Research ArticleHydrostatin-SN10 Ameliorates Pancreatitis-Induced LungInjury by Affecting IL-6-Induced JAK2/STAT3-AssociatedInflammation and Oxidative Stress

Xuehua Piao ,1 Yanping Zou,2 Xiaodan Sui,3 Baohai Liu ,4 Fanji Meng,5 Shuangdi Li,6

Qingyu Zhang,4 Chi Ma,4 and Tong Wu4

1Department of Traditional Chinese Medicine, The First Affiliated Hospital of Jinzhou Medical University, Jinzhou 121001, China2Department of Digestive Endoscopy, The Affiliated Hospital of Changchun University of Traditional Chinese Medicine,Changchun 130021, China3Internal Medicine of Traditional Chinese Medicine, The Affiliated Hospital of Changchun University of TraditionalChinese Medicine, Changchun 130021, China4Department of Gastroenterology, The First Affiliated Hospital of Jinzhou Medical University, Jinzhou 121001, China5Department of Cardiology, The Fourth Affiliated Hospital of Harbin Medical University, Harbin 150001, China6Heart Disease Center, The Affiliated Hospital of Changchun University of Traditional Chinese Medicine, Changchun 130021, China

Correspondence should be addressed to Baohai Liu; liubaoh627@163.com

Received 4 September 2019; Accepted 15 October 2019; Published 18 November 2019

Guest Editor: Mansur A. Sandhu

Copyright © 2019 Xuehua Piao et al. This is an open access article distributed under the Creative Commons Attribution License,which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Hydrostatin-SN1 (peptide sequence, DEQHLETELHTLTSVLTANGFQ), a kind of peptides extracted from snake venom, has beenreported to have anti-inflammatory effect, but its truncated mutant hydrostatin-SN10 (peptide sequence, DEQHLETELH) onpancreatitis-induced acute lung injury has not been well documented. Interleukin- (IL-) 6-induced Janus Kinase 2/SignalTransducer and Activator of Transcription 3 (JAK2/STAT3) pathway is involved with inflammatory and oxidative stressactivities and may be associated with the pathogenesis of lung injury, and related molecules were measured. Taurocholate-induced pancreatitis associated with acute lung injury was established and treated with hydrostatin-SN10. Pancreatitis wasconfirmed by measuring the serum levels of amylase, lipase, and trypsinogen and urinary amylase. Lung injury was determinedby histologically assessing acinar cell changes. The related molecules of IL-6-induced JAK2/STAT3-associated inflammation andoxidative stress were quantitated by real time-PCR, Western blot, and/or immunochemical assay. Hydrostatin-SN10 reduced thelevels of serum amylase, lipase, and trypsinogen and urinary amylase when compared with the model group (p < 0:05).Hydrostatin-SN10 significantly inhibited the IL-6-stimulated JAK2/STAT3 pathway and reduced the number of apoptotic cellsvia the downregulation of caspase 3 and BAX (proapoptotic) and upregulation of Bcl2 (antiapoptotic) (p < 0:05). IL-6 inducedthe increase in the levels of JAK2 and STAT3, which was reversed by hydrostatin-SN10 treatment (p < 0:05). In addition,hydrostatin-SN10 reduced the expression of IL-6 and TNF- (tumor necrosis factor-) α and increased the level of IL-10 (p < 0:05).On the other hand, hydrostatin-SN10 treatment increased the levels of superoxide dismutase (SOD) and reduced glutathione(GSH) and the levels of malondialdehyde (MDA) and alanine aminotransferase (ALT) (p < 0:05). These results suggest thathydrostatin-SN10 may inhibit pancreatitis-induced acute lung injury by affecting IL-6-mediated JAK2/STAT3 pathway-associated inflammation and oxidative stress.

HindawiOxidative Medicine and Cellular LongevityVolume 2019, Article ID 9659757, 12 pageshttps://doi.org/10.1155/2019/9659757

1. Introduction

Pancreatitis-induced lung injury is the most aggressive disor-ders and the main threat to public health [1, 2]. Despiteadvances in surgery [3, 4], radiotherapy, and chemotherapy[5], the effective therapy for the patients with lung injuryremains unavailable. Drug treatment is always with low effi-cacy and/or significant toxicity. It is urgent to explore effica-cious and safe potential drugs against pancreatitis-inducedlung injury.

Cathelicidin from sea snake discovered to have both anti-microbial andanti-inflammatoryproperties is apotential drugfor the development of peptide antibiotics [6]. Hydrostatin-SN1 (peptide sequence, DEQHLETELHTLTSVLTANGFQ),a bioactive peptide, was screened from a Hydrophis cyano-cinctus venomglandT7phage display library [7] and reportedto reduce inflammation in amousemodel of acute lung injury[8].Hydrostatin-SN1 exerts its anti-inflammatory function viabinding soluble tumor necrosis factor receptor (sTNFR). Bio-informatics analysis showed that the truncated hydrostatin-SN1 (hydrostatin-SN10, DEQHLETELH) would have higherbinding ability with sTNFR. The binding test in vitro showedthat hydrostatin-SN1 bound TNFR1 with moderate bindingability and equilibrium dissociation constant KD values were32μ, while the KD values for hydrostatin-SN10 were 20μ.However, the effects of hydrostatin-SN10 on pancreatitis-induced lung injury remain unclear and explored in the pres-ent work.

IL-6 is a proinflammatory, proangiogenic, and apoptoticcytokine [9], and its concentration has been reported to beincreased following lung injury [10]. IL-6 trans-signalingcan result in pancreatitis-mediated lung injury and lethality[11]. IL-6 is involved in innate and adaptive immuneresponses to lung injury [12]. IL-6 can significantly affectthe phosphorylation of Janus Kinase 2/Signal Transducerand Activator of Transcription 3 (JAK2/STAT3) [13] andtheir activities while JAK2/STAT3 is a proinflammationand apoptosis pathway [14]. More studies showed that poorclinical outcome of pancreatitis-induced lung injury waslinked with the elevated serum IL-6 [11]. It has been demon-strated that the IL-6/JAK2/STAT3 pathway plays a criticalrole in the risk of pancreatitis-induced lung injury [15].Meanwhile, the signaling pathway is also associated withthe oxidative and inflammatory responses [16, 17].

In this study, we evaluated the effect of hydrostatin-SN10on pancreatitis-induced lung injury to test the hypothesisthat hydrostatin-SN10 may inhibit pancreatitis-induced lunginjury cells via the downregulation of the IL-6-inducedJAK2/STAT3 pathway.

2. Materials and Methods

2.1. Reagents. ELISA kits for IL-6, TNF-α, and IL-10 werepurchased from Abcam (Boston, MA, USA). Antibodiesagainst JAK2, STAT3, caspase 3, BAX, and Bcl2 were pur-chased from Abcam. PrimeScript RT Master Mix andSYBR Premix Ex Taq™ kits were purchased from Takara(Dalian, China). Hydrostatin-SN10 (purity > 99%) was pur-chased from Shanghai Qiangyao Biotechnology Company

(Shanghai, China), and the peptide sequence was sequencedby the automated Edman degradation method by using aProcise cLC 492 protein sequencer (Applied Biosystems,USA). The sequence of hydrostatin-SN10 is DEQHLETELH.

2.2. Animal Care. All processes were approved by the Institu-tional Animal Use and Care Committee of the First AffiliatedHospital of Jinzhou Medical University and were performedaccording to the National Institutes of Health guidelinesfor the care and handling of animals. Male C57BL/6 mice(8 weeks) were purchased from the animal center of JilinUniversity (Changchun, China). All animals were housedunder a 12 h light/12 h dark cycle and were provided withfood and water ad libitum. All animal experiments wereapproved by the Animal Research Ethics Committee ofthe First Affiliated Hospital of Jinzhou Medical University(Jinzhou, China) and were performed in accordance withthe guidelines for the care and use of experimental ani-mals, which are consistent with the NIH guidelines.

2.3. Establishment of Pancreatitis-Induced Lung Injury. Allmice were allocated into three groups: CG (wild group),MG (pancreatitis-induced lung injury model group), andHG (hydrostatin-SN10-treated model group). In the MGand HG groups, the mice were anesthetized with ether andmaintained by an intraperitoneal injection of ketamine40mg/kg (Sigma). The mice underwent laparotomy via amidline incision. A 28-gauge 1/2-inch needle attached to a1ml U-40 insulin syringe was inserted into the biliopancrea-tic duct. One ml/kg of 5% sodium taurocholate (Sigma) wasinjected into biliopancreatic duct, and the abdomen wasclosed with interrupted nylon sutures. Hyperbaric oxygenwas administered in a hyperbaric chamber after 5-hourinduction of pancreatitis and lasted 5 d, 2 sessions daily(1.5 h) at 2.5-fold atmospheric pressure [18]. After establish-ment of the model with pancreatitis-induced lung injury, themice were intraperitoneally injected with PBS in the MG andCG groups and the mice were intraperitoneally injected withhydrostatin-SN10 (1.6mg/kg) once daily for 5 days. Subse-quently, all mice were sacrificed by intraperitoneal injectionof pentobarbital (200mg/kg, Sigma) and pulmonary tissuewas obtained.

2.4. HE Staining. Lung tissue was cut into a series of 5μm sec-tions and stained with hematoxylin and eosin (H&E). Theseverity of acinar cell injury was evaluated by usingcomputer-aided morphology. Five microscopic fields (100x)were chosen for each sample. The severity of lung tissueinjury was confirmed based on the amounts of neutrophilinfiltration and alveolar septal capillary density.

2.5. The Diagnosis of Acute Pancreatitis. Serum amylase,serum lipase, urinary trypsinogen-2, and urinary amylaseare important biomarkers in the diagnosis of pancreatitis[19]. Mouse pancreatic amylase ELISA kit and pancreaticlipase ELISA kit were purchased from Biocompare Company(CA, USA). Mouse trypsinogen ELISA kit was purchasedfrom Abbkine Scientific Co. Ltd. (CA, USA). Fifty-microliter blood was obtained from each mouse tail after3-day model establishment, and serum was prepared via

2 Oxidative Medicine and Cellular Longevity

centrifugation at 2000×g for 10min. The correspondingkits were used to measure the amylase and trypsinogen-2level in serum or urine according to the manufacturer’sinstructions after 3-day model establishment.

2.6. Measurement of Inflammatory Cytokines. Mouse IL-6ELISA kit (ab100712), mouse IL-10 ELISA kit (ab108870),and mouse TNF-α ELISA kit (ab208348) were purchasedfrom Abcam (Boston, MA, USA). Serum levels of cytokineswere measured by using the corresponding kits after 3-daymodel establishment.

2.7. Analysis of Oxidative Stress. Oxidative stress was ana-lyzed using the kits for detecting the activities of superoxidedismutase (SOD), reduced glutathione (GSH), and the levelsof malondialdehyde (MDA) and alanine aminotransferase(ALT) (Sangon Biotech Shanghai Co. Ltd., Shanghai, China)according to the protocols provided by the manufacturer.Lung tissue of oxidative stress was measured by using thecorresponding kits after 3-day model establishment.

2.8. Reverse Transcription-Quantitative Polymerase ChainReaction (RT-qPCR). Relative mRNA levels of JAK2, STAT3,Bcl2, BAX, and caspase 3 were analyzed by using RT-qPCR.Total RNAwas isolated from lung tissues by using the TRIzolreagent (Takara, Dalian, China) after 3-day model establish-ment and was reverse transcribed to complementary DNA byusing a reverse transcription kit (Takara). With the primerslisted in Table 1, PCR was performed under the followingcondition: denaturation at 95°C for 30 s, followed by 40 cyclesat 95°C for 10 s and 60°C for 45 s. A relative mRNA level oftarget genes was normalized against β-actin, and the delta-delta CT procedure was used to determine the fold increasein the corresponding genes.

2.9. Western Blot. Protein was isolated from lung tissues after3 d model establishment by using the protein purification kit(Sangon, Shanghai, China). Protein levels were determinedusing Western blot analysis following the protocol in thelab with modification [20, 21]. The primary antibodies (CellSignaling Technology) against p-STAT3 (1 : 2000), p-JAK-2(1 : 2000), STAT3 (1 : 2000), JAK-2 (1 : 2000), caspase 3(1 : 2000), BAX (1 : 2000), Bcl-2 (1 : 2000), and β-actin(1 : 2000) were used, and the HRP-conjugated anti-rabbit/-mouse IgG secondary antibody (1 : 2000, Cell Signaling Tech-nology) was used. Intensities of the bands were measured byImage Lab software (Bio-Rad) to assess relative protein levels.

2.10. Immunohistochemistry Analysis. Immunohistochemis-try analysis was performed according to the previous reportwith slight modification [22]. Paraffin-embedded lung tissueswere first sliced to 5μm thick sections and placed into warmwater at 42°C for spreading. The sections were then collectedand baked to be prepared into paraffin-embedded tissue sec-tions. Next, the sections were soaked in xylene solution andgraded alcohol in sequence for conventional deparaffiniza-tion until rehydration. Subsequently, the sections wereimmersed in a citric acid buffer solution, followed by heatingin a microwave oven for 3 times (3min each time). The sec-tions were braised for 5min after each heating to achieve suf-ficient antigen retrieval. After rinsing, the endogenousperoxidase blocker was added dropwise to the specimensand reacted for 10min. The sections were then rinsed andadded with goat serum in drops for blocking for 20min. Sub-sequently, the goat serum blocking buffer was shaken off. Theprimary antibody (1 : 200) was added, followed by incubationin a refrigerator at 4°C overnight. On the next day, the spec-imens were rinsed and added with the secondary antibody(1 : 2000) and reacted for 30min. After rinsing adequately,streptavidin-peroxidase solution was added for reaction for10min, followed by dropwise addition of diaminobenzidine(DAB) (Solarbio, Beijing, China) for color development.Finally, the nucleus was counterstained with hematoxylinand mounted and observed under a microscope.

2.11. Tunnel Analysis of Cell Apoptosis. The tissues embeddedin paraffin were sliced into 5μm thick sections. Then, theywere placed in warm water at 42°C for spreading, followedby collection, baking, and preparation into paraffin-embedded tissue sections. Next, the sections were soaked inxylene solution and graded alcohol in sequence for conven-tional deparaffinization until rehydration. TdT reaction solu-tion was added in drops for reaction in the dark for 1 h.Deionized water was then added dropwise and incubatedfor 15min to terminate the reaction. After that, hydrogenperoxide was added in drops to block the activity of endoge-nous peroxidase. The working solution was added dropwisefor reaction for 1 h, followed by rinsing. After adding DABsolution for color development, the sections were rinsed,mounted, and observed.

2.12. Statistical Analysis. The results were expressed asmeans ± standard deviation (S.D.). Data comparisons wereanalyzed by two-tailed Student’s t-test or one-way analysisof variance followed by Bonferroni’s post hoc test using SPSS

Table 1: Primers for reverse transcription-quantitative polymerase chain reaction.

Gene Forward sequence (5′-3′) Reverse sequence (5′-3′)JAK2 GCAGCAGCAGAACCTACAG CTAACACCGCCATCCCAAG

STAT3 GACTCAAAGCCACCTCATTC GCCTTGCCTTCCTAAATACC

Caspase 3 CATGGAAGCGAATCAATGGACT CTGTACCAGACCGAGATGTCA

BAX CCCGAGAGGTCTTTTTCCGAG CCAGCCCATGATGGTTCTGAT

Bcl-2 GGTGGGGTCATGTGTGTGG CGGTTCAGGTACTCAGTCATCC

β-Actin GCACCACACCTTCTACAATGAG GATAGCACAGCCTGGATAGCA

3Oxidative Medicine and Cellular Longevity

software (version 17.0, SPSS Inc., Chicago, IL, USA), andp < 0:05 was considered statistically significant.

3. Results

3.1. Taurocholate Induced Pancreatitis. Pancreatitis wascharacterized by the increase in serum amylase, serum lipase,serum trypsinogen, and urinary amylase [19]. The presentresults indicated were marked by the increase in the levelsof serum amylase, serum lipase, serum trypsinogen, and uri-nary amylase. The levels of serum amylase (Figure 1(a)),serum lipase (Figure 1(b)), serum trypsinogen (Figure 1(c)),and urinary amylase (Figure 1(d)) were increased signifi-cantly in the MG group when compared with the CG group(p < 0:05). The hydrostatin-SN10 treatment reduced the levelof serum amylase (Figure 1(a)), serum lipase (Figure 1(b)),serum trypsinogen (Figure 1(c)), and urinary amylase(Figure 1(d)) in the HG group when compared with theMG group (p < 0:05).

3.2. Hydrostatin-SN10 Reduced the Severity of Pancreatitis-Induced Lung Injury. In the CG group, there was no neutro-phil infiltration and congestion of the alveolar septal capil-laries. Lung injury was marked by massive neutrophilinfiltration and congestion of the alveolar septal capillariesin the MG group while the situation was reduced in the HGgroup after 1- and 5-day taurocholate-induced pancreatitisassociated with lung injury (Figure 2).

3.3. Hydrostatin-SN10 Treatment Reduced the Levels of TNF-α and IL-6 and Increased the Level of IL-10 in Serum. Asdescribed above, IL-1β, TNF-α, and IL-6 are markers of sys-temic inflammatory responses after the establishment oftaurocholate-induced pancreatitis associated with acute lunginjury. As showed in Figure 3, hydrostatin-SN10 treatmentalleviated the serum levels of TNF-α and IL-6 and increasedthe level of IL-10 in the HG group when compared with theMG group (p < 0:05).

3.4. Hydrostatin-SN10 Treatment Reduced Oxidative Stress.SOD, GSH, ALT, andMDA are important biomarkers of oxi-dative stress, which may be associated with taurocholate-induced pancreatitis associated with acute lung injury.Taurocholate-induced pancreatitis associated with lunginjury increased oxidative stress by reducing the levels ofSOD and GSH and increasing the levels of ALT and MDAin the MG group when compared with the CG group(Table 2, p < 0:05). Hydrostatin-SN10 treatment increasedthe levels of SOD and GSH and reduced the levels of ALTand MDA in the HG group when compared with the MGgroup (Table 2, p < 0:05). The results suggested thathydrostatin-SN10 treatment reduced oxidative stress causedby the lung injury.

3.5. Hydrostatin-SN10 Reduced the Relative mRNA Level ofJAK2/STAT3 and Apoptotic Molecules. We further exam-ined the effects of hydrostatin-SN10 on JAK2/STAT3 sig-naling and apoptosis in lung tissues. Figure 4(a) showedthat hydrostatin-SN10 had no effect on relative mRNA

Seru

m am

ylas

e act

ivity

(IU

/ml)

CG MG HG

0.2

0.3

0.4p < 0.05 p < 0.05

(a)

Seru

m li

pase

activ

ity (n

g/m

l)

CG MG HG50

100

150

200 p < 0.05 p < 0.05

(b)

Seru

m tr

ypsin

ogen

leve

l(n

g/m

l)

CG MG HG30

40

50

60

70p < 0.05 p < 0.05

(c)

Urin

ary

amyl

ase a

ctiv

ity(I

U/m

l)

CG MG HG0.4

0.8

1.2

1.6

p < 0.05 p < 0.05

(d)

Figure 1: The levels of biomarkers in the diagnosis of pancreatitis among different groups. All data were presented as box plots with whiskersat the 10th percentile and 90th percentile, and the statistical difference was significant if p < 0:05.

4 Oxidative Medicine and Cellular Longevity

levels of JAK2/STAT3 signaling. However, hydrostatin-SN10 significantly reduced relative mRNA levels of caspase3 and BAX and increased the level of Bcl2 (Figure 4(b)).

3.6. Hydrostatin-SN10 Inhibited the Relative Protein Level ofPhosphorylated JAK2/STAT3 Signaling. IL-6 increase pro-moted the expression of phosphorylated JAK2 (p-JAK2)and phosphorylated STAT3 (p-STAT3). The present findingdemonstrated that hydrostatin-SN10 inhibited the relativeprotein level of phosphorylated JAK2/STAT3 signaling(Figure 5(a)) (p < 0:05) but no effect on the relative proteinlevel of JAK2 and STAT3 (Figure 5(b)) (p > 0:05). The resultssuggested that hydrostatin-SN10 might affect the phosphor-

ylation of JAK2/STAT3 via IL-6 since the treatment ofhydrostatin-SN10 could reduce the level of IL-6.

3.7. Hydrostatin-SN10 Reduced the Relative Protein Levelsof Apoptotic Molecules and Increased the Relative ProteinLevel of Antiapoptotic Molecule. Hydrostatin-SN10 signifi-cantly increased antiapoptotic marker Bcl2 and reducedthe protein levels of apoptotic biomarkers of BAX and cas-pase 3 of lung tissues (Figure 6, p < 0:05). The results sug-gested that hydrostatin-SN10 had antiapoptotic propertiesfor taurocholate-induced pancreatitis associated with acutelung injury.

3.8. Hydrostatin-SN10 Inhibited the Expression of thePhosphorylated JAK2/STAT3 in Lung Tissue. We furtherexamined if hydrostatin-SN10 could inhibit JAK2/STAT3expression in lung tissues by immunohistochemistry stain-ing. The protein expression of p-JAK2 (Figure 7(a)) but noJAK2 (Figure 7(b)) was increased after 3- and 5-day modelestablishment in the MG group when compared with theCG group. Hydrostatin-SN10 treatment significantly inhib-ited the protein expression of p-JAK2 (Figure 7(a)) but noeffect on the expression of JAK2 (Figure 7(b)) after 3- and 5-day model establishment in the HG group when compared

IL-6 IL-10TNF-𝛼

The c

once

ntra

tion

ofcy

toki

nes (

pg/m

l)

10

20

30

40250350450550650

CGMGHG

p < 0.05p < 0.05

p < 0.05p < 0.05 p < 0.05 p < 0.05

Figure 3: ELISA analysis of the effects of hydrostatin-SN10 onthe secretory activity of cytokines (IL-6, TNF-α, and IL-10). Allmice were allocated into three groups: CG (wild group), MG(pancreatitis-induced lung injury model group), and HG(hydrostatin-SN10-treated model group). n = 12 for each group,and statistical difference was significant if p < 0:05.

CG MG HG

3 d

5 d

G

Figure 2: HE staining analysis of the severity of lung injury. All mice were allocated into three groups: CG (wild group), MG (pancreatitis-induced lung injury model group), and HG (hydrostatin-SN10-treated model group). n = 12 for each group.

Table 2: The levels of biomarkers of oxidative stress amongdifferent groups.

CG MG HG

SOD (U/mg prot) 280:7 ± 46:5∗ 145:2 ± 35:1 221:4 ± 42:3∗

GSH (nM/mg prot) 6:9 ± 2:3∗ 1:7 ± 0:5 5:2 ± 2:3∗

MDA (nM/mg prot) 0:9 ± 0:4∗ 2:3 ± 0:8 1:5 ± 0:4∗

ALT (U/mg prot) 161.4± 31.6∗ 208.1± 42.7 189.2± 35.6∗

Note. All mice were allocated into three groups: CG (wild group), MG(pancreatitis-induced lung injury model group), and HG (hydrostatin-SN10-treated model group). n = 12 for each group, and ∗p < 0:05 vs. theMG group.

5Oxidative Medicine and Cellular Longevity

with the MG group. Similarly, the protein expression of p-STAT3 (Figure 7(c)) but no STAT3 (Figure 7(d)) wasincreased after 3- and 5-day model establishment in the MGgroup when compared with the CG group. Hydrostatin-

SN10 treatment significantly inhibited the protein expressionof p-STAT3 (Figure 7(c)) but no effect on the expression ofJAK2 (Figure 7(d)) after 3- and 5-day model establishmentin the HG group when compared with the MG group.

Relat

ive m

RNA

leve

ls

JAK2 STAT30

5

10

15

20

CGMGHG

(a)

Relat

ive m

RNA

leve

ls

Bcl2 BAX Caspase 30

5

10

15

CGMGHG

p < 0.05p < 0.05

p < 0.05p < 0.05 p < 0.05

p < 0.05

(b)

Figure 4: Relative mRNA levels of JAK2/STAT3 signaling and apoptotic molecules.

Relat

ive p

rote

in le

vels

p-JAK2 p-STAT30.0

0.1

0.2

0.3

0.4

0.5

CGMGHG

p < 0.05p < 0.05

p < 0.05p < 0.05

p-JAK2

𝛽-Actin

p-STAT3

CG MG HG

JAK2

STAT3

(a)

Relat

ive p

rote

in le

vels

JAK2 STAT30.0

0.5

1.0

1.5

CGMGHG

(b)

Figure 5: Western blot analysis of the effects of hydrostatin-SN10 on the relative protein levels of JAK2/STAT3 signaling. (a) Relative proteinlevels of p-JAK2 and p-STAT3. (b) Relative protein levels of JAK2 and STAT3. n = 12 for each group, and statistical difference was significantif p < 0:05.

6 Oxidative Medicine and Cellular Longevity

3.9. Hydrostatin-SN10 Reduced the Expression of ApoptoticBiomarkers and Increased the Expression of the AntiapoptoticBiomarker in Lung Tissues. The protein expression of Bcl2(Figure 8(a)) was reduced after 3- and 5-day model establish-ment in the MG group when compared with the CG group.Hydrostatin-SN10 treatment significantly increased theprotein expression of Bcl2 (Figure 8(a)) after 3- and 5-daymodel establishment in the HG group when compared withthe MG group. In contrast, the protein expression of BAX(Figure 8(b)) was increased after 3- and 5-day model estab-lishment in the MG group when compared with the CGgroup. Hydrostatin-SN10 treatment significantly inhibitedthe protein expression of BAX (Figure 8(b)) after 3- and 5-day model establishment in the HG group when comparedwith the MG group. The protein expression of caspase 3(Figure 8(c)) was increased after 3- and 5-day model estab-lishment in the MG group when compared with the CGgroup. Hydrostatin-SN10 treatment significantly inhibitedthe protein expression of caspase 3 (Figure 8(c)) after 3-and 5-day model establishment in the HG group whencompared with the MG group. The results suggested that

hydrostatin could effectively reverse the apoptotic activityin the animal model by downregulating the expression ofproapoptotic molecules and upregulating the expressionof antiapoptotic molecules in the HG group when com-pared with the MG group.

3.10. Hydrostatin-SN10 Treatment Inhibited the Apoptosis inLung Tissues. Tunnel results indicated that there was no apo-ptosis in the lung tissues of animal models from the CGgroup (Figure 9). Apoptosis was increased significantly inthe MG group while the hydrostatin-SN10 treatment inhib-ited the apoptosis in lung tissues in the HG group. All theseresults suggested that hydrostatin-SN10 had obvious antia-poptotic properties in the treatment of lung injury.

4. Discussion

Hydrostatin, as a bioactive peptide extracted from snake poi-son, was reported to inhibit inflammatory responses [8, 23].However, little is known about its effect on pancreatitis-induced lung injury. Our results in this study showed thathydrostatin-SN10 could significantly inhibit pancreatitis-induced lung injury. To the best of our knowledge, this isthe first report to demonstrate that hydrostatin-SN10 is par-ticularly potent against pancreatitis-induced lung injury.

IL-6 is one common inflammatory cytokine that is asso-ciated with lung injury. IL-6 may inhibit proliferation, pro-mote apoptosis, and promote lung injury via activation ofthe JAK2/STAT3 signaling pathway [10, 24, 25]. In thisstudy, we proposed to test the hypothesis that hydrostatin-SN10 could inhibit pancreatitis-induced lung injury via sup-pression of the IL-6-induced JAK2/STAT3 signaling. Ourstudy results showed that hydrostatin-SN10 could signifi-cantly reduce the level of IL-6 and improve the injury of lungtissues by inactivating JAK2/STAT3 phosphorylation.Although the direct evidence of the JAK2/STAT3 phosphor-ylation in the hydrostatin-SN10 action remains unclear, ourresults provide important information to the possible molec-ular mechanism. Previous reports showed that antioxidantproperties could be improved by affecting JAK2/STAT3signaling pathways [26] since JAK2/STAT3 is associatedwith inflammation and oxidative stress. Chronic low-gradeinflammation and oxidative stress play central roles in theprogression of common diseases. Inflammation and oxida-tive stress could be inhibited via inaction of JAK2/STAT3 sig-naling pathways [27].

Hydrostatin-SN10 treatment significantly reduced thenumber of apoptotic cells via the inhibition of the IL-6 andprotein levels of proapoptotic biomarkers, such as caspase 3and BAX, and increase of antiapoptotic biomarkers Bcl2(Figures 4, 6, and 8). Previous studies have shown that IL-6restores the phosphorylation of STAT3 [28], thereby pro-moting the apoptosis of lung cells, and our present findingswas consistent with the reports.

Although IL-6 is an important inflammatory cytokine inaggregating pancreatitis-induced lung injury, it is possible asmany other proinflammatory cytokines can also be the tar-gets for hydrostatin-SN10 function. Indeed, in addition toIL-6, G-CSF [29], IL-6R [30], IL-8 [31, 32], MCP-1 [33],

CG MG HG

BAX

Casepase 3

Bcl2

Bcl2 Box Caspase 3

𝛽-Actin

Relat

ive p

rote

in le

vels

0.0

0.2

0.4

0.6

0.8

1.0

CGMGHG

p < 0.05p < 0.05

p < 0.05p < 0.05

p < 0.05p < 0.05

Figure 6: Western blot analysis of the effects of hydrostatin-SN10on apoptotic markers (Bcl2, BAX, and caspase 3). n = 12 for eachgroup, and statistical difference was significant if p < 0:05.

7Oxidative Medicine and Cellular Longevity

RANTES [34], and TNF-α [35, 36] also significantly alteredor reduced lung injury. These inflammatory cytokines werealso closely related to the development and occurrence of

lung injury. TNF-α, together with other inflammatory fac-tors, could promote lung injury and development [37, 38].These results strongly suggest that the effects of hydrostatin-

CG MG HG

3 d

5 d

p-JAK2

(a)

CG MG HG

3 d

5 d

JAK2

(b)

CG MG HG

p-STAT3

3 d

5 d

(c)

STAT3

3 d

5 d

CG MG HG

(d)

Figure 7: Immunohistochemical analysis of the effects of hydrostatin-SN10 on the relative protein levels of JAK2/STAT3 signaling. (a)p-Jak2. (b) JAK2. (c) p-STAT3. (d) STAT3. n = 12 for each group, and statistical difference was significant if p < 0:05.

8 Oxidative Medicine and Cellular Longevity

SN10 on pancreatitis-induced lung injury may also be due toits effects on many other inflammatory cytokines.

Hydrostatin-SN10 may have a protective effect againstinjury to the pancreas and lungs, reduce apoptosis, theinflammatory cascade, and neutrophil infiltration, and con-trol oxidative stress (Figure 10), which is the main cause oflung injury [39, 40]. Our study findings provide experimentalevidence to support the biological activities of hydrostatin-SN10 in inhibiting pancreatitis-induced lung injury cells,and a further study is needed to explore potential applica-tion of hydrostatin-SN10 in prevention and treatment ofpancreatitis-induced lung injury.

5. Conclusion

In conclusion, our experimental results demonstrated thathydrostatin-SN10 had potent activity against pancreatitis-induced lung injury cells and significantly inhibited the IL-6-induced pancreatitis-associated lung injury cells associatedwith induction of apoptosis, oxidative stress, and inflamma-tory responses and inactivation of the IL-6/JAK2/STAT3 sig-naling pathway. Our findings provide supporting evidence towarrant further preclinical investigation for developinghydrostatin-SN10 as an alternative therapeutic agent againstaggressive lung injury.

CG MG HG

3 d

5 d

Bcl2

(a)

CG MG HG

3 d

5 d

BAX

(b)

CG MG HG

3 d

5 d

Caspase 3

(c)

Figure 8: Immunohistochemical analysis of the effects of hydrostatin-SN10 on apoptotic markers (Bcl2, BAX, and caspase 3). (a) Bcl2. (b)BAX. (c) Caspase 3 n = 12 for each group, and statistical difference was significant if p < 0:05.

9Oxidative Medicine and Cellular Longevity

Data Availability

The data used to support the results of this study are includedin the article. The materials for the current study are availablefrom the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare that they have no conflicts of interest.

References

[1] Amiti, R. Tamizhselvi, and V. Manickam, “Menadione(vitamin K3) inhibits hydrogen sulfide and substance P viaNF-кB pathway in caerulein-induced acute pancreatitis andassociated lung injury in mice,” Pancreatology, vol. 19, no. 2,pp. 266–273, 2019.

[2] Y. Meng, S. Sha, J. Yang, and H. Ren, “Effects of Tec tyrosinekinase inhibition on the inflammatory response of severe acutepancreatitis-associated acute lung injury in mice,” DigestiveDiseases and Sciences, vol. 64, no. 8, pp. 2167–2176, 2019.

[3] B. O'Gara, B. Subramaniam, S. Shaefi, A. Mueller, V. Banner-Goodspeed, and D. Talmor, “Anesthetics to Prevent LungInjury in Cardiac Surgery (APLICS): a protocol for a random-ized controlled trial,” Trials, vol. 20, no. 1, p. 312, 2019.

[4] H. Choi, B. Shin, H. Yoo et al., “Early corticosteroid treatmentfor postoperative acute lung injury after lung cancer surgery,”Therapeutic Advances in Respiratory Disease, vol. 13, article1753466619840256, 2019.

[5] K. Okutur, M. Bozkurt, T. Korkmaz et al., “Metastasis-inducedacute pancreatitis successfully treated with chemotherapy andradiotherapy in a patient with small cell lung cancer,” CaseReports in Oncological Medicine, vol. 2015, Article ID304279, 5 pages, 2015.

[6] L. Wei, J. Gao, S. Zhang et al., “Identification and character-ization of the first cathelicidin from sea snakes with potentantimicrobial and anti-inflammatory activity and specialmechanism,” The Journal of Biological Chemistry, vol. 290,no. 27, pp. 16633–16652, 2015.

[7] Z. Zheng, H. Jiang, Y. Huang et al., “Screening of an anti-inflammatory peptide from Hydrophis cyanocinctus andanalysis of its activities and mechanism in DSS-inducedacute colitis,” Scientific Reports, vol. 6, article 25672, 2016.

[8] G. Wu, J. Wang, P. Luo et al., “Hydrostatin-SN1, a sea snake-derived bioactive peptide, reduces inflammation in a mousemodel of acute lung injury,” Frontiers in Pharmacology,vol. 8, p. 246, 2017.

CG MG HG

3 d

5 d

Figure 9: Tunnel analysis of the effects of hydrostatin-SN10 on the apoptosis of lung tissues among different groups.

IL-6

IL-6R

JAK2 Tyk2

STAT3 STAT3

STAT3

STAT3

Cell apoptosis

Bcl2 Bax

Caspase 3

Hydrostatin-SN10

IL-10TNF-𝛼

SODGSH

Figure 10: Schematic diagram of the effects of hydrostatin-SN10 onthe JAK2/STAT3 signaling pathway. Hydrostatin-SN10 exerts itsanti-inflammation and antioxidant properties via IL-6-inducedJAK/STAT3 signaling pathway. IL-6 binds to the IL-6 receptor onthe cell membrane. The complex of IL-6 and IL-6R interacts theJAK2 and activates transcription factors of the signal transducersand activators of STAT3 and initiates JAK2/STAT2 signaling.STAT3 is phosphorylated and then forms dimers with otherSTAT. The activated STAT3 complex will then enter into thenucleus initiating or inhibiting transcription of its regulating genes(including inflammatory cytokines, oxidative stress, and apoptosisfactors), resulting in the changes of cell apoptosis.

10 Oxidative Medicine and Cellular Longevity

[9] Q. Li, W. X. Ye, Z. J. Huang, Q. Zhang, and Y. F. He, “Effect ofIL-6-mediated STAT3 signaling pathway on myocardial apo-ptosis in mice with dilated cardiomyopathy,” European Reviewfor Medical and Pharmacological Sciences, vol. 23, no. 7,pp. 3042–3050, 2019.

[10] J. M. Shieh, H. Y. Tseng, F. Jung, S. H. Yang, and J. C. Lin,“Elevation of IL-6 and IL-33 levels in serum associated withlung fibrosis and skeletal muscle wasting in a bleomycin-induced lung injury mouse model,” Mediators of Inflamma-tion, vol. 2019, Article ID 7947596, 12 pages, 2019.

[11] H. Zhang, P. Neuhofer, L. Song et al., “IL-6 trans-signalingpromotes pancreatitis-associated lung injury and lethality,”The Journal of Clinical Investigation, vol. 123, no. 3,pp. 1019–1031, 2013.

[12] M. L. Yang, C. T. Wang, S. J. Yang et al., “IL-6 amelioratesacute lung injury in influenza virus infection,” ScientificReports, vol. 7, no. 1, article 43829, 2017.

[13] Y. Zhou, L. Lv, Q. Liu, and J. Song, “Total flavonoids extractedfrom Nervilia fordii function in polycystic ovary syndromethrough IL-6 mediated JAK2/STAT3 signaling pathway,” Bio-science Reports, vol. 39, no. 1, 2019.

[14] Z. Liu, L. Gan, Z. Zhou, W. Jin, and C. Sun, “SOCS3 promotesinflammation and apoptosis via inhibiting JAK2/STAT3 sig-naling pathway in 3T3-L1 adipocyte,” Immunobiology,vol. 220, no. 8, pp. 947–953, 2015.

[15] X. Han, Y.Wang, H. Chen et al., “Enhancement of ICAM-1 viathe JAK2/STAT3 signaling pathway in a rat model of severeacute pancreatitis-associated lung injury,” Experimental andTherapeutic Medicine, vol. 11, no. 3, pp. 788–796, 2016.

[16] A. K. Singh, A. S. Bhadauria, U. Kumar et al., “Novel indole-fused benzo-oxazepines (IFBOs) inhibit invasion of hepatocel-lular carcinoma by targeting IL-6 mediated JAK2/STAT3oncogenic signals,” Scientific Reports, vol. 8, no. 1, article5932, 2018.

[17] E. Reda, S. Hassaneen, and H. S. El-Abhar, “Novel trajectoriesof bromocriptine antidiabetic action: Leptin-IL-6/ JAK2/p-STAT3/SOCS3, p-IR/p-AKT/GLUT4, PPAR-γ/Adiponectin,Nrf2/PARP-1, and GLP-1,” Frontiers in Pharmacology, vol. 9,p. 771, 2018.

[18] H. M. Chen, M. H. Shyr, S. W. Ueng, and M. F. Chen, “Hyper-baric oxygen therapy attenuates pancreatic microcirculatoryderangement and lung edema in an acute experimental pan-creatitis model in rats,” Pancreas, vol. 17, no. 1, pp. 44–49,1998.

[19] G. Rompianesi, A. Hann, O. Komolafe et al., “Serum amylaseand lipase and urinary trypsinogen and amylase for diagnosisof acute pancreatitis,” Cochrane Database of SystematicReviews, vol. 4, article CD012010, 2017.

[20] K. Gavini and K. Parameshwaran, StatPearls Publishing, Trea-sure Island (FL), 2019.

[21] A. Springhorn and T. Hoppe, “Western blot analysis of theautophagosomal membrane protein LGG-1/LC3 in Caenor-habditis elegans,” Methods in Enzymology, vol. 619, pp. 319–336, 2019.

[22] L. Niu, C. Ye, Y. Sun et al., “Mutant huntingtin induces ironoverload via up-regulating IRP1 in Huntington’s disease,” Cell& Bioscience, vol. 8, no. 1, p. 41, 2018.

[23] N. Wang, Y. Huang, A. Li et al., “Hydrostatin-TL1, an anti-inflammatory active peptide from the venom gland of Hydro-phis cyanocinctus in the South China Sea,” International Jour-nal of Molecular Sciences, vol. 17, no. 11, article 1940, 2016.

[24] F. Ning, H. Zheng, H. Tian et al., “Research on effect ofadiponectin on sepsis-induced lung injury in rats throughIL-6/STAT3 signaling pathway,” Panminerva Medica, 2019.

[25] X. Y. Wu, F. Tian, M. H. Su et al., “BF211, a derivative of bufa-lin, enhances the cytocidal effects in multiple myeloma cells byinhibiting the IL-6/JAK2/STAT3 pathway,” InternationalImmunopharmacology, vol. 64, pp. 24–32, 2018.

[26] S. Lei, W. Su, Z. Y. Xia et al., “Hyperglycemia-induced oxida-tive stress abrogates remifentanil preconditioning-mediatedcardioprotection in diabetic rats by impairing caveolin-3-modulated PI3K/Akt and JAK2/STAT3 signaling,” OxidativeMedicine and Cellular Longevity, vol. 2019, Article ID9836302, 19 pages, 2019.

[27] Z. Geng, W. Y. Fan, B. Zhou et al., “FNDC5 attenuates obesity-induced cardiac hypertrophy by inactivating JAK2/STAT3-associated inflammation and oxidative stress,” Journal ofTranslational Medicine, vol. 17, no. 1, p. 107, 2019.

[28] K. Harling, E. Adankwah, A. Güler et al., “Constitutive STAT3phosphorylation and IL-6/IL-10 co-expression are associatedwith impaired T-cell function in tuberculosis patients,” Cellu-lar &Molecular Immunology, vol. 16, no. 3, pp. 275–287, 2018.

[29] W. Jing, F. Qin, X. Guo et al., “G-CSF mediates lung injury inmice with adenine-induced acute kidney injury,” InternationalImmunopharmacology, vol. 63, pp. 1–8, 2018.

[30] D. A. Chepurnova, E. V. Samoilova, A. A. Anisimov, A. D.Verin, and A. A. Korotaeva, “Compounds of IL-6 receptorcomplex during acute lung injury,” Bulletin of ExperimentalBiology and Medicine, vol. 164, no. 5, pp. 609–611, 2018.

[31] X. Jia, B. Cao, Y. An, X. Zhang, and C. Wang, “Rapamycinameliorates lipopolysaccharide-induced acute lung injury byinhibiting IL-1β and IL-18 production,” International Immu-nopharmacology, vol. 67, pp. 211–219, 2019.

[32] Y. Wang, M. Ji, L. Chen, X. Wu, and L. Wang, “Breviscapinereduces acute lung injury induced by left heart ischemicreperfusion in rats by inhibiting the expression of ICAM-1and IL-18,” Experimental and Therapeutic Medicine, vol. 6,no. 5, pp. 1322–1326, 2013.

[33] K. Amirshahrokhi and A. R. Khalili, “Carvedilol attenuatesparaquat-induced lung injury by inhibition of proinflamma-tory cytokines, chemokine MCP-1, NF-κB activation andoxidative stress mediators,” Cytokine, vol. 88, pp. 144–153,2016.

[34] M. Bhatia, A. E. Proudfoot, T. N. Wells, S. Christmas, J. P.Neoptolemos, and J. Slavin, “Treatment with Met‐RANTESreduces lung injury in caerulein‐induced pancreatitis,” TheBritish Journal of Surgery, vol. 90, no. 6, pp. 698–704, 2003.

[35] S. Yu, J. Xie, Y. Xiang et al., “Downregulation of TNF-α /TNF-R1 Signals by AT-Lipoxin A4May Be a Significant Mechanismof Attenuation in SAP-Associated Lung Injury,” Mediators ofInflammation, vol. 2019, Article ID 9019404, 13 pages, 2019.

[36] W. Y. Lai, J. W. Wang, B. T. Huang, E. P. Lin, and P. C. Yang,“A novel TNF-α-targeting aptamer for TNF-α-mediated acutelung injury and acute liver failure,” Theranostics, vol. 9, no. 6,pp. 1741–1751, 2019.

[37] L. Tutkun, S. B. Iritas, S. Deniz et al., “TNF-α and IL-6 as bio-markers of impaired lung functions in dimethylacetamideexposure,” Journal of Medical Biochemistry, vol. 38, no. 3,pp. 276–283, 2019.

[38] N. Murphy, O. Treacy, K. Lynch et al., “TNF-α/IL-1β–licensedmesenchymal stromal cells promote corneal allograft survival-viamyeloid cell-mediated induction of Foxp3+regulatory T

11Oxidative Medicine and Cellular Longevity

cells in the lung,” FASEB Journal, vol. 33, no. 8, pp. 9404–9421,2019.

[39] X. Meng, L. Hu, and W. Li, “Baicalin ameliorateslipopolysaccharide-induced acute lung injury in mice by sup-pressing oxidative stress and inflammation via the activationof the Nrf2-mediated HO-1 signaling pathway,” Naunyn-Schmiedeberg's Archives of Pharmacology, vol. 392, no. 11,pp. 1421–1433, 2019.

[40] X. Gu, Y. Nan, X. Pang, W. Zhang, J. Zhang, and Y. Zhang,“products of oxidative stress and transient receptor potentialankyrin A1 expression in the brainstem after lung ischemia-reperfusion injury,” Pulmonary Circulation, vol. 9, no. 3,article 204589401986516, 2019.

12 Oxidative Medicine and Cellular Longevity

Stem Cells International

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

MEDIATORSINFLAMMATION

of

EndocrinologyInternational Journal of

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

Disease Markers

Hindawiwww.hindawi.com Volume 2018

BioMed Research International

OncologyJournal of

Hindawiwww.hindawi.com Volume 2013

Hindawiwww.hindawi.com Volume 2018

Oxidative Medicine and Cellular Longevity

Hindawiwww.hindawi.com Volume 2018

PPAR Research

Hindawi Publishing Corporation http://www.hindawi.com Volume 2013Hindawiwww.hindawi.com

The Scientific World Journal

Volume 2018

Immunology ResearchHindawiwww.hindawi.com Volume 2018

Journal of

ObesityJournal of

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

Computational and Mathematical Methods in Medicine

Hindawiwww.hindawi.com Volume 2018

Behavioural Neurology

OphthalmologyJournal of

Hindawiwww.hindawi.com Volume 2018

Diabetes ResearchJournal of

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

Research and TreatmentAIDS

Hindawiwww.hindawi.com Volume 2018

Gastroenterology Research and Practice

Hindawiwww.hindawi.com Volume 2018

Parkinson’s Disease

Evidence-Based Complementary andAlternative Medicine

Volume 2018Hindawiwww.hindawi.com

Submit your manuscripts atwww.hindawi.com