respectively, membrane plaques of gap junction had disappeared from cell mem- branes. This change was accompanied by numerous perinuclear and intranuclear spots (Figures 6D and 6H), suggestive of gap junc- tion internalization. In cells treated with hepta- chlor (1 gg/ml), for 1 and 12 h (Figures 7B and 7C), there was a dramatic decrease of mem- brane-bound gap junction plaques. After 24 h, membrane-bound gap junction plaques reap- peared in the heptachlor (1 gg/ml) treated cells (Figure 7D). In cells treated with heptachlor (10 gg/ml) for 11 12, and 24 h, (Figures 7F, 7G, and 7H, respectively), there were no plaques on the membrane.

tion in the relative amount of the P1 and P2 bands, with complete loss at 12 h and 24 h treatment. Little effect on the relative amount o f P1 and P0 was observed at 1 gg/ml hepta- chlor between 1 and 24 h.

Discussion

The results of the present study clearly demon- strated that heptachlor and heptachlor epoxide blocked GJIC in normal human breast epithe-

75

Figure 6. Indirect immunofluorescent staining of connexin 43 in normal human breast epithelial cells treated with heptachlor epoxide. A, control; B, heptachlor epoxide (1 ~tg/ml) for I h; C, heptachlor epoxide (1 lag/ml) for 12 h; D, heptachlor epoxide (1 ~tg/rrd) for 24 h; E, phase contrast image of A; F, heptachlor epoxide (10 ~tg/ml) for 1 h; G, heptachlor epoxide (10 I~g/ml) for 12 h; H, heptachlor epoxide (10 txg/ml) for 24 h.

Figure 7. Indirect immunofluorescent staining of connexin 43 in normal human breast epithelial cells treated with heptachlor. A, control; B, heptachlor (1 lig/ml) for 1 h; C, heptachlor (1 ~g/ml) for 12 h; D, heptachlor (1 ~tg/ml) for 24 h ; E, phase contrast image of A; F, heptachlor (10 Ilg/ml) for 1 h; G, heptachlor (I0 ~tg/ml) for 12 h; H, heptachlor (10 ~tg/ml) for 24 h.

76

lial cells at concentrations which were noncyto- toxic. These observations are similar to those observed in other cell lines such as the liver WB-F344 cells and are consistent with their potential as tumor promoters, which has been observed in rat liver (Telang et al., 1982; Williams et al., 1984; Ruch et al., 1990; Ma- tesic et al., 1994).

The permeability of gap junction channels can be disrupted by a variety of mechanisms at either the transcriptional, translational, or post-translational levels (Saez et al., 1990). It has been hypothesized that hyperphosphoryl- ation of Cx43 is a possible mechanism by which TPA inhibits GJIC in rat liver WB cells (Oh et al., 1991; Matesic et al., 1994; Berthoud et al., 1993). Organochlorides induced hypo- phosphorylation of Cx43 in WB cells (Matesic et al., 1994). However, the mechanism by which these compounds inhibited GJIC inrat liver is still unclear, since this apparent dephos- phorylation event occurred more slowly than the inhibition of GJIC.

In normal human breast epithelial cells, we could not detect any change from controls in the steady-state levels of Cx43 mRNA follow- ing treatment with the organochlorides hepta- chlor or heptachlor epoxide. Heptachlor and heptachlor epoxide caused an apparent hypo- phosphorylation of Cx43 as evidenced by decreased amounts of the P1 immunoreactive band relative to the P0 band. Results from FRAP analyses showed no significant inhibi- tion of GJIC at 1 h with 1 Ixg/ml heptachlor and heptachlor epoxide (Figure 3), with corres- pondingly little change in P1/P0 (Figure 5). At the higher concentration (10 gg/ml) of hepta- chlor and heptachlor epoxide, both inhibition of GJIC (Figure 3) and hypophosphorylation of Cx43 (Figure 5) were observed at 1 h, and these effects were sustained through 12 h treatments, with only slight recovery of GJIC at 24 h. Thus, the change in Cx43 phosphoryl- ation roughly correlated with observed inhibi- tion of GJIC. However, it cannot yet be

concluded that the observed Cx43 hypophos- phorylation event was causal of GJIC inhibi- tion.

A heptachlor-induced increase of intracel- lular free [Ca2+]i might be another mechanism by which GJIC could be inhibited. Treatment of pig polymorphonuclear leukocytes with heptachlor stimulated superoxide generation and increased intracellular Ca 2÷ concentration (Suzaki et al., 1988). Superoxide anion in- creased intracellular free calcium (Masumoto et al., 1990). Reduction of GJIC has been correlated with the increase of intracellular Ca 2÷ (Rose and Loewenstein, 1975). Alterna- tively, these data might suggest that the block of junctional communication with heptachlor and heptachlor epoxide is mediated by an oxidative stress-related effect. In a paper by Ruch et al. (1990) it was shown that inhibition of dye coupling by heptachlor was reversible within 1 h after removal, and did not relate to inhibition of cytochrome P450 monoxygenases which metabolize some compounds.

Environmental pollutants have been sus- pected to be a serious worldwide problem for animal health (Huff, 1994). While the two pesticides used in the present study have been shown to be tumor promoters in rodent bio- assays and to inhibit GJIC in vitro, in both rat liver cells and normal human breast epithelial cells, the presence of these chemicals, together with other environmental pollutants, in human tissues does not prove that they are, indeed, human tumor promoters. However, these studies do demonstrate that these chemicals can inhibit GJIC, an important biological process associated with the regulation of cell proliferation and differentiation, in a normal human breast epithelial cell in vitro.

In conclusion, our results demonstrate that heptachlor and heptachlor epoxide can inhibit GJIC after exposure to noncytotoxic concen- trations of these chemicals. Further studies on the mechanism by which GJIC is inhibited could lead to preventive intervention measures

which might ameliorate their effects on GJIC. These results are consistent with observations showing that these pesticides are tumor pro- moters in rodent systems and suggest that they have the potential of being human breast tumor promoters.

Acknowledgment

We thank Heather de Feijter-Rupp for her assistance with fluorescence recovery after photobleaching studies. This work was sup- ported by grants from the Michigan Great Lakes Protection Fund, and from the NIEHS Superfund, grant 2P42ES04911-06. In addi- tion, owing to an instrument upgrade, funds were provided by the National Cancer Institute (CA21104), MSU College of Human Medi- cine, MSU-Cancer Center, and the MSU Provost Office.

References

Acquavella JF, Ireland BK, Ramlow JM. Organochlorines and breast cancer. J Natl Cancer Inst. 1993;85:1872-3.

Baker DB, Loo S, Baker J. Evaluation of human exposure to the heptaehlor epoxide contamination of milk in Hawaii. Ha- waii Med J. 1991;50:108-12.

Berthoud VM, Rook MB, Traub O, Hertzberg EL, Saez JC. On the mechanisms of cell uncoupling induced by tumor promoter phorbol ester in clone 9 cells, a rat fiver epithelial cell line. Eur J Cell Biol. 1993;62:384-96.

Colburn T, Vom Saal FS, Soto AM. Developmental effects of endocrine-disrupting chemicals in wildlife and humans. Environ Health Perspect. 1993;101:378-84.

Davis DL, Bradlow HL, Wolff M, Woodruff T, Hoel DG, Anton-Culver H. Medical hypothesis: xenoestrogens as preventable causes of breast cancer. J Natl Cancer Inst. 1993;85:648-52.

Dupont E, E1 Aoumari A, Roustiau-Severe S, Braind J, Gros D. Immunological characterization of rat cardiac gap junc- tions: presence of common antigenic determinants in heart of other vertebrate species and in various organs. J Membr Biol. 1988;104:119-28.

Falck F Jr, Ricci A Jr, Wolff MS, Godhold J, Deckers P. Pesticides and polychlorinated biphenyl residues in human breast lipids and their relation to breast cancer. Arch Environ Health. 1992;47:1434.

77

Hasler CM, Bennink MR, Trosko JE. Inhibition of gap june- tion-mediated intercellular communication by ~-linolenate. Am J Physiol. 1991;261:C161-8.

Hayashi T, Hasler CM, Oh SY, Madhukar BV, Chang CC, Trosko JE. A human kidney epithelial cell culture as an in

vitro model to study chemical modification of intercellular communication. In Vitro Toxicol. 1996 [in press].

Huff J. Carcinogenic hazards from eating fish and shellfish contaminated with disparate and complex chemicals mix- tures. In: Yang RSH, ed. Toxicology of chemical mixtures. New York: Academic Press; 1994;157-94.

Hunter DJ, Kelsey KT. Pesticide residues and breast cancer: The harvest of a silent spring? J Natl Cancer Inst. 1993;85:598-9.

Kao CY, Nomata K, Oaldey CS, Welsch CW, Chang CC. Two types of normal human breast epithelial cells derived from reduction mammoplasty phenotypic characterization and response to SV40 transfection. Carcinogenesis. 1995;16: 531-8.

Krieger N, Wolff MS, Hiatt RA, Rivera M, Vogelman J, Orentreich N. Breast cancer and serum organochlorines: a prospective study among white, black and asian women. J Natl Cancer Inst. 1994;86:589-99.

MacMahon B. Pesticide residues and breast cancer? J Natl Cancer Inst. 1994;86:572-3.

Masumoto N, Tasaka K, Miyake A, Tanizawa O. Superoxide anion increases intracellular free calcium in human myome- trial cells. J Biol Chem. 1990;265:22533-6.

Matesic DF, Rupp HL, Bonney WL, Ruch RJ, Trosko JE. Changes in gap junction permeability, phorphorylation, and number mediated by phorbol esters and non-phorbol ester tumor promoters in rat liver epithelial cells. Mol Carcinogen. 1994;10:226-36.

Matuo YK, Lopes JN, Casanova IC, Matuo T, Lopes JL. Organocholine pesticide residues in human milk in the Ribeirao Preto region, State of Sao Paulo, Brazil. Arch Environ Contam Toxicol. 1992;22:167-75.

Moser GJ, Smart RC. Hepatic tumor-promoting chlorinated hydrocarbons stimulate protein kinase C activity. Carcino- genesis. 1989;10:851-6.

Mussalo-Rauhamau, Hasanen E, Pyysalo H, Antervo K, Kauppila R, Pantzar P. Occurrence of beta-hexachlorocy- clohexane in breast cancer patients. Cancer. 1990;66:2124- 8.

Oh S, Grupen CG, Murray AW. Phorbol ester induces phos- phorylation and down-regulation of Cx43 in WB cells. Biochim Biophys Acta. 1991;1094:243-5.

Reuber MD. Carcinogenicity of heptachlor and heptachlor epoxide. J Environ Pathol Toxicol Oncol. 1987;7:85-114.

Rose B, Loewenstein WR. Permeability of cell junction depends on local cytoplasmic calcium activity. Nature (London). 1975;254:250-2.

Rucfi RJ, Fransson R, Flodstrom S, Warngard L, Klannig JE. Inhibition of hepatocyte gap junctional intercellular com- munication by endosulfan, chlordane and heptachlor. Car- cinogenesis. 1990;11:1097-101.

Saez JC, Spray DC, Hertzberg EL. Gap junctions: biochemical properties and functional regulation under physiological

78

and toxicological conditions. In Vitro Toxicol. 1990;3:69- 86.

Soto AM, Lin TM, Justicia H, Silvia RM, Sonnensehein C. An 'in culture' bioassay to assess the estrogenicity of xenobio- tics (E-screen). In: Colborn T, Clement C, eds. Chemically induced alterations in sexual and functional development the wild-life/human connection. (Advances in modern environmental toxicology; vol.21). Princeton: Princeton Scientific Publishing; 1992:295-309.

Suzaki E, Inoue B, Okimasu E, Ogata M, Utsumi K. Stimula- tive effect of chlordane on the various functions of the guinea pig leukocytes. Toxicol Appl Pharmacol. 1988;93: 137-45.

Telang S, Tong C, Williams GM. Epigenetic membrane effects of a possible tumor promoting type on cultured liver cells by the non-genotoxic organochlorine pesticides, chlordane and heptaehlor. Carcinogenesis. 1982;3:1175-8.

Trosko JE, Chang CC. Nongenotoxic mechanisms in carcino- genesis: role of inhibited intercellular communication. In: Hart AW, Hoerger FG, eds. Banbury Report 31: Carcino- gen risk assessment: new directions in the qualitative and

quantitative aspects. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1988:139-70.

Yang Tr, Kao CY, Jou YS et al. Expression of gap junction genes in two types of normal human breast epithelial cells and breast cancer cell lines. Proc Am Assoc Cancer Res. 1993;34:45.

Wade MH, Trosko JE, Schindler M. A fluorescence photo- bleaching assay of gap junction-mediated communication between human cells. Science. 1986;232:525-8.

Williams GM, Numoto S. Promotion of mouse liver neoplasms by the organochlorine pesticides chlordane and heptachlor in comparison to dichloridiphenyltrichloroethane. Carcino- genesis. 1984;5:1689-96.

Wolff MS, Toniolo PG, Lee EW, Rivera M, Dubin N. Blood levels of organochlorine residues and risk of breast cancer. J Natl Cancer Inst. 1993;85:648-52.

Yamasaki H. Cell--cell interaction in carcinogenesis. Toxicol Pathol. 1986;14:363-9.

Address for correspondence: James E. Trosko, B240 Life Sciences, East Lansing, MI 48824, USA