of April 5, 2018.This information is current as

Inflammation in MiceImiquimod-Induced Psoriasiform Skin Dual Inhibition of TNFR1 and IFNAR1 in

E. VandenbrouckeLynda Grine, Lien Dejager, Claude Libert and Roosmarijn

ol.1403015http://www.jimmunol.org/content/early/2015/04/24/jimmun

published online 24 April 2015J Immunol 

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Author Choice Author Choice option

The Journal of ImmunologyFreely available online through

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved.Copyright © 2015 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on April 5, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

by guest on April 5, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

The Journal of Immunology

Dual Inhibition of TNFR1 and IFNAR1 inImiquimod-Induced Psoriasiform Skin Inflammation in Mice

Lynda Grine, Lien Dejager, Claude Libert,1 and Roosmarijn E. Vandenbroucke1

Psoriasis is a chronic inflammatory skin disease affecting 2–3% of the world population and is mainly characterized by epidermal

hyperplasia, scaling, and erythema. A prominent role for TNF in the pathogenesis of psoriasis has been shown, and consequently

various types of TNF antagonists such as etanercept and infliximab have been used successfully. Recently, increasing amounts of

data suggest that type I IFNs are also crucial mediators of psoriasis. To investigate whether blocking their respective receptors

would be useful, TNFR1- and IFNAR1-deficient mice were challenged with Aldara, which contains imiquimod, and is used as an

experimental model to induce psoriasis-like skin lesions in mice. Both transgenic mice showed partial protection toward Aldara-

induced inflammation compared with control groups. Additionally, TNFR1 knockout mice showed sustained type I IFN produc-

tion in response to Aldara. Double knockout mice lacking both receptors showed superior protection to Aldara in comparison with

the single knockout mice and displayed reduced levels of IL-12p40, IL-17F, and S100A8, indicating that the TNF and type I IFN

pathways contribute significantly to inflammation upon treatment with Aldara. Our findings reveal that dual inhibition of TNFR1

and IFNAR1 may represent a potential novel strategic treatment of psoriasis. The Journal of Immunology, 2015, 194: 000–000.

Psoriasis is a chronic inflammatory skin disease affecting 2–3% of the world population (1, 2). Despite extensivestudies, details of the disease mechanism remain to be

elucidated. Initially, psoriasis was described as a disease involvingexcessive proliferation of keratinocytes, which then trigger in-flammation. Today, it is known that the immune system is in-volved at multiple stages of the disease. Initiating events, forexample, wounds or infections, cause keratinocytes to releasestress signals, which are picked up by resident immune cells suchas dendritic cells (DCs). Subsequently, IL-12 and IL-23 are re-leased and trigger T cells to differentiate into Th1 and Th17 cellsproducing cytokines such as TNF, IFN-g, and IL-17, which starta proinflammatory cascade (3–7). This will recruit and activatemore immune cells and at the same time act on the keratinocytes,increasing stress responses and causing hyperproliferation of theepidermal layer.The proinflammatory effects of TNF are thought to mediate

various autoimmune diseases, as increased amounts of TNF areproduced in several of these diseases, indicating an important role

for this cytokine. Several neutralizing anti-TNF agents, such as

etanercept and infliximab, have been successfully applied in au-

toimmune diseases, including inflammatory bowel disease, rheu-

matoid arthritis, and psoriasis (8). Indeed, the amelioration

achieved with TNF antagonists confirms that TNF is a pivotal

proinflammatory mediator in psoriatic lesions. Treatment with

etanercept rapidly reduces the inflammatory immune cell influx

(DCs, T cells, and macrophages) in lesional skin and impairs the

production of IL-17 and IL-22 by Th17 cells (9). However, TNF

inhibitors are also associated with side effects, such as reactivation

of latent tuberculosis, hepatosplenic T cell lymphoma, liver tox-

icity, and increased susceptibility to opportunistic infections, such

as Listeria and Legionella infections (10, 11). TNF signaling is

clearly crucial for the full functionality of the immune system. As

TNF signals through two receptors, TNFR1 (p55) and TNFR2

(p75), and it is assumed that most proinflammatory effects of TNF

are mediated mainly by TNFR1 (12), our concept is to specifically

block this receptor, leaving TNF signaling through TNFR2 intact.Another important family of cytokines are the type I IFNs that are

mainly known for their antiviral actions. However, additionally, thepleiotropic type I IFNs play a crucial role in other innate and adaptiveimmune responses. This family consists of different a genes (Ifna), 13in humans and 14 in mice, and one b IFN gene (Ifnb), both of whichsignal through the heterodimeric receptor complex, consisting ofIFNAR1 and IFNAR2. Type I IFNs have been associated with auto-immune diseases because type I IFN-inducible genes are upregulatedin some autoimmune diseases, displaying a so-called IFN signature(13–15). This is an upregulation of type I IFN–inducible genes or genescontaining IFN-sensitive response elements (ISREs) found in tissuessuch as skin lesions in psoriasis and the inflamed joints of rheumatoidarthritis patients (16–19). Similarly, treatment of patients affected byhepatitis C or multiple sclerosis with IFN-a or IFN-b, respectively, isassociated with induction or exacerbation of psoriasis, indicating thattype I IFNs can be involved in the pathogenesis of psoriasis (20–22).Paradoxically, TNF-blocking agents can also induce cutaneouspsoriasis-like lesions in patients treated for other autoimmune dis-orders. This side effect may be due to increased type I IFN productionby plasmacytoid DCs (pDCs) following reduction of TNF levels, be-cause TNF stimulates pDC maturation and subsequently IFN-a release

Inflammation Research Center, Flanders Institute for Biotechnology, 9052 Ghent,Belgium; and Department of Biomedical Molecular Biology, Ghent University, 9052Ghent, Belgium

1C.L. and R.E.V. contributed equally to this work.

ORCID: 0000-0002-8327-620X (R.E.V.).

Received for publication December 4, 2014. Accepted for publication March 22,2015.

This work was supported by the Agency for Innovation by Science and Technology,the Research Foundation Flanders, and the Interuniversity Attraction Poles Programof the Belgian Science Policy.

Address correspondence and reprint requests to Dr. Roosmarijn E. Vandenbrouckeand Dr. Claude Libert, VIB-Ghent University, Technologiepark 927, 9052 Ghent,Belgium. E-mail addresses: Roosmarijn.Vandenbroucke@irc.VIB-UGent.be (R.E.V.)and Claude.Libert@irc.VIB-UGent.be (C.L.)

Abbreviations used in this article: Cnfn, Cornifelin; DC, dendritic cell; DKO, doubleknockout; IMQ, imiquimod; ISRE, IFN-sensitive response element; Ivl, Involucrin;KO, knockout; Krt6b, Keratin6b; Lor, Loricrin; pDC, plasmacytoid dendritic cell;qRT-PCR, quantitative real-time PCR.

This article is distributed under The American Association of Immunologists, Inc.,Reuse Terms and Conditions for Author Choice articles.

Copyright� 2015 by The American Association of Immunologists, Inc. 0022-1767/15/$25.00

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1403015

Published April 24, 2015, doi:10.4049/jimmunol.1403015 by guest on A

pril 5, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

(23–26). Aldara, which contains imiquimod (IMQ), a TLR7/8 agonist,has been increasingly used as an experimental model in mice becauseit induces psoriasiform lesions that resemble human psoriasis (7).Clearly, both TNF and type I IFNs play a role in psoriasis (27). In

this study, we show that mice lacking TNFR1 or IFNAR1 aremodestly protected from Aldara-induced psoriasiform skin inflam-mation. Double knockout (DKO) mice deficient in both receptors aresignificantly better protected from psoriasis-like lesions induced byAldara. We show that TNFR1 signaling mediates a negative feedbackon type I IFN signaling upon TLR7 activation, and that IFNAR1induces systemic IL-12p40 in response to Aldara. We propose dualinhibition of TNFR1 and IFNAR1 as a novel therapeutic strategy forthe treatment of psoriasis.

Materials and MethodsMice

C57BL6/J mice were purchased from Janvier Labs (Le Genest Saint Isle,France). TNFR1 KO mice generated by M. Rothe were a gift fromH. Bleuthmann (Hoffmann-La Roche, Basel, Switzerland). They were kept ona C57BL6/J background. IFNAR1 KO mice were provided by D. Bonaparte(Gulbenkian Institute of Science, Oeiras, Portugal). These mice were back-crossed for .10 generations into a homogeneous C57BL6/J background.Homozygous TNFR1/IFNAR1 DKO mice were generated by crossing ho-mozygous TNFR1 KOmice with homozygous IFNAR1 KOmice, followed byintercrossing and selecting DKO mice. All animals were maintained in a spe-cific pathogen-free, temperature-controlled, air-conditioned animal house witha 14/10-h light/dark cycle and received food and water ad libitum. Experi-ments were performed in the specific pathogen-free animal house on malemice 8–12 wk old. All animal experiments were approved by the InstitutionalEthics Committee for Animal Welfare of the Faculty of Sciences, GhentUniversity (Ghent, Belgium) and followed the European guidelines.

IMQ-induced psoriasis-like skin lesions and scoring ofsymptoms

Mice were briefly sedated with isoflurane and the back skin of mice was shaved.Two days later, a dose of 62.5 mg Aldara cream (5% IMQ, 3M Pharmaceuticals)was applied daily on the back for 4–7 consecutive days. Mice were scored dailybased on a modified psoriasis area and severity index scoring system as describedpreviously (6). In brief, to describe the severity of psoriasis, erythema (redness ofthe skin) and scaling were scored in a blinded manner on a scale from 0 to 4: 0,none; 1, slight; 2, moderate; 3, marked; 4, very marked. Thickness of the skinwas measured on H&E-stained skin sections as described below.

H&E staining

Tissue samples were fixed in 4% paraformaldehyde and embedded inparaffin. Deparaffinized 5-mm sections were stained with H&E. Imageswere taken with an Olympus BX51 light microscope (340 magnifica-tion) and epidermal thickness was quantified with Volocity software(PerkinElmer).

Detection of TNFR1, TNF, IFN ligands, IL-17A/F,IL-12p40/p70, and IL-23p19

Mice were treated with IMQ and euthanized for blood, spleen, and skincollection at the indicated times. Blood was collected through cardiacpuncture and allowed to clot at 4˚C overnight. Serum was collected afterremoval of the clot and centrifugation and stored at 280˚C until assayed.Whole-skin samples were homogenized in ice-cold buffer (PBS, 0.5%CHAPS, Roche cOmplete protease inhibitor). Homogenates were centri-fuged for 30 min at 20,000 3 g and 4˚C, after which the supernatant wascollected and stored at 220˚C. Protein concentration was determined bythe Bradford method (Bio-Rad). For the detection of TNFR1 levels, themouse sTNF RI/TNFRSF1A duoset ELISA (R&D Systems) was used.Luminex technology was used to detect TNF, IL-12p40, IL-12p70, IL-23p19, IL-17A/F (Bio-Rad), and IFN-a and IFN-b (mouse IFN-a/bplatinum; Procarta). All above-mentioned techniques were performedaccording to the manufacturers’ instructions.

Quantitative real-time PCR

Skin samples were collected in RNAlater (Ambion). RNAwas isolated withthe RNeasy fibrous tissue kit (Qiagen) according to the manufacturer’sinstructions. RNA concentration was measured with the NanoDrop 1000(Thermo Scientific) and quality was checked using the Agilent 2100Bioanalyzer, and 1 mg RNAwas used to prepare cDNAwith SuperScript II(Invitrogen). Quantitative real-time PCR (qRT-PCR) was performed usingSensiFAST SYBR No-ROX kit (Bioline) and the LightCycler 480 (Roche).Expression levels were normalized to the expression of the two most stablereference genes, which were determined for each condition using geNorm(qBase, Biogazelle). Values are represented as relative expression nor-malized to the geometric mean of the two selected most stable referencegenes. Primer sequences and references genes can be found in Tables I andII, respectively. Table III lists the fold inductions of the transcript levels inIFNAR1 KO, TNFR1 KO, and DKO skin for the indicated genes from day0 to 6 after IMQ.

Statistical analysis

Results (mean 6 SD or SEM) were compared with a two-tailed Student ttest. A p value,0.05 was considered significant. In vivo experiments wererepeated four times. Transcriptional data has been performed twice. Serummarkers were measured three times.

Table I. Primer sequences for qRT-PCR analysis

Gene Forward Primer (59→39) Reverse Primer (59→39)

Hprt AGTGTTGGATACAGGCCAGAC CGTGATTCAAATCCCTGAAGTRpl CCTGCTGCTCTCAAGGTT TGGTTGTCACTGCCTCGTACTTUbc AGGTCAAACAGGAAGACAGACGTA TCACACCCAAGAACAAGCACACnfn TTGCTGATGGCCGGTCTTATT GCCAGTCTTTCCAATGAGACAAIvl ATGTCCCATCAACACACACTG TGGAGTTGGTTGCTTTGCTTGLor CACATCAGCATCACCTCCTTCC CCTCCTCCACCAGAGGTCTTTCKrt6b CCATCAAGAGTCAAACTAGCCAC GCTCAAACATAGGCTCCAGGTTS100a8 AAATCACCATGCCCTCTACAAG CCCACTTTTATCACCATCGCAAIfit2 ATCTCTCCCTACTCTGCCCTCCTA GCGTATAAATCAGCAATCCCTTCACxcl10 CCAAGTGCTGCCGTCATTTTC GGCTCGCAGGGATGATTTCAAUsp18 AGCCCTCATGGTCTGGTTGGTT GCACTCCGAGGCACTGTTATCC

Table II. Reference genes per condition

Condition Samples Reference Genes

0, 2, 4, or 6 d + IMQ TNFR1 + IFNAR1 KO + control groups Rpl + Hprt0, 2, 4, or 6 d + IMQ DKO Rpl + Ubc0, 2, or 6 h + IMQ TNFR1 KO + control group Rpl + Hprt

2 DUAL TNFR1 AND IFNAR1 INHIBITION IN PSORIASIS

by guest on April 5, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

ResultsTNFR1 signaling partially mediates IMQ-inducedpsoriasiform skin inflammation

In 2009, Van der Fits et al. (7) proposed the topical application ofthe TLR7/8 agonist IMQ in the form of Aldara cream as a modelfor psoriasis. To investigate the role of TNFR1 in the TNF-mediated disease, we treated wild-type mice daily with Aldara,hereafter termed IMQ, on the back for 4 consecutive days andlooked at the kinetics of TNF and TNFR1 in serum and whole-skin lysates, respectively. Upon treatment with IMQ, TNFR1 andTNF were induced on days 2 and 4, respectively (Fig. 1A). Wethen questioned whether inhibiting TNFR1 signaling is sufficientto ameliorate the Aldara-induced symptoms. Therefore, we treatedwild-type and TNFR1 KO mice for 7 consecutive days with IMQ.Redness and scaling were scored daily as described previously (6).

Initially, all mice scored 0 on erythema, scaling, and thickening.During IMQ treatment, wild-type mice showed increased ery-thema, scaling, and epidermal thickening (Fig. 1B). TNFR1-deficient mice were moderately protected from both scaling anderythema during IMQ treatment. There was no difference in theIMQ-induced epidermal hyperplasia, suggesting that TNFR1 isnot involved in the hyperproliferation of keratinocytes in theAldara model (Fig. 1C, 1D). Parakeratosis, the retention of nucleiin the corneal layer, was not blocked by the absence of TNFR1(data not shown). IMQ has been reported to cause splenomegaly(28), which we also observed in the wild-type mice (Fig. 1E). Incontrast, TNFR1 KO mice showed significantly less splenomegaly(Fig. 1E). To assess transcriptional differences between wild-typeand TNFR1-deficient skin, markers that are generally upregulatedin psoriasis were measured by qRT-PCR. On day 6 of IMQtreatment, expression of various genes was increased in wild-type mice (Fig. 1F). Remarkably, markers such as Cornifelin(Cnfn) and Involucrin (Ivl) were significantly stronger induced inTNFR1 KO skin, whereas others, including Keratin6b (Krt6b) andS100a8, were less induced in the TNFR1 KO mice. The inductionof Loricrin (Lor) expression in the absence of TNFR1 was higherthan in wild-type mice.

Sustained type I IFN signaling in TNFR1 KO mice

IMQ induces large amounts of type I IFNs by stimulating pDCs,and these cytokines can initiate psoriasis (18). We wonderedwhether TNFR1 is modulating this process in the Aldara model.We treated wild-type and TNFR1 KO mice with IMQ and isolated

Table III. Transcriptional fold induction of markers in skin

Markers IFNAR1 KO TNFR1 KO DKO

Cornifelin(Cfn)

3.1 6 1.0 16.2 6 3.7 2.3 6 1.3

Involucrin(Ivl)

0.3 6 0.1 7.9 6 0.9 3.9 6 1.8

Loricrin (Lor) 0.5 6 0.1 15.2 6 5.9 6.5 6 5.3Keratin6b

(Krt6b)2.1 6 2.5 316. 0 6 167.5 1.2 6 1.9

S100a8 1048.6 6 787.4 235.5 6 82.8 1.8 6 0.8

FIGURE 1. TNFR1 KO mice are partially protected against IMQ-induced psoriasis-like skin lesions. Wild-type and TNFR1 KO mice were treated with

Aldara for a maximum of 7 d and (A) protein levels of TNF in serum (left) and TNFR1 in skin (right) were measured in wild-type mice. Bars represent mean6SD (n = 4). (B) Erythema and scaling were scored on days 4 and 7. Bars represent scores (024) (mean 6 SD; n = 6–8). (C) Epidermal hyperplasia in skin

sections of IMQ-treated mice taken on days 0, 4, and 7, quantified with Volocity (mean6 SD; n = 4–5). (D) Representative H&E-stained skin sections on day 7.

Scale bars, 100 mm. (E) Splenomegaly 7 d after daily control cream or IMQ treatment of mice, calculated as the ratio of spleen weight to total body weight. (F)

qRT-PCR analysis of gene expression of Cnfn, Ivl, Lor, Krt6b, and S100a8 in whole-skin lysates (days 0 and 6). Bars represent relative transcript levels (mean 6SD; n = 4). Black indicates wild-type mice; light gray indicates TNFR1 KO mice. *p , 0.05, **p , 0.01, ***p , 0.001, ****p . 0.0001.

The Journal of Immunology 3

by guest on April 5, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

skin and serum early after the first IMQ treatment and every otherday during the following treatment days. After repeated treatmentwith IMQ, levels of IFN-a in the skin showed a tendency to bedecreased in wild-type mice, but this difference did not reachstatistical significance (Fig. 2A). This is in line with the obser-vations of Walters et al. (29) and is presumably due to exhaustion ofmyeloid precursor cells and reduced pDC numbers. To measure thepotential induction of IFN-a, we measured its levels in serum atdifferent time points based on the observations of Walters et al., whoreported that IFN-a was induced 3 h after application of Aldara.Indeed, both IFN-a and IFN-b were induced in wild-type mice 3 hafter IMQ application, but decreased rapidly (Fig. 2B). Analysis ofgene expression in skin lysates revealed transient upregulation ofISRE genes such as Cxcl10, Ifit2, and Usp18, which reflect IFN-a/bactivity, as early as 2 h after topical application of IMQ (Fig. 2C). Incontrast, TNFR1 KO mice did not display this transient expression ofboth type I IFN ligands and ISRE genes: IFN-a and IFN-b expres-sion remained strong in the sera 4.5 h after IMQ application and inthe skin 4 d later (Fig. 2A, 2B). Likewise, abrogation of TNFR1signaling leads to sustained transcriptional expression of Cxcl10, Ifit2,and Usp18 six hours after IMQ challenge (Fig. 2C). These dataclearly indicate that TNFR1 signaling is involved in silencing thetype I IFN response in the Aldara model.

Type I IFNs and IFNAR1 contribute to epidermal thickeningduring IMQ-induced psoriasiform skin inflammation

To further investigate the role of type I IFN signaling in the Aldaramodel, we examined the response to IMQ in mice deficient in thereceptor 1 of type I IFNs (IFNAR1 KOmice). We treated wild-typemice and IFNAR1 KO mice for 7 consecutive days with IMQ andscored the responses as described above. Before any IMQ wasapplied, all mice scored 0 for each parameter. IFNAR1 KO miceexhibited significantly less erythema on day 4 but this protectionwas lost on day 7. Both mouse strains had similar scaling at eachtime point (Fig. 3A). Analysis of H&E-stained sections from af-

fected back skin showed that epidermal hyperproliferation on day7 was markedly less in IFNAR1 KO mice compared with WTmice, as depicted in Fig. 3B (quantification) and Fig. 3C (repre-sentative H&E images).Similarly to the TNFR1 KO mice, IFNAR1 KO mice developed

significantly less splenomegaly in comparison with IFNAR1 wild-type mice after IMQ (Fig. 3D). Additionally, IFNAR1 abrogationled to reduced expression of Cnfn, Ivl, Lor, and Ker6b, but it didnot affect the gene expression levels of S100a8 (Fig. 3E).It has been reported that treatment with IFN-a or IFN-b can affect

TNFR1 and TNFR2 levels (30, 31). To test whether IFNAR1 is in-volved in the upregulation of TNFR1 observed in Fig. 1A, we mea-sured TNFR1 protein levels in wild-type and IFNAR1-deficient skintreated with IMQ. As shown in Fig. 3F, the increase in TNFR1 proteinlevel in response to IMQ was comparable in IFNAR1 KO mice andwild-type mice. Collectively, these results suggest that deletion of ei-ther TNFR1 or IFNAR1 can ameliorate IMQ-induced psoriasis-likeskin lesions. Moreover, our data indicate that TNFR1 signaling is in-volved early in the Aldara model, in addition to type I IFNs, whichhave already been described as the initiating cytokines of psoriasis (18).

Deficiency in both TNFR1 and IFNAR1 leads to superiorprotection against IMQ-induced psoriasiform skininflammation

Next, we wondered whether abrogation of both receptors simulta-neously could enhance protection. Therefore, we crossed TNFR1 KOmice with IFNAR1 KO mice to generate DKO mice deficient for bothreceptors. The same parameters weremeasured to assess the response ofthe DKO mice to IMQ-induced psoriasiform skin inflammation. Incomparison with the single KO and wild-type mice, DKO mice hadsignificantly reduced erythema and scaling on day 4 and no psoriaticlesions by day 7 (Fig. 4A). Abrogation of both receptors did not resultin less splenomegaly compared with the single KOs (Fig. 4B). DKOmice also displayed significantly less IMQ-induced epidermal thick-ening compared with the single KOs and wild-type mice on day 7, butnot in comparison with control cream (Fig. 4C, 4D). Overall, DKO

FIGURE 2. Deficient TNFR1 signaling leads to increased type I IFNs and ISRE signature. Wild-type and TNFR1 KO mice were treated with IMQ for 4

consecutive days and skin and blood were isolated at the indicated time points (mean 6 SD; n = 4). (A) Kinetics of IFN-a protein levels in whole skin

lysates during 4 d. (B) Kinetics of IFN-a (left) and IFN-b (right) protein levels in serum. (C) qRT-PCR analysis of typical ISRE genes (Cxcl10, Ifit2, and

Usp18) in whole-skin lysates. Bars represent relative transcript levels (mean 6 SD; n = 4). Black indicates wild-type mice; light gray indicates TNFR1 KO

mice. *p , 0.05, **p , 0.01, ***p , 0.001, ****p . 0.0001.

4 DUAL TNFR1 AND IFNAR1 INHIBITION IN PSORIASIS

by guest on April 5, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

mice displayed reduced or intermediate fold induction of severalmarkers in comparison with TNFR1 KO and IFNAR1 KO mice(Table III). Altogether, our data suggest that simultaneous deletion ofTNFR1 and IFNAR1 leads to better control of IMQ-induced psoriasis-like skin lesions.

TNFR1 and IFNAR1 signaling and the IL-23/IL-17 axis inIMQ-induced psoriasiform skin inflammation

Van der Fits et al. (7) described the importance of the IL-23/IL-17axis in IMQ-induced psoriasis-like skin lesions using mice defi-cient in either IL-23p19 or IL-17RA (7). To assess the role ofTNFR1 and IFNAR1 in the IL-23/IL-17 axis, serum was isolatedat different time points during IMQ application. IMQ induced IL-12p40 expression in serum of wild-type mice with a peak 48 hafter application (Fig. 5A). IL-12p40 is a subunit in both IL-12and IL-23 and is a novel drug target for the treatment of psoriasis(32–34). The induction was also observed in serum of TNFR1 KOmice (Fig. 5A), indicating that the induction of IL-12p40 does notrequire TNFR1 activation. However, the increase of IL-12p40 wassignificantly less pronounced in serum of IMQ-treated IFNAR1KO mice and DKO mice (Fig. 5A). As IL-12p40 is a commonsubunit of IL-23 and IL-12, we measured total IL-12 (IL-12p70)and IL-23p19 levels in serum. We did not observe a change incirculating IL-12 levels and, surprisingly, IL-23p19 levels werenot detectable in serum (data not shown) in the Aldara model.Next, we measured IL-17A and IL-17F separately in serum.Pantelyushin et al. (35) found that IL-17F has a more important

role in the IMQ-induced psoriasiform skin inflammation modelthan does IL-17A by comparing the response of IL-17A and IL-17F KO mice. IL-17F KO mice were better protected againstchallenge with repeated IMQ treatments compared with the IL-17A KO mice. In blood, we detected an increase of IL-17F levels(Fig. 5B) but not of IL-17A levels (data not shown). This induc-tion was significantly less outspoken in TNFR1 KO mice, whereasIFNAR1 KO mice had significantly reduced IL-17F serum levelscompared with wild-type and TNFR1 KO mice. The DKO miceshowed no significant difference in serum IL-17F levels after IMQtreatment, and levels were significantly lower compared withwild-type and TNFR1 KO mice, but not in comparison withIFNAR1 KO mice. These data provide evidence that TNFR1 andIFNAR1 signaling affects the systemic levels of IL-23/IL-17 axis–associated cytokines in the Aldara model.

DiscussionIMQ is a TLR7/8 agonist used to treat basal cell carcinoma,squamous cell carcinoma, actinic keratosis, and genital and peri-anal warts and is used in the form of a topically applied creamcalled Aldara. Its medicinal use has been associated with de novoinduction or exacerbation of psoriasis (36–38). This led to the useof a cream containing IMQ on mice to mimic the inflammatoryskin disease (7, 29, 35, 39).The Aldara model has been increasingly used as a model in mice

to induce psoriasis-like lesions in mice. It is an easy model, as itdoes not require any surgical expertise such as xenograft models,

FIGURE 3. IFNAR1 KO mice are protected against IMQ-induced psoriasiform skin inflammation compared with wild-type mice. (A) Wild-type and

IFNAR1 KO mice were treated with IMQ for a maximum of 7 d and scored for erythema and scaling on days 4 and 7. Bars represent scores (024) (mean6SD; n = 6). (B) Epidermal hyperplasia from skin sections on days 0, 4, and 7, quantified with Volocity (mean6 SD; n = 6). (C) Representative skin sections

on day 7 stained with H&E. Scale bars, 100 mm. (D) Splenomegaly after 7 d with control cream or IMQ treatment calculated as the ratio of spleen weight to

total body weight. (E) qRT-PCR analysis of gene expression of Cnfn, Ivl, Lor, Krt6b, and S100a8 in whole-skin lysates (days 0 and 6). Bars represent

relative transcript levels (mean 6 SD; n = 4). (F) TNFR1 concentration was measured in whole-skin lysates from IFNAR1 KO mice treated with IMQ with

ELISA (n = 5). Black indicates wild-type mice; dark gray indicates IFNAR1 KO mice. *p , 0.05, **p , 0.01, ***p , 0.001, ****p . 0.0001.

The Journal of Immunology 5

by guest on April 5, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

and it induces skin inflammation in all murine backgrounds, al-though severity can differ. Although its active ingredient is IMQ,other ingredients of Aldara may also affect the skin (29). Its maindisadvantage is the lack of chronicity to closely resemble psori-asis, but over the years it has been shown that most relevantpathways in human psoriasis are also implicated in the pathologyof IMQ-induced skin inflammation, justifying its use as an ex-perimental in vivo model (40). In the present study, we studied theresponse of TNFR1, IFNAR1, and double-deficient mice upondaily treatment of the skin with Aldara.TNF is upregulated in human psoriatic lesional skin and is thought

to maintain the inflammatory loop in these lesions (5). The clinicalbenefits of TNF antagonists have confirmed its proinflammatoryrole in psoriasis and other autoimmune diseases, such as rheumatoidarthritis and Crohn’s disease. However, these drugs have side effectsranging from increased susceptibility to infections to de novo in-duction of psoriasis, as mentioned above. Although TNF is mainlyknown as a very potent proinflammatory cytokine, it is essential foreliciting an appropriate immune response. We think that the currentstrategy of TNF inhibition is not optimal because of the differentaxes involved in TNF signaling (12). Indeed, TNF can bind to twodifferent receptors, TNFR1 and TNFR2. Using the current TNFantagonists, the actions of TNF via both TNFR1 and TNFR2 areabolished. Although both receptors bind TNF, they differ in bio-logical actions. Inhibition of soluble TNF or TNFR1 increases thespecificity of the treatment by targeting the proinflammatory axisof TNF signaling while leaving the regulatory TNFR2 pathwayintact. Consequently, several studies suggest that specific inhibitionof soluble TNF or TNFR1 in autoimmune diseases might be suf-ficient to achieve benefits similar to those of TNF antagonists, butwithout causing side effects (12, 41, 42). Although we did not ad-dress this issue, we do show that genetic ablation of TNFR1 issufficient to partially protect mice from the full-blown skin in-flammation upon IMQ treatment. Furthermore, we report specificupregulation of TNFR1 in the skin treated with IMQ, drawing an-other parallel to human psoriasis, in which TNFR1 expression is

also increased (43, 44). This finding shows another similarity be-tween the IMQ-induced psoriasiform skin inflammation mousemodel and human psoriasis.To elucidate the role of type I IFNs in IMQ-induced psoriasis-

like skin lesions, we investigated the induction of type I IFN–re-sponsive genes. We found elevated levels of IFN-a, IFN-b, anda significant ISRE signature early after topical application of IMQ,which rapidly decreased in wild-type mice after their inductionpeak. We hereby confirm the very early and transient actions oftype I IFNs in psoriasis proposed by Nestle et al. (18). However,a study showed that treatment with an mAb raised against IFN-a,MEDI-545, failed to reveal efficacy in reducing disease activity(45). Possibly, blocking IFN-a might not be sufficient, becauseIFN-b is also present in psoriatic plaques and signals throughthe same heterodimeric complex IFNAR1/IFNAR2. Additionally,type I IFNs are thought to initiate psoriasis, whereas MEDI-545was used in patients with established psoriatic plaques, whichcould also explain the inefficacy of MEDI-545. Remarkably, in theabsence of TNFR1 signaling, both IFN production and ISRE geneexpression were sustained in serum and skin, respectively. Thismight be due to inefficient maturation of pDCs and enhancedrelease of IFN-a in response to blockade of TNF signaling, aspreviously reported by Palucka et al. (26). This correlates with theobservations that patients on anti-TNF therapy to treat other au-toimmune diseases can have increased type I IFN levels and de-velop cutaneous lesions with psoriasiform morphology (46, 47). Ithas been suggested that a balance between TNF and type I IFNs islost upon treatment with TNF antagonists, leading to unopposedincreases in IFN levels. We hypothesize that patients with rheu-matoid arthritis or Crohn’s disease on anti-TNF drugs are morevulnerable to developing psoriasis upon, for example, TLR7 ac-tivation and will produce excessive and sustained amounts of typeI IFNs. Moreover, Ueyama et al. (39) described how the effects ofIMQ are enhanced in the presence of IFN-a, leading to productionof IL-1b, IL-6, IL-23, inducible NO synthase/NO, and TNF. Al-though TNF can be inhibited by anti-TNF treatment, the afore-

FIGURE 4. Double genetic deficiency of TNFR1 and IFNAR1 enhances protection against IMQ-induced psoriasis-like skin lesions. DKO mice were

treated with IMQ for a maximum of 7 d and compared with TNFR1 KO, IFNAR1 KO, and wild-type mice. (A) Erythema and scaling were scored on days 4

and 7. Bars represent scores (0–4) (mean 6 SD; n = 8, 6, 6, and 8) (B) Splenomegaly after 7 d with control cream or IMQ treatment calculated as the ratio

of spleen weight to total body weight. (C and D) Epidermal hyperplasia was determined in H&E-stained skin sections. Images were analyzed with Volocity

and epidermis was quantified (n = 8, 6, 6, and 8). Scale bars, 100 mm. Representative images are displayed. Dark gray indicates IFNAR1 KO mice; light

gray indicates TNFR1 KO mice; white indicates DKO mice. *p , 0.05, **p , 0.01, ***p , 0.001, ****p . 0.0001.

6 DUAL TNFR1 AND IFNAR1 INHIBITION IN PSORIASIS

by guest on April 5, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

mentioned cytokines can lead to increased inflammation in thesepatients, especially when type I IFNs are already increased inthese patients. It is therefore recommended to evaluate whetherthese patients would benefit from anti-IFNAR1 treatment to avoidpsoriasis as a side effect. In human psoriatic lesions, a set of 57 geneswas identified that were typically associated with antiviral defenseand termed STAT1–57 and were repressed following treatmentwith biologics (48). These genes were enriched for ISRE sequencesand thus inducible by type I IFNs, but also by, for example, IFN-gand TNF. This implies that the interaction between TNFR1 andIFNAR1 is much more complex than anticipated, as it depends on thegenetic background, environment, and other parameters that con-tribute to the heterogeneity. Although we did not provide evidence forthis, TNFR1 and IFNAR1 signaling might come together at the levelof transcription factors, such as PI3K and STAT.In our study, we evaluated skin-specific markers to assess the

severity of psoriasiform lesions. Remarkably, when both IFNAR1and TNFR1 signaling are impaired, each marker follows one of thesingle KO phenotypes, except for S100a8, which is less induced inDKO mice compared with the single KO mice, indicating that itsinduction is dependent on both pathways. However, TNF and IL-17 have been reported to induce S100a8 synergistically (49, 50).Because IL-17F is reduced in both TNFR1 KO and IFNAR1 KOmice, this raises the question whether the reduced IL-17F levelsaffect the expression of S100a8 in DKO mice as well. Thisremains to be investigated in more depth.Van der Fits et al. (7) and many others have provided solid

evidence for a prominent role for the IL-23/IL-17 axis in psoriasis(35, 51, 52). Although the IL-17 cytokine family consists ofmultiple ligands, IL-17A is the most characterized ligand and isoften referred to as IL-17. However, many studies have revealedan important role for IL-17F as well, including a study performedby Pantelyushin et al. (35) where they reported more IL-17F–producing cells in IMQ-inflamed skin than IL-17A–secretingcells. Similarly, we observed no changes in IL-17A serum levelsduring IMQ treatment, whereas IL-17F increased significantly. Inboth single and DKO mice, IL-17F was less increased than inwild-type control mice. Although type I IFNs have been reportedin some models to inhibit IL-17A/F through the induction of IL-10or IL-27 (53, 54), we show in the present study reduced IL-17F inthe absence of IFNAR1 signaling. Similarly, TNFR1 deficiencyresulted in decreased IL-17F blood levels. There is, however, noadditive effect of both signaling pathways, as dual deletion of bothTNFR1 and IFNAR1 resulted in IL-17F levels in response to IMQtreatment comparable to those in IFNAR1 KO mice. Moreover,IL-12p40 levels were affected as well. IL-12p40 is a subunitshared by IL-12 and IL-23 and has recently been validated as

a therapeutic target for psoriasis (32–34). Although IL-12 and IL-23 are not strictly known as typical type I IFN–induced genes, thepresence of ISRE elements in the promoter regions for units p35,p40, and p19 have been described (55–59). It is remarkable thatthe p40 subunit was detected, but complete IL-12 or IL-23 was notfound in circulation. The subunits of IL-12 and IL-23 do not sharesimilar promoters, but are only formed when the respective sub-units are coexpressed in the same environment (60, 61). Thisshould allow the immune system to steer the immune response ina delicate and subtle way depending on the situation. However, therole of systemic IL-12p40 in psoriasis remains unclear.Our results demonstrate the complexity of the interactions of two

cytokines, TNF and type I IFNs, and their receptors, TNFR1 andIFNAR1, respectively, and their respective effects on other cyto-kines and antimicrobial proteins as depicted in a schematicoverview in Fig. 6. We show that they both mediate parts of theinflammatory pathogenesis of IMQ-induced psoriasiform skininflammation and that simultaneous inhibition of both pathways

FIGURE 5. Full induction of IL-12p40 and IL-17F is affected upon genetic deletion of TNFR1 and IFNAR1. Mice were treated with IMQ for 4

consecutive days and blood was isolated at days 0, 2, and 4. Luminex technology was used to measure (A) IL-12p40 and (B) IL-17F. Bars represent mean6SD (at least four mice per group). Black indicates wild-type mice; light gray indicates TNFR1 KO mice; dark gray indicates IFNAR1 KO mice; white

indicates DKO mice. *p , 0.05, **p , 0.01, ***p , 0.001, ****p . 0.0001.

FIGURE 6. Connections between TNFR1, IFNAR1, IL-12p40, and IL-

17F in the IMQ psoriasis mouse model. Topical application of IMQ leads to

production of various cytokines such as TNF and type I IFNs. TNF triggers

TNFR1, which will lead to production of antimicrobial proteins by kerati-

nocyte. Together with IFNAR1, TNF also promotes the production of IL-

17F, a known mediator in the pathogenesis of psoriasis. Possibly TNF and

IL-17F act together to stimulate the production of proteins such as S100A8

and neutrophil recruitment (question mark). Activation of IFNAR1 leads to

the production of IL-12p40 as well, a novel drug target in psoriasis.

The Journal of Immunology 7

by guest on April 5, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

ameliorates IMQ-induced skin inflammation. Although we havenot tested the hypothesis of dual inhibition in other psoriasismodels and we lack information from clinical studies, our resultsshow that it might be of interest to evaluate whether blocking bothTNFR1 and IFNAR1 in psoriasis patients may achieve clinicallysuperior results compared with TNF antagonists. Interestingly,therapeutic blocking tools for both IFNAR1 (62) and TNFR1 (63)are available.First, by simultaneously inhibiting both TNFR1 and IFNAR1,

one would prevent sustained type I IFN production during blockadeof the TNF/TNFR1 axis. Consequently, the paradoxical side effectsassociated with the current TNF antagonists, namely de novo in-duction of psoriasis, could possibly be resolved by additionallytargeting the IFNAR1 pathway. Second, TNFR1 and IFNAR1 havedifferent targets, promoting inflammation through different path-ways in psoriasis. As a result, dual inhibition results in additive andsynergistic reduction of psoriatic symptoms by silencing variouspathways. This is very interesting, because the complex biologyunderlying a disease is often multifactorial and requires a multi-faceted approach, which can be achieved by combination therapies.Blocking both TNFR1 and IFNAR1 reduces activation of the IL-23/IL-17 axis during IMQ-mediated skin inflammation throughreduction of IL-12p40 and IL-17F levels, two novel drug targets inpsoriasis, Crohn’s disease, and rheumatoid arthritis (34, 64–69).In conclusion, our findings warrant study of the potential stra-

tegic advantages of combined inhibition of the cytokine receptorsTNFR1 and IFNAR1 for the treatment of psoriasis.

AcknowledgmentsWe thank Joke Vanden Berghe for technical assistance and Amin Bredan

for manuscript editing.

DisclosuresThe authors have no financial conflicts of interest.

References1. Kurd, S. K., and J. M. Gelfand. 2009. The prevalence of previously diagnosed

and undiagnosed psoriasis in US adults: results from NHANES 2003–2004. J.Am. Acad. Dermatol. 60: 218–224.

2. Stern, R. S., T. Nijsten, S. R. Feldman, D. J. Margolis, and T. Rolstad. 2004.Psoriasis is common, carries a substantial burden even when not extensive, and isassociated with widespread treatment dissatisfaction. J. Investig. Dermatol.Symp. Proc. 9: 136–139.

3. Ackermann, L., I. T. Harvima, J. Pelkonen, V. Ritamaki-Salo, A. Naukkarinen,R. J. Harvima, and M. Horsmanheimo. 1999. Mast cells in psoriatic skin arestrongly positive for interferon-g. Br. J. Dermatol. 140: 624–633.

4. Chiricozzi, A., E. Guttman-Yassky, M. Suarez-Farinas, K. E. Nograles, S. Tian,I. Cardinale, S. Chimenti, and J. G. Krueger. 2011. Integrative responses to IL-17and TNF-a in human keratinocytes account for key inflammatory pathogeniccircuits in psoriasis. J. Invest. Dermatol. 131: 677–687.

5. Ettehadi, P., M. W. Greaves, D. Wallach, D. Aderka, and R. D. Camp. 1994.Elevated tumour necrosis factor-alpha (TNF-a) biological activity in psoriaticskin lesions. Clin. Exp. Immunol. 96: 146–151.

6. Johansen, C., A. T. Funding, K. Otkjaer, K. Kragballe, U. B. Jensen, M. Madsen,L. Binderup, T. Skak-Nielsen, M. S. Fjording, and L. Iversen. 2006. Proteinexpression of TNF-a in psoriatic skin is regulated at a posttranscriptional levelby MAPK-activated protein kinase 2. J. Immunol. 176: 1431–1438.

7. van der Fits, L., S. Mourits, J. S. Voerman, M. Kant, L. Boon, J. D. Laman,F. Cornelissen, A. M. Mus, E. Florencia, E. P. Prens, and E. Lubberts. 2009.Imiquimod-induced psoriasis-like skin inflammation in mice is mediated via theIL-23/IL-17 axis. J. Immunol. 182: 5836–5845.

8. Bradley, J. R. 2008. TNF-mediated inflammatory disease. J. Pathol. 214: 149–160.

9. Zaba, L. C., I. Cardinale, P. Gilleaudeau, M. Sullivan-Whalen, M. Suarez-Farinas, J. Fuentes-Duculan, I. Novitskaya, A. Khatcherian, M. J. Bluth,M. A. Lowes, and J. G. Krueger. 2007. Amelioration of epidermal hyperplasia byTNF inhibition is associated with reduced Th17 responses. J. Exp. Med. 204:3183–3194.

10. Lanternier, F., F. Tubach, P. Ravaud, D. Salmon, P. Dellamonica, S. Bretagne,M. Couret, B. Bouvard, M. Debandt, I. Gueit, et al; Research Axed on Toleranceof Biotherapies Group. 2013. Incidence and risk factors of Legionella pneu-

mophila pneumonia during anti-tumor necrosis factor therapy: a prospectiveFrench study. Chest 144: 990–998.

11. Pena-Sagredo, J. L., M. V. Hernandez, N. Fernandez-Llanio, E. Gimenez-Ubeda,S. Munoz-Fernandez, A. Ortiz, M. A. Gonzalez-Gay, and M. C. Farinas, Bio-badaser group. 2008. Listeria monocytogenes infection in patients with rheu-matic diseases on TNF-a antagonist therapy: the Spanish Study Groupexperience. Clin. Exp. Rheumatol. 26: 854–859.

12. Van Hauwermeiren, F., R. E. Vandenbroucke, and C. Libert. 2011. Treatment ofTNF mediated diseases by selective inhibition of soluble TNF or TNFR1. Cy-tokine Growth Factor Rev. 22: 311–319.

13. Banchereau, J., and V. Pascual. 2006. Type I interferon in systemic lupuserythematosus and other autoimmune diseases. Immunity 25: 383–392.

14. Ronnblom, L. 2011. The type I interferon system in the etiopathogenesis ofautoimmune diseases. Ups. J. Med. Sci. 116: 227–237.

15. Ronnblom, L., and M. L. Eloranta. 2013. The interferon signature in autoim-mune diseases. Curr. Opin. Rheumatol. 25: 248–253.

16. Bhardwaj, N., U. Santhanam, L. L. Lau, S. B. Tatter, J. Ghrayeb, M. Rivelis,R. M. Steinman, P. B. Sehgal, and L. T. May. 1989. IL-6/IFN-beta 2 in synovialeffusions of patients with rheumatoid arthritis and other arthritides. Identificationof several isoforms and studies of cellular sources. J. Immunol. 143: 2153–2159.

17. Gordon, R. A., G. Grigoriev, A. Lee, G. D. Kalliolias, and L. B. Ivashkiv. 2012.The interferon signature and STAT1 expression in rheumatoid arthritis synovialfluid macrophages are induced by tumor necrosis factor a and counter-regulatedby the synovial fluid microenvironment. Arthritis Rheum. 64: 3119–3128.

18. Nestle, F. O., C. Conrad, A. Tun-Kyi, B. Homey, M. Gombert, O. Boyman,G. Burg, Y. J. Liu, and M. Gilliet. 2005. Plasmacytoid predendritic cells initiatepsoriasis through interferon-a production. J. Exp. Med. 202: 135–143.

19. Schmid, P., P. Itin, D. Cox, G. K. McMaster, and M. A. Horisberger. 1994. Thetype I interferon system is locally activated in psoriatic lesions. J. Interferon Res.14: 229–234.

20. Afshar, M., A. D. Martinez, R. L. Gallo, and T. R. Hata. 2013. Induction andexacerbation of psoriasis with interferon-a therapy for hepatitis C: a review andanalysis of 36 cases. J. Eur. Acad. Dermatol. Venereol. 27: 771–778.

21. Citro, V., R. Fristachi, and G. Tarantino. 2007. Extensive psoriasis induced bypegylated interferon: a case report. J. Med. Case Reports 1: 86.

22. Downs, A. M., and M. G. Dunnill. 2000. Exacerbation of psoriasis by interferon-a therapy for hepatitis C. Clin. Exp. Dermatol. 25: 351–352.

23. Cantaert, T., D. Baeten, P. P. Tak, and L. G. van Baarsen. 2010. Type I IFN andTNFa cross-regulation in immune-mediated inflammatory disease: basic con-cepts and clinical relevance. Arthritis Res. Ther. 12: 219.

24. Dutz, J. P. 2007. Tumor necrosis factor-a inhibition and palmoplantar pustulosis:Janus-faced therapy? J. Rheumatol. 34: 247–249.

25. Ju, X., M. Zenke, D. N. Hart, and G. J. Clark. 2008. CD300a/c regulate type Iinterferon and TNF-a secretion by human plasmacytoid dendritic cells stimu-lated with TLR7 and TLR9 ligands. Blood 112: 1184–1194.

26. Palucka, A. K., J. P. Blanck, L. Bennett, V. Pascual, and J. Banchereau. 2005.Cross-regulation of TNF and IFN-a in autoimmune diseases. Proc. Natl. Acad.Sci. USA 102: 3372–3377.

27. Grine, L., L. Dejager, C. Libert, and R. E. Vandenbroucke. 2015. An inflam-matory triangle in psoriasis: TNF, type I IFNs and IL-17. Cytokine GrowthFactor Rev. 26: 25–33.

28. Craft, N., K. W. Bruhn, B. D. Nguyen, R. Prins, J. W. Lin, L. M. Liau, andJ. F. Miller. 2005. The TLR7 agonist imiquimod enhances the anti-melanomaeffects of a recombinant Listeria monocytogenes vaccine. J. Immunol. 175:1983–1990.

29. Walter, A., M. Schafer, V. Cecconi, C. Matter, M. Urosevic-Maiwald, B. Belloni,N. Schonewolf, R. Dummer, W. Bloch, S. Werner, et al. 2013. Aldara activatesTLR7-independent immune defence. Nat. Commun. 4: 1560.

30. Cubillas, R., K. Kintner, F. Phillips, N. J. Karandikar, D. L. Thiele, andG. R. Brown. 2010. Tumor necrosis factor receptor 1 expression is upregulated indendritic cells in patients with chronic HCV who respond to therapy. Hepat. Res.Treat. 2010: 429243.

31. Reuss, R., S. Pohle, K. Retzlaff, J. Hemberger, and P. Oschmann. 2009. Inter-feron b-1a induces tumor necrosis factor receptor 1 but decreases tumor necrosisfactor receptor 2 leukocyte mRNA levels in relapsing-remitting multiple scle-rosis. Neuroimmunomodulation 16: 171–176.

32. Clarke, A. W., L. Poulton, H. Y. Wai, S. A. Walker, S. D. Victor, T. Domagala,D. Mraovic, D. Butt, N. Shewmaker, P. Jennings, and A. G. Doyle. 2010. A novelclass of anti-IL-12p40 antibodies: potent neutralization via inhibition of IL-12-IL-12Rb2 and IL-23-IL-23R. MAbs 2: 539–549.

33. Kauffman, C. L., N. Aria, E. Toichi, T. S. McCormick, K. D. Cooper,A. B. Gottlieb, D. E. Everitt, B. Frederick, Y. Zhu, M. A. Graham, et al. 2004. Aphase I study evaluating the safety, pharmacokinetics, and clinical response ofa human IL-12 p40 antibody in subjects with plaque psoriasis. J. Invest. Der-matol. 123: 1037–1044.

34. Toichi, E., G. Torres, T. S. McCormick, T. Chang, M. A. Mascelli,C. L. Kauffman, N. Aria, A. B. Gottlieb, D. E. Everitt, B. Frederick, et al. 2006.An anti-IL-12p40 antibody down-regulates type 1 cytokines, chemokines, andIL-12/IL-23 in psoriasis. J. Immunol. 177: 4917–4926.

35. Pantelyushin, S., S. Haak, B. Ingold, P. Kulig, F. L. Heppner, A. A. Navarini, andB. Becher. 2012. Rorgt+ innate lymphocytes and gd T cells initiate psoriasiformplaque formation in mice. J. Clin. Invest. 122: 2252–2256.

36. Gilliet, M., C. Conrad, M. Geiges, A. Cozzio, W. Th€urlimann, G. Burg,F. O. Nestle, and R. Dummer. 2004. Psoriasis triggered by Toll-like receptor 7agonist imiquimod in the presence of dermal plasmacytoid dendritic cell pre-cursors. Arch. Dermatol. 140: 1490–1495.

8 DUAL TNFR1 AND IFNAR1 INHIBITION IN PSORIASIS

by guest on April 5, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

37. Rajan, N., and J. A. Langtry. 2006. Generalized exacerbation of psoriasis as-sociated with imiquimod cream treatment of superficial basal cell carcinomas.Clin. Exp. Dermatol. 31: 140–141.

38. Vinter, H., L. Iversen, T. Steiniche, K. Kragballe, and C. Johansen. 2015. Aldara-induced skin inflammation—studies of psoriasis patients. Br. J. Dermatol. 172:345–353.

39. Ueyama, A., M. Yamamoto, K. Tsujii, Y. Furue, C. Imura, M. Shichijo, andK. Yasui. 2014. Mechanism of pathogenesis of imiquimod-induced skin in-flammation in the mouse: a role for interferon-a in dendritic cell activation byimiquimod. J. Dermatol. 41: 135–143.

40. Flutter, B., and F. O. Nestle. 2013. TLRs to cytokines: mechanistic insights fromthe imiquimod mouse model of psoriasis. Eur. J. Immunol. 43: 3138–3146.

41. Kontermann, R. E., S. M€unkel, J. Neumeyer, D. M€uller, M. Branschadel,P. Scheurich, and K. Pfizenmaier. 2008. A humanized tumor necrosis factorreceptor 1 (TNFR1)-specific antagonistic antibody for selective inhibition oftumor necrosis factor (TNF) action. J. Immunother. 31: 225–234.

42. Williams, S. K., O. Maier, R. Fischer, R. Fairless, S. Hochmeister, A. Stojic,L. Pick, D. Haar, S. Musiol, M. K. Storch, et al. 2014. Antibody-mediated in-hibition of TNFR1 attenuates disease in a mouse model of multiple sclerosis.PLoS ONE 9: e90117. Available at: http://journals.plos.org/plosone/article?id510.1371/journal.pone.0090117.

43. Kristensen, M., C. Q. Chu, D. J. Eedy, M. Feldmann, F. M. Brennan, andS. M. Breathnach. 1993. Localization of tumour necrosis factor-alpha (TNF-a)and its receptors in normal and psoriatic skin: epidermal cells express the 55-kDbut not the 75-kD TNF receptor. Clin. Exp. Immunol. 94: 354–362.

44. Kumari, S., M. C. Bonnet, M. H. Ulvmar, K. Wolk, N. Karagianni, E. Witte,C. Uthoff-Hachenberg, J. C. Renauld, G. Kollias, R. Toftgard, et al. 2013. Tumornecrosis factor receptor signaling in keratinocytes triggers interleukin-24-dependent psoriasis-like skin inflammation in mice. Immunity 39: 899–911.

45. Bissonnette, R., K. Papp, C. Maari, Y. Yao, G. Robbie, W. I. White, C. Le, andB. White. 2010. A randomized, double-blind, placebo-controlled, phase I studyof MEDI-545, an anti-interferon-alfa monoclonal antibody, in subjects withchronic psoriasis. J. Am. Acad. Dermatol. 62: 427–436.

46. Iborra, M., B. Beltran, G. Bastida, M. Aguas, and P. Nos. 2011. Infliximab andadalimumab-induced psoriasis in Crohn’s disease: a paradoxical side effect. J.Crohn’s Colitis 5: 157–161.

47. van Baarsen, L. G., C. A. Wijbrandts, F. Rustenburg, T. Cantaert, T. C. van derPouw Kraan, D. L. Baeten, B. A. Dijkmans, P. P. Tak, and C. L. Verweij. 2010.Regulation of IFN response gene activity during infliximab treatment in rheu-matoid arthritis is associated with clinical response to treatment. Arthritis Res.Ther. 12: R11.

48. Swindell, W. R., A. Johnston, X. Xing, J. J. Voorhees, J. T. Elder, andJ. E. Gudjonsson. 2013. Modulation of epidermal transcription circuits in pso-riasis: new links between inflammation and hyperproliferation. PLoS ONE 8:e79253. Available at: http://journals.plos.org/plosone/article?id510.1371/journal.pone.0079253.

49. Koenders, M. I., R. J. Marijnissen, I. Devesa, E. Lubberts, L. A. Joosten, J. Roth,P. L. van Lent, F. A. van de Loo, and W. B. van den Berg. 2011. Tumor necrosisfactor-interleukin-17 interplay induces S100A8, interleukin-1b, and matrixmetalloproteinases, and drives irreversible cartilage destruction in murine ar-thritis: rationale for combination treatment during arthritis. Arthritis Rheum. 63:2329–2339.

50. Mose, M., Z. Kang, L. Raaby, L. Iversen, and C. Johansen. 2013. TNFa- and IL-17A-mediated S100A8 expression is regulated by p38 MAPK. Exp. Dermatol.22: 476–481.

51. Wohn, C., J. L. Ober-Blobaum, S. Haak, S. Pantelyushin, C. Cheong,S. P. Zahner, S. Onderwater, M. Kant, H. Weighardt, B. Holzmann, et al. 2013.Langerinneg conventional dendritic cells produce IL-23 to drive psoriatic plaqueformation in mice. Proc. Natl. Acad. Sci. USA 110: 10723–10728.

52. Yoshiki, R., K. Kabashima, T. Honda, S. Nakamizo, Y. Sawada, K. Sugita,H. Yoshioka, S. Ohmori, B. Malissen, Y. Tokura, and M. Nakamura. 2014. IL-23from Langerhans cells is required for the development of imiquimod-inducedpsoriasis-like dermatitis by induction of IL-17A-producing gd T cells. J. Invest.Dermatol. 134: 1912–1921.

53. Sweeney, C. M., R. Lonergan, S. A. Basdeo, K. Kinsella, L. S. Dungan,S. C. Higgins, P. J. Kelly, L. Costelloe, N. Tubridy, K. H. Mills, and

J. M. Fletcher. 2011. IL-27 mediates the response to IFN-b therapy in multiplesclerosis patients by inhibiting Th17 cells. Brain Behav. Immun. 25: 1170–1181.

54. Zhang, L., S. Yuan, G. Cheng, and B. Guo. 2011. Type I IFN promotes IL-10production from T cells to suppress Th17 cells and Th17-associated autoimmuneinflammation. PLoS ONE 6: e28432. Available at: http://journals.plos.org/plosone/article?id510.1371/journal.pone.0028432.

55. Goriely, S., C. Molle, M. Nguyen, V. Albarani, N. O. Haddou, R. Lin, D. De Wit,V. Flamand, F. Willems, and M. Goldman. 2006. Interferon regulatory factor 3 isinvolved in Toll-like receptor 4 (TLR4)- and TLR3-induced IL-12p35 geneactivation. Blood 107: 1078–1084.

56. Maruyama, S., K. Sumita, H. Shen, M. Kanoh, X. Xu, M. Sato, M. Matsumoto,H. Shinomiya, and Y. Asano. 2003. Identification of IFN regulatory factor-1binding site in IL-12 p40 gene promoter. J. Immunol. 170: 997–1001.

57. Masumi, A., S. Tamaoki, I. M. Wang, K. Ozato, and K. Komuro. 2002. IRF-8/ICSBP and IRF-1 cooperatively stimulate mouse IL-12 promoter activity inmacrophages. FEBS Lett. 531: 348–353.

58. Sheikh, S. Z., T. Kobayashi, K. Matsuoka, J. C. Onyiah, and S. E. Plevy. 2011.Characterization of an interferon-stimulated response element (ISRE) in theIl23a promoter. J. Biol. Chem. 286: 1174–1180.

59. Zhao, X., E. J. Ross, Y. Wang, and B. H. Horwitz. 2012. Nfkb1 inhibits LPS-induced IFN-b and IL-12 p40 production in macrophages by distinct mecha-nisms. PLoS ONE 7: e32811. Available at: http://journals.plos.org/plosone/article?id510.1371/journal.pone.0032811.

60. Choi, I.-K., Y. Li, E. Oh, J. Kim, and C.-O. Yun. 2013. Oncolytic adenovirusexpressing IL-23 and p35 elicits IFN-g- and TNF-a-co-producing T cell-mediated antitumor immunity. PLoS ONE 8: e67512. Available at: http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0067512.

61. Smith, S., J. N. Gabhann, R. Higgs, K. Stacey, M. Wahren-Herlenius,A. Espinosa, M. G. Totaro, A. Sica, E. Ball, A. Bell, et al. 2012. Enhanced in-terferon regulatory factor 3 binding to the interleukin-23p19 promoter correlateswith enhanced interleukin-23 expression in systemic lupus erythematosus.Arthritis Rheum. 64: 1601–1609.

62. Dejager, L., S. Vandevyver, M. Ballegeer, E. Van Wonterghem, L. L. An,J. Riggs, R. Kolbeck, and C. Libert. 2014. Pharmacological inhibition of type Iinterferon signaling protects mice against lethal sepsis. J. Infect. Dis. 209: 960–970.

63. Steeland, S., L. Puimege, R. E. Vandenbroucke, F. Van Hauwermeiren,J. Haustraete, N. Devoogdt, P. Hulpiau, G. Leroux-Roels, D. Laukens,P. Meuleman, et al. 2015. Generation and characterization of small single do-main antibodies inhibiting human tumor necrosis factor receptor 1. J. Biol.Chem. 290: 4022–4037.

64. Fujishima, S., H. Watanabe, M. Kawaguchi, T. Suzuki, S. Matsukura, T. Homma,B. G. Howell, N. Hizawa, T. Mitsuya, S. K. Huang, and M. Iijima. 2010. In-volvement of IL-17F via the induction of IL-6 in psoriasis. Arch. Dermatol. Res.302: 499–505.

65. Fuss, I. J., C. Becker, Z. Yang, C. Groden, R. L. Hornung, F. Heller,M. F. Neurath, W. Strober, and P. J. Mannon. 2006. Both IL-12p70 and IL-23 aresynthesized during active Crohn’s disease and are down-regulated by treatmentwith anti-IL-12 p40 monoclonal antibody. Inflamm. Bowel Dis. 12: 9–15.

66. Hot, A., and P. Miossec. 2011. Effects of interleukin (IL)-17A and IL-17F inhuman rheumatoid arthritis synoviocytes. Ann. Rheum. Dis. 70: 727–732.

67. Paradowska-Gorycka, A., E. Wojtecka-Lukasik, J. Trefler, B. Wojciechowska,J. K. Lacki, and S. Maslinski. 2010. Association between IL-17F gene poly-morphisms and susceptibility to and severity of rheumatoid arthritis (RA).Scand. J. Immunol. 72: 134–141.

68. Seiderer, J., I. Elben, J. Diegelmann, J. Glas, J. Stallhofer, C. Tillack, S. Pfennig,M. J€urgens, S. Schmechel, A. Konrad, et al. 2008. Role of the novel Th17 cy-tokine IL-17F in inflammatory bowel disease (IBD): upregulated colonic IL-17Fexpression in active Crohn’s disease and analysis of the IL17F p.His161Argpolymorphism in IBD. Inflamm. Bowel Dis. 14: 437–445.

69. Wedebye Schmidt, E. G., H. L. Larsen, N. N. Kristensen, S. S. Poulsen,A. M. Lynge Pedersen, M. H. Claesson, and A. E. Pedersen. 2013. TH17 cellinduction and effects of IL-17A and IL-17F blockade in experimental colitis.Inflamm. Bowel Dis. 19: 1567–1576.

The Journal of Immunology 9

by guest on April 5, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from