information aspects of nucleic acids measurement technologies description of nucleic acid...

16
Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis problems introduced by these new technologies

Post on 21-Dec-2015

225 views

Category:

Documents


5 download

TRANSCRIPT

Page 1: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

Information Aspects of Nucleic Acids Measurement Technologies

• Description of nucleic acid measurement technologies

• Algorithmic, optimization, data analysis problems introduced by these new technologies

Page 2: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

General Topics

• Optimization of the information measured in an assay or a set of assays.(Expression probe design)

• Optimization of information to resource ratio in molecular level assays.(Multiplexed genotyping assays)

• Biologically driven data analysis(Analysis of gene expression data)

• Algorithms for raw data interpretation(SBH, RE mapping)

Page 3: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

Nucleic Acid Measurement Technologies (examples)

• Array based hybridization assays (DNA chips)

• MassSpectrometry based techniques

• Restriction enzyme fragmentation and length separation

• Large scale sequencing

Page 4: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

A Few Basic Concepts of Molecular Biology

• DNA

• Proteins

• The central dogma of cellular biology

• DNA as a sequence of bases

• Watson-Crick –ery

Page 5: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

Central Dogma

Transcription

mRNA

Cells express different subset of the genesIn different tissues and under different conditions

Gene (DNA)

Translation

Protein

Page 6: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

DNA

• Carries the code for cellular functioning

• Variation in the code is the source for variation in properties

• Disease and disease susceptibility can be caused by changes in the DNA.

• DNA is the same for all cells of an individual.

Page 7: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

mRNA and Proteins

• Execute the code• Relative levels are different in

different cells, depending on function and condition

• Are indicative of the state of the cell

Page 8: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

Watson-Crick Complimentarity

A binds to TC binds to G

AATGCTTAGTCTTACGAATCAG

Perfect match

AATGCGTAGTCTTACGAATCAG

One base mismatch

Page 9: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

FISH

• Fluorescence In-Situ Hybridiztion

• Fluorecsently labeled probes hybridize to specific chromosomal locations.

• Example application: low resolution localization of an EST.

Page 10: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

Array Based Hybridization Assays (DNA Chips)

Unknown sequence (target)Many copies.

Array of probes

Page 11: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

• Target hybs to WC complimentary probes only• Therefore – the fluorescence pattern is indicative of the

target sequence.

Array Based Hyb Assays

Page 12: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

Thermal Ink Jet Arrays, by Agilent Technologies

cDNA array,Inkjet deposition

In-Situ synthesized oligonucleotide array. 25-60 mers.

Page 13: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

Expression Profiling

• Given a set of genes of interest, measure the quantities of the corresponding mRNA, in cells in various conditions.

• Assumptions: • base sequences are known• Fluorescence levels are linear with

expression levels• Example computational problem: design

specific and sensitive probes.

Page 14: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

Specific Probes

Input:Querry sequence (m:500-2000).Background message (total length of 50Mb).Probe length (20-70).

Output:For each probe candidate, its distance to the background message.

m

Page 15: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

In future lectures and mini-projects

we will discuss/study information problems related to designing hybridization based assays and to the interpretation and data analysis of the results.

Page 16: Information Aspects of Nucleic Acids Measurement Technologies Description of nucleic acid measurement technologies Algorithmic, optimization, data analysis

SBH