inducible nitric oxide synthase in retinal ischemia-reperfusion injury

Exp. Eye Res. (1996) 63, 501–509

Inducible Nitric Oxide Synthase in Retinal Ischemia-reperfusion

Injury

MASANORI HANGAI, NAGAHISA YOSHIMURA*a, KANO HIROI, MICHIKO MANDAI

YOSHIHITO HONDA

Department of Ophthalmology and Visual Science, Kyoto University Graduate School of Medicine,

Kyoto 606, and a Department of Ophthalmology, Shinshu University School of Medicine,

Matsumoto 390, Japan

(Received Cleveland 12 September 1995 and accepted in revised form 19 January 1996)

The purpose of this study was to determine whether inducible nitric oxide synthase (iNOS) was implicatedin the pathogenesis of retinal ischemia-reperfusion injury. Semi-quantitative reverse transcription-polymerase chain reaction showed that the level of iNOS mRNA expression was markedly increased inrat retina following transient ischemia, with peak expression at 12 hr after reperfusion (15±7-foldincrease over pre-ischemic levels). In situ hybridization showed that iNOS mRNA was expressed byresident retinal cells, most likely glial cells in the innermost retina, and also by the neutrophils that hadinfiltrated the retina. Intraperitoneal administration of NG-(1-iminoethyl)--ornithine (-NIO), aninhibitor of iNOS, significantly increased the rate of b-wave recovery compared to that of control animals.The values (mean³...) were 55±0³4±4% versus 40±1³5±1% (P!0±05) at 1 day and 68±6³6±6%versus 45±8³3±5% (P!0±05) at 3 days. This study shows that iNOS mRNA is highly expressed by non-neuronal cells of the inner retina during reperfusion following transient retinal ischemia. It also showsthat -NIO treatment provides some protection against ischemia-reperfusion injury. We suggest thatnitric oxide produced by iNOS may mediate retinal ischemia-reperfusion injury.

# 1996 Academic Press LimitedKey words : inducible nitric oxide synthase; ischemia-reperfusion; retina; neutrophils ; retinal glial

cells ; NG-(1-iminoethyl)--ornithine ; reverse transcription-polymerase chain reaction; in situ hybrid-ization.

1. Introduction

Nitric oxide (NO) is an important messenger when

present at low physiological concentrations. However,

at high concentrations NO mediates tissue damage

due to its cytotoxicity (Moncada, Palmer and Higgs,

1991). NO is synthesized by three isoforms of NO

synthase (NOS). Neuronal and endothelial isoforms,

termed constitutive NOS (cNOS), share the same en-

zymatic character ; they are constitutively expressed,

are regulated by intracellular calcium, and release

NO for a short period. In contrast, a third isoform of

NOS (termed inducible NOS, iNOS) is induced at the

transcriptional level by macrophages, neutrophils and

a number of other cells in response to inflammatory

stimuli such as lipopolysaccharide and cytokines.

Once expressed, iNOS tonically synthesizes high levels

of NO, independent of intracellular calcium. Recently,

there is increasing evidence to suggest that iNOS is

implicated in the pathogenic process of various

diseases, including cerebral ischemic injury (Kilbourn

et al., 1990; Kroncke et al., 1991; Corbett et al.,

1992; Mulligan, Moncada and Ward, 1992; Iadecola

et al. 1995a, b).

* For correspondence at : Department of Ophthalmology, ShinshuUniversity School of Medicine, Matsumoto 390, Japan.

Inflammatory reactions occur in the retina fol-

lowing transient ischemia (Szabo et al., 1991a, b), and

we previously showed that mRNA for interleukin-1, a

proinflammatory cytokine that can induce iNOS, was

upregulated in rat retina following transient ischemia

(Hangai et al., 1995). It is thus possible that iNOS is

induced in the retina following transient ischemia,

and that it subsequently participates in the patho-

genesis of retinal ischemia-reperfusion injury. The first

objective of this study was to determine whether iNOS

is induced in retina following transient ischemia; the

second objective was to determine whether such

putative iNOS mediates retinal ischemia-reperfusion

injury. To answer these questions, mRNA expression

for iNOS in rat retina was examined following

transient ischemia by semi-quantitative reverse trans-

cription-polymerase chain reaction (RT-PCR) and in

situ hybridization histochemistry. The effects of NG-(1-

iminoethyl)--ornithine (-NIO), which is known to

inhibit iNOS (McCall et al., 1991) were also examined,

on the changes in b-wave of the electroretinogram.

2. Materials and Methods

Animals

All animal studies were conducted in compliance

with the ARVO Statement for the Use of Animals in

0014-4835}96}11050109 $25.00}0 # 1996 Academic Press Limited

502 M. HANGAI ET AL.

Ophthalmic and Vision Research. Seventy-seven adult

male Sprague-Dawley rats weighing 250 to 300 g

were used for polymerase chain reaction (PCR)

experiments, and six were used for in situ hybridization

experiments ; 17 rats weighing 250 g were used for

the electroretinogram (ERG) experiments.

Animal Surgery

Rats were anesthetized by intramuscular injections

of ketamine-HCl (70 mg kg−") and xylazine

(10 mg kg−"). The pupils were dilated with the

instillation of 1% atropine sulfate and 0±5% phenyl-

ephrine. After a lateral conjunctival peritomy and

disinsertion of the lateral rectus muscle, the optic

nerve of the right eye was exposed by blunt dissection.

Retinal ischemia and reperfusion were produced in 41

rats according to the technique described previously,

with slight modification (Stefansson et al., 1988). In

brief, a 6–0 nylon suture was passed behind the optic

nerve and tightened until blood flow ceased in all of

the retinal vessels. Complete nonperfusion was con-

firmed through an operating microscope. Reperfusion

was induced by releasing the suture, and was

confirmed by observation through the operating

microscope. Eyes that failed to reperfuse within 5 min

were excluded from the experiment. Sham-operated

control rats underwent similar surgery but without

tightening of the suture. Rats were sacrificed at 0,

0±25, 0±5, 1, 3, 6, 12, 24, 48, 96, and 168 hr after

reperfusion (n¯3–5, at each time).

Retinal ischemia was also produced in nine rats by

elevating the intraocular pressure. The anterior

chamber was cannulated with a 27 gauge infusion

needle connected to a saline container, which was

elevated to produce an intraocular pressure of

140 mmHg for 2 hr. Optic nerve injury was produced

in 9 rats by ligating the optic nerve intraorbitally for

30 sec. It was also produced in nine rats by crushing

the optic nerve intraorbitally between fine forceps for

30 sec at 0±5 mm from the eye. The latter procedure

produced transient retinal ischemia for 2–5 min. Optic

nerve transection was performed intraorbitally in nine

rats at 0±5 mm from the eye, but care was taken not

to produce retinal ischemia. The rats that suffered

pressure-induced ischemia or the optic nerve damages

were killed at 3, 12 and 24 hr (n¯3 at each time)

after reperfusion.

Reverse Transcription-Polymerase Chain Reaction (RT-

PCR)

For cDNA synthesis total RNA was isolated by the

acid guanidinium thiocyanate-phenol chloroform

(AGPC) extraction method (Chomczynski and Sacchi,

1987). The first strand cDNA was synthesized as

described previously (Hangai et al., 1995). Briefly,

before cDNA synthesis the total RNA was treated by

RNase-free DNase (Promega, Madison, WI, U.S.A.).

The first strand cDNA was synthesized from 5 µg

RNA, and then amplified by a step cycle (95°C, 30 sec;

55°C, 30 sec; 72°C, 60 sec) for 25 or 35 cycles (β-

actin, 25 cycles ; iNOS, 35 cycles) (Saiki et al., 1988).

The primers used in this experiment were CGCTACA-

CTTCCAACGCAAC (sense) and AGGAAGTAGGTGAG-

GGCTTG (antisense) for iNOS (Wood et al., 1993), and

AGCTGAGAGGGAAATCGTGC (sense) and ACCAGA-

CAGCACTGTGTTGG (antisense) for β-actin (Nudel et

al., 1983).

To examine ligation-induced retinal ischemia, the

same RNA preparations were used as in the previous

study (Hangai et al., 1995). The RNAs were freshly

isolated to examine the other animal models used in

this study.

Sequencing of the PCR Products

PCR products were separated by 2% agarose gel

electrophoresis and bands of the expected size (407 bp

for iNOS and 295 bp for β-actin) were extracted. The

extracted DNA was subcloned into the pBluescript II

vector (Stratagene, La Jolla, CA, U.S.A.). Before

subcloning, the vector was treated with Eco RV and

the T-vectors were made by Taq polymerase and

deoxythymidine triphosphate (Marchuk et al., 1991).

Nucleotide sequencing of the subcloned DNA was

carried out by the dideoxynucleotide chain termin-

ation method using a Sequenase ver. 2.0 DNA

sequencing kit (United States Biochemicals, Cleveland,

OH, U.S.A.) (Sanger, Nicklen and Coulson et al.,

1977). Double strand template DNAs were denatured

by alkaline treatment and the sequencing reaction

was initiated by adding T3 and}or T7 primer.

Semi-quantitation of Levels of iNOS mRNA by RT-PCR

Semi-quantitative RT-PCR was carried out on the

cDNA from the rats that suffered ligation-induced

retinal ischemia. This procedure was performed as

previously described (Hangai et al., 1995). Briefly,

2 µCi of radiolabeled dCTP was added to the PCR

mixture. The PCR products were then electrophoresed

in a 2% agarose gel and stained with ethidium

bromide. The bands were then excised and the

radioactivity incorporated into the DNA was measured

by Cerenkov scintillation counting. A standard curve

was drawn from the radioactivity measured in serial

dilutions of the template cDNA; this standard curve

was used to calculate the relative quantity of the

expressed genes in each cDNA. First, the cDNA

concentration was normalized by the relative quantity

of β-actin gene expression determined by PCR with the

specific primers. Similar experiments were carried out

using specific primers for iNOS in order to quantify

their relative expression over the time course of

reperfusion after ischemia. The mean of the results

from three sham-operated control rats was used as the

INDUCIBLE NOS IN RETINAL ISCHEMIA 503

control level, and the level of each gene expression

was calculated as a ratio to this control.

Preparation of cRNA Probe

iNOS cDNA was generated by PCR amplification

using specific primers : nucleotides 2207–3418

(1212 bp) of rat iNOS (Wood et al., 1993). This

fragment was subcloned and sequenced to ascertain

that it was indeed derived from the target genes. cRNA

probe labeled with α-$&S-UTP ("1000 Ci mmol−" ;

Amersham Japan, Tokyo, Japan) was generated by

transcription of linearized plasmid DNAs by using the

Riboprobe Gemini II Core System and T3 RNA

polymerase (Promega). Partial alkaline hydrolysis

was carried out at 60°C to yield approximately

100–150 bp. The radiolabeled probe was diluted with

hybridization buffer to approximately 2¬10( cpm

ml−". Specific activity of the probe was approximately

1±1¬10* cpm mg−".

In Situ Hybridization

At 12 hr after cessation of 2 hr ischemia, the rats

were deeply anesthetized and perfused with

phosphate-buffered 4% paraformaldehyde at 4°C, after

which the eyes were enucleated and postfixed over-

night in the same fixative. Following fixation, the eyes

were dehydrated in a graded alcohol series and

embedded in paraffin. The sagittal sections of 5 µm

thickness were deparaffinized, rehydrated, treated with

glycine (2 mg ml−"), and then acetylated in freshly

prepared 0±25% acetic anhydride in 100 m tri-

ethanolamine. After dehydration, the slides were pre-

hybridized at 50°C for 1 hr in the following buffer :

4¬SSC, 50% formamide, 5¬Denhardt solution,

10 m ethylenediaminetetraacetic acid (EDTA),

33 µg ml−" polyadenylic acid, 250 µg ml−" yeast

tRNA, 20 m dithiothreitol (DTT), and 500 µg ml−"

heat-denatured salmon sperm DNA. In the case of

hybridization, 10% dextran sulfate was added to the

above described buffer. The slides were hybridized for

18 hr in the hybridization buffer, washed four times in

2¬SSC containing 10 m DTT at 50°C, incubated

with RNase A (50 µg ml−" in 0±5 NaCl, 10 m Tris,

1 m EDTA, pH 8±0) for 30 min at 37°C, and then

washed twice in 50% formamide, 2¬SSC, and 10 m

DTT for 30 min. They were then dehydrated, dried,

and dipped in Kodak NTB3 emulsion (Rochester, NY,

U.S.A.) (diluted 1:1 with water). After 4 weeks

exposure, they were developed and counterstained

with cresylviolet.

L-NIO Treatment of Rats Following Induced Ischemia

-NIO was a generous gift from Dr Thom W. Mittag

(Mount Sinai School of Medicine, New York, NY,

U.S.A.). -NIO (2±5 mg ml−") was prepared in saline.

Ischemia was produced for 1 hr in 17 rats by ligating

the optic nerve. Nine rats received intraperitoneal

administration of -NIO (5 mg kg−") four times, once

every 6 hr, beginning 2 hr after reperfusion (total

dose, 20 mg kg−"). The other rats, which served as

controls, received the same volume of saline adminis-

tered according to the same schedule.

Effects of L-NIO on ERG b-Wave Recovery

Before, and at 1 and 3 days after ischemia, flash

ERGs were recorded from both eyes using a photo-

stimulator lamp placed in front of each eye with

maximum light intensity (the intensity was 3500 Lx

on the surface of the cornea). After dark adaptation for

at least 60 min, a carbon electrode (NEC San-ei,

Tokyo, Japan) was placed on the cornea and stainless

steel needle electrodes (NEC San-ei) placed under the

skin of the nose and the tail, which served as a

reference and ground, respectively. The responses

were amplified with a time constant of 0±3 sec and a

high pass filter of 1000 Hz (Biological Amplifier 1243,

Nihon Kohden, Tokyo, Japan) and were averaged of

four trials (QC-111J, Nihon, Kohden).

Each b-wave amplitude was estimated as percent

recovery compared to the preischemic level, which

was corrected by the ratio of amplitude change in the

nonischemic fellow eye, as shown in the following

equation:

Recovery (%)¯100¬(iA}iApre

)}(niA}niApre

)

where iApre

and niApre

are the preischemic amplitude

of the ischemic eye and the opposite, nonischemic

eye, respectively, and iA and niA are the postischemic

amplitude of the ischemic eye and the nonischemic

fellow eye, respectively. This calculation was per-

formed to eliminate individual and daily variations

(Spivey and Pearlman, 1953; Lawwill, 1972; Stein-

horst et al., 1993).

Light Microscopic Examination

The eyes used in ERG experiments were also

examined by light microscopy. At 7 days after

reperfusion, the rats were killed and the eyes enu-

cleated. Immediately after enucleation the eyes were

cut open, fixed in 1±5% formaldehyde and 1% glutar-

aldehyde in phosphate buffer, dehydrated through

ethanol and xylene, and embedded in paraffin. Sagittal

sections, 5 µm-thick, through the optic nerve were

obtained and stained with hematoxylin and eosin.

3. Results

Specific Amplification of iNOS mRNA by RT-PCR

Reverse transcription-polymerase chain reaction

(RT-PCR) analysis was carried out at each time point

using specific primers for iNOS. Control amplification

with primers for β-actin was also performed at the


F. 1. Specific amplification of iNOS mRNA by RT-PCR.First strand cDNAs used in this experiment were fromnormal retina (for β-actin) and from retina at 12 hr aftertransient ischemia (for iNOS). For PCR amplification, 35cycles were used for iNOS and 25 cycles for β-actin. EachDNA was confirmed to be derived from the target cDNAsequences by nucleotide sequencing. An ethidium bromidestained agarose gel (2%) is shown. φX174 HaeIII fragmentswere used as size markers.

same time. Amplification using these primers gave

bands of the expected sizes (iNOS, 407 bp; β-actin,

295 bp) (Fig. 1). By nucleotide sequencing of the PCR

products, the amplified DNAs were confirmed to be

derived from the target cDNAs (graphic data not

shown).

Specific Induction of iNOS mRNA to Retinal Ischemia-

reperfusion

To confirm that this induction of iNOS mRNA was

due to ischemia-reperfusion and not to damage of the

optic nerve, we compared mRNA expression for iNOS

by RT-PCR among rat models of ligation-induced

ischemia, pressure-induced ischemia and optic nerve

damages (Fig. 2). Pressure-induced ischemia greatly

F. 2. Upregulation of iNOS mRNA expression by retinalischemia reperfusion. Shown is a representative electro-phoresis pattern of PCR products from three samples at eachtime. PCR amplification was carried out using specificprimers for iNOS (35 cycles). The figures indicate the timeafter reperfusion (hr). LI, ligation-induced ischemia; PI,pressure-induced ischemia; LOD, ligation-induced opticnerve damage; FOD, optic nerve damage produced byforceps ; OT, optic nerve transection; M, marker (φX174HaeIII fragments).

168

2000

0N

Time after reperfusion (hr)

% o

f co

ntr

ol

0.5

1000

1800

1600

1200

1400

800

600

400

200

0 0.25 1 3 6 9612 24 48

*

Time after reperfusion (hr)

168N 1/20 1/4 1 3 6 9612 24 48

β-actin

iNOS

(B)

(A)

F. 3. Quantitative RT-PCR analysis of the levels of iNOSmRNA expression in rat retina following 2 hr ischemia.Levels of iNOS mRNA expression were evaluated by a semi-quantitative RT-PCR method, as described in Materials andMethods. β-actin was used as a control. The values indicatedare means³... of 3–5 animals at each time point. *P!0±0001 versus pre-ischemic level (ANOVA) followed byScheffe test). (C) Representative electrophoresis pattern ofPCR products for iNOS mRNA. N, retina from non-operatedrats.

upregulated expression for iNOS mRNA similar to with

ligation-induced ischemia. This was not detected at

3 hr after reperfusion, but increased markedly at 12


F. 4. Localization by in situ hybridization of iNOS mRNA in rat retina following 2 hr in ischemia. (A) Low power dark-fieldautoradiographs showing silver grains in a row at the innermost retina and some scattered grains over the inner plexiform layer(IPL) in the sections from rats sacrificed 12 hr after cessation of ischemia. (B) No hybridization was observed when a sense probewas used. (C), (D), (E) High power bright-field view of the same sections as (A) showing silver grains over non-neuronal cells(arrows) interior to ganglion cells (arrowheads) (C, D) and neutrophils (double arrowheads) in the IPL and vitreous (V), (C, E).The asterisk indicates a retinal blood vessel. INL, inner nuclear layer. Cresylviolet stain. Bar, 10 µm (A, B) ; 100 µm (C, D, E).


T I

Recovery rate of b-wave amplitude of ischemic eyes

Recovery rate (%)

Time (days) -NIO Control P

1 55±0³4±4 40±1³5±1 !0±053 68±6³6±6 45±8³3±5 !0±05

The values indicated are means³...

and 24 hr. In contrast, iNOS mRNA was not detected

by RT-PCR at any time in retinas following the optic

nerve injuries or optic nerve transection.

Time Course of iNOS mRNA Expression Following

Transient Retinal Ischemia

In order to monitor levels of iNOS mRNA expression,

a semi-quantitative PCR procedure was carried out

(Fig. 3) ; β-actin, which is expressed constitutively,

was used as an internal control. iNOS mRNA

expression showed no obvious changes before 6 hr,

but then rapidly increased after 12 hr (15±7-fold,

P!0±0001 vs. preischemic level, ANOVA followed by

Scheffe test). This upregulation of iNOS mRNA was

transient, as the expression declined to baseline levels

at 48 hr.

Localization of iNOS mRNA

iNOS mRNA was localized using in situ hybridi-

zation with specific riboprobes prepared from the target

GCL

(A)ILM

OPL

INL

IPL

ONL

(B) (C)

F. 5. Light micrographs of posterior rat retina. Thinning of the inner retina was observed equivalently throughout all retinalareas in both saline-treated and -NIO-treated retinas, but no apparent difference was detected between them anywhere. Shownare representative photographs taken in the region 0±5–1 mm from the optic disc. (A) Normal, uninjected retina. ILM, innerlimiting membrane; GCL, ganglion cell layer ; IPL, inner plexiform layer ; INL, inner nuclear layer ; OPL, outer plexiform layer ;ONL, outer nuclear layer. (B) Saline-treated retina 7 days after reperfusion. Note severe retinal ganglion cell (RGC) loss andatrophy of the NFL. (C) NIO-treated retina 7 days after reperfusion. Note that the RGC and NFL appear better preserved.Hematoxylin and eosin stain. Bar, 25 µm.

sequences. No iNOS mRNA expression was detected in

normal retinas, but at 12 hr after reperfusion of the

ischemic rats, iNOS mRNA was expressed predom-

inantly in the innermost retina: that is, the ganglion

cell layer (GCL) or the nerve fiber layer (NFL) [Fig.

4(A)]. In addition, occasional signals were seen in the

inner plexiform layer (IPL). There were no signals in

the inner nuclear layer (INL), the outer nuclear layer

(ONL), or the pigmented epithelium. No hybridization

was observed in parallel experiments when a sense

probe for iNOS mRNA was used [Fig. 4(B)]. High-

power bright field examination showed that at least

two types of cells expressed iNOS mRNA [Fig. 4(C)–(E)].

One type appeared to reside in the nerve fiber layer

(NFL), as they were located in a row interior to the

ganglion cells [Fig. 4(A) and (C)], although the NFL

was thinned at this time by the ischemic insult. These

cells were also densely stained by cresylviolet, and

some of them showed spindle-shaped nuclei [Fig.

4(C)]. Other types of cells had segmented or poly-

morphous nuclei and were scattered in the IPL, the

GCL and the vitreous (Fig. 4(D) and (E)].

Effects of L-NIO on the Rate of ERG b-Wave Recovery

To determine whether iNOS induction mediates

retinal ischemia-reperfusion injury, the effects of -

NIO treatment on the rate of b-wave recovery were

examined (Table I). The rate of the b-wave recovery

(mean³SEM) was 40±1³5±1% and 45±8³3±5% of

the pre-ischemic level at 24 and 72 hr, respectively, in

the control (n¯8). In -NIO treated rats, the b-wave

amplitude was 55±0³4±4% and 68±6³6±6% at 24


and 72 hr, respectively (n¯9). This effect of -NIO

was statistically significant (P!0±05; ANOVA fol-

lowed by Scheffe test). Administration of -NIO

according to the protocol did not alter the ERG of the

fellow, nonischemic eyes.

Light Microscopic Study

To confirm the detrimental effects of iNOS induction,

light microscopy was used to examine the effect of

-NIO treatment on the histology. At 7 days after

reperfusion, thinning of the inner retina was observed

equivalently throughout all retinal areas in both

saline-treated and -NIO-treated rats. This change was

identical in the two groups throughout the entire

retina, although there was a trend that retinal

ganglion cells and the NFL were better preserved in

-NIO-treated retinas than in retinas of saline-treated

rats (Fig. 5). No remarkable changes were seen in the

outer retina of ischemic retinas of either group. No

prominent changes were observed in -NIO-treated

fellow non-ischemic eyes.

4. Discussion

This study in rats shows that iNOS mRNA is highly

expressed by non-neuronal cells of the inner retina

during reperfusion following transient retinal

ischemia. Semi-quantitative RT-PCR showed that

iNOS mRNA was transiently induced, with peak

expression at 12 hr after reperfusion (Fig. 3). This

induction of iNOS mRNA appeared to be specifically

due to ischemia-reperfusion, and was not related to

damage to the optic nerve, as it also occurred in the

eyes in which ischemia-reperfusion was produced by

elevating intraocular pressure and because it was not

detected by RT-PCR in rat retina following optic nerve

injuries or transection (Fig. 2). In situ hybridization

revealed that the iNOS mRNA was localized in the

inner retina: the GCL, NFL, IPL and the vitreous

(Fig. 4).

At least two types of cells within the inner retina

appeared to express the iNOS mRNA (Fig. 4). One

appeared to be resident retinal cells, which were

located in a row interior to the ganglion cells and

whose nuclei appeared to be smaller and more densely

stained by cresylviolet than those of the ganglion cells

[Fig. 4(A) and (C)]. Some of these cells had spindle-

shaped nuclei. From the location and morphology, we

suggest that these cells are astrocytes (Schnitzer,

1988), although microglial cells cannot be ruled out.

iNOS has been shown to be expressed by retinal glial

cells, such as Mueller cells and astrocytes in response

to lipopolysaccharide, cytokines and infection

(Dighiero et al., 1994; Goureau et al., 1994). The

other type of cells were randomly scattered in the IPL,

the GCL and the vitreous cavity [Fig. 4(D) and (E)] and

had segmented or polymorphous nuclei. It was

reported that cells infiltrating the retina during the

first 24 hr are neutrophils (Szabo et al., 1991a, b;

Hangai et al., 1995). Therefore, we suggest that cells

seen in this study are neutrophils recruited into the

ischemic retina. It has been reported that retinal

pigment epithelial cells (RPE) in culture can also

express iNOS in response to cytokines and activated T

cells (Goureau et al., 1993; Liversidge et al., 1994),

but we could not detect iNOS mRNA in RPE in this

study.

Expression of iNOS mRNA was relatively delayed

during reperfusion; it was not detected before 6 hr

after the end of ischemia (Fig. 3). We previously

showed that interleukin-1 (IL-1) mRNA expression

was upregulated during reperfusion in this same

model (Hangai et al., 1995). According to the results

of semi-quantitative RT-PCR in that study, induction

of iNOS mRNA was preceded by that of IL-1 mRNA.

Because IL-1 is one of the cytokines that can induce

iNOS (Moncada, Palmer and Higgs, 1991), it may

mediate iNOS induction in the retina following

transient ischemia. In addition, the in situ hybrid-

ization experiments showed cellular localization of

iNOS mRNA to be similar to that of IL-1β mRNA

(Hangai et al., 1995), although iNOS mRNA was not

detected in endothelial cells (Fig. 4). This temporal and

spatial correlation between IL-1 and iNOS mRNA

expression suggests that IL-1 initiates and promotes

inflammatory}immunologic events such as activation

of glial cells, and recruitment and stimulation of

neutrophils, and, as a result, induces iNOS mRNA in

these cells in an autocrine and}or paracrine manner.

Whether iNOS mediates retinal ischemia-

reperfusion injury was the next issue that we wished

to address. We found that -NIO treatment signi-

ficantly increased the rate of b-wave recovery (Table

I). -NIO is thought to be a potent and irreversible

inhibitor of inducible NOS, because it effectively

inhibits NOS activity in phagocytic cells (McCall et al.,

1991), and also inhibits immune complex injury, a

process in which iNOS is involved (Mulligan, Moncada

and Ward, 1992). The results raise the possibility that

NO generated by iNOS induced in ischemic retinas

mediates retinal ischemia-reperfusion injury. How-

ever, it cannot be denied that constitutive isoforms of

NOS were also inhibited by the -NIO treatment in this

study (Rees et al., 1990; Moore et al., 1994), and that

the inhibition of cNOS was involved in the process of

increased b-wave recovery. Further studies to confirm

this hypothesis are needed.

In contrast to our results, Ostwald et al. found that

pretreatment of -NG-nitro-arginine-methylester (-

NAME) did not alter early recovery of b-wave in cats

(Ostwald et al., 1995). The reason for this discrepancy

is uncertain in this study. One possible explanation for

this is that these differences may result from the

different time schedules of drug administration. They

infused -NAME intravenously for 30 min starting

1 hr before the ischemic insult, whereas we repeatedly

gave -NIO intraperitoneally starting 2 hr after reper-


fusion. -NAME administered 1 hr before ischemia

might not effectively inhibit iNOS activity, because

iNOS mRNA expression exhibited delayed upregula-

tion (12–24 hr) after reperfusion.

The finding of b-wave recovery must be explained

with caution, as it does not necessarily represent the

entire spectrum of ischemic damage in the retina. In

fact, no prominent difference in retinal thickness was

detected by the light microscopic study (Fig. 5). The

results imply, therefore, that -NIO treatment de-

creased injury of the localized retinal tissue associated

specifically with the generation of the b-wave. In

general, heterogeneous actions of NO are thought to

exist depending upon its local redox forms. It has been

suggested that retinal ischemia-reperfusion injury

involves free radical formation (Szabo et al., 1991a, b;

Nayak, Kita and Marmor, 1993; Peachey, Green and

Ripps, 1993) and excitatory amino acid release (Yoon

and Marmor, 1989; Louzada et al., 1992). NO can

react with superoxide anion (O#

−) to generate the

highly cytotoxic free radical, peroxynitrite (dONOO−)

and hydroxyl free radical (dOH−) (Beckman et al.,

1990; Radi et al., 1991). In contrast, oxidation of NO

produces nitrosonium, which can inactivate receptors

for -methyl--aspartate (NMDA), and thus can

prevent NMDA-mediated neurotoxicity (Manzoni et

al., 1992, Lipton et al., 1993). The results do not

exclude the possibility that these heterogeneous effects

of NO are involved in the retinal ischemia-reperfusion

injury.

In conclusion, this study has shown that iNOS

mRNA is highly expressed by non-neuronal cells of the

inner retina during reperfusion following transient

retinal ischemia. It has also shown that -NIO

treatment provides some protection against ischemia-

reperfusion injury. The results suggest that nitric

oxide produced by iNOS induced during reperfusion

mediates retinal ischemia-reperfusion injury.

Acknowledgements

The authors thank Professor Thom W. Mittag (MountSinai School of Medicine, New York, NY, U.S.A.) for -NIOand Ms Hisako Okuda for her help with the histologictechniques.

This work was supported in part by a Grant-in-Aid forScientific Research from the Ministry of Education, Science,Sports and Culture of the Japanese Government.

References

Beckman, J. S., Beckman, T. W., Chen, J., Marshall, P. A.and Freeman, B. A. (1990). Apparent hydroxyl radicalproduction by peroxynitrite : implications for endo-thelial injury from nitric oxide and superoxide. Proc.Natl. Acad. Sci. U.S.A. 87, 1620–4.

Chomczynski, P. and Sacchi, N. (1987). Single-step methodof RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156–9.

Corbett, J. A., Tilton, R. G., Chang, K., Hasan, K. S., Ido, Y.,Wang, J. L., Sweetland, M. A., Lancaster, J., Jr.,Williamson, J. R. and McDaniel, M. L. (1992). Amino-

guanidine, a novel inhibitor of nitric oxide formation,prevents diabetic vascular dysfunction. Diabetes 41,552–6.

Dighiero, P., Reux, I., Hauw, J. J., Fillet, A. M., Courtois, Y.and Goureau, O. (1994). Expression of inducible nitricoxide synthase in cytomegalovirus-infected glial cells ofretinas from AIDS patients. Neurosci. Lett. 166, 31–4.

Goureau, O., Lepoivre, M., Becquet, F. and Courtois, Y.(1993). Differential regulation of inducible nitric oxidesynthase by fibroblast growth factors and transforminggrowth factor beta in bovine retinal pigmented epithelialcells : inverse correlation with cellular proliferation.Proc. Natl. Acad. Sci. U.S.A. 90, 4276–80.

Goureau, O., Hicks, D., Courtois, Y. and De-Kozak, Y.(1994). Induction and regulation of nitric oxidesynthase in retinal Mueller glial cells. J. Neurochem. 63,310–7.

Hangai, M., Yoshimura, N., Yoshida, M., Yabuuchi, K. andHonda, U. (1995). Interleukin-1 gene expression intransient retinal ischemia in the rat. Invest. Ophthalmol.Vis. Sci. 36, 571–8.

Iadecola, C., Xu, X, Zhang, F., el-Fakahany, E. E. and Ross,M. E. (1995a). Marked induction of calcium-indepen-dent nitric oxide synthase activity after focal cerebralischemia. J Cereb. Blood Flow Metab. 15, 52–9.

Iadecola, C., Zhang, F. and Xu, X. (1995b). Inhibition ofinducible nitric oxide synthase ameliorates cerebral.ischemic damage. Am. J. Physiol. 268, 286–92.

Kilbourn, R. G., Jubran, A., Gross, S. S., Griffith, O. W., Levi,R., Adams, L. and Lodato, R. F. (1990). Reversal ofendotoxin-mediated shock by NG-methyl--arginine, aninhibitor of nitric oxide synthesis. Biochem. Biophys. Res.Commun. 172, 1132–8.

Kroncke, K. D., Kolb-Bachofen, V., Berschick, B., Burkart, V.and Kolb, H. (1991). Activated macrophages killpancreatic syngeneic islet cells via arginine-dependentnitric oxide generation. Biochem. Biophys. Res. Commun.175, 752–8.

Lawwill, T. (1972). Practical rabbit electroretinography.Am. J. Ophthalmol. 74, 135–41.

Lipton, S. A., Choi, Y. B., Pan, Z. H., Lei, S. Z., Chen, H. S.,Sucher, N. J., Loscalzo, J., Singel, D. J. and Stamler, J. S.(1993). A redox-based mechanism for the neuro-protective and neurodestructive effects of nitric oxideand related nitroso-compounds. Nature 364, 626–32.

Liversidge, J., Grabowski, P., Ralston, S., Benjamin, N. andForrester, J. V. (1994). Rat retinal pigment epithelialcells express an inducible form of nitric oxide synthaseand produce nitric oxide in response to inflammatorycytokines and activated T cells. Immunology 83, 404–9.

Louzada Jr, P., Dias, J. J., Santos, W. F., Lachat, J. J.,Bradford, H. F. and Coutinho-Netto, J. (1992).Glutamate release in experimental ischaemia of theretina: An approach using microdialysis. J. Neurochem.59, 358–63.

Manzoni, O., Prezeau, L., Marin, P., Deshager, S., Bockaert,J. and Fagni, L. (1992). Nitric oxide-induced blockade ofNMDA receptors. Neuron 8, 653–62.

Marchuk, D., Drumm, M., Saulino, A. and Collins, F. S.(1991). Construction of T-vectors, a rapid and generalsystem for direct cloning of unmodified PCR products.Nucleic Acid Res. 19, 1154.

McCall, T. B., Feelisch, M., Palmer, R. M. and Moncada, S.(1991). Identification of -iminoethyl--ornithine as anirreversible inhibitor of nitric oxide synthase in phago-cytic cells. Br. J. Pharmacol. 102, 234–8.

Moncada, S., Palmer, R. M. and Higgs, E. A. (1991). Nitricoxide : physiology, pathophysiology, and pharm-acology. Pharmacol. Rev. 43, 109–42.

Moore, W. M., Webber, R. K., Jerome, G. M., Tjoeng, F. S.,


Misko, T. P. and Currie, M. G. (1994). -N6-(1-iminoethyl)lysine : a selective inhibitor of induciblenitric oxide synthase. J. Med. Chem. 37, 3886–8.

Mulligan, M. S., Moncada, S. and Ward, P. A. (1992).Protective effects of inhibitors of nitric oxide synthase inimmune complex-induced vasculitis. Br. J. Pharmacol.107, 1159–62.

Nayak, M. S., Kita, M. and Marmor, M. F. (1993). Protectionof rabbit retina from ischemic injury by superoxidedismutase and catalase. Invest. Ophthalmol. Vis. Sci. 34,2018–22.

Nudel, U., Zakut, R., Shani, M., Neuman, S., Levy, Z. andYaffe, D. (1983). The nucleotide sequence of the ratcytoplasmic beta-actin gene. Nucleic Acid Res. 11,1759–71.

Ostwald, P., Goldstein, I. M., Pachnanda, A. and Roth, S.(1995). Effects of nitric oxide synthase inhibition onblood flow after retinal ischemia in cats. Invest.Ophthalmol. Vis. Sci. 36, 2396–403.

Peachey, N. S., Green, D. J. and Ripps, H. (1993). Ocularischemia and the effects of allopurinol on functionalrecovery in the retina of the arterially perfused cat eye.Invest. Ophthalmol. Vis. Sci. 34, 58–65.

Radi, R., Beckman, J. S., Bush, K. M. and Freeman, B. A.(1991). Peroxynitrite oxidation of sulfhydryls. Thecytotoxic potential of superoxide and nitric oxide. J.Biol. Chem. 266, 4244–50.

Rees, D. D., Palmer, R. M., Schulz, R., Hodson, H. F. andMoncada, S. (1990). Characterization of three inhibitorsof endothelial nitric oxide synthase in vitro and in vivo.Br. J. Pharmacol. 101, 746–52.

Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi,R., Horn, G. T., Mullis, K. B. and Erlich, H. A. (1988).Primer-directed enzymatic amplification of DNA with athermostable DNA polymerase. Science 239, 487–91.

Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNAsequencing with chain-terminating inhibitors. Proc.Natl. Acad. Sci., U.S.A. 74, 5463–7.

Schnitzer, J. (1988). Astrocytes in the guinea pig, horse, andmonkey retina: their occurrence coincides with thepresence of blood vessels. Glia 1, 74–89.

Spivey, B. E. and Pearlman, J. T. (1953). Day-to-dayvariations in the ERG of humans and rabbits. Am. J.Ophthalmol. 55, 1013–20.

Stefansson, E., Wilson, C. A., Schoen, T. and Kuwabara, T.(1988). Experimental ischemia induces cell mitosis inthe adult rat retina. Invest. Ophthalmol. Vis. Sci. 29,1050–5.

Steinhorst, U. H., Chen, E. P., Hatchell, D. L., Samsa, G. P.,Saloupis, P. T., Westendorf, J. and Machemer, R.(1993). Aclacinomycin A in the treatment of ex-perimental proliferative vitreoretinopathy. Efficacy andtoxicity in the rabbit eye. Invest. Ophthalmol. Vis. Sci. 34,1753–60.

Szabo, M. E., Droy-Lefaix, M. T., Doly, M. and Braquet, P.(1991a). Free radical-mediated effects in reperfusioninjury: a histologic study with superoxide dismutaseand EGB 761 in rat retina. Ophthalmic Res. 23, 225–34.

Szabo, M. E., Droy-Lefaix, M. T., Doly, M., Carre, C. andBraquet, P. (1991b). Ischemia and reperfusion-inducedhistologic changes in the rat retina. Demonstration of afree radical-mediated mechanism. Invest. Ophthalmol.Vis. Sci. 32, 1471–8.

Wood, E. R., Berger, H., Jr., Sherman, P. A. and Lapetina,E. G. (1993). Hepatocytes and macrophages express anidentical cytokine inducible nitric oxide synthase gene.Biochem. Biophys. Res. Commun. 191, 767–74.

Yoon, Y. H. and Marmor, M. F. (1989). Dextromethorphanprotects retina against ischemic injury in vivo. Arch.Ophthalmol. 107, 409–11.

inducible nitric oxide synthase in retinal ischemia-reperfusion injury

Documents