A

augtl(P(e©

K

1

apoasc

CT

w

1d

Biochemical Engineering Journal 39 (2008) 435–442

Improving albumin production of hepatic lineage cells frommouse embryonic stem cells in vitro

Chih-Hsiu Yin a, Wannhsin Chen b, Chang-Chun Hsiao c,d,∗,Chao-Long Chen d, Wen-Teng Wu e,∗∗

a Department of Chemical Engineering, National Tsing Hua University, Hsinchu 300, Taiwanb Biomedical Engineering Research Laboratories, Industrial Technology Research Institute, Chutung, Hsinchu 310, Taiwan

c Graduate Institute of Clinical Medical Sciences, College of Medicine, Chang Gung University,Kaohsiung 833, Taiwan

d Liver Transplant Program, Chang Gung Memorial Hospital-Kaohsiung Medical Center,Chang Gung University, College of Medicine, Kaohsiung 833, Taiwan

e Department of Chemical Engineering, National Cheng Kung University, Tainan 701, Taiwan

Received 7 November 2006; received in revised form 15 October 2007; accepted 17 October 2007

bstract

Embryonic stem (ES) cells can differentiate into hepatic lineage cells in vitro and can potentially be used as source of hepatocytes in researchnd therapy. A good source of ES cell-derived hepatocytes with greater liver function may be needed when attempting to transplant hepatocytes orse bioartificial livers to treat liver disease. This in vitro study explores the use of mouse ES cells to derive hepatic lineage cells able to producereater levels albumin. To do this we designed a series of experimental studies and developed a refined culture method which involved adjustinghe composition of culture medium and the time that it would be used. The embryoid bodies (EBs) cultured by this method produced hepaticineage cells capable of producing high amounts of albumin (1.90 ± 0.198 pg/h cell). These cells, which were able to uptake indocyanine greenICG), expressed the hepatic genes �1-anti-trypsin (AAT), �-fetoprotein (AFP), albumin, carbamoyl-phosphate synthetase 1 (CPS1), cytochrome

450 7A1 (CYP7A1), glucose-6-phosphatase (G6P), tyrosine aminotransferase (TAT), tryptophan 2,3-dioxygenase (TDO2), and transthyretinTTR). In conclusion, we found that this method allowed us to effectively derive high albumin-producing ES cell-derived hepatic lineage cells forxperimental and clinical use.

2007 Elsevier B.V. All rights reserved.

umin

tti

oc

eywords: Embryonic stem cells; Hepatic differentiation; Dexamethasone; Alb

. Introduction

Hepatocytes are very useful in the treatment of liver failure,s they can be used to develop bioartificial livers [1] and be trans-lanted [2,3]. They can also be used to assess the metabolismf xenobiotics in vitro for drug screening [4,5]. However, these

pplications of hepatocytes are limited by the shortage of stableources of human hepatocytes. Immortalized human hepatocytesan be found in greater quantities and have been used as alterna-

∗ Corresponding author at: Graduate Institute of Clinical Medical Sciences,hang Gung University, 123, Ta-Pei Road, Niao-Sung, Kaohsiung 833, Taiwan.el.: +886 7 7317123x8856; fax: +886 7 7324841.

∗∗ Corresponding author. Tel.: +886 6 2376734; fax: +886 6 2754228.E-mail addresses: cchsiao@mail.cgu.edu.tw (C.-C. Hsiao),

twu@mail.ncku.edu.tw (W.-T. Wu).

[dhhbhmr[u

369-703X/$ – see front matter © 2007 Elsevier B.V. All rights reserved.oi:10.1016/j.bej.2007.10.014

ives to human hepatocytes. However, due to dedifferentiation,heir therapeutic efficacy is less than ideal and they are used withncreased risk of malignant transformation [6].

Hepatic lineage cells have recently been derived from embry-nic stem (ES) cells in vitro [7]. ES cells, which are the innerell mass of blastocysts with pluripotent and self-renewal ability8,9], can differentiate into hepatic lineage cells via spontaneousifferentiation or induction of hepatotrophic factors [7]. Theepatic phenotypes of the ES cell-derived hepatic lineage cellsave been found to express hepatic genes and hepatic proteinsy functional assay, morphology, and in vivo assay [7]. Theyave also been found to have therapeutic applications in animal

odels, in which injection of these cells could improve survival

ates and liver function in mice with DMN-induced cirrhosis10] or CCl4-injured livers [11,12]. Therefore, ES cells can besed as a potentially unlimited source of functional hepatocytes.

4 ginee

sctgsphtchiwhhdihc

ictmttslduphabap

2

2

B

wmD11aGcs11fh

2

co(2swtoaaIFo1

mthd

2

Ffcd

36 C.-H. Yin et al. / Biochemical En

ES cells differentiate spontaneously, are often found inmaller populations and have lower liver function hepatic lineageells. One suggested strategy of improving hepatic differentia-ion and liver function of these cells is to add hepatotrophicrowth factors and inducers. ES cell differentiation in vitro isimilar to embryogenesis [13–15]. Hence, some studies haveroposed gradually adding fibroblast growth factors (FGFs),epatocyte growth factor (HGF) and oncostatin M (OSM) sohat the differentiation of mouse ES cells in liver developmentan be mimicked [16,17]. The effect of non-growth factors onepatocyte differentiation from ES cells has also been exam-ned. Dexamethasone (Dex), insulin, transferrin, and seleniumere been found able to improve production of ES cell-derivedepatic lineage cells with mature hepatic markers [17]. Bothuman insulin and Dex have been found to enhance the hepaticifferentiation of mouse ES cells [18]. In addition, in the stud-es mentioned above, the most suitable extracellular matrix forepatic differentiation of ES cells has been reported to be type Iollagen [10,17–19].

In this study, we systematically investigate the factors thatnfluence hepatic differentiation of mouse ES cells. Duringourse of our experiments, we first discovered that by adjustinghe time at which the culture medium was used, we could pro-

ote the efficient differentiation of hepatic lineage cells. Onceiming was found to affect differentiation, we experimented withhe composition of culture medium. Based on our findings from aeries of studies, we refined the culture method so that the hepaticineage cells we derived from mouse ES cells were able to pro-uce high levels of albumin. The hepatic lineage cells we derivedsing this method were also found to have mature hepatocytehenotypes capable of ICG uptake and expression of matureepatic genes. In conclusion, the derivation of more mature hep-tic lineage cells with greater production of albumin achievedy the refined culture method makes possible the greater avail-bility of more functional hepatocytes for experimental use andossible treatment of liver disease.

. Materials and methods

.1. ES cells cultivation

Mouse ES-D3 cells used in this study were obtained fromioresources Collection and Research Center (Taiwan). ES cells

Edw

ig. 1. Flowchart of hepatic differentiation of ES cells. ES cells differentiated into heor 2 days, and attached culture for 13 days. To improve hepatic differentiation, HD multured in MES medium from day 0 to 7 and then they were cultured in HD mediumescribed in Section 3.

ring Journal 39 (2008) 435–442

ere maintained in an undifferentiated state on feeder cells inouse embryonic stem (MES) cell medium consisting of 85%ulbecco’s Modified Eagle’s Medium (DMEM, Gibco, USA),5% FBS (ES cell grade, Gibco), 12.5 U/ml penicillin (Gibco),2.5 �g/ml streptomycin (Gibco), 0.1 mM non-essential aminocid (NEAA, Gibco), and 0.1 mM �-mercaptoethanol (�-ME,ibco). Feeder cells were primary mouse embryonic fibroblasts

ultured in mouse embryonic fibroblast (MEF) medium con-isting of 90% DMEM, 10% FBS, 12.5 U/ml penicillin, and2.5 �g/ml streptomycin. The feeder cells were inactivated by0 �g/ml mitomycin C (Sigma, USA) for 2.5–3 h before useor cultivation of ES cells. All cells were cultured at 37 ◦C in aumidified, 5% CO2 incubator.

.2. Hepatic differentiation of ES cells

Fig. 1 shows the flowchart of hepatic differentiation of ESells in this study. To induce ES cell differentiation, embry-id bodies (EBs) were formed from ES cells in hanging drops900 cells per 30 �l drop of MES medium) in petri dishes fordays, and then transferred the EBs in another petri dishes for

uspension culture for additional 2 days. The 4-day-old EBsere collected and inoculated into 24-well plates coated with

ype I collagen (BD Biosciences, USA), each well containednly one EB. To improve the efficiency of hepatic differenti-tion, a hepatocyte differentiation (HD) medium was appliedt various cultivation times. HD medium consisted of 85%scove’s modified Dulbecco’s medium (IMDM, Gibco), 15%BS, 0.1 mM NEAA, 0.1 mM �-ME, 1/100 dilution of stockf ITS (Gibco), 100 nM Dex (Sigma), 12.5 U/ml penicillin, and2.5 �g/ml streptomycin.

In some experiments, EBs were formed and cultured in MESedium for a specified duration. They were then cultured in

rial media at a time point determined to be most conducive toepatic differentiation. The compositions of the trial media areescribed in Section 3.

.3. Experimental design

To examine the factors that affect hepatic differentiation ofS cells, a series of experiments using two-level full factorialesigns were carried out. Experimental design and data analysisere performed by Design-Expert (Stat-Ease, USA) software.

patic lineage cells via three steps: hanging drops for 2 days, suspension cultureedium was applied at an optimal time. As shown in this figure, EBs formed andfrom day 7 to 17. Detail of screening optimal time to introduce HD medium is

ginee

Adc

2

esbqdEbwaacwcbala

2

cDi

t2itbmgtaAamaU

2e

dmPwmbt2

TP

G

�

A

A

A

C

C

G

T

T

T

C.-H. Yin et al. / Biochemical En

ll data are shown as mean ± standard deviation. Some of theata were analyzed statistically by ANOVA, with a p value < 0.05onsidered statistically significant.

.4. Albumin measurement

EBs for hepatic differentiation were replaced with new mediavery two days. Conditioned media was harvested for albuminecretion assay on day 11, 13, 15, and 17. Albumin secretedy differentiated cells was measured by mouse albumin ELISAuantitation kit (Bethyl, USA) according to the manufacturer’sirections. The specificity of the antibody of the mouse albuminLISA kit was tested and found to have no cross reactivity withovine albumin (data not shown). The albumin yield of EBsas used to evaluate hepatic differentiation, which was defined

s the sum of all albumin produced from day 11 to 17. Thelbumin production of albumin-positive cells could also be cal-ulated by combining the data of FACS analysis. On day 17, EBsere analyzed to determine their percentage of albumin-positive

ells and total albumin production (the sum of 24 EBs in 48 h)y FACS analysis and ELISA, respectively. Consequently, thelbumin production of albumin-positive cells could be calcu-ated and was presented as picograms of albumin secreted perlbumin-positive cell per hour.

.5. FACS analysis

The differentiated cells were dissociated by 2500 U/ml type Iollagenase (Gibco) while being incubated for 30 min at 37 ◦C.uring the incubation, pipetting was done several times to

mprove cell dissociation. The dissociated cells were washed

(paw

able 1rimers and RT-PCR conditions

ene Primers Anne

-Actin TTCCTTCTTGGGTATGGAAT 55GAGCAATGATCTTGATCTTC

AT AATGGAAGAAGCCATTCGAT 55AAGACTGTAGCTGCTGCAGC

FP TCGTATTCCAACAGGAGG 55AGGCTTTTGCTTCACCAG

lbumin GCTACGGCACAGTGCTTG 55CAGGATTGCAGACAGATAGTC

PS1 ATGACGAGGATTTTGACAGC 60CTTCACAGAAAGGAGCCTGA

YP7A1 TACGCATGTTTCTCAACGATAC 55TCTTGGACAGCAAATAGTCTTC

6P CTACCTGCTACTAAAAGGGCTAGG 60GCTAGGCAGTATGGGATAAGACTG

AT TATCCTGAGGGTACCAGTTTACC 58TCTTCGACTTCTCTCTGGTGTAG

DO2 TGCGCAAGAACTTCAGAGTGA 58AGCAACAGCTCATTGTAGTCT

TR CTCACCACAGATGAGAAG 55GGCTGAGTCTCTCAATTC

ring Journal 39 (2008) 435–442 437

wice in ice-cold PBS and fixed in 4% paraformaldehyde for0 min at room temperature. The fixed cells were washed twicen PBS and incubated in permeabilizing buffer for 30 min at roomemperature for permeabilizing and blocking. Permeabilizinguffer consisted of PBS, 0.5% saponin (Sigma), and 5% skimilk. To detect albumin expression, the cells were incubated with

oat anti-mouse albumin antibody (Bethyl) for 30 min at roomemperature. The cells were then washed two times in the perme-bilizing buffer, followed by staining with chicken anti-goat IgGlexa Fluor 488 antibody (Molecular probes, USA) for 30 min

t room temperature. The stained cells were washed twice in per-eabilizing buffer, twice in PBS, and finally suspended in PBS

nd analyzed on a flow cytometer FACScan (Becton Dickinson,SA).

.6. ICG uptake and double staining for albuminxpression by immunostaining

The cellular uptake of ICG was examined as previouslyescribed by Yamada et al. [20]. Differentiated cells were sub-erged in MES medium containing 1 mg/ml ICG (Daiichiharmaceutical Taiwan Ltd., Taiwan) for 15 min at 37 ◦C. Theyere then washed twice in D-PBS and observed under a lighticroscope equipped with a digital camera. The cells would later

e examined for expression of albumin. To prepare them for this,hey were fixed in 4% paraformaldehyde at room temperature for0 min. The fixed cells were incubated in permeabilizing buffer

same as for FACS analysis) for 30 min at room temperature forermeabilizing and blocking. To detect albumin expression, goatnti-mouse albumin antibody was added for 30 min. The cellsere then washed twice in permeabilizing buffer, followed by

aling temperature (◦C) Cycles Product size (bp)

20 200

30 484

25 173

25 260

35 126

35 583

30 369

30 211

35 420

25 225

4 gineering Journal 39 (2008) 435–442

sfle

2

GR(ief1ppwpp

3

3

tucIicoftuisaicNa

Fig. 2. Albumin yield of EBs by various cultivation time to change to HDmedium. EBs formed and cultured in HD medium for hepatic differentiationat day 0, 5, 7, and 9. Before cultured in HD medium, EBs were cultured in MESmedium. In addition, some of EBs were cultured in MES medium alone duringttE

safiaodomsmcric(t(am

3

TM

R

12345678

38 C.-H. Yin et al. / Biochemical En

taining with chicken anti-goat IgG Alexa Fluor 488 antibodyor 30 min. The stained cells were washed twice in permeabi-izing buffer and twice in PBS. Finally, the stained cells werexamined under a fluorescence microscope.

.7. RT-PCR

Total RNA of cells was extracted by RNeasy Mini Kit (QIA-EN, Netherlands). RT-PCR was performed with a One-StepT-PCR Kit (QIAGEN) in a GeneAmp PCR System 9700

Applied Biosystems, USA) according to the manufacturer’snstructions. To detect hepatic differentiation, we analyzed thexpression of hepatic-specific genes: �1-anti-trypsin (AAT), �-etoprotein (AFP), albumin, carbamoyl-phosphate synthetase

(CPS1), cytochrome P450 7A1 (CYP7A1), glucose-6-hosphatase (G6P), tyrosine aminotransferase (TAT), trypto-han 2,3-dioxygenase (TDO2), and transthyretin (TTR). �-actinas used as the endogenous control. The genes, sequence of therimers, annealing temperature, reaction cycles, and the RT-PCRroduct size are shown in Table 1.

. Results

.1. Screening the optimal time to change culture medium

The composition of culture medium is critical for the cultiva-ion of specific cells. Noting that IMDM, Dex, and ITS had beensed frequently by other studies for hepatic differentiation of ESells [16–18,21–23], we developed a HD medium consisting ofMDM, Dex, and ITS. Hepatic differentiation of mouse ES cellsn the HD medium was confirmed (data not shown). Because ESell differentiation occurs in vitro, like embryogenesis, in stepsver time [13–15] and may be induced efficiently for hepatic dif-erentiation by the HD medium at a certain stage, we examinedhe effect of changing HD medium at different times. For eval-ating factors that affect hepatic differentiation, a hepatogenicndicator that can be defined quantitatively is essential. Ureaynthesis [16,19,24,25] and albumin secretion [19,22,24,26,27]re commonly used as quantitative hepatogenic indicators. Urea

s synthesized for removing ammonia by urea cycle in hepato-ytes, and urea synthesis can represent the mature liver function.evertheless, urea that is synthesized by ES cell-derived hep-

tic lineage cells may not be high enough to distinguish from

o

m

able 2atrix of experiment using the 23 full factorial design to analyze the three factors: ba

un # Factors

Basal medium Dex (nM)

DMEM 0DMEM 0DMEM 100DMEM 100IMDM 0IMDM 0IMDM 100IMDM 100

a Albumin yield of EB from day 9 to 17, each run consisted by 24 data of individua

he culture period. The albumin yield of EBs indicated the total albumin secre-ion of EBs from day 9 to 17. Each bar consisted of 36 data of individual culturedBs. The data are also analyzed statistically by t-test, *indicates p < 0.05.

erum urea. Since albumin is the major protein secreted by hep-tocytes, albumin levels can also be taken to represent the liverunction. In addition, albumin measurement by immunoassays sensitive and specific to distinguish between mouse albuminnd bovine albumin. Therefore, we measured the albumin yieldf EBs and used those measurements as an indicator of hepaticifferentiation. We noted that the hepatic differentiation abilityf EBs was variable. The EBs showed different levels of albu-in secretion, even though the EBs were produced from the

ame batch of ES cells. To overcome this statistical issue, weeasured albumin yield from a larger sample size of individual

ultured EBs, achieving a normal distribution. Fig. 2 shows thisesult. The EBs cultured in MES medium alone (MES mediumn Fig. 2) had the lowest albumin yield (478 ± 411 ng/EB). EBsultured in HD medium alone also had a poor albumin yieldday 0, 566 ± 1020 ng/EB). When MES medium was changedo HD medium on day 5 or 9, the EBs had higher albumin yields1410 ± 1380 and 809 ± 687 ng/EB, respectively). The highestlbumin yield (1750 ± 1670 ng/EB) was achieved when MESedium was changed to HD medium on day 7.

.2. Effect of basal medium, Dex, and ITS on albumin yield

f EBs

As can be seen in Fig. 2, changing of MES medium to HDedium at day 5–7 was more suitable because it enhanced albu-

sal medium, Dex, and ITS

Responses

ITS (dilute of stock) Albumin yield (ng/EB)a

0 852 ± 12501/100 955 ± 14600 1390 ± 12201/100 2290 ± 19700 530 ± 9141/100 756 ± 8570 1280 ± 9521/100 2180 ± 1940

l cultured EBs.

gineering Journal 39 (2008) 435–442 439

mdfafToamwebhdb(

3y

atwpcmmuad(tRstE

TAf

S

MXXXXXXXPC

Crdsvm

Table 4Matrix of the experiment using the 23 full factorial design to study the threefactors: insulin, transferrin, and selenium

Run # Factors Responses

Insulin(�g/ml)

Transferrin(�g/ml)

Selenium(ng/ml)

Albumin yield(ng/EB)a

1 0 0 0 1510 ± 12502 0 0 6.7 1570 ± 8043 0 5.5 0 1530 ± 11404 0 5.5 6.7 1440 ± 11505 10 0 0 1530 ± 9776 10 0 6.7 1570 ± 11407 10 5.5 0 2180 ± 15408

i

3c

atEsfraa(ac

e

C.-H. Yin et al. / Biochemical En

in production of EBs. To examine the factors that affect hepaticifferentiation of ES cells, an experiment using a two-level fullactorial design was performed varying the type of basal mediumnd adding various amounts of Dex and ITS. Therefore, a 23 fullactorial design experiment consisting of 8 runs was performed.he albumin yield of EBs was measured to evaluate the effectf medium composition on differentiation. The EBs that formednd transferred to an attached culture were cultured in MESedium from day 0 to 7. From day 7 to 17, 8 runs of trial mediaere used for hepatic differentiation. Table 2 shows the result of

xperimental design, Table 3 results of ANOVA. The effect ofasal medium (X1) showed no significant difference (p = 0.2),owever, the effect of Dex (X2) and ITS (X3) showed significantifference (p < 0.0001 and p = 0.03, respectively). Interactionsetween two and three factors showed no significant differencep > 0.05).

.3. Effect of insulin, transferrin, and selenium on albuminield of EBs

As can be seen in Table 3, Dex and ITS were essential forlbumin secretion of EBs from day 7 to 17 of ES cell differentia-ion. We examined the effect of insulin, transferrin, and seleniumith another experiment using a 23 full factorial design in theresence of Dex in the culture medium from day 7 to 17 of ESell differentiation. From day 0 to 7, EBs were cultured in MESedium; from day 7 to 17, the EBs were cultured in 8 runs of trialedia. Because we were examining the effect of selenium, we

sed DMEM as basal medium since it did not contain seleniumnd would not confound our results. We found no significantifferences between the results obtained for DMEM and IMDMTable 3). Table 4 shows the results of experiments designed toest the effect of media composition on hepatic differentiation.

esults of ANOVA can be seen in Table 5. None of the factors

howed significant difference (p > 0.05), indicating that insulin,ransferrin, and selenium did not improve the albumin yield ofBs significantly when Dex was added in the culture media.

able 3NOVA of result of experiment using the 23 full factorial design to study three

actors: basal medium, Dex, and ITS

ource SSi d.f. MSi F P > F

odel 42.04 7 6.01 7.24 <0.0001

1 1.67 1 1.67 2.01 0.1575

2 34.56 1 34.56 41.69 <0.0001

3 3.95 1 3.95 4.77 0.0303

1X2 0.66 1 0.66 0.79 0.3743

1X3 0.44 1 0.44 0.54 0.4652

2X3 0.24 1 0.24 0.29 0.5929

1X2X3 0.51 1 0.51 0.62 0.4317ure error 152.55 184 0.83or total 194.59 191

odes of X1, X2, and X3 are the three factors, basal medium, Dex, and ITS,espectively. The definition of abbreviations is as following: SSi, sum of squares;.f., degree of freedom; MSi, mean square; F, F value; P > F, probability ofeeing the observed F value; Model, predictive model; Pure error, amount ofariation in the response; Cor total, totals of all information corrected for theean.

EgOp

TAf

S

MXXXXXXXPC

Crdsvm

10 5.5 6.7 1970 ± 1440

a Albumin yield of EB from day 9 to 17, each run consisted by 24 data ofndividual cultured EBs.

.4. Characterization of ES cell-derived hepatic lineageells

Based upon our results, the culture method was refined bydjusting the composition of the culture medium and fixing theime medium, we could improve the secretion of albumin byBs. The culture medium that produced the optimal results con-isted of DMEM, Dex, insulin, and transferrin. Although a fullactorial design experiment indicated that insulin and transfer-in did not improve the albumin yield, adding of Dex, insulin,nd transferrin (run 7 in Table 4) increased the differentiated EBlbumin yield more than adding Dex alone (run 1 in Table 4)p = 0.05, t-test). The best time to replace MES medium withdjusted medium for maximum albumin yield was day 7 of ESell differentiation.

We further examined ES cell-derived hepatic lineages gen-rated by the refined culture method using flow cytometry and

LISA. The refined culture method resulted in decreased cellrowth (Fig. 3A) but increased expression of albumin (Fig. 3B).f all differentiated cells, 5.9% of the cells were albumin-ositive. Furthermore, the refined culture method improved the

able 5NOVA for the experiment using 23 full factorial design to study the three

actors: insulin, transferrin, and selenium

ource SSi d.f. MSi F P > F

odel 369.19 7 52.74 1.15 0.3313

4 155.56 1 155.56 3.4 0.0666

5 47.77 1 47.77 1.05 0.3079

6 0.046 1 0.046 1.01E-03 0.9746

4X5 116.46 1 116.46 2.55 0.1121

4X6 8.79 1 8.79 0.19 0.6615

5X6 39.05 1 39.05 0.85 0.3565

4X5X6 1.52 1 1.52 0.033 0.8554ure error 8407.09 184 45.69or total 8776.28 191

odes of X4, X5, and X6 are the three factors, insulin, transferrin, and selenium,espectively. The definition of abbreviations is as following: SSi, sum of squares;.f., degree of freedom; MSi, mean square; F, F value; P > F, probability ofeeing the observed F value; Model, predictive model; Pure error, amount ofariation in the response; Cor total, totals of all information corrected for theean.

440 C.-H. Yin et al. / Biochemical Engineering Journal 39 (2008) 435–442

Fig. 3. Albumin expression of ES cell-derived hepatic lineage cells. Albuminexpression of day 17 of differentiated cells in refined culture method was con-firmed by flow cytometer and ELISA. Because analysis by flow cytometerrequired high quantity of cells, 24 individual cultured EBs in the same culturecondition were collected and mixed as one sample. Total cells (A), percentageof albumin-positive cells (B), and albumin production of albumin-positive cells(E*

at

aactfaih

E1ACCcc

Fig. 4. Double staining of ICG uptake and albumin immunostaining. The day 17hepatic lineage cells by refined culture method were examined for their hepaticptl

tht(cc

4

hplmAcphcaf

C) were measured. EBs cultured in MES medium alone were used as controls.ach bar consisted of 6 repeats. The data are also analyzed statistically by t-test,indicates p < 0.05.

lbumin production of albumin-positive cells 2.8-fold comparedo those cultured in MES medium alone (Fig. 3C).

We also confirmed that the albumin-positive cells were hep-tic lineage cells by double staining of ICG uptake and mouselbumin immunostaining. The ICG uptake test is routinely usedlinically to assess liver function and was used in this studyo confirm that the hepatic lineage cells were in fact derivedrom ES cells (Fig. 4A) [20]. This ICG uptake area also showedlbumin protein expression (Fig. 4B). Together, these findingsndicate these ES-derived albumin-positive cells had matureepatic characteristics.

The hepatic gene expression of the differentiated cells fromS cells was also examined by RT-PCR (Fig. 5). The day7 differentiated cells expressed endoderm markers (AAT,FP, albumin, and TTR) and mature hepatic markers (CPS1,

YP7A1, G6P, TAT, and TDO2). It is important to note thatYP7A1 has only been found in hepatocytes, not in yolk sacells [21], which proves molecularly that the ES derived cellsontained hepatocytes. Moreover, the differentiated cells we cul-

lbhi

henotype by double staining of ICG uptake (A) and mouse albumin immunos-aining (B). Both photos were taken at the same field. Scale bar indicates theength of 200 �m.

ured using the refined culture method also had stronger matureepatic gene expression (CPS1, CYP7A1, G6P, TAT, and TDO2)han the differentiated cells cultured in MES medium aloneFig. 5). This result suggests that the refined culture methodan improve the maturation of ES cell-derived hepatic lineageells.

. Discussion

Albumin is the major protein in plasma and is produced byepatocytes. In the body, it maintains the oncotic pressure in thelasma. It also shows high affinity with bilirubin, hormones,ipids, drugs, and other substances, which promotes the for-

ation of complex and improve their transportation in plasma.lthough the albumin level in plasma is a well-established indi-

ator of liver function, and albumin is essential to maintain bodyhysiology, few studies focus on the ability of ES cell-derivedepatic lineage cells to produce albumin. To obtain the ESell-derived hepatic lineage cells with high albumin-productionbility, this study used a series of experiments to investigateactors influencing albumin secretion of ES cell-derived hepatic

ineage cells. We first found day 5–7 of ES cell differentiation toe the best times to replace MES medium with HD medium forepatic differentiation. We then found that Dex and ITS couldmprove albumin yield of differentiated EBs. Later, we found

C.-H. Yin et al. / Biochemical Enginee

Fig. 5. RT–PCR analysis of hepatic gene expression. The day 17 differentiatedcells in refined culture condition and MES medium were examined for theirh(

taEmcmtb

mticGabtDctmeDifi

bsnlwdgt[

d[alwicaci[ddpc0d(lw

itpcalitfcOpae

A

(

R

epatic gene expression by RT-PCR. Mouse fetal liver (E13.5) and adult livers2 months old) were used as positive controls.

hat in the presence of Dex in culture media, insulin, transferrin,nd selenium did not significantly improve the albumin yield ofBs. In this series of experiments, we developed a refined cultureethod that would better promote hepatic differentiation of ES

ells. Our culture method was found to not only increase albu-in production of ES cell-derived hepatic lineage cells, but also

o promote the production of mature hepatic cells, characterizedy ICG uptake and hepatic gene expression.

Dex significantly influenced the hepatic differentiation ofouse ES cells. Dex, a synthetic glucocorticoid, is an essen-

ial factor in the cultivation of primary hepatocytes. Dex canmprove liver function by increasing the expression of liver spe-ific genes, such as P450 [28], albumin [29,30], TAT [31], and6P [32]. Dex also affects hepatocyte spheroid formation [33]

nd cell morphology [34]. Moreover, Dex has been found toe beneficial for hepatic differentiation of ES cells [18,35]. Inhe present study, one important finding is that the timing ofex addition can improve hepatic differentiation of mouse ES

ells. Our refined culture method included two steps of cultiva-ion: endoderm cells were differentiated spontaneously in MES

edium in first step (day 0–7), and hepatic cells were differ-ntiated by Dex induction in second step (day 7–17). Adding

ex before or after day 7 of ES cell differentiation was resulted

n reduced hepatic differentiation. To our knowledge, this is therst report of time-dependent Dex induction. This result may

ring Journal 39 (2008) 435–442 441

e due to the fact that the addition of Dex in the mid to latetages of ES cell differentiation could mimic when fetuses areormally exposed to high concentrations of glucocorticoids inate gestation, essential for maturation of organs. A similar resultas reported that used Dex and human insulin to induce hepaticifferentiation of mouse ES cells [18]. In that study, albuminene expression was increased, though there was no indicationhat the timing was critical in hepatic differentiation of ES cells18].

Few studies have been concerned with the ability of ES cell-erived hepatic lineage cells to secrete albumin. Kania et al.22] proposed a novel two-step protocol for hepatic differenti-tion of mouse ES cells by which a high population of hepaticineage cells with albumin expression (albumin-positive cellsere about 60% of total cells) could be derived [22]. Compar-

ng with the report [22], our study had lower population of ESell-derived hepatic lineage cells with albumin expression (5.9%lbumin-positive cells). However, we derived the hepatic lineageells with high albumin-production ability, capable of produc-ng 63-fold more albumin than Kania et al. on a per cell basis22]. Although other studies have measured albumin secretion ofifferentiated cells [24,36], the reports do not provide enoughata for a valid comparison. Our study also compared mouserimary hepatocytes culture in vitro. Mouse primary hepato-ytes have been found to produce lower levels of albumin (range.01–0.1 pg/h cell) [37–39]. In the present study, the ES cell-erived hepatic lineage cells produced greater levels of albumin1.90 ± 0.198 pg/h cell). Consequently, ES cell-derived hepaticineage cells were generally superior to primary hepatocytesith regard to albumin secretion.In summary, the refined culture method that developed here

nvolves adjusting the culture medium composition and fixinghe time that medium is changed for differentiation. It madeossible the derivation of hepatic lineage cells from mouse ESells. The hepatic lineage cells produced a high level of albuminnd were found to have mature hepatic characteristics. Becauseiver failure patients are often found to have low albumin levelsn the blood, the ES-derived hepatic lineage cells produced usinghe refined culture method in this study may be more suitableor use in the development of a bioartificial liver and hepato-yte transplantation than primary hepatocytes in these patients.ur strategy may one day be used to derive higher albumin-roducing human hepatic lineage cells from human ES cellsnd these cells may provide an unlimited source of cells forxperimental use and for the clinical treatment of liver disease.

cknowledgement

This study was supported in part by National Science CouncilTaiwan) Grants NSC94-2214-E-182-006.

eferences

[1] J.W. Allen, T. Hassanein, S.N. Bhatia, Advances in bioartificial liverdevices, Hepatology 34 (2001) 447–455.

[2] I.J. Fox, J. Roy-Chowdhury, Hepatocyte transplantation, J. Hepatol. 40(2004) 878–886.

4 ginee

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

42 C.-H. Yin et al. / Biochemical En

[3] S. Gupta, J.R. Chowdhury, Therapeutic potential of hepatocyte transplan-tation, Semin. Cell Dev. Biol. 13 (2002) 439–446.

[4] D.M. Cross, M.K. Bayliss, A commentary on the use of hepatocytes in drugmetabolism studies during drug discovery and development, Drug Metab.Rev. 32 (2000) 219–240.

[5] M.J. Gomez-Lechon, M.T. Donato, J.V. Castell, R. Jover, Human hepato-cytes in primary culture: the choice to investigate drug metabolism in man,Curr. Drug Metab. 5 (2004) 443–462.

[6] B.H. Kim, S.R. Sung, E.H. Choi, Y.I. Kim, K.J. Kim, S.H. Dong, H.J.Kim, Y.W. Chang, J.I. Lee, R. Chang, Dedifferentiation of conditionallyimmortalized hepatocytes with long-term in vitro passage, Exp. Mol. Med.32 (2000) 29–37.

[7] N. Lavon, N. Benvenisty, Study of hepatocyte differentiation using embry-onic stem cells, J. Cell Biochem. 96 (2005) 1193–1202.

[8] M.J. Evans, M.H. Kaufman, Establishment in culture of pluripotential cellsfrom mouse embryos, Nature 292 (1981) 154–156.

[9] G.R. Martin, Isolation of a pluripotent cell line from early mouse embryoscultured in medium conditioned by teratocarcinoma stem cells, Proc. Natl.Acad. Sci. U.S.A. 78 (1981) 7634–7638.

10] T. Teratani, H. Yamamoto, K. Aoyagi, H. Sasaki, A. Asari, G. Quinn, H.Sasaki, M. Terada, T. Ochiya, Direct hepatic fate specification from mouseembryonic stem cells, Hepatology 41 (2005) 836–846.

11] Y. Kumashiro, K. Asahina, R. Ozeki, K. Shimizu-Saito, Y. Tanaka, Y. Kida,K. Inoue, M. Kaneko, T. Sato, K. Teramoto, S. Arii, H. Teraoka, Enrich-ment of hepatocytes differentiated from mouse embryonic stem cells as atransplantable source, Transplantation 79 (2005) 550–557.

12] H. Yamamoto, G. Quinn, A. Asari, H. Yamanokuchi, T. Teratani, M. Ter-ada, T. Ochiya, Differentiation of embryonic stem cells into hepatocytes:biological functions and therapeutic application, Hepatology 37 (2003)983–993.

13] T.C. Doetschman, H. Eistetter, M. Katz, W. Schmidt, R. Kemler, The invitro development of blastocyst-derived embryonic stem cell lines: forma-tion of visceral yolk sac, blood islands and myocardium, J. Embryol. Exp.Morphol. 87 (1985) 27–45.

14] G.M. Keller, In vitro differentiation of embryonic stem cells, Curr. Opin.Cell Biol. 7 (1995) 862–869.

15] A.M. Wobus, K.R. Boheler, Embryonic stem cells: prospects for develop-mental biology and cell therapy, Physiol. Rev. 85 (2005) 635–678.

16] R. Chinzei, Y. Tanaka, K. Shimizu-Saito, Y. Hara, S. Kakinuma, M. Watan-abe, K. Teramoto, S. Arii, K. Takase, C. Sato, N. Terada, H. Teraoka,Embryoid-body cells derived from a mouse embryonic stem cell line showdifferentiation into functional hepatocytes, Hepatology 36 (2002) 22–29.

17] T. Hamazaki, Y. Iiboshi, M. Oka, P.J. Papst, A.M. Meacham, L.I. Zon, N.Terada, Hepatic maturation in differentiating embryonic stem cells in vitro,FEBS Lett. 497 (2001) 15–19.

18] H. Shirahashi, J. Wu, N. Yamamoto, A. Catana, H. Wege, B. Wager, K.Okita, M.A. Zern, Differentiation of human and mouse embryonic stemcells along a hepatocyte lineage, Cell Transplant. 13 (2004) 197–211.

19] R.E. Schwartz, J.L. Linehan, M.S. Painschab, W.S. Hu, C.M. Verfaillie,D.S. Kaufman, Defined conditions for development of functional hep-atic cells from human embryonic stem cells, Stem Cells Dev. 14 (2005)643–655.

20] T. Yamada, M. Yoshikawa, S. Kanda, Y. Kato, Y. Nakajima, S. Ishizaka, Y.Tsunoda, In vitro differentiation of embryonic stem cells into hepatocyte-like cells identified by cellular uptake of indocyanine green, Stem Cells 20

(2002) 146–154.

21] K. Asahina, H. Fujimori, K. Shimizu-Saito, Y. Kumashiro, K. Okamura, Y.Tanaka, K. Teramoto, S. Arii, H. Teraoka, Expression of the liver-specificgene Cyp7a1 reveals hepatic differentiation in embryoid bodies derivedfrom mouse embryonic stem cells, Genes Cells 9 (2004) 1297–1308.

[

ring Journal 39 (2008) 435–442

22] G. Kania, P. Blyszczuk, A. Jochheim, M. Ott, A.M. Wobus, Generationof glycogen- and albumin-producing hepatocyte-like cells from embryonicstem cells, Biol. Chem. 385 (2004) 943–953.

23] A. Kubo, K. Shinozaki, J.M. Shannon, V. Kouskoff, M. Kennedy, S. Woo,H.J. Fehling, G. Keller, Development of definitive endoderm from embry-onic stem cells in culture, Development 131 (2004) 1651–1662.

24] A.B. Hu, J.Y. Cai, Q.C. Zheng, X.Q. He, Y. Shan, Y.L. Pan, G.C. Zeng, A.Hong, Y. Dai, L.S. Li, High-ratio differentiation of embryonic stem cellsinto hepatocytes in vitro, Liver Int. 24 (2004) 237–245.

25] M. Sgodda, H. Aurich, S. Kleist, I. Aurich, S. Konig, M.M. Dollinger, W.E.Fleig, B. Christ, Hepatocyte differentiation of mesenchymal stem cells fromrat peritoneal adipose tissue in vitro and in vivo, Exp. Cell Res. 313 (2007)2875–2886.

26] C.H. Yin, W. Chen, C.C. Hsiao, C.Y. Kuo, C.L. Chen, W.T. Wu, Productionof mouse embryoid bodies with hepatic differentiation potential by stirredtank bioreactor, Biosci. Biotechnol. Biochem. 71 (2007) 728–734.

27] A. Soto-Gutierrez, N. Kobayashi, J.D. Rivas-Carrillo, N. Navarro-Alvarez,D. Zhao, T. Okitsu, H. Noguchi, H. Basma, Y. Tabata, Y. Chen, K. Tanaka,M. Narushima, A. Miki, T. Ueda, H.S. Jun, J.W. Yoon, J. Lebkowski, N.Tanaka, I.J. Fox, Reversal of mouse hepatic failure using an implanted liver-assist device containing ES cell-derived hepatocytes, Nat. Biotechnol. 24(2006) 1412–1419.

28] K. Monostory, K. Kohalmy, R.A. Prough, L. Kobori, L. Vereczkey, Theeffect of synthetic glucocorticoid, dexamethasone on CYP1A1 inducibilityin adult rat and human hepatocytes, FEBS Lett. 579 (2005) 229–235.

29] D.M. Jefferson, L.M. Reid, M.A. Giambrone, D.A. Shafritz, M.A. Zern,Effects of dexamethasone on albumin and collagen gene expression inprimary cultures of adult rat hepatocytes, Hepatology 5 (1985) 14–20.

30] C. Roncero, I. Fabregat, M. Benito, Regulation of gene expression byinterleukin-6 in fetal rat hepatocyte primary cultures: role of epidermalgrowth factor and dexamethasone, Hepatology 22 (1995) 1769–1775.

31] L.L. Shelly, G.C. Yeoh, Effects of dexamethasone and cAMP on tyro-sine aminotransferase expression in cultured fetal rat hepatocytes, Eur. J.Biochem. 199 (1991) 475–481.

32] E. van Schaftingen, I. Gerin, The glucose-6-phosphatase system, Biochem.J. 362 (2002) 513–532.

33] S.F. Abu-Absi, W.S. Hu, L.K. Hansen, Dexamethasone effects on rat hep-atocyte spheroid formation and function, Tissue Eng. 11 (2005) 415–426.

34] L.M. Arterburn, J. Zurlo, J.D. Yager, R.M. Overton, A.H. Heifetz, A mor-phological study of differentiated hepatocytes in vitro, Hepatology 22(1995) 175–187.

35] A. Dasgupta, R. Hughey, P. Lancin, L. Larue, P.V. Moghe, E-cadherin syn-ergistically induces hepatospecific phenotype and maturation of embryonicstem cells in conjunction with hepatotrophic factors, Biotechnol. Bioeng.92 (2005) 257–266.

36] M. Tsutsui, S. Ogawa, Y. Inada, E. Tomioka, A. Kamiyoshi, S. Tanaka, T.Kishida, M. Nishiyama, M. Murakami, J. Kuroda, Y. Hashikura, S. Miya-gawa, F. Satoh, N. Shibata, Y.I. Tagawa, Characterization of cytochromeP450 expression in murine embryonic stem cell-derived hepatic tissuesystem, Drug Metab. Dispos. (2006).

37] T. Ehashi, H. Miyoshi, N. Ohshima, Oncostatin M stimulates proliferationand functions of mouse fetal liver cells in three-dimensional cultures, J.Cell Physiol. 202 (2005) 698–706.

38] S.P. Monga, M.S. Hout, M.J. Baun, A. Micsenyi, P. Muller, L. Tummala-palli, A.R. Ranade, J.H. Luo, S.C. Strom, J.C. Gerlach, Mouse fetal liver

cells in artificial capillary beds in three-dimensional four-compartmentbioreactors, Am. J. Pathol. 167 (2005) 1279–1292.

39] Y. Sakai, J. Jiang, N. Kojima, T. Kinoshita, A. Miyajima, Enhanced in vitromaturation of fetal mouse liver cells with oncostatin M, nicotinamide, anddimethyl sulfoxide, Cell Transplant. 11 (2002) 435–441.