Id

Ga

Nb

c

a

ARRAA

KBAMCHS

1

n(tcesloewe

L

0d

Toxicology 295 (2012) 56– 67

Contents lists available at SciVerse ScienceDirect

Toxicology

j ourna l ho me pag e: www.elsev ier .com/ locate / tox ico l

n utero exposure to benzo(a)pyrene predisposes offspring to cardiovascularysfunction in later-life

.E. Julesa, S. Pratapb, A. Rameshc, D.B. Hooda,∗

Department of Neuroscience and Pharmacology, Environmental-Health Disparities and Medicine, Center for Molecular and Behavioral Neuroscience, Meharry Medical College,ashville, TN 37208, USADepartment of Microbiology & Immunology, Microarray/Bioinformatics Core, Meharry Medical College, Nashville, TN 37208, USADepartment of Biochemistry and Cancer Biology, Meharry Medical College, Nashville, TN 37208, USA

r t i c l e i n f o

rticle history:eceived 27 October 2011eceived in revised form 28 January 2012ccepted 30 January 2012vailable online 21 February 2012

eywords:enzo(a)pyrenengiotensinicroarray

ardiovascular diseasesypertensionusceptibility-exposure paradigm

a b s t r a c t

In utero exposure of the fetus to benzo(a)pyrene [B(a)P], a polycyclic aromatic hydrocarbon, is thoughtto dysregulate cardiovascular development. To investigate the effects of in utero B(a)P exposure on car-diovascular development, timed-pregnant Long Evans Hooded (LEH) rats were exposed to diluent orB(a)P (150, 300, 600 and 1200 �g/kg/BW) by oral gavage on embryonic (E) days E14 (the metamor-phosing embryo stage) through E17 (the 1st fetal stage). There were no significant effects of in uteroexposure to B(a)P on the number of pups born per litter or in pre-weaning growth curves. Pre-weaningprofiles for B(a)P metabolite generation from cardiovascular tissue were shown to be dose-dependentand elimination of these metabolites was shown to be time-dependent in exposed offspring. Systolicblood pressure on postnatal day P53 in the middle and high exposure groups of offspring were signifi-cantly elevated as compared to controls. Microarray and quantitative real-time PCR results were directlyrelevant to a biological process pathway in animal models for “regulation of blood pressure”. Microar-ray and quantitative real-time PCR analysis revealed upregulation of mRNA expression for angiotensin

(AngII), angiotensinogen (AGT) and endothelial nitric oxide synthase (eNOS) in exposed offspring. Bio-logical network analysis and gene set enrichment analysis subsequently identified potential signalingmechanisms and molecular pathways that might explain the elevated systolic blood pressures observedin B(a)P-exposed offspring. Our findings suggest that in utero exposure to B(a)P predispose offspring tofunctional deficits in cardiovascular development that may contribute to cardiovascular dysfunction in later life.

. Introduction

The fetal origins of adult disease hypothesis proposes that coro-ary heart disease and stroke, and the disorders related to them,i.e. hypertension and type 2 diabetes) originate through responseso under-nutrition during fetal life and infancy, which permanentlyhange the body’s structure and function in ways that lead to dis-ase in later life (Barker, 1995). Experimental studies have alsohown that manipulation of the diets of pregnant dams leads toife-long alterations in blood pressure and metabolism of theirffspring (Hales et al., 1996; Barker, 2000). Further, there is a lit-

rature of longitudinal studies demonstrating that people bornith low birth weight suffer from higher rates of stroke (Martyn

t al., 1996; Eriksson et al., 2000; Rich-Edwards et al., 1997). Cur-

Abbreviations: PAHs, polycyclic aromatic hydrocarbons; B(a)P, benzo(a)pyrene;EH, Long–Evans hooded; ED, embryonic day; P, postnatal day; ANGII, angiotensin.∗ Corresponding author. Tel.: +1 615 327 6358; fax: +1 615 327 6632.

E-mail address: dhood@mmc.edu (D.B. Hood).

300-483X/$ – see front matter © 2012 Elsevier Ireland Ltd. All rights reserved.oi:10.1016/j.tox.2012.01.017

© 2012 Elsevier Ireland Ltd. All rights reserved.

rently, very little is known about the mechanisms by which in uteroinsult leads to altered expression of key genes and proteins dur-ing early-life to result in diseased phenotypes in later-life. On thebasis of epidemiology data in support of the Barker hypothesis, itis proposed that exposure to certain environmental chemicals aswell as altered nutrition, or in combination with altered nutrition,will in some instances, not lead to readily discernable structuralmalformations but instead, to alterations in developmental pro-gramming expressed as a permanently altered gland, organ, orsystem potential. These effects will occur in a time-specific (i.e. vul-nerable window) and tissue-specific manner, and such alterationsmay be irreversible (Heindel, 2005). The later-life result is an animalthat is sensitized such that it will be more susceptible to diseaseslater in life.

As a member of the polycyclic aromatic hydrocarbon (PAH)family, benzo(a)pyrene [B(a)P], is ubiquitous throughout the envi-

ronment and is derived from the incomplete combustion of organicmatter (Ramesh et al., 2011). Humans are exposed to PAHs throughseveral routes that include air, water, food, skin contact and occupa-tional settings. For a major portion of the general population that is

icolog

npaents1

otfihPpPeobic1

htRassTehestheerefiftmwscstpibiRrtbisu

(awr

G.E. Jules et al. / Tox

ot exposed to PAHs via proximity to sources of pollution or occu-ational modality, food ingestion is the major route of exposures compared to inhalation (Butler et al., 1993). Previous studies onxposure of humans to B(a)P, have revealed that the range and mag-itude of dietary exposures (2–500 ng/day) are exceedingly largerhan for inhalation (10–50 ng/day) (Lioy et al., 1988) making expo-ure via diet a major route of exposure for PAHs (Beckman et al.,998; Phillips, 1999).

PAH intake from ambient air has been reported to be in the rangef 0.02–3 �g/day (World Health Organization, 2003). However,he levels vary depending on the geographic area, local traf-c patterns, pollutant emissions from smokestacks, and personalabits such as smoking etc. In particular, occupational exposures toAHs vary with the setting; 9.6–450 �g/m3 in aluminum smelters,etroleum refineries, and copper mines. Occupational exposure toAHs occurs in the production of aluminum, coal-fired power gen-rating processes, iron and steel foundries, tar distillation, shaleil extraction, wood impregnation, roofing, road paving, carbonlack production, carbon electrode production, restaurant cook-

ng, diesel engine servicing, fire fighting, aviation fuel handling,himney sweeping and calcium carbide production (Boffetta et al.,997).

It is well established that environmental exposure to B(a)P canave multiple deleterious tissue effects depending on the dose,ime (prenatal, postnatal) and term of exposure (for review seeamesh et al., 2011). Because of the above mentioned consider-tions regarding potential routes of exposure, the present studyought to survey the health implications of in utero B(a)P expo-ure from the standpoint of developmental cardiovascular toxicity.he susceptibility-exposure paradigm utilized in this animal mod-ls study uses doses of B(a)P that may be perceived to be ratherigh. This is due to the fact that if doses that approximate ambi-nt levels which humans are exposed were employed, we wouldeldom discern any manifestations of disease. It is within this con-ext that it must be noted that the body/tissue burden of aromaticydrocarbons is governed by the daily intake doses, duration ofxposure, and the half-life of this toxicant in the body (Grassmant al., 1998). The half-life of PAHs is greater in humans than inodent tissues (National Academy of Sciences, 1983; Grassmant al., 1998). Furthermore, humans enjoy longer lifespan (about 30-old longer) than rodents (Kim, 2007). If the interspecies differencesn exposure history and toxicant accumulation characteristics areactored into experimental design, employing B(a)P doses higherhan ambient levels is obligatory towards assessing the environ-

ental health effects from exposure. Further, the B(a)P doses thate used in our study are of relevance to special B(a)P expo-

ure scenarios in humans, which include cumulative intake fromonsumption of a B(a)P-contaminated diet, inhalation of tobaccomoke (both mainstream and side stream), breathing of con-aminated air released from occupational settings (workers frometrochemical, graphite electrode and aluminum manufacturing

ndustries), people/children that live in unvented homes usingiomass for cooking and home heating and/or that work and play

n the vicinity of hazardous waste sites (reviewed in WHO, 2010;amesh et al., 2010). Moreover, a recent review by our groupeported on the global distribution of PAHs and detailed substan-ial environmental contamination (mg/g dry media or g/L water)y these toxicants (Ramesh et al., 2011). Therefore, it is our opin-

on that the cumulative annual intake of B(a)P by vulnerable andusceptible populations likely approximates the high B(a)P dosessed in the present study.

Previous studies have reported that chronic exposure

12–24 weeks) of Apo-E knockout mice to 5 mg/kg B(a)P acceler-ted atherosclerotic plaques (Curfs et al., 2004). Also, a correlationas reported by these authors relative to the stages of plaques,

eactive metabolites of B(a)P and formation of DNA adducts.

y 295 (2012) 56– 67 57

This type of B(a)P exposure-induced atherosclerosis has beenshown to be mediated through altered expression of antioxidantenzymes and enhanced generation of reactive oxygen species(ROS) in this mouse model (Yang et al., 2009). An enhancedexpression of aryl hydrocarbon receptor (AhR) receptor targetgene expression was also observed in mouse aortic endothelialcells suggesting that upregulation of AhR and of its target genesplay a key role in B(a)P-induced atherogenesis (Wang et al.,2009).

Recent studies suggest that the pathogenic role of B(a)P maybe attributed to its ability to be metabolized into highly reac-tive compounds, such as 6-hydroxy-B(a)P. These metabolites arisefrom the biological oxidation by mixed-function oxidases and therapid autoxidation of 6-hydroxy-B(a)P to produce high levels ofquinones and diones (Burdick et al., 2003b; Lorentzen and Ts’o,1977; Lorentzen et al., 1979). These three groups of metabolitesundergo one electron redox cycling (from quinone to semiquinoneradical to hydroquinone forms) to generate large quantities of intra-cellular ROS (Burdick et al., 2003a; Flowers et al., 1996; Penninget al., 1996). The presence of two ROS species, such as hydrogenperoxide and superoxide anion, in turn react to form an even morereactive species, the hydroxyl radical. The presence of high lev-els of B(a)P metabolites combined with ROS produces a robustoxidative microenvironment that has been shown to cause DNAmodifications and alterations in multiple cellular signaling path-ways (Lorentzen et al., 1979).

Studies demonstrate that B(a)P is readily metabolized by theplacenta and accumulates in fetal tissue during gestation (Bouayedet al., 2009). Likewise, recent studies also suggest that B(a)Padversely affects a number of fetal developmental indices such aslow birth weight (Perera et al., 1998, 1999, 2003), impaired learn-ing and memory (Perera et al., 2007, 2009), and decreased immuneresponse (Hannah et al., 1982). Increasing evidence strongly sug-gests that B(a)P plays both a direct and indirect role in thedevelopment and progression of cardiovascular diseases (Gentnerand Weber, 2011). Cardio- and cerebro-vascular events are morecommon in individuals with hypertension, hyperlipidemia, anddiabetes mellitus, and in smokers (Thirman et al., 1994). It has beenwell established that B(a)P, upon activation, is converted into anumber of highly reactive intermediates that can bind to and mod-ify DNA and protein structures (Miller and Ramos, 2001; Uno et al.,2004). These metabolites can also induce the production of reactiveoxygen species which can damage the endothelium lining of bloodvessels where macrophages and lipoproteins infiltrate and accu-mulate, to later form atherosclerotic lesions and plaques (Thirmanet al., 1994). Numerous studies also suggest that cigarette smok-ers have a greater incidence and degree of atherosclerotic lesions(Thirman et al., 1994; Zhang and Ramos, 2008) however the specificbiological and developmental pathways altered by in utero B(a)Pexposure are poorly understood.

In the current study we examined the in utero effects of B(a)Pexposure on gene expression in rat offspring heart tissue sub-sequent to in utero exposure to B(a)P. The results demonstratethat systolic blood pressure was significantly elevated. eNOS pro-tein expression and mRNA levels for angiotensin (AngII) were alsosignificantly increased in B(a)P exposed offspring compared tocontrols. Analysis of gene transcription microarray data revealedthat 563 of the 16,000 genes were significantly altered in B(a)P-exposed offspring. Of the genes demonstrating modulation by B(a)Pexposure, 377 genes were up-regulated greater than two-fold and186 were down-regulated greater than two-fold. Common generesponses modulated as a result of B(a)P-exposure were identi-

fied and included xenobiotic metabolizing genes, genes known toalter lipid metabolism, nucleic acid metabolism, and more impor-tantly, cardiovascular development and function. Among the mostsignificantly altered pathways was the renin–angiotensin system

5 icology

pn

2

2

ttwfdclwae

mtLMiAf2wa

21

gsmaoic

govispp

2

caehgbtesdohac

eeooATpf1d

t

8 G.E. Jules et al. / Tox

athway, with the angiotensinogen (AGT) gene demonstrating sig-ificant up-regulation as a result of in utero B(a)P exposure.

. Materials and methods

.1. Animals

To determine the total number of Long–Evans hooded dams (litters) as well ashe number of offspring needed for these studies, we made the following assump-ions. We conservatively estimated that the variance between measures from littersould be approximately 10% of the mean response, so that using littermates from

our to five different litters within an experimental group would be sufficient toetect a significant difference. Based on these assumptions, the power analysis indi-ated that 3 replicates or cohorts from 4 to 5 different litters would suffice. Since theitter is the statistical unit and sampling was from at least 4 to 5 individual litters

ithin an experimental group, the litter representation would be sufficient to detect 20% change in any of our experimental end-points with an 80% power and a type-Irror rate of 5%.

All experiments were approved by the Institutional Animal Care and Use Com-ittee (IACUC) of Meharry Medical College (MMC) and were performed according

o Guidelines for Animal Experimentation as set forth by the NIH. Timed-pregnantong–Evans Hooded dams were obtained from Harlan Sprague–Dawley (St. Louis,O, USA) on gestational day (GD) 11. Upon arrival, animals were housed individually

n clear plastic cages with laboratory grade (heat-treated) pine shavings as bedding.nimals were quarantined for 2 days in the AAALAC = accredited MMC animal care

acility and were maintained in a controlled environment with a temperature of1 ± 2 ◦C and relative humidity of 50–10% with a 12/12 h light/dark cycle. Damsere fed commercial Rat Chow (#5012: Purina Mills, St. Louis, MO, USA), and water

nd food were available ad libitum.

.2. Susceptibility-exposure paradigm and embryology from embryonic (E) days4–17

Each dam was randomly assigned to either (1) control or (2) experimentalroup, and on E14–17 timed-pregnant dams were exposed by oral gavage using ourusceptibility-exposure paradigm (Brown et al., 2007). E14 is known as the meta-orphosing embryo stage where somites 43–45 (caudal); mandibular, maxillary,

nd frontonasal processes; cervical sinuses closing; mammary welts; differentiaionf handplates; arm buds vascularized, brachial nerves entering; beginning of umbil-cal hernia. On E17 or the 1st fetal stage, there is rapid growth of eyelids; palateompletes; pinna covers ear ducts and the umbilical hernia withdraws.

Each dam was randomly assigned to either a (1) control or (2) experimentalroup, and on GD14–17 timed-pregnant dams were exposed by oral gavage usingur susceptibility-exposure paradigm (Brown et al., 2007). Dams were given a totalolume of 0.875 ml of (1) peanut oil alone or (2) 150, 300, 600 and 1200 �g/kg B(a)Pn peanut oil. Offspring from control and B(a)P-exposed animals were maintained intandard stainless steel cages on pelleted paper bedding (#7084: Harlan, TX) untilostnatal day P53, at which time they were sacrificed using previously describedrocedures (Sheng et al., 2010).

.3. Tissue preparation and B(a)P disposition analysis

The connective tissue which partitions the aorta from the muscle of the thoracicavity was dissected out. The epicardial and pericardial fat surrounding the heartnd perivascular fat surrounding the aorta were also removed with fine tweez-rs. The aorta was cut above the point it emerges from the ventricular tissue. Aftereart and aorta were retrieved from the animal, organs and tissue were placed in alass petridish and kept on ice. A small incision was made to the heart and wholelood was carefully drained from the heart and aorta into a heparinized conicalube. Washes proceeded with chilled isotonic saline at least 2 times to removexcess blood following which; the residual organ (heart plus aorta) was cut intomall pieces using a sterile scalpel blade. Subsequently, the resulting samples ofissected cardiac tissues were minced separately with a fine pair of scissors, thor-ughly mixed and then pooled per experimental group (n = 4–5/group/cohort) as aomogenate of minced, mixed and pooled tissue sample per experimental groupnd stored at −70 ◦C until analyzed. Plasma from blood samples was harvested byentrifugation at 2900 × g for 20 min and stored frozen at −70 ◦C until analyzed.

Prior to analyses, the plasma and heart-aorta samples were thawed and homog-nized in 0.25 M Tris–sucrose–EDTA (pH 7.4) and 0.1% SDS. The homogenate wasxtracted with a solution containing water, methanol, and chloroform at a ratiof 1:1.5:2 (v/v). The organic phase was dried under N2 and resuspended in 0.5 mlf methanol. Particulates in the extracts were removed by passing them throughcrodisc filters (0.45 �m, 25-mm diameter; Gelman Sciences, Ann Arbor, MI, USA).he final extracts were stored at 4 ◦C in amber-colored screwtop vials to preventhotodegradation until analysis. The bioavailable concentrations of metabolites

rom the extracts were identified and measured by a reverse-phase HPLC (Model200; Agilent, Wilmington, DE) equipped with a UV and a fluorescence detector asescribed previously (Brown et al., 2007).

B(a)P disposition analysis in plasma and whole heart-aorta tissue from con-rol and B(a)P-exposed offspring was analyzed for bioavailable levels of B(a)P

295 (2012) 56– 67

metabolites by liquid–liquid extraction and reverse phase high performance liq-uid chromatography (HPLC) as previously outlined in (Brown et al., 2007). Datawere derived from 4 to 5 offspring per litter per group so that analyses representrepetitions from 3-cohorts comprising 12–15 offspring.

2.4. Blood pressure measurements

To assess whether in utero B(a)P exposure affected blood pressure in off-spring rats, the systolic blood pressure of conscious-nonanesthetized animals(n = 5–6/litter/group) was measured on P53. Blood pressure was measured (non-invasive) by determining the tail blood volume with a volume pressure recordingsensor and an occlusion tail-cuff (CODA System, Kent Scientific, Torrington, CT, USA).Windaq Acquisition 1.58 and Windaq Analysis 2.29 software (DATAQ InstrumentsDI200AC) were used to record and analyze the data, respectively. Briefly, offspringwere conditioned restraint tubes from P46 through P50 prior to blood pressuremeasurements in the laboratory in which measurements were done. Analysis wasperformed two rats at a time by placed offspring in restraining tubes followed by tailcuff placement on tails. The Windaq Acquisition software was then set to performa number of acclimatization runs to help condition the rats for the blood pressuremeasurement. After this acclimatization session, animals were returned to theirhome-cages in the animal care facility.

Regarding the potential for exposure to mild stress during the acclimatizationsession and during data acquisition; studies support the proposition that LEH ratsadapt more readily to acute stress following prolonged exposure to a variety of mildstressors as compared to SD rats (Bielajew et al., 2002).

2.5. SDS-PAGE and Western blot analysis

Frozen samples of pooled heart tissue (described above in Section 2.2) fromcontrol and B(a)P-exposed offspring was thawed and homogenized in 1 ml RIPAbuffer (Bio-Rad, USA) containing a protease-phosphatase inhibitor cocktail (Bio-rad, USA) for 1 min. Lysates were then centrifuged at 15000 RPM for 10 min, andthe supernatant transferred to new tubes. Protein concentrations of the tissuelysates were determined using Bio-Rad protein assay reagent. Using 10% SDS-polyacrylamide gels, equal amounts of protein (from P-0 and P-53) were resolvedunder reducing conditions. Following electrophoresis the proteins were trans-blotted to Immobilon-FL membranes (Millipore Corporation, Billerica, MA, USA).Non-specific binding sites were blocked with 4% non-fat dry milk for 1.5 h andthen incubated overnight at 4 ◦C in polyclonal primary antibody against eNOS,nNOS or AngII (Santa Cruz, USA), with non-fat dry milk in Tris-buffered saline-Tween 20 buffer, while gently shaken. Next, the membranes were washed 4 timesfor 5 min each at room temperature in PBS + 0.1% Tween 20 with gentle shaking,using a generous amount of buffer. After washing, the membranes were incu-bated with a fluorescent secondary antibody raised against the primary antibodyin non-fat dry milk in Tris-buffered saline + SDS + Tween 20. This incubation lastedfor 1-h, after which the membranes were washed 4 × 5-min at room temperaturewith PBS + 0.1% Tween 20. Proteins were visualized and analyzed using the LiCorsystem.

2.6. RNA extraction

Total RNA was isolated from rat heart tissue with TRIzol reagent as describedin accordance with the protocol suggested by the manufacturer (Life Technologies,Carlsbad, CA, USA). RNA was purified using an mRNA purification kit from Promega(Madison WI, USA).

2.7. Quantitative real time RT-PCR

Three genes known to be involved in blood pressure regulation (AngII, nNOSand eNOS) were selected to be measured by qRT-PCR. Additionally, (BH4/BH2) oxi-doreductase (Spr) was also quantified. Quantitative Real time RT-PCR was carriedout using the iScript one-step RT-PCR kit with SYBR Green, PCR plates and opticallyclear adhesive plate seals (Bio-Rad Laboratories, USA). A Bio-Rad C1000 ThermalCycler was used to detect the fluorescence level. Reactions were carried out in low96-well clear PCR plates, with a 2×PCR buffer containing 0.4 mM of each dNTP (dATP,dCTP, dGTP, dTTP), SYBR Green dye, magnesium ions, 20 nM fluorescein, iTaq DNAPolymerase and stabilizers. Forward and reverse primers (300 nM final concentra-tion each), nuclease-free water, RNA template (1 pg–100 ng total RNA) and iScriptreverse transcriptase for one-step RT-PCR were added to PCR buffer in a final reac-tion volume of 50 �l. Amplification parameters were: cDNA synthesis at 50 ◦C for10 min, followed by reverse transcriptase inactivation at 95 ◦C for 5 min, PCR cyclingand detection (30–45 cycles) at 95 ◦C for 30 s; and 55–60 ◦C at 30 s (data collectionstep). All primers were designed using OligoPerfect Designer Software (Invitrogen,USA) and can be found in Table 1. Samples were analyzed in duplicate, and 18 SrRNA primers were used (Ambion, Austin, TX, USA) as the endogenous control. Fold

induction was calculated using the formula 2−��CT , where �CT = target gene CT –actin CT, and the ��CT is based on the mean �CT of respective control [non-B(a)Ptreated]. The CT value is determined as the cycle at which the fluorescence signalemitted is significantly above background levels and is inversely proportional to theinitial template copy number.

G.E. Jules et al. / Toxicology 295 (2012) 56– 67 59

Table 1Primers used in real-time quantitative RT-PCR experiment.

Name Symbol Primer Sequence

Angiotensin AngII Forward CTGTGAAGGAGGGAGACTGCAngiotensin AngII Reverse GTGGACTGTAGCAGGGGTGT

Neuronal nitric oxide synthase NOS1 Forward CTGCAAAGCCCTAAGTCCAGNeuronal nitric oxide synthase NOS1 Reverse AGCAGTGTTCCTCTCCTCCA

Endothelial nitric oxide synthase NOS3 Forward TGACCCTCACCGATACAACAEndothelial nitric oxide synthase NOS3 Reverse CTGTACAGCACAGCCACGTT

7,8-Dihydrobiopterin oxidoreductase Spr Forward TACAGCCCATCTCTGAGTGC7,8-Dihydrobiopterin oxidoreductase Spr Reverse CTTCATAATGGCCTCCTCCA

T and BHi

2

tsa2sT1usaalwf1eioag2hdsod1bwbtpAtp

2

atef((Afct

2

Rd(g

t

et al., 2007) as well as from our group (Wu et al., 2003; Wormleyet al., 2004), there were no significant differences in the numberof pups born per litter between control and B(a)P-exposed dams(Table 2). Likewise, no convulsions, tremors, abnormal movements

Table 2Average number of offspring born per litter.

Animal dose group Dams Number of pups/l

Vehicle – Control 17 10 ± 0.32150 �g/kg BW 7 12 ± 0.65300 �g/kg BW 6 11 ± 0.80

hree genes known to be involved in blood pressure regulation (AngII, eNOS, iNOS

n Table 1 were designed using OligoPerfect Designer Software (Invitrogen, USA).

.8. cDNA microarray hybridization, data acquisition and analysis

For this study, RNA samples were extracted from heart tissue and submittedo the Vanderbilt Functional Genomics Shared Resource facility (FGSR). All RNAamples processed in the Vanderbilt FGSR were checked on the Agilent 2100 Bio-nalyzer to determine integrity, and quantitated by A260 on the Thermo Nanodrop000 spectrophotometer. Samples with a minimum RNA Integrity Number (RIN)core of 7.0 and with 260/280 ratio of 1.9–2.1 were used in microarray experiments.he Agilent 1-color Low Input Quick Amp (LIQA) target labeling kit and Agilent-color spike-in were used to prepare targets for hybridization following the man-facturer’s protocols. Briefly, 100 ng input total RNA was mixed with diluted RNApike-ins per protocol specifications. The target reactions were reverse transcribed,nd then the reverse transcription products were used in transcription reactionsccording to the manufacturer’s protocol using the Agilent QuickAmp kit. The Cyabeled cRNA targets were quantitated and specific activity of each labeled target

as calculated. All yields ranged from 6.0 to 8.5 �g, with specific activity rangingrom 19 to 22 across the 8 reactions. Minimum requirements for hybridization are.65 �g of cRNA target and specific activity greater than 6.0. Equivalent mass ofach co-hybridized sample (0.825 �g) was combined, fragmented, and then placedn hybridization cocktail. Smear assessments of the cRNA target all had a majorityf the target between 200 and 2000 nt (recommendation for smear assessment is

majority of target between 200 and 2000 nt). A total of 70% or more of each tar-et fell within this size range. Targets were fragmented for 30 s at 60 ◦C and then× Hi-RPM Buffer was added. Hybridizations were set up at 65 ◦C, 10RPM, for 17-

hybridization in an Agilent Hybridization chamber. Hybridizations were takenown and washed per Agilent protocol. The arrays were scanned on the Agilent “C”canner at 3 �m, 20bit. Next, 2, 4 × 44k 1 color Gene Expression slides were runn the Agilent “C” using the recommended settings of 3 �m resolution, 20 bit pixelepth. The gain used was G 100%. Data were processed using Feature Extraction0.7.1, and analyzed with GE1 107 Sep09 FE protocol. The data were then analyzedy gene set enrichment analysis for statistically significant overexpressed path-ays. The WEBGESTALT software tool was used to conduct enrichment analysis

y mapping transcripts which were up or down-regulated greater than 2-fold toheir corresponding reference Kyoto Encyclopedia of Genes and Genomes (KEGG)athways and Gene Ontology (GO) biological process pathways (Zhang et al., 2005).n interaction network visualization of GO biological processes was created using

he GeneMANIA plug in (Mostafavi et al., 2008) for the Cytoscape bioinformaticslatform (Shannon et al., 2003).

.9. Statistical analysis

B(a)P metabolite levels, systolic blood pressure and heart rate data are expresseds mean ± SEM. The cardiac function values of each animal were obtained throughhe average of 15 values (each value collected at 1-min intervals during the 30-minxperimental period). Statistical significance was estimated using 2-way ANOVAollowed by the Bonferroni post test. The level of significance was set at p < 0.05GraphPad Prism 5.0). The values for eNOS, nNOS, AngII and 7,8-dihydrobiopterinBH4/BH2) oxidoreductase (Spr) mRNA and/or protein are reported as means ± SEM.n analysis of variance (ANOVA) was used for the determination of statistical dif-

erences between control and B(a)P-exposed offspring groups All pairwise multipleomparisons were performed using the Student–Newman–Keuls method. The cri-erion for statistical significance was p < 0.05 in all cases.

.10. RNA-extraction

Tissue samples destined for RNA analysis were lysed with Trizol reagent andNA extracted according to the manufacturer’s instructions. The RNA pellet was

issolved in nuclease-free water and subjected to clean-up using RNeasy columnsQiagen, Hilden, Germany) with on-column DNase treatment for the removal ofenomic DNA.

RNA quality and integrity were assessed using the Nanodrop spectrophotome-er (Nanodrop Technologies, Montchanin, USA) and 2100 Bioanalyzer (Agilent

4/BH2 oxidoreductase) were selected to be measured by qRT-PCR. Primers shown

Technologies, Waldbronn, Germany) respectively. Samples with ratios ofabsorbance at 280/260 nm between 1.8 and 2.0 and at 280/230 nm between 2.0 and2.2, and with RNA integrity number (RIN) of ≥7.5 were judged to be of acceptablequality and integrity to be used for microarray labelling.

2.10.1. RNA isolation and reverse transcription-real time quantitative PCR assay(RT-qPCR)

Total RNA isolated as described above using the TRIzol method (Invitrogen,Cergy-Pontoise, France) was then reverse-transcribed into cDNA using the RTApplied Biosystems kit (Foster City, CA). qPCR assays were performed next using thefluorescent dye SYBR Green methodology and an ABI Prism 7300 detector (AppliedBiosystems). The gene specific primers were provided by Qiagen (Courtaboeuf,France). The specificity of each gene amplification was verified at the end of qPCRreactions through analysis of dissociation curves of the PCR products. Amplificationcurves were analysed with ABI Prism 7000 SDS software using the comparative cyclethreshold method. Relative quantification of the steady-state target mRNA levelswas calculated after normalization of the total amount of cDNA tested to 18 S mRNAendogenous reference. Target gene mRNA expression is presented as the relativefold change between the intensity of the target-specific band to that of the 18sRNAband on P53 as compared to P0 in both control and B(a)P-exposed offspring (600 and1200 �g/kg BW). An analysis of variance (ANOVA) was used for the determinationof statistical differences between control and B(a)P-exposed offspring groups Allpairwise multiple comparisons were performed using the Student–Newman–Keulsmethod. The criterion for statistical significance was p < 0.05 in all cases.

2.11. Determination of 7,8-dihydrobiopterin (BH4/BH2) oxidoreductase (Spr)mRNA levels

In order to determine the potential for whether increasing BH4 concentrationsprecipitate endothelial dysfunction in offspring rats subsequent to in utero B(a)Pexposure, assessment was performed by RT-PCR for determination of BH4 precursorsepiapterin (BH2) by monitoring 7,8-dihydrobiopterin:NADP+ oxidoreductase alsoknown as sepiapterin reductase, (Spr). Total RNA was isolated as described above.Forward primer for 7,8-dihydrobiopterin (BH4/BH2) oxidoreductase (Spr) was 5′-ACAGCCCATCTCTGAGTGC-3′ and reverse primer 5′-CTTCATAATGGCCTCCA-3′ .

3. Results

3.1. Toxicological observations

Consistent with previous reports (Baldwin et al., 2005; Brown

600 �g/kg BW 15 12 ± 0.531200 �g/kg BW 9 11 ± 0.59

Offspring exposed in utero to B(a)P exhibit no overt signs of toxicity effects on littersize. As shown in Table 2, there was no significant difference between the averagenumber of pups born per litter for control or B(a)P exposed litters.

60 G.E. Jules et al. / Toxicology 295 (2012) 56– 67

0 3 5 7 9 11 13 150

10

20

30

40

50

Postnatal day

Wei

gh

t G

ain

(g)

Control

150 ug/kg/BW

300 ug/kg/BW

600 ug/kg/BW

1200 ug/kg/BW

Fig. 1. Absence of an in utero B(a)P-exposure effect on body weight in offspring.Offspring from dams exposed to different concentrations of B(a)P (0, 600 and1200 �g/kg BW respectively) were sacrificed. Weights were measured prior to sac-rifice. There were no significant difference between the controls and B(a)P-exposedow

oofi

3r

sTthtww

3r

mspdorodadt

mcpsirqscawr

1311975300

50

100

150

200

250

300

350

150 µg/kg300 µg/kg

600 µg/kg

1200 µg/kg

**

*

* * *

#

#

#

#

#

Postnatal Days

B(a

)P M

eta

bo

lite

Co

nc

en

tra

tio

ns

(ng

/ml p

las

ma

)

1311975300

50

100

150

200

250

300

350150 µg/kg

300 µg/kg

600 µg/kg

1200 µg/kg

**

* ** *

#

#

#

#

#

Postnatal Days

B(a

)P M

eta

bo

lite

Co

nc

en

tra

tio

ns

(ng

/g t

iss

ue

)

1311975300

20

40

60

80

100

4,5-diol

7,8-diol

9,10-diol

3(OH) BaP

9(OH) BaP

600 µg BaP/kg BW

PND

Perc

en

t D

istr

ibu

tio

n (

%)

3,6-dione

6,12-dione

A

B

C

Fig. 2. (A) The effect of in utero B(a)P exposure on metabolite disposition in off-spring. Offspring from dams exposed to different concentrations of B(a)P (150,300, 600 and 1200 �g/kg BW B(a)P respectively) were anesthetized and sacri-ficed. B(a)P metabolites were extracted from plasma (A) followed by HPLC analysis.Total B(a)P metabolites increased in a dose-dependent manner, and were elimi-nated in a time-dependent manner. Values are expressed as the mean ± SEM ofthree separate experiments in which plasma were pooled from three LEHR off-spring. *p-value ≤0.05, #p-value ≤0.01 significantly different from 150 �g/kg BWB(a)P. (B) In utero B(a)P-exposure effects on metabolite disposition in develop-ing cardiac tissue. Offspring from dams exposed to different concentrations ofB(a)P (150, 300, 600 and 1200 �g/kg BW B(a)P respectively) were anesthetizedand sacrificed. B(a)P metabolites were extracted from cardiac tissue (B) followedby HPLC analysis. Total B(a)P metabolites increased in a dose-dependent man-ner, and were eliminated in a time-dependent manner. Values are expressed asthe mean ± SEM of three separate experiments in which hearts were pooled fromthree LEHR offspring. *p-value ≤0.05, #p-value ≤0.01 significantly different from150 �g/kg BW B(a)P. (C) in utero B(a)P exposure affects the qualitative distribution ofmetabolites in offspring. Offspring from dams exposed to different concentrations ofB(a)P (150, 300, 600 and 1200 �g/kg/BW B(a)P respectively) were anesthetized andsacrificed. The percentage distribution of B(a)P metabolites found in hearts of B(a)P-

ffspring. Values are expressed as the mean ± SEM of three separate experiments inhich weights were averaged from four to five rat offspring.

r any other predictable or reproductive indicators of toxicity werebserved during the exposure or pre-weaning period in any of theve treatment groups of offspring.

.2. In utero B(a)P exposure has no effect on total body weight ofat offspring

At the various postnatal days (P0, 3, 5, 7, 9, 11 and 13), off-pring were removed from each control or B(a)P treatment groups.otal body weight was measured for each offspring. Offspring werehen anesthetized and sacrificed, at which point whole blood wasarvested subsequent to cardiac puncture. As depicted in Fig. 1,he there were no significant differences between the total bodyeights in control and B(a)P-exposed offspring for any of the pre-eaning time points.

.3. In utero B(a)P exposure results in metabolite disposition inat offspring

To confirm whether B(a)P was absorbed into the blood foretabolism and distributed to target tissues, a bioavailability

tudy was conducted during the pre-weaning period (P0–13) usinglasma and heart tissue from exposed offspring. Timed-pregnantams were exposed to diluent (control) or various concentrationsf B(a)P in utero on E14 to E17 (0, 150, 300, 600 and 1200 �g/kg BWespectively). The data obtained in Fig. 2A and B demonstrate thatffspring from the B(a)P-exposed groups exhibit dose-dependentisposition of total B(a)P metabolites in both plasma (Fig. 2A)nd whole heart tissue, respectively (Fig. 2B). A time-dependentecrease in total B(a)P metabolites was also documented duringhe pre-weaning period.

As indicated in Fig. 2C, there were three principal groups ofetabolite types (diols, hydroxy derivatives and diones). The per-

ent distribution of diol metabolites was high throughout thereweaning period and remained over 70% of the total heart tis-ue burden. On the other hand, the hydroxyl B(a)P metabolitesncreased in distribution between P9 and P13, while the dionesemained fairly constant in their distribution from P0 to P13. Theualitative distribution of total B(a)P metabolites depicted in Fig. 2Cuggest that both phase 1 and phase 2 (toxification and detoxifi-

ation) pathways were activated within exposed offspring plasmand heart tissue. The sustained presence of the hydroxy derivativesithin heart tissue is of even greater significance, as these highly

eactive metabolites can be further oxidized into quinones, which

exposed offspring is shown in Fig. 3C. The data shown is a representative sample of600 ug/kg BW B(a)P.

have the potential to undergo redox cycling to form more reac-tive oxygen species (ROS) (Baldwin et al., 2005; Brown et al., 2007;Zhang et al., 2005). In summary, B(a)P metabolite concentrationsand metabolite types in heart tissues quantified in the present study

were found to be in agreement with those detected in develop-ing rodent brain tissues as previously reported (Brown et al., 2007;McCallister et al., 2008; Sheng et al., 2010).

G.E. Jules et al. / Toxicology 295 (2012) 56– 67 61

B(a)P Doses (µg/kg BW)

Syst

oli

c P

ress

ure

(m

mH

g)

0

50

100

150

200

250

0 600 120 0

Fig. 3. In utero B(a)P-exposure negatively affects systolic blood pressure in offspring.The blood pressure of offspring from dams exposed to different concentrations ofB(a)P (0, 600 and 1200 �g/kg BW respectively) were measured using tail cuff (KentScientific, USA). Each session consisted of 5 acclimatization cycles followed by 15 BPmeasurements cycles. A set was accepted if the computer identified >50% successfulrw*

3d

aaTTiidposoih

3o

irssom

Fig. 4. In utero B(a)P-exposure upregulates cardiac tissue eNOS protein expressionin offspring. Offspring from dams exposed to different concentrations of B(a)P (150,300, 600 and 1200 �g/kg/BW B(a)P respectively) were anesthetized, sacrificed andmajor organs collected. Protein lysates were extracted from cardiac tissue for treat-ment groups 0, 600 and 1200 �g/kg BW respectively, for P-0, -5, -10, -15 and -53.Lysates protein concentration were determined and then analyzed by western blot.The data shown is a representative sample of three gels (see figure). The bands depict

TKs

Ed–

eadings. Values are expressed as the mean ± SEM of three separate experiments inhich blood pressure measurements were averaged from four-five rat offspring.

p-value ≤0.05 significantly different from control.

.4. In utero B(a)P exposure increases systolic blood pressure in aose-dependent manner in rat offspring

To determine whether in utero B(a)P exposure results inlterations in later-life cardiovascular phenotypes, offspring werenalyzed for heart rate, systolic and diastolic blood pressure.hese parameters were measured on P53. The results are shown asable 3B. The results shown in Table 3B and Fig. 3, demonstrate that

n utero B(a)P exposure induced a statistical significant increasen heart rate, systolic and diastolic blood pressure in a dose-ependent manner in exposed offspring. Control systolic bloodressure averaged 131.5 ± 5.8 mmHg. Systolic blood pressure inffspring from the 600 �g/kg BW B(a)P group indicated a small, buttatistically significant increase (19% higher than controls), whileffspring in the 1200 �g/kg BW B(a)P showed an even greaterncrease in systolic blood pressure as compared to controls (53%igher than controls).

.5. In utero exposure to B(a)P upregulates eNOS protein inffspring

As a means of determining whether the observed increasen systolic blood pressure was related to alterations in theenin–angiotensin system, heart tissue proteins critical to this

ystem were quantified using Western blot analysis. The resultshown in Fig. 4 illustrate that temporal developmental expressionf eNOS from B(a)P-exposed offspring cardiac tissue is positivelyodulated as a result of in utero B(a)P exposure. In control

able 3AEGG molecular pathway enrichment analysis of gene expression changes from control Pet.

KEGG enriched pathway Observed [O] Expected [E]

PPAR signaling pathway 6 0.40

Renin–angiotensin system 2 0.11

Hematopoietic cell lineage 5 0.42

Drug metabolism by CYPP450 4 0.45

Tight junction 5 0.73

Cell adhesion molecules-CAMs 5 0.86

Primary bile acid biosynthesis 2 0.08

Retinol metabolism 3 0.38

Metabolism of xenobiotics by CYPP450 3 0.39

nrichment analysis from control P 53 versus 1200 �g/kg BW transcriptome data set. Coerived by ratio of significantly altered genes mapping to the pathway versus expected nuraw enrichment p-value of hypergeometic test for enrichment. Column 4 – Benjamini a

immunocomplexes for eNOS and the internal control, GAPDH, at P-0, -5, -10, -15 and-53.

offspring, eNOS expression is high during the first postnatal weekand drops to presumably constitutive levels from P10 through P53.In exposed offspring, it is readily apparent that there is an over-all dose-dependent increase in developmental eNOS expression.Modulation of developmental eNOS expression as a result of inutero exposure to B(a)P (when compared to controls) is evidencedby very low expression during the first postnatal week followedby an increase in expression through P 53for the 600 �g/kg BWB(a)P-exposed offspring. This overall upregulation of developmen-

tal expression appears to be dose-dependent as developmentalexpression is further potentiated in the 1200 �g/kg BW B(a)P-exposed offspring (Fig. 4).

53 versus 1200 �g/kg BW B(a)P-exposed offspring heart tissue transcriptome data

Enrichment [R] = [O]/[E] Raw p-value BH adjusted p-value

14.88 3.31E−06 1.00E−0418.35 5.30E−03 2.13E−0211.91 6.58E−05 1.10E−03

8.84 1.10E−03 9.40E−036.85 9.00E−04 9.40E−035.84 1.70E−03 1.16E−02

24.46 3.00E−03 1.70E−027.98 6.40E−03 2.13E−027.75 6.90E−03 2.13E−02

lumn 1 – Significantly enriched KEGG pathway. Column 2 – Enrichment ratio (R)mber of genes mapping to pathway form a reference baseline database. Column 3

nd Hochburg adjusted p-value to correct for multiple testing.

62 G.E. Jules et al. / Toxicology 295 (2012) 56– 67

0.0

1.0

2.0

3.0

4.0

5.0

6.0

600 ug/kg

BW

1200 ug/kg

BW

600 ug/kg

BW

1200 ug/kg

BW

P-0 P- 53

Fold

Ch

an

ge

(Rel

ati

ve

to c

on

trol)

nNOS

eNOS

BH4/BH2

Ang II

Fig. 5. In utero B(a)P-exposure upregulates heart nNOS, eNOS, BH4/BH2 oxidore-ductase and AngII mRNA in offspring. Relative expression levels of nNOS, eNOS,BH4/BH2 and AngII as measured by qRT-PCR. Quantitative RT-PCR was performedusing iScript one-step RT-PCR kit with SYBR Green, PCR plates, optically clearadhesive plate seals (Bio-Rad Laboratories, USA), and RNA template from offspringexposed in utero to different concentrations of B(a)P (0, 600 and 1200 �g/kg BWrespectively). The mRNA expression levels were determined using primers pur-ctA

37l

eec6dmopcPT7doBptT

3

beowgpAcKelw

sg

Fig. 6. The effect of in utero B(a)P-exposure on genes in the “Regulation of BloodPressure” Gene Ontology biological processed (GO:008217) in LEH rat offspring.Angiotensin (AGT) was set as a seed gene in order to build an interaction and co-

4. Discussion

To the best of our knowledge, this is the first report of itskind showing that in utero B(a)P exposure from E14-E17 results in

Table 3BCardiovascular endpoints monitored in control and in utero B(a)P-exposed offspring.

LEH rats Heart rate (bmp) Systolic pressure(mmHg)

Diastolicpressure (mmHg)

hased from Invitrogen (USA). A Bio-Rad C1000 Thermal Cycler was used to detecthe fluorescence level. Relative expression was calculated using the formula 2−��CT .ll relative mRNA values were normalized to 18S rRNA levels.

.6. In utero B(a)P exposure upregulates eNOS, nNOS, AngII and,8-dihydrobiopterin (BH4/BH2) oxidoreductase (Spr) mRNA

evels in offspring.

In order to corroborate the overall developmental proteinxpression data obtained, qRT-PCR was performed for Ang II,NOS, nNOS and dihydrobiopterin oxidoreductase mRNAs. The foldhange in relative mRNA levels was greater for nNOS and AGT at00 �g/kg BW B(a)P on PND 53. Fig. 6 shows the corroborationata for the results shown as Fig. 5. The fold change in relativeRNA levels is greater for nNOS and AngII at 600 �g/kg BW B(a)P

n P53. Consistent with the developmental protein expressionrofiling data in Fig. 5, eNOS mRNA expression is 2.8 fold aboveontrol levels in the 1200 �g/kg BW B(a)P-exposed offspring on53 with AngII mRNA expression at 1.75 fold above control levels.he key observation of these experiments comes with analysis of,8-dihydrobiopterin NADP oxidoreductase or BH4/BH2 oxidore-uctase mRNA expression in the 1200 �g/kg BW B(a)P-exposedffspring on P53 in comparison to the other data epochs. That theH4/BH2 oxidoreductase and eNOS mRNA are upregulated in com-arison to the other experimental groups is significant and suggesthat early-life B(a)P exposure results in later-life eNOS uncoupling.his hypothesis is presented in the discussion section.

.7. Transcriptome microarray pathway enrichment analysis

The results from the transcriptome microarray were analyzedy gene set enrichment analysis for statistically significant over-xpressed pathways in a comparison of control versus exposedffspring [1200 �g/kg BW B(a)P]. The WEBGESTALT software toolas used to map transcripts which were up or down-regulated

reater than 2 fold to their corresponding reference Kyoto Encyclo-edia of Genes and Genomes (KEGG) pathways (Zhang et al., 2005).

hypergeometric test with a Benjamini-Hochburg (BH) false dis-overy rate correction was used to determine significantly enrichedEGG pathways. The results are shown in Table 3A. As would bexpected, a number of CYPs in exposed heart tissue were modu-ated as a result of in utero exposure to B(a)P. The genes identified

ere CYP2a2, CYP7a1 and CYP2b12.Of note is significant enrichment in the renin–angiotensin

ystem pathway (KEGG pathway: rno04614). AGT among otherenes involved in blood pressure regulation, was shown to be

expression network of associated genes in Rat using the GeneMANIA plug-in and theCytoscape bioinformatics platform. Nodes in grey had greater than 2-fold expressiondifferences (up or down-regulation) in the microarray dataset.

differentially expressed in the microarray and suggest that thismodulation is a result of in utero exposure to B(a)P. The results aredirectly relevant to a biological process pathway in animal mod-els for “regulation of blood pressure”. Further, we see this as anattempt to put these results into perspective with respect to thegene ontology literature in cardiovascular toxicology. In this modal-ity, Angiotensin (AngII) was set as a seed gene in order to build aninteraction and co-expression network of associated genes in Ratoffspring using the GeneMANIA plug in and the Cytoscape bioin-formatics platform.

Control 504.6 ± 15.7 131.6 ± 1.2 85.0 ± 4.2600 �g/kg 554.6 ± 26.2* 156.1 ± 45* 113.0 ± 3.3*

1200 �g/kg 466.3 ± 16.9* 200.4 ± 2.4* 155.6 ± 3.2*

* p < 0.05.

G.E. Jules et al. / Toxicology 295 (2012) 56– 67 63

Fig. 7. Proposed Mechanism for Endothelial Dysfunction. 7,8-dihydrobiopterin NADP oxidoreductase (BH4/BH2) mediated eNOS uncoupling resulting in (1) decreased nitricoxide production (NO), (2) increased superoxide radical (O2

•−) and (3) peroxynitrite anion (ONOO–). The effect of introducing oxidative B(a)P-metabolites into this cycleu minedu ng ear

ftfrmgirTrs

1df2gtatPtpaWet“eeripl

epApt[rmcdt

pregulates the expression of the BH4/BH2 oxidoreductase as was empirically deterncoupling of eNOS as a result of high oxidative cardiovascular tissue burdens duri

unctional cardiovascular deficits in later life. Reports in the litera-ure demonstrate that the daily exposure of humans to B(a)P rangesrom �g to mg levels (reviewed in Dutta et al., 2010). The debateegarding the high doses of B(a)P used in our studies becomes a bitore palatable upon critically analyzing the literature in the area

ermane to “fetal basis of PAH-induced deficits in different exper-mental model systems.” (spanning from toxicity to cancer)” Thiseview reveals that a range of concentrations have been utilized.he concentrations used in the present study are well within theange of B(a)P concentrations represented in these very importanteminal studies that have defined systemic toxicity.

Illustrative of this fact, pregnant C57 mice when gavaged with00 or 500 �g/kg BW/day B(a)P on embryonic days 10–13 showedysmorphogenesis of renal tubules and progressive loss of renalunction at postnatal weeks 7 and 52 in the offspring (Nanez et al.,011). In a representative high dose study, B6129F1 mice whenavaged with 1000 or 15,000 �g/kg BW/day di-methyl benzan-hracine (DMBA) on embryonic day 17 revealed lung adenomasnd carcinomas in offspring, that also exhibited significant mor-alities between postnatal weeks 10 and 30 (Castro et al., 2008).rior to this report, when C57 mice were subcutaneously adminis-ered 1000 �g DMBA or B(a)P/kg BW/week for 3-weeks prior toregnancy, the ovarian reserve in offspring was reduced by 1/3s compared to unexposed control mice (Jurisicova et al., 2007).e offer these seminal studies to demonstrate the range of B(a)P

xposure doses utilized in “differential experimental model sys-ems” that were employed to interrogate hypothesis germane tofetal basis of PAH-induced deficits in animal models.” The dosesmployed in the present study fall well within the range of the dosesmployed in the above-mentioned studies. Further, the toxic effectseported in the present study reinforce the notion that early-life,n utero exposure to PAHs results in a diverse spectrum of patho-hysiological changes that are transmitted and expressed during

ater-life in the offspring.In the present study, in utero exposure resulted in altered gene

xpression of both Angiotensinogen (AGT) and AngII, potentiallyredisposing the offspring to the development of hypertension.lthough similar studies have been done using a similar exposurearadigm in mice (Thackaberry et al., 2005; Aragon et al., 2008a,b)he AhR agonist used (i.e. 2, 3, 7, 8-tetrachlorodibenzo-[p]-dioxinTCDD]) was a much stronger agonist than B(a)P. However, theesults from these studies clearly demonstrate that the environ-

ental toxicant TCDD significantly altered genes involved in fetal

ardiac homeostasis, cell cycle regulation, and extracellular matrixevelopment and remodeling (Thackaberry et al., 2005). In addi-ion, Aragon et al. (2008a,b) further demonstrated that most of the

in Fig. 5. These three scenarios are proposed to lead to the apparent later-life (P53)ly-life, developmental processes.

TCDD-induced changes in cardiac gene expression observed duringfetal development remained induced in the adult mice, all of whichprobably further predispose the mice to cardiovascular dysfunction(Aragon et al., 2008a,b).

Very little is known of the long term effects of B(a)P on thedevelopment and function of the cardiovascular system of pre-natally exposed offspring. Endothelial dysfunction can be broadlydefined as a disruption in any of the regulatory processes of theendothelium, including an imbalance between vasorelaxing andconstricting factors leading to dysregulation of smooth muscle tone(Rubanyi, 1993). The AngII treatment of mice offspring exposed inutero and during lactation to TCDD, resulting in increased predis-position to renal fibrosis and hypertension in adulthood (Aragonet al., 2008a,b), clearly supports the findings in the present study.When AngII was infused during the pre-weaning period into TCDDexposed mice offspring, systolic blood pressure increased in arobust manner as compared to control offspring (Aragon et al.,2008a,b). These studies support the contention that the B(a)Pexposure-induced increase in systolic blood pressure in the presentstudy is likely mediated by the vasoconstricting factor, angiotensinII. In both human and animal models, hypertension is often associ-ated with increased circulating angiotensin II (Kaplan, 2002).

In the present study, we demonstrated that B(a)P [an aryl hydro-carbon (AhR) receptor agonist] precipitates toxic effects within thedeveloping cardiovascular system in our animal model. Previousstudies have reported variations on this central theme (Aboutablet al., 2009; Burstyn et al., 2005), and have even included otherAhR agonists (Heid et al., 2001; Kang et al., 2006; Kopf et al., 2008;Korashy and El-Kadi, 2006). In humans, 2,3,7,8-tetrachlorodibenzo-[p]-dioxin (TCDD; a much more potent and stable AhR agonistthan B(a)P) exposure was associated with cardiovascular diseasessuch as hypertension (Kang et al., 2006; Kim et al., 2003; Pesatoriet al., 2003). Polychlorinated biphenyls, also AhR agonists, havebeen shown to cause endothelial dysfunction. This effect may bemediated by increased oxidative stress from AhR-induced CYP1A1activity (Hennig et al., 2002; Ramadass et al., 2003).

There have been three previous studies conducted in animalmodels that have suggested that B(a)P exposure accelerates thedevelopment of atherosclerosis (Curfs et al., 2004; Penn and Snyder,1988; Yang et al., 2009), and the present study provides further evi-dence that this may be attributable to increased oxidative stress.The identification of the developmental period over which there

is formation/accumulation of the reactive 3-OH and 9-OH metabo-lites in the developing cardiovascular system is a key finding of thisstudy. The identified B(a)P exposure-induced metabolites couldfurther oxidize to form B(a)P quinones that would undergo redox

64 G.E. Jules et al. / Toxicology 295 (2012) 56– 67

Table 4(A) Genes found to be modulated subsequent to in utero B(a)P exposure in rat offspring. Expression fold changes of genes in “regulation of blood pressure” gene ontologybiological process (GO:008217) are shown as well as the REFSEQ-mRNA accession number; (B) genes found not to be modulated subsequent to in utero B(a)P exposure in ratoffspring.

REFSEQ-mRNA Fold Change Gene Symbol Gene Name

ANM 004797 8.9 Adipoq Adiponectin, C1Q and collagen domainNM 000029.3 8.5 AngII Angiotensinogen (serpin peptidase inhibitor clade A, member 8)NM 000025 9.3 Adrb3 Adrenergic, beta-3-, receptorNM 001058.3 9.9 Tacr1 Tachykinin receptor 1NM 138712 5.8 PPAR� Peroxisome proliferator-activated receptorNM 001057 −2.2 Tac2 Tachykinin 2

Gene symbol Gene name

BADAMTS18 ADAM metallopeptidase with thrombospondin type 1 motif 18AGTR2 Angiotensin II receptor, type 2GPD1 Glycerol-3-phosphate dehydrogenase 1 (soluble)HRASLS5 HRAS-like suppressor family, member 5Tac4 Tachykinin receptor 4Tacr2 Tachykinin receptor 2Tacr3 Tachykinin receptor 3TF TransferrinTFF2 Trefoil factor 2THRSP Thyroid hormone responsive protein, isoform CRA a

G us 120–

c2

sBodntliabfItt(ifcse

lfaeehttaS(bi

et

ene ontology biological process analysis of gene expression from control P 53 vers Fold change. Column 3 – Gene symbol. Column 4 – Gene name.

ycling and generate reactive oxygen species (Kerzee and Ramos,000; Kiruthiga et al., 2007).

In support of our findings as to involvement of reactive oxygenpecies are the experiments in Fig. 5 demonstrating that eNOS andH4/BH2 7,8-dihydrobiopterin NADP oxidoreductase or BH4/BH2xidoreductase mRNA is upregulated in offspring from the highose group. Collectively our data supports the proposed mecha-ism that is presented as Fig. 7. Recall that dihydrobiopterin and/oretrahydrobiopterin serve as critical co-factors for the endothe-ial nitric-oxide synthase (eNOS). Deficiency of BH4/BH2 resultsn eNOS uncoupling that is associated with increased superoxidend decreased NO• production (Kuzkaya et al., 2003). BH4 haseen shown to play a critical role in allowing for electron trans-er from the prosthetic heme to l-arginine (Kuzkaya et al., 2003).n the absence of BH4, electron flow from the reductase domain tohe oxygenase domain is diverted to molecular oxygen rather thano l-arginine, leading to a condition known as eNOS uncouplingXia et al., 1998; Radi et al., 1991), causing production of superox-de rather than nitric oxide. Superoxide reacts rapidly with NO• toorm the peroxynitrite anion (ONOO−), which is a strong biologi-al oxidant (Sampson et al., 1996) known to oxidize lipids, protein,ulfhydryls, and DNA and to cause nitration of tyrosines (Sampsont al., 1996; Zhao et al., 2001; Daiber and Ullrich, 2002).

Supplementation with BH4 is generally able to restore endothe-ial NO synthase (eNOS)-mediated NO formation and endothelialunction in hypertension, hypercholesterol-emia and diabetes (Alpnd Channon, 2004; Cosentino and Luscher, 1999; Vasquez-Vivart al., 2002). It is well known that nitric oxide (NO) generated byNOS critically determines vascular tone as well as vascular wallomeostasis (Fleming and Busse, 2003). Reduced NO bioavailabilityhen has been associated with an increase in the formation of reac-ive oxygen species within the vascular wall and generally servess the key determinant of endothelial dysfunction (Bauersachs andchafer, 2005). This phenomenon was demonstrated by Cai et al.2005) who showed reduced eNOS dimer/monomer ratio in com-ination with increased oxidative stress and reduced NO formation

n hyperglycaemic endothelial cells (Table 4).The paradoxical finding of a concomitant increase in eNOS

xpression and reduced endothelium-dependent vasodilata-ion/relaxation by Bouloumié et al. (1997), Bauersachs et al. (1999)

0 �g/kg BW transcriptome data set. Column 1 – REFSEQ mRNA number. Column 2

and Cosentino et al. (1997) has drawn attention to the fact thateNOS itself in pathological states may be the source of superoxideanions, i.e. “eNOS uncoupling” (for review, see Stuehr et al., 2001).Endothelial dysfunction and eNOS uncoupling are clearly apparentin experimental diabetes and in diabetic patients (Guzik et al., 2002;Hink et al., 2001) despite the fact that eNOS expression is actuallyincreased (Bauersachs and Schafer, 2005). The uncoupling of eNOShas also been linked to its monomerization (Zou et al., 2002).

Similarly, in Apo E knock-out mice, peroxynitrite-mediated BH4oxidation has also been identified as a pathogenic cause of eNOSuncoupling (Laursen et al., 2001). It is safe to say that numerouscommon diseases such as hypercholesterolemia, hypertension, dia-betes, and heart failure are associated with a loss of NO• productionby the endothelium, a condition commonly referred to as endothe-lial dysfunction (Zeiher et al., 1993). In many of these conditions,eNOS uncoupling seems to be present, leading to an increase inendothelial cell O2

•− production and a decrease in NO• production(Kuzkaya et al., 2003). In the present study, the results suggest eNOSuncoupling mediated by 7,8-dihydrobiopterin NADP oxidoreduc-tase (BH4/BH2) mRNA upregulation to result in (1) decreased nitricoxide production (NO), (2) increased superoxide radical (O2

•−) and(3) peroxynitrite anion (ONOO–). The effect of introducing oxida-tive B(a)P-metabolites into this cycle upregulates the expressionof the BH4/BH2 oxidoreductase as was empirically determined inFig. 5. These three scenarios are proposed to lead to the appar-ent later-life (P53) uncoupling of eNOS as a result of high oxidativecardiovascular tissue burdens during early-life, developmental pro-cesses.

Additionally, PAHs are also known to cause adverse inflamma-tory effects in the respiratory system (Borm et al., 1997). B(a)P andother AhR agonists increase the expression of proinflammatorycytokines such as interleukin-8 and tumor necrosis factor-alpha(TNF-�) which in turn cause infiltration of macrophages and neu-trophils into the lung (Borm et al., 1997; Podechard et al., 2008).Not only do activated pulmonary neutrophils cause increased ROSbut they also may act synergistically with pulmonary B(a)P to pro-

duce an even larger number of reactive B(a)P metabolites thanwould be produced in the absence of pulmonary neutrophils (Bormet al., 1997). Further, inflammatory cytokines, once produced, cir-culate systemically causing increased production of oxygen free

icolog

rKprti

niitstptttpithtp

5

ontlooo

F

0McSiuCN

C

A

tc

R

A

A

G.E. Jules et al. / Tox

adicals in distal tissues including vascular smooth muscle cells (Deeulenaer et al., 1998). Future work will focus on characterizingossible relationships between inflammatory mediators and PAHeactive metabolites serving as a source of oxidative stress leadingo increased NO bioactivity in the peripheral vasculature to resultn later-life cardiovascular diseased phenotypes in offspring.

It remains a daunting challenge to link exposure to compo-ents of air pollution during development with later-life alterations

n cardiovascular disease phenotypes. The present study is mostnformed by the genome-wide analyses of aryl hydrocarbon recep-or (AhR) agonist effects on gene clusters (Sartor et al., 2009). Thetudy by Sartor and colleagues has provided important informa-ion regarding the potential for dysregulation of potential operativeathways. The study found that the AhR in unstimulated cells bindso an extensive array of gene clusters with functions in the regula-ion of gene expression, differentiation and pattern specification,hereby connecting multiple morphogenetic and developmentalrograms. The global network that was identified constituted a crit-

cal new resource for the study of AhR-regulated gene expressionhat should prompt new hypotheses to promote a more compre-ensive understanding of the physiological role of the AhR and ofhe resulting deleterious health effects from exposure of the humanopulation to environmental AhR agonists.

. Conclusion

Exposure to polycyclic aromatic hydrocarbons during embry-nic life may derail the concerted expression of genes critical toormal cardiovascular system development to alter the normal pat-erns of expression of these genes. The resulting altered phenotypeikely persists throughout life and contributes to the determinationf disease susceptibility in the adult. Future studies from our lab-ratory will explore the possibility of epigenetic modifications inffspring tissues subsequent to in utero B(a)P-exposure.

unding

This work was supported, in part, by NIH grants S11ES014156-5, U54NS041071-002, 1R56ES017448-01A1 and 3P20D000516-07S1 to D.B.H.; 1R01CA142845-01A1 to A.R. Also,

ritical to the conduct of these studies were grants from theimons Foundation Autism Research Initiative, Research Centersn Minority Institutions (RCMI) grant G12RRO3032, Nuclear Reg-latory Commission Grant NRC-27-10-515 and Meharry Medicalollege-Vanderbilt University Alliance for Research Training ineuroscience Grant (T32MH065782).

onflict of interest statement

None.

cknowledgments

Special thanks to our colleagues Michael G. Izban, Ph.D. for assis-ance with RNA preparation analyses and Diana Marver, Ph.D. forritical review of the manuscript.

eferences

boutabl, M.E., Zordoky, B.N., El-Kadi, A.O., 2009. 3-Methylcholanthrene andbenzo(a)pyrene modulate cardiac cytochrome P450 gene expression and arachi-

donic acid metabolism in male Sprague Dawley rats. Br. J. Pharmacol. 158 (7),1808–1819.

lp, N., Channon, K.M., 2004. Regulation of endothelial nitric oxide synthase bytetrahydrobiopterin in vascular disease. Arterioscler. Thromb. Vasc. Biol. 24,413–420.

y 295 (2012) 56– 67 65

Aragon, A., Goens, M., Carbett, E., Walker, M., 2008a. Perinatal 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure sensitizes offspring to angiotensinII-induced hypertension. Cardiovasc. Toxicol. 8 (3), 145–154.

Aragon, A.C., Kopf, P.G., Campen, M.J., Huwe, J.K., Walker, M.K., 2008b. In utero andlactational 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure: effects on fetal andadult cardiac gene expression and adult cardiac and renal morphology. Toxicol.Sci. 101 (2), 321–330.

Baldwin, N.E., Chesler, E.J., Kirov, S., Langston, M.A., Snoddy, J.R., Williams, R.W.,Zhang, B., 2005. Computational, integrative, and comparative methods for theelucidation of genetic coexpression networks. J. Biomed. Biotechnol. 2005 (2),172–180.

Barker, D.J.P., 2000. Fetal Origins of Cardiovascular and Lung Disease. RCOG Press,New York, NY.

Barker, D.J.P., 1995. Fetal origins of coronary heart disease. BMJ 311, 171–174.Bauersachs, J., Bouloumié, A., Fraccarollo, D., Hu, K., Busse, R., Ertl, G., 1999. Endothe-

lial dysfunction in chronic myocardial infarction despite increased vascularendothelial nitric oxide synthase and soluble guanylyl cyclase expression: roleof enhanced vascular superoxide production. Circulation 100, 292–298.

Bauersachs, J., Schafer, A., 2005. Tetrahydrobiopterin and eNOS dimer/monomerratio-a clue to eNOS uncoupling in diabetes? Cardiovasc. Res. 65 (4),768–769.

Beckman, S.O., Thuvander, A., Andersson, C., 1998. Preview of PAHs in Food: Poten-tial Health Effects and Contents in Food, vol. 8. National Food Administration,Uppsala, Sweden.

Bielajew, C., Konkle, A.T.M., Merali, Z., 2002. The effects of chronic mild stress on maleSprague-Dawley and Long–Evans rats I. Biochem. Physiol. Anal. 136, 583–592.

Boffetta, P., Jourenkova, N., Gustavsson, P., 1997. Cancer risk from occupational andenvironmental exposure to polycyclic aromatic hydrocarbons. Cancer CausesControl 8 (3), 444–472.

Borm, P.J., Knaapen, A.M., Schins, R.P., Godschalk, R.W., Schooten, F.J., 1997. Neu-trophils amplify the formation of DNA adducts by benzo[a]pyrene in lung targetcells. Environ. Health Perspect. 105 (Suppl. 5), 1089–1093.

Bouayed, J., Desor, F., Rammal, H., Kiemer, A.K., Tybl, E., Schroeder, H., Rychen,G., Soulimani, R., 2009. Effects of lactational exposure to benzo[alpha]pyrene(B[alpha]P) on postnatal neurodevelopment, neuronal receptor gene expressionand behaviour in mice. Toxicology 259 (3), 97–106.

Bouloumié, A., Bauersachs, J., Linz, W., Schflkens, B., Wiemer, G., Fleming, I., 1997.Endothelial dysfunction coincides with an enhanced NO synthase expressionand superoxide anion production. Hypertension 30, 934–941.

Brown, L.A., Khousbouei, H., Goodwin, J.S., Irvin-Wilson, C.V., Ramesh, A., Sheng, L.,McCallister, M.M., Jiang, G.C., Aschner, M., Hood, D.B., 2007. Down-regulationof early ionotrophic glutamate receptor subunit developmental expression asa mechanism for observed plasticity deficits following gestational exposure tobenzo(a)pyrene. Neurotoxicology 28 (5), 965–978.

Burdick, A.D., Davis, J.W., Liu, I.I., Hudson, K.J., Shi, L.G., Monske, H., Burchiel, M.L.S.W.,2003a. Benzo(a)pyrene quinones increase cell proliferation, generate reactiveoxygen species, and transactivate the epidermal growth factor receptor in breastepithelial cells. Cancer Res. 63, 7825–7833.

Burdick, A.D., Davis, J.W., Liu, K.J., Hudson, L.G., Shi, H., Monske, M.L., Burchiel, S.W.,2003b. Benzo(a)pyrene quinones increase cell proliferation, generate reactiveoxygen species, and transactivate the epidermal growth factor receptor in breastepithelial cells. Cancer Res. 63 (22), 7825–7833.

Burstyn, I., Kromhout, H., Partanen, T., Svane, O., Langard, S., Ahrens, W., Kaup-pinen, T., Stucker, I., Shaham, J., Heederik, D., Ferro, G., Heikkila, P., Hooiveld, M.,Johansen, C., Randem, B., Boffetta, P., 2005. Polycyclic aromatic hydrocarbonsand fatal ischemic heart disease. Epidemiology 16 (6), 744–750.

Butler, J., Post, G., Lioy, P., Waldman, J., Greenberg, A., 1993. Assessment ofcarcinogenic risk from personal exposure to benzo(a)pyrene in the totalhuman environmental exposure study. J. Air Waste Manage. Assoc. 43 (7),970–977.

Castro, D.J., Baird, W.M., Pereira, C.B., Giovanini, J., Lohr, C.V., Fischer, K.A., Yu,Z., Gonzalez, F.J., Krueger, S.K., Williams, D.E., 2008. Fetal mouse Cyp1b1 andtransplacental carcinogenesis from maternal exposure to dibenzo(a,l)pyrene.Cancer Prevent. Res. 1 (2), 128–134.

Cai, S., Khoo, J., Channon, K.M., 2005. Augmented BH4 by gene transfer restores nitricoxide synthase function in hyperglycemic human endothelial cells. Cardiovasc.Res. 65, 823–831.

Cosentino, F., Hishikawa, K., Katusic, Z., Luscher, T.F., 1997. High glucose increasesnitric oxide synthase expression and superoxide anion generation in humanaortic endothelial cells. Circulation 96, 25–28.

Cosentino, F., Luscher, T.F., 1999. Tetrahydrobiopterin and endothelial nitric oxidesynthase activity. Cardiovasc. Res. 43, 274–278.

Curfs, D.M., Lutgens, E., Gijbels, M.J., Kockx, M.M., Daemen, M.J., Van Schooten, F.J.,2004. Chronic exposure to the carcinogenic compound benzo[a]pyrene induceslarger and phenotypically different atherosclerotic plaques in ApoE-knockoutmice. Am. J. Pathol. 164 (1), 101–108.

Daiber, A., Ullrich, V., 2002. Peroxynitrite reactions with heme and heme-thiolate(P450) proteins. Methods Enzymol. 359, 379–389.

De Keulenaer, G.W., Alexander, R.W., Ushio-Fukai, M., Ishizaka, N., Griendling, K.K.,1998. Tumour necrosis factor alpha activates a p22phox-based NADH oxidasein vascular smooth muscle. Biochem. J. 329 (Pt 3), 653–657.

Dutta, K., Ghosh, D., Nazmi, A., Kumawat, K.L., Basu, A., 2010. A common carcinogenbenzo[a]pyrene causes neuronal death in mouse via microglial activation. PLoSONE 5 (4), e9984.

Eriksson, J., Forsen, T., Tuomilehto, J., Osmond, C., Barker, D., 2000. Early growth,adult income and risk of stroke. Stroke 31, 869–874.

6 icology

F

F

G

G

G

H

H

H

H

H

H

J

K

K

K

K

K

K

K

K

K

L

L

L

L

M

M

M

M

6 G.E. Jules et al. / Tox

leming, I., Busse, R., 2003. Molecular mechanisms involved in the regulation of theendothelial nitric oxide synthase. Am. J. Physiol. Regul. Integr. Comp. Physiol.284, R1–R12.

lowers, L., Bleczinski, W.F., Burczynski, M.E., Harvey, R.G., Penning, T.M., 1996.Disposition and biological activity of benzo[a]pyrene-7,8-dione. A geno-toxic metabolite generated by dihydrodiol dehydrogenase. Biochemistry 35,13664–13672.

entner, N.J., Weber, L.P., 2011. Intranasal benzo[a]pyrene alters circadian bloodpressure patterns and causes lung inflammation in rats. Arch. Toxicol. 85,337–346.

rassman, J.A., Masten, S.A., Walker, N.J., Lucier, G.W., 1998. Animal models ofhuman response to dioxins. Environ. Health Perspect. 106 (Suppl. 2), 761–775.

uzik, T., Mussa, S., Gastaldi, D., Sadowski, J., Ratnatunga, C., Pillai, R., 2002. Mecha-nisms of increased vascular superoxide production in human diabetes mellitus:role of NAD(P)H oxidase and endothelial nitric oxide synthase. Circulation 105,1656–1662.

ales, C., Desai, M., Ozanne, S., Crowther, N.J., 1996. Fishing in the stream of dia-betes: from measuring insulin to the control of fetal organogenesis. Biochem.Soc. Trans. 24, 341–350.

annah, J.B., Hose, J.E., Landolt, M.L., Miller, B.S., Felton, S.P., Iwaoka, W.T., 1982.Benzo(a)pyrene-induced morphologic and developmental abnormalities inrainbow trout. Arch. Environ. Contam. Toxicol. 11 (6), 727–734.

eid, S.E., Walker, M.K., Swanson, H.I., 2001. Correlation of cardiotoxicity mediatedby halogenated aromatic hydrocarbons to aryl hydrocarbon receptor activation.Toxicol. Sci. 61 (1), 187–196.

eindel, J.J., 2005. The fetal basis of adult disease: role of environmental exposures– introduction. Birth Defects Res. A: Clin. Mol. Teratol. 73, 131–132.

ennig, B., Meerarani, P., Slim, R., Toborek, M., Daugherty, A., Silverstone, A.E.,Robertson, L.W., 2002. Proinflammatory properties of coplanar PCBs: in vitroand in vivo evidence. Toxicol. Appl. Pharmacol. 181 (3), 174–183.

ink, U., Li, H., Mollnau, H., Oelze, M., Matheis, E., Hartmann, M., 2001. Mecha-nisms underlying endothelial dysfunction in diabetes mellitus. Circ. Res. 88,e14–e22.

urisicova, A., Taniuchi, A., Li, H., Shang, Y., Antenos, M., Detmar, J., Xu, J., Matikainen,T., Ito Hernandez, A., Nunez, G., Casper, R.F., 2007. Maternal exposure to poly-cyclic aromatic hydrocarbons diminishes murine ovarian reserve via inductionof Harakiri. J. Clin. Invest. 117 (12), 3971–3978.

ang, H.J., Kim, H.J., Kim, S.K., Barouki, R., Cho, C.H., Khanna, K.K., Rosen, E.M.,Bae, I., 2006. BRCA1 modulates xenobiotic stress-inducible gene expression byinteracting with ARNT in human breast cancer cells. J. Biol. Chem. 281 (21),14654–14662.

aplan, N., 2002. Hypertension and diabetes. J. Hum. Hypertens. 16 (Suppl. 1),S56–S60.

erzee, J.K., Ramos, K.S., 2000. Activation of c-Ha-ras by benzo(a)pyrene in vascularsmooth muscle cells involves redox stress and aryl hydrocarbon receptor. Mol.Pharmacol. 58 (1), 152–158.

im, J.S., Lim, H.S., Cho, S.I., Cheong, H.K., Lim, M.K., 2003. Impact of Agent Orangeexposure among Korean Vietnam veterans. Ind. Health 41, 149–157.

im, S.K., 2007. Common aging pathways in worms, flies, mice and humans. J. Exp.Biol. 210, 1607–1612.

iruthiga, P.V., Shafreen, R.B., Pandian, S.K., Arun, S., Govindu, S., Devi, K.P., 2007. Pro-tective effect of silymarin on erythrocyte haemolysate against benzo(a)pyreneand exogenous reactive oxygen species (H2O2) induced oxidative stress. Chemo-sphere 68 (8), 1511–1518.

opf, P., Huwe, J., Walker, M., 2008. Hypertension, cardiac hypertrophy,and impaired vascular relaxation induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin are associated with increased superoxide. Cardiovasc. Toxicol. 8 (4),181–193.

orashy, H.M., El-Kadi, A.O.S., 2006. The role of aryl hydrocarbon receptor in thepathogenesis of cardiovascular diseases. Drug Metab. Rev. 38 (3), 411–450.

uzkaya, N., Weissmann, N., Harrison, D., Dikalov, S., 2003. Interactions of peroxyni-trite, tetrahydrobiopterin, ascorbic acid, and thiols: implications for uncouplingendothelial nitric-oxide synthase. J. Biol. Chem. 278 (25), 22546–22554.

aursen, J., Somers, M., Kurz, S., McCann, L., Warnholtz, A., Freeman, B.A., 2001.Endothelial regulation of vasomotion in apoE-deficient mice: implications forinteractions between peroxynitrite and tetrahydrobiopterin. Circulation 103,1282–1288.

ioy, P., Waldman, J., Greenberg, A., Harkov, R., Pietarinen, C., 1988. The Total HumanEnvironmental Exposure Study (THEES) to benzo(a)pyrene: comparison of theinhalation and food pathways. Arch. Environ. Health 43 (4), 304–312.

orentzen, R.J., Ts’o, P.O., 1977. Benzo[a]yrenedione/benzo[a]pyrenediol oxida-tionreduction couples and the generation of reactive reduced molecular oxygen.Biochemistry 16, 1467–1473.

orentzen, R.J., Lesko, S.A., McDonald, K., Ts’o, P.O.P., 1979. Toxicity of metabolicbenzo(a)pyrenediones to cultured cells and the dependence upon molecularoxygen. Cancer Res. 39 (8), 3194–3198.

artyn, C., Barker, D., Osmond, C., 1996. Mothers’ pelvic size, fetal growth, and deathfrom stroke and coronary heart disease in men in the UK. Lancet 348, 1264–1268.

cCallister, M.M., Maguire, M., Ramesh, A., Aimin, Q., Liu, S., Khoshbouei, H., Aschner,M., Ebner, F.F., Hood, D.B., 2008. Prenatal exposure to benzo(a)pyrene impairslater-life cortical neuronal function. Neurotoxicology 29 (5), 846–854.

iller, K.P., Ramos, K.S., 2001. Impact of cellular metabolism on the biological effectsof benzo(a)pyrene and related hydrocarbons. Drug Metab. Rev. 33 (1), 1–35.

ostafavi, S., Debajyoti, R., Warde-farley, D., Grouios, C., 2008. GeneMANIA: a real-time multiple association network integration algorithm for predicting genefunction. Genome Biol. S4 (Suppl. 1), 9.

295 (2012) 56– 67

Nanez, A., Ramos, I.N., Ramos, K.S., 2011. A mutant Ahr allele protects the embry-onic kidney from hydrocarbon-induced deficits in fetal programming. Environ.Health Perspect. 119 (12).

National Academy of Sciences, 1983. Polycyclic Aromatic Hydrocarbons: Evaluationof Sources and Effects, vol. 476. National Academy Press, Washington, DC.

Penn, A., Snyder, C., 1988. Arteriosclerotic plaque development is “promoted” bypolynuclear aromatic hydrocarbons. Carcinogenesis 9 (12), 2185–2189.

Penning, T.M., Ohnishi, S.T., Ohnishi, T., Harvey, R.G., 1996. Generation of reactiveoxygen species during the enzymatic oxidation of polycyclic aromatic hydro-carbon trans-dihydrodiols catalyzed by dihydrodiol dehydrogenase. Chem. Res.Toxicol. 9, 84–92.

Perera, F.P., Jedrychowski, W., Rauh, V., Whyatt, R.M., 1999. Molecular epidemiologicresearch on the effects of environmental pollutants on the fetus. Environ. HealthPerspect. 107 (Suppl. 3), 451–460.

Perera, F.P., Li, Z., Whyatt, R., Hoepner, L., Wang, S., Camann, D., Rauh, V., 2009.Prenatal airborne polycyclic aromatic hydrocarbon exposure and child IQ at age5 years. Pediatrics 124 (2), e195–e202.

Perera, F.P., Rauh, V., Tsai, W.Y., Kinney, P., Camann, D., Barr, D., Bernert, T., Garfinkel,R., Tu, Y.H., Diaz, D., Dietrich, J., Whyatt, R.M., 2003. Effects of transplacen-tal exposure to environmental pollutants on birth outcomes in a multiethnicpopulation. Environ. Health Perspect. 111 (2), 201–205.

Perera, F.P., Tang, D., Rauh, V., Tu, Y.H., Tsai, W.Y., Becker, M., Stein, J.L., King,J., Del, P.G., Lederman, S.A., 2007. Relationship between polycyclic aromatichydrocarbon-DNA adducts, environmental tobacco smoke, and child develop-ment in the World Trade Center cohort. Environ. Health Perspect. 115 (10),1497–1502.

Perera, F.P., Whyatt, R.M., Jedrychowski, W., Rauh, V., Manchester, D., Santella, R.M.,Ottman, R., 1998. Recent developments in molecular epidemiology: a study ofthe effects of environmental polycyclic aromatic hydrocarbons on birth out-comes in Poland. Am. J. Epidemiol. 147 (3), 309–314.

Pesatori, A.C., Consonni, D., Bachetti, S., Zocchetti, C., Bonzini, M., Baccarelli, A.,Bertazzi, P.A., 2003. Short- and long-term morbidity and mortality in the popu-lation exposed to dioxin after the Seveso accident. Ind. Health 41 (3), 127.

Phillips, D.H., 1999. Polycyclic aromatic hydrocarbons in the diet. Mut. Res./Genet.Toxicol. Environ. Mut. 443 (1–2), 139–147.

Podechard, N., Lecureur, V., Le Ferrec, r., Guenon, E., Sparfel, I., Gilot, L., Gordon, D.,Lagente, J.R., Fardel, V.O., 2008. Interleukin-8 induction by the environmentalcontaminant benzo(a)pyrene is aryl hydrocarbon receptor-dependent and leadsto lung inflammation. Toxicol. Lett. 177 (2), 130–137.

Radi, R., Beckman, J.S., Bush, K.M., Freeman, B.A., 1991. Peroxynitrite oxidation ofsulfhydryls. The cytotoxic potential of superoxide and nitric oxide. J. Biol. Chem.266, 4244–4250.

Ramadass, P., Meerarani, P., Toborek, M., Robertson, L.W., Hennig, B., 2003. Dietaryflavonoids modulate PCB-induced oxidative stress CYP1A1 induction, andAhR-DNA binding activity in vascular endothelial cells. Toxicol. Sci. 76 (1),212–219.

Ramesh, A., Archibong, A., Niaz MS, 2010. Ovarian susceptibility to benzo[a]pyrene:tissue burden of metabolites and DNA adducts in F-344 rats. J. Toxicol. Environ.Health A 73, 1611–1625.

Ramesh, A., Archibong, A.E., Hood, D.B., Guo, Z., Loganathan, B.G., 2011. Globalenvironmental distribution and human health effects of polycyclic aromatichydrocarbons. In: Global Contamination Trends of Persistent Organic Chemicals.CRC Press, Boca Raton, pp. 95–124.

Rich-Edwards, J., Stampfer, M., Manson, J., Rosner, B., Hankinson, S., Colditz, G., Wil-lett, W., Hennekens, C.H., 1997. Birth weight and risk of cardiovascular diseasein a cohort of women followed up since 1976. BMJ 315, 396–400.

Rubanyi, G.M., 1993. The role of endothelium in cardiovascular homeostasis anddiseases. J. Cardiovasc. Pharmacol. 22 (Suppl. 4), S1–S14.

Sampson, J.B., Rosen, H., Beckman, J.S., 1996. Peroxynitrite-dependent tyrosine nitra-tion catalyzed by superoxide dismutase, myeloperoxidase, and horseradishperoxidase. Methods Enzymol. 269, 210–218.

Sartor, M., Schnekenburger, M., Marlowe, J., Reichard, J., Wang, Y., Fan, Y., Ma, C.,Karyala, S., Halbleib, D., Liu, X., Medvedovic, M., Puga, A., 2009. Genomewideanalysis of aryl hydrocarbon receptor binding targets reveals an extensive arrayof gene clusters that control morphogenetic and developmental programs. Env-iron. Health Perspect. 117, 1139–1146.

Shannon, P., Markiel, A., Ozier, O., Baliga, N.S., Wang, J.T., Ramage, D., Amin,N., Schwikowski, B., Ideker, T., 2003. Cytoscape: a software environment forintegrated models of biomolecular interaction networks. Genome Res. 13,2498–2504.

Sheng, L., Ding, X., Ferguson, M., McCallister, M., Rhoades, R., Maguire, M., Ramesh,A., Aschner, M., Campbell, D., Levitt, P., Hood, D.B., 2010. Prenatal polycyclicaromatic hydrocarbon exposure leads to behavioral deficits and downregulationof receptor tyrosine kinase, MET. Toxicol. Sci. 118 (2), 625–634.

Stuehr, D., Pou, S., Rosen, G.M., 2001. Oxygen reduction by nitric-oxide synthases. J.Biol. Chem. 276, 14533–14536.

Thackaberry, E.A., Jiang, Z., Johnson, C.D., Ramos, K.S., Walker, M.K., 2005. Toxi-cogenomic profile of 2,3,7,8-tetrachlorodibenzo-p-dioxin in the murine fetalheart: modulation of cell cycle and extracellular matrix genes. Toxicol. Sci. 88(1), 231–241.

Thirman, M.J., Albrecht, J.H., Krueger, M.A., Erickson, R.R., Cherwitz, D.L., Park, S.S.,

Gelboin, H.V., Holtzman, J.L., 1994. Induction of cytochrome CYPIA1 and for-mation of toxic metabolites of benzo[a]pyrene by rat aorta: a possible role inatherogenesis. Proc. Natl. Acad. Sci. U. S. A. 91 (12), 5397–5401.

Uno, S., Dalton, T.P., Derkenne, S., Curran, C.P., Miller, M.L., Shertzer, H.G., Nerbert,D.W., 2004. Oral exposure to benzo[a]pyrene in the mouse: detoxication by

icolog

V

W

W

W

W

G.E. Jules et al. / Tox

inducible cytochrome P450 is more important than metabolic activation. Mol.Pharmacol. 65, 1225–1237.

asquez-Vivar, J., Martasek, P., Whitsett, J., Joseph, J., Kalyanaraman, B., 2002. Theratio between tetrahydrobiopterin and oxidized tetrahydrobiopterin analoguescontrols superoxide release from endothelial nitric oxide synthase: an EPR spintrapping study. Biochem. J. 362, 733–739.

ang, Z., Yang, H., Ramesh, A., Roberts, I.I., Zhou, L.J., Lin, L., Zhao, X., Guo,Y.Z., 2009. Overexpression of Cu/Zn-superoxide dismutase and/or catalaseaccelerates benzo(a)pyrene detoxification by upregulation of the aryl hydro-carbon receptor in mouse endothelial cells. Free Radic. Biol. Med. 47 (8),1221–1229.

HO, 2010. Some non-heterocyclic polycyclic aromatic hydrocarbons and somerelated exposures. IARC Monographs on the Evaluation of the Carcinogenic Risksto Humans, vol. 92. World Health Organization, Geneva, Switzerland, 861 pp.

orld Health Organization, 2003. Selected nitro- and nitro-oxy-polycyclic aromatichydrocarbons. Environmental Health Criteria 229, United Nations EnvironmentProgramme, the International Labour Organization and the World Health Orga-

nization, Geneva.

ormley, D.D., Chirwa, S., Nayyar, T., Wu, J., Johnson, S., Brown, L.A., Harris, E.,Hood, D.B., 2004. Inhaled benzo(a)pyrene impairs long-term potentiation inthe F1 generation rat dentate gyrus. Cell. Mol. Biol. (Noisy.-le-grand) 50 (6),715–721.

y 295 (2012) 56– 67 67

Wu, J., Ramesh, A., Nayyar, T., Hood, D.B., 2003. Assessment of metabolites andAhR and CYP1A1 mRNA expression subsequent to prenatal exposure to inhaledbenzo(a)pyrene. Int. J. Dev. Neurosci. 21 (6), 333–346.

Xia, Y., Tsai, A.L., Berka, V., Zweier, J.L., 1998. Superoxide generation from endothelialnitric-oxide synthase. A Ca2+/calmodulin-dependent and tetrahydrobiopterinregulatory process. J. Biol. Chem. 273, 25804–25808.

Yang, H., Zhou, L., Wang, Z., Roberts, I.I., Lin, L.J., Zhao, X., Guo, Y.Z., 2009.Overexpression of antioxidant enzymes in ApoE-deficient mice suppressesbenzo(a)pyrene-accelerated atherosclerosis. Atherosclerosis 207 (1), 51–58.

Zeiher, A.M., Drexler, H., Saurbier, B., Just, H., 1993. Endothelium-mediated coronaryblood flow modulation in humans. Effects of age, atherosclerosis, hypercholes-terolemia, and hypertension. J. Clin. Invest. 92, 652–662.

Zhang, B., Kirov, S., Snoddy, J., 2005. WebGestalt: an integrated system for exploringgene sets in various biological contexts. Nucleic Acids Res. 33 (Web Server issue),W741–W748.

Zhang, Y., Ramos, K.S., 2008. The development of abdominal aortic aneurysms inmice is enhanced by benzo(a)pyrene. Vasc. Health Risk Manag. 4 (5), 1095–1102.

Zhao, K., Whiteman, M., Spencer, J.P., Halliwell, B., 2001. DNA damage by nitrite andperoxynitrite: protection by dietary phenols. Methods Enzymol. 335, 296–307.

Zou, M., Shi, C., Cohen, R.A., 2002. Oxidation of the zinc-thiolate complex and uncou-pling of endothelial nitric oxide synthase by peroxynitrite. J. Clin. Invest. 109,817–826.