Article

Pesticides-induced biochemicalalterations in occupational NorthIndian suburban population

RK Sharma1, G Upadhyay2, NJ Siddiqi3 andB Sharma1

AbstractPesticides are used in agriculture to protect crops from insects–pests. Most of the field workers of NorthIndian population are exposed to commonly used insecticides. In the present study, pesticides induced oxida-tive stress as well as alterations in the level of acetylcholinesterase (AChE) in a total of 70 male healthyagricultural sprayers, exposed to pesticides for about 5 years, were studied and the results were comparedwith 70 controls. The levels of antioxidant enzymes (superoxide dismutase, CAT, glutathione-S-transferaseand glutathione peroxidase), AChE, lipid peroxidation and glutathione (GSH) contents were determined intheir blood erythrocytes (red blood cells (RBCs)). The results indicated significant increase in the levels ofmalondialdehyde as well as the activities of antioxidant enzymes in pesticide-exposed individuals. The levelsof GSH, RBC-AChE activity and plasma antioxidant potential were sharply decreased when compared withcontrol subjects. The ferric-reducing ability of plasma (FRAP) assay was carried out to evaluate the antioxidantpotential of pesticide in exposed as well as healthy controls. A significant positive correlation was observedbetween plasma FRAP value and the activity of AChE from RBCs in pesticides sprayers. Furthermore, theseresults were supported by enhanced messenger RNA expressions of cytochrome P450 isoform 2E1 (CYP2E1)and gutathione-S-transferase isoform pi (GST-pi) in the white blood cells of the randomly selected pesticide-exposed individuals. The decreased GSH level in human red blood cells accompanied by increase in the levels ofthe activities of antioxidative enzymes and over expressions of CYP2E1 and GST-pi is an indicative of oxidativestress in pesticides-exposed individuals. The reduced activity of AChE indicates possible occurrence of pertur-bations in blood as well as neurotoxicity in pesticide sprayers.

KeywordsPesticides; lipid peroxidation; erythrocytes; antioxidant enzymes; AChE; GSH

Introduction

The increased use of pesticides has caused both envi-

ronmental and public health concerns.1 Pesticides are

widely used in agriculture to improve production,

protect stored crops and control disease vectors.

Although pesticides usage has benefits, the health

risks have been associated to nontarget subjects

including humans who are occupationally and/or

environmentally exposed to these agrochemicals.2

These compounds are known to produce toxicity to

different systems in the human body resulting in

hematological and biochemical perturbations.3 In

north Indian population, the exposure of field workers

to the pesticides such as organophosphates (OPs),

carbamates (CMs), organochlorines and pyrethriods

is very common. Occupational exposure of farmers

in particular to these pesticides occurs via dermal

1 Department of Biochemistry, Faculty of Science, University ofAllahabad, Allahabad, Uttar Pradesh, India2 Department of Biology, City College of New York, New York,NY, USA3 Department of Biochemistry, College of Science, King SaudUniversity, Riyadh, Saudi Arabia

Corresponding author:Bechan Sharma, Department of Biochemistry, Faculty of Science,University of Allahabad, Allahabad 211002, Uttar Pradesh, India.Email: bechansharma@gmail.com

Human and Experimental Toxicology32(11) 1213–1227

ª The Author(s) 2013Reprints and permission:

sagepub.co.uk/journalsPermissions.navDOI: 10.1177/0960327112474835

het.sagepub.com

absorption and inhalation.4 Chronic exposure to pesti-

cides is associated with damage to health as these

chemicals are reported to induce oxidative stress via

production of reactive oxygen species (ROS) such

as superoxide anions (O2_c), hydrogen peroxide

(H2O2) and hydroxyl radicals (OH�), carcinogenesis,

neurotoxicity, reproductive and developmental aber-

rations and immunotoxicity.2,5

For last two decades, the pesticide-induced oxida-

tive stress as a possible mechanism of toxicity has

been a focus of toxicological research.6 Strong asso-

ciation of aerial exposure of these pesticides to gen-

otoxicity and onset of neurological symptoms in the

humans have been reported.7,8 These reports have

also indicated that these compounds may cause

alterations in the level of acetylcholinesterase

(AChE) from red blood cell (RBC) membrane,

micronucleus formation, sister chromatid exchanges

in mice and human lymphocytes and chromosomal

as well as mitotic aberrations in peripheral blood

lymphocytes.9–11

Erythrocytes (Red blood cells (RBCs)) have been

used as a convenient tool to evaluate oxidative stress

induced by xenobiotics and prooxidants in terms of

alterations in the biochemical constituents of the

membrane.12 The presence of hemoglobin (Hb), oxy-

gen and polyunsaturated fatty acids makes RBCs

prone to oxidative stress leading to the osmotic fragi-

lity. The RBC membrane integrity is maintained by a

balanced action of the prooxidant chemical species

and the antioxidant defense system.13

The evaluation of xenobiotic-induced oxidative

stress in terms of the alterations in the levels of the

activities of antioxidative enzymes such as cytochrome

P450s (CYPs), superoxide dismutase (SOD), catalase

(CAT), glutathione-S-transferase (GST), glutathione

reductase (GR), glutathione peroxidase (GPx) as well

as the membrane lipid peroxidation (LPO) and fragility

has been widely studied in order to ascertain the extent

of ROS-mediated toxicity.14 The ROS have been

shown to cause apoptosis as well as altered expression

of xenobiotic-metabolizing enzymes.15,16 In fact to

attain a dynamic homeostasis, a balance between the

functions of CYPs, phase II and antioxidant enzymes

with the ROS is maintained. The major xenobiotic bio-

transformation reactions of phase I metabolism are

catalyzed by CYP isoenzymes by hydroxylation, desa-

turation, dealkylation, sulfoxidation and nitroreduc-

tion. CYPs are involved in metabolic activation and

oxidative metabolism of many endogenous and foreign

chemicals resulting in toxic metabolites that in turn

produce toxicity to vital organs in experimental ani-

mals and humans. However, the phase II enzymes

such as GST and uridine diphosphate-glucuronyl trans-

ferase are mainly involved in early cellular defense

against toxicity. The imbalance in it by any means

causes excessive production of reactive intermediates

and ROS that may cause damage to the macromole-

cules.17,18 The impaired dynamic homeostasis due to

increased oxidative stress and DNA damage due to

increased production of ROS has been shown to be

associated with the pesticide-induced health hazards.8

These notions have been supported by some studies

indicating that the prolonged exposure to pesticides

alter the expression and activities of oxidative redox

indices (SOD, CAT, GPx, GR, etc.).19,20

The relationship between free radicals and CYPs is

well documented. The CYP enzymes, being the most

important xenobiotic-metabolizing enzymes, produce

ROS during biotransformation of xenobiotics. Cells

generate ROS such as superoxide anion (O2_c�) and

H2O2 as a result of the metabolism of xenobiotics

by CYP. Both O2_c� and H2O2 may be converted to

a highly reactive hydroxyl radical (OH.�) by iron

(Fe2þ)-catalyzed Haber–Weiss and Fenton reactions.

Many xenobiotics are converted to toxic quinones

by CYP. These quinones are redox-sensitive agents

and are reversibly reduced to semihydroquinones/

hydroquinones, which generate O2_c�.2

Various efforts have been made in past in order to

predict the underlying mechanism of pesticide-

induced toxicity using in vitro and animal model

systems. These predictions may or may not be directly

correlated with humans. Since the consequences of

pesticide exposure could vary from one population

to another or one ethnic group to another depending

upon the environmental conditions, it is inevitable

to assess the toxicity induced by pesticides in North

Indian suburban/rural population, who have been

using different pesticides as spray to protect their

crops from the insects–pests. Using blood cells (RBCs

and white blood cells (WBCs)) of the pesticide-

exposed individuals, we have shown in the present

communication that the field occupants and pesticide

sprayers from a section of North Indian suburban/

rural population exhibit high level of oxidative stress

and increased levels of expressions of cytochrome

P450 isoform 2E1 (CYP2E1) and gutathione-S-trans-

ferase isoform pi (GST-pi). The information from this

work may be exploited for proper strategy design

toward adequate pesticide formulation and usage as

well as better environmental management.

1214 Human and Experimental Toxicology 32(11)

Materials and methods

Chemicals and reagents

Bromophenolblue, 1-chloro-2,4-dinitrobenzene

(CDNB), dithiothreitol, ethidium bromide (EtBr),

ethoxy resorufin (ERF), ethylene-diamine-tetra-acetic

acid (EDTA), glucose-6-phosphate dehydrogenase

(GDH), glutathione (GSH; oxidized), GSH (reduced),

H2O2, nicotinamide adenine dinucleotide phosphate

(NADPH), 4-nitrocatechol, p-nitrophenol, perchloric

acid, pyrogallol, resorufin tetrasodium salt, thiobarbi-

turic acid (TBA) and 2,4,6-tri[2-pyridyl]-s-triazine and

Tris-base were purchased from Sigma-Aldrich (India).

Reverse transcriptase polymerase chain reaction (PCR)

kit was purchased from MBI Fermentas (Amherst ,

New York, USA). Taq polymerase, Taq buffer, deox-

yribonucleotide triphosphates (dNTPs), 100 bp ladder,

the forward and reverse primers for cytochrome P450

isoform 1A1 (CYP1A1), CYP2E1, GST-pi and glycer-

aldehyde 3-phosphate dehydrogenase (GAPDH) were

procured from Bangalore Genei (Bangalore, India).

Some common chemicals were procured locally.

Subjects and sample collection

Institutional Ethics Committee clearance was obtained

for collecting the human blood samples. Informed con-

sent was obtained from all the participants prior to their

inclusion in the study. The blood samples (5 ml) were

collected from 70 male occupational pesticide sprayers

on different farms and orchards and from 70 healthy

males that have no previous or current exposure to

pesticides. All the subjects were residents of Allahabad

and Lucknow or its adjacent areas in North India. The

groups of pesticides most commonly used by order of

frequency were organophosphates (OPs), CMs, orga-

nochlorines and pyrethroids. The purpose of the study

was explained to all the participants and their consents

were taken. A detailed questionnaire including demo-

graphic characteristics was recorded (Table 1). A com-

plete health assessment of each participant was also

performed during the sample collection. It is important

to mention that the farmers included in the study

usually did not wear gloves or masks or any other pro-

tection devices during spraying the pesticides. They

were having previous spraying experience of about

3–8 years. Average exposure duration for sprayers and

farmers was 3–4 h/week. Mixing of chemicals with

bare hands and leakages from the tanks of pesticide

during spraying operations were found to be very com-

mon for these individuals (Table 1).

Sample preparation

Venous blood was collected in the heparinized tubes

from both normal and occupational sprayers as coded

samples from both the control and sprayers. Samples

were transported to the analytical toxicology laboratory

in ice-cold condition immediately after the collection.

The content was centrifuged at 1000g for 10 min for

RBC separation. The buffy coat was removed and the

remaining RBCs were drawn from the bottom and then

the packed RBCs were washed three times with cold

phosphate-buffered saline (pH 7.4). After the final

wash, the RBCs were lysed by hypotonic shock and

different dilutions were used as hemolysate.21 The

analyses of different biochemical indices were carried

out in the hemolysate on the same day.

RNA isolation

The total RNA was extracted from 1 ml blood

obtained from controls and pesticide-exposed individ-

uals using standard procedure. In brief, 1 ml blood

sample was mixed with same volume of TRI BD

reagent kit in ice-cold condition. Chloroform was

added to each sample (0.2 ml ml�1 of TRI BD reagent

used), mixed and kept at room temperature for 10 min.

The sample was centrifuged at 12,000g for 15 min at

4�C. The aqueous phase was collected in fresh tube

and isopropanol was added to it (0.5 ml ml�1 of TRI

BD reagent used). The mixture was mixed gently and

kept at room temperature for 10 min. The samples

were centrifuged again at 12,000g for 10 min at

Table1. Demographic details about the normal as well asoccupational pesticide-exposed subjects.

VariablesHealthycontrols

Pesticidesprayers

Age (years) 31.25 + 3.06 (24–38) 29.73 + 9.39 (18–54)Height (cm) 167 + 4 (162–173) 161 + 3 (151–167)Weight (kg) 64.83 + 9.35(56–81) 53.75 + 8.45 (45–67)Addiction

Tobacco chewers 0 13Smoking 0 2Alcoholic 0 6

EthnicityUrban 54 23Rural 16 47

EducationLiterate 57 52Illiterate 13 18

DietVegetarian 52 43Nonvegetarian 18 27

Experience ofpesticide spraying

0 3–8 years

Sharma RK et al. 1215

4�C. The obtained RNA pellet was washed with 75%ethanol and centrifuged at 7500g for 10 min. The

resulting RNA pellet was dried under electric lamp

and dissolved in diethylpyrocarbonate (DEPC)-

treated water (RNase-free water) and stored at

�80�C till further use. The concentration of RNA was

determined by reading the absorbance at 260 nm.

cDNA preparation

Complementary DNA (cDNA) synthesis from isolated

RNA was performed using oligo dT primers and

RevertAid™ minus Mu-LV reverse Transcriptase Kit

(Thermo Scientific, Life Science Research, USA)

under standard conditions supplied by manufacturer.

In brief, 200 ng of total RNA was mixed with 5 ml of

oligo dT primer (1 mg ml�1), and the final volume was

made up to 11 ml by the addition of RNase-free DEPC-

treated water. The content was mixed gently and incu-

bated for 5 min at 65�C. The mixed content was chilled

on ice for 1 min and then 4 ml of 5X reaction buffer

(supplied with kit), 2 ml of dNTP and 2 ml of RNase-

free DEPC-treated water were added. The mixture was

incubated at 25�C for 5 min. Finally, reverse transcrip-

tase enzyme (1 ml) was added to the mix and incubated

for 60 min at 37�C. The reaction was terminated by

heating the content at 70�C for 5 min. cDNA samples

prepared were stored at �80�C until further use.

Expression analysis

Forward and reverse primers for CYP1A1, CYP2E1,

GST-pi and GAPDH were synthesized as described

previously in the literature.22–24 Primer sequences and

PCR conditions for above mentioned genes are given

in Table 2. The PCR products were visualized on

1.2% (w/v) agarose gel in the presence of EtBr

(20 mg ml�1) and the density of the bands was analyzed

by computerized densitometry system (Alpha Imager

System; Alpha Innotech Corporation, San Leandro,

CA, USA) and normalized to that of GAPDH.

GSH content

RBC GSH was measured by the method of Beutler.25

This method was based on the ability of the –SH

group to reduce 5,50-dithiobis-2-nitrobenzoic acid

(DTNB), which possesses a molar absorption coeffi-

cient (e ¼ 1.36 � 104 M�1 s�1) and forms a yellow-

colored anionic product whose optical density is mea-

sured at 412 nm. The concentration of GSH is

expressed in milligram per millililer of packed RBCs.

Determination of SOD activity in human RBCs

The activity of human RBC SOD was determined by

slight modification of the method described by Mark-

lund and Marklund.26 In brief, the assay mixture

containing hemolysate (50 ml) was incubated with

2.85 ml of 0.05 M Tris–succinate buffer (pH 8.2) at

37�C for 20 min. Reaction was started by adding

100 ml of 8 mM pyrogallol. The increase in

absorbance was recorded at 412 nm for 3 min at 30s

intervals. An appropriate blank was also run simulta-

neously. The SOD activity is expressed in unit (50%inhibition of pyrogallol autoxidation per minute) per

milligram of Hb.

Determination of CAT activity in human RBCs

The CAT activity in hemolysate of human RBCs was

measured spectrophotometrically by monitoring the

decrease in H2O2 concentration over increasing reac-

tion time as described by Aebi.27 The reaction mix-

ture contains hemolysate diluted 1:50 in 50 mM

phosphate buffer (pH 7.0) and 10 mM H2O2 in a

quartz cuvette. The decomposition rate of the

Table 2. Primer sequences to amplify the genes involved in the pesticide metabolism.

Gene Primers Amplicon Size (bp) Number of cycles Reference

CYP1A1 FP-50TTCCGACACTCTTCCTTCGT30 367 30 Fasco et al.22

RP-50ATGGTTAGCCCATAGATGGG30

CYP2E1 FP-50TTCAGCGGTTCATCACCCT30 77 30 Furukawa et al.23

RP-50GAGGTATCCTCTGAAAATGGTGTC30

GST-pi FP-50GGCTCACTCAAAGCC TCCTG30 246 32 Kuzma et al.24

RP-50AGTGCCTTCACATAGTCATC30

GAPDH FP-50GGTCGGAGTCAACGGATTTGGTCG30 787 – Fasco et al.22

RP-CCTCCGACGCCTGCTTCCCAAC30

CYP1A1: cytochrome P450 isoform 1A1; CYP2E1: cytochrome P450 isoform 2E1; GST-pi: gutathione-S-transferase isoform pi;GAPDH: glyceraldehyde 3-phosphate dehydrogenase; FP: forward primer; RP: reverse primer; bp: base pair.

1216 Human and Experimental Toxicology 32(11)

substrate H2O2 at a final concentration of 10 mmol l�1

was monitored at 240 nm and 25�C after adding

directly the sample in cuvette. The CAT activity was

calculated in units (micromoles of H2O2 decomposed

per minute) per milligram of Hb.

Isolation of WBCs from human blood

The isolation of WBCs was carried out according to the

method described by Boyum.28 The whole blood was

centrifuged at 250g for 20 min at 20�C to remove plate-

lets and plasma. WBCs were isolated from the buffy

coat by dextran sedimentation and further purified with

histopaque density gradient centrifugation at 700g for

30 min at 20�C. WBCs were recovered from histopaque

11191/10771 and washed thrice with Hank’s balanced

salt solution (pH 7.4, 138 mM sodium chloride (NaCl),

2.7 mM potassium chloride, 8.1 mM disodium hydro-

gen phosphate and 1.5 mM potassium dihydrogen phos-

phate) containing 0.6 mM magnesium chloride, 1.0 mM

calcium chloride and 10 mM glucose.

CYP1A1 activity assay in WBCs from humanblood

The activity of CYP1A1 was assayed according to the

method described elsewhere by Pohl and Fouts29 and

Upadhyay et al.17 The activity of CYP1A1 was moni-

tored in terms of ethoxy resorufin-o-deethylase

(EROD) activity spectrofluorimetrically. The incuba-

tion mixture (3 ml) containing phosphate buffer, pH

7.4 (100 mM), glucose-6-phosphate (5 mM), GDH

(1–2 units), magnesium sulfate (5 mM), BSA

(1.6 mg ml�1), ERF (1.5 mM), NADPH (0.6 nM) and

varying concentrations of WBC lysate proteins was

incubated at 37�C for 20 min in water bath. Methanol

of 2.5 ml was added to the incubation mixture to stop

the reaction and vortexed for 30s. The incubation mix-

ture was kept on ice for 2 min. Mixture was centrifuged

at 825g for 10 min and the supernatant was measured at

550 nm excitation and 585 nm emission wavelengths

and the activity was expressed in picomoles of resoru-

fin per minute per milligram of protein.

Measurement of CYP2E1 activity (PNPH assay)in WBCs lysate

CYP2E1 activity was determined according to the

method described elsewhere by Koop,30 with a slight

modification. Reaction mixture containing 4-

nitrophenol (0.2 mM) mixed with 50 mM Tris-

hydrochloric acid (HCl; pH 7.4), 25 mM MgCl2 and

varying concentrations of WBCs lysate proteins was

incubated at 37�C for 5 min. A 20-ml of 50 mM

NADPH was added to initiate the reaction and was

further incubated for 10 min. A 500-ml 0.6 N perchlo-

ric acid was added to stop the reaction. After centrifu-

gation at 825g for 20 min, supernatant was taken and a

100-ml 10 N sodium hydroxide (NaOH) was added

and the absorbance was monitored at 510 nm.

CYP2E1 activity was calculated in terms of nano-

moles of nitrophenol hydroxylation per minute per

milligram of proteins.

GST activity assay

GST activity was measured spectrophotometrically

by the method of Habig et al.31 using CDNB as sub-

strate. In brief, the assay mixture (3 ml) contained 1

mM CDNB in ethanol, 1 mM GSH, 100 mM potas-

sium phosphate buffer (pH 6.5) and sample aliquots.

Activity was determined by measuring an increase

in the absorbance of the reaction mixture at 340 nm.

Enzyme activity was calculated using the extinction

coefficient (e ¼ 9.6 mM�1 cm�1) and expressed as

unites per milligram of Hb.

GPx activity assay

The GPx activity was determined using the method of

Paglia and Valentine.32 The sample was diluted 1:50 in

100 mM phosphate buffer (pH 7.4) containing 1 mM

EDTA and added to the assay tube. The final concen-

trations of the reagents used in the assay were 0.3 mM

GSH, 0.3 mM NADPH, 1.1 U ml�1 GR from Sacchar-

omyces cerevisiae (Sigma, St Louis, Missouri, USA)

and 44.1 mM phosphate buffer (pH 7.4). After 3 min

of incubation at 37�C, the change in absorbance was

monitored at 340 nm after the addition of 1.1 mM (final

concentration) tert-butyl hydroperoxide. GPx activity

was calculated as unit (micromoles of NADPH oxi-

dized per minute) per milligram of Hb.

Quantification of LPO

LPO was measured according to the method of Ester-

bauer and Cheeseman.33 Packed RBCs (0.2 ml) were

suspended in phosphate buffer (pH 7.4). The lysate

(1 ml) was added to 1 ml of 10% trichloroacetic acid

and the mixture was centrifuged for 5 min at 3000 r/

min. The supernatant (1 ml) was added to 1 ml of

0.67% TBA in 0.05 mol l�1 NaOH and heated for

30 min at 90�C. The reaction mixture was cooled and

the absorbance was recorded at 532 nm. The

Sharma RK et al. 1217

concentration of malondialdehyde (MDA) in RBCs

was determined from a standard plot and expressed

as nanomoles per milliliter of packed RBCs.

Determination of FRAP

The ferric-reducing ability of plasma (FRAP) values

were determined following the method of Benzie and

Strain.34 Working FRAP reagent was prepared by mix-

ing acetate buffer (300 mM, pH 3.6), 2,4,6-tri[2-pyri-

dyl]-s-triazine (10 mM in 40 mM HCl) solution and

FeCl3_c6H2O (20 mM) solution in 10:1:1 ratio, respec-

tively. FRAP reagent of 3 ml was mixed with 100 ml of

plasma; the content was mixed vigorously so that the

contents were mixed thoroughly. The absorbance was

read at 593 nm at the interval of 30s for 4 min. Aqueous

solution of known Fe2þ concentration in the range of

100–1000 mM was used for calibration. Using the

regression equation, the FRAP values (micromoles of

Fe(II) per milliliter of the plasma) was calculated.

Determination of the activity of AChE(E.C. 3.1.1.7) in RBCs

The membrane bound AChE activity in the human

RBCs was analyzed following the methods of Ellman

et al.35 and Beutler.25 Packed RBCs were suspended

in 0.154 M NaCl and to this suspension, b-

mercaptoethanol-EDTA stabilizing solution was

added and the hemolysate was frozen overnight. The

hemolysate was thawed preceding the experimental

procedure. The reaction mixture is composed of

50 mM Tris-HCl (pH 7.4) and 5 mM EDTA with

0.5 mM DTNB solution. The reaction was initiated

by adding 0.5 mM acetylthiocholine iodide. The

increase in optical absorbance was monitored at

412 nm, 28 + 1�C and 30s intervals for 3 min using

a ultraviolet–visible double beam spectrophotometer

(Thermo Scientific Chemito Spectroscan UV 2700,

Nasik, India) with quartz cuvette (1 cm light path)

against a blank. Measurements were made in tripli-

cate for each blood sample. One unit of AChE

activity was expressed as nanomoles of substrate

hydrolyzed per minute per gram of Hb under experi-

mental conditions using extinction coefficient (e)13.6 � 104 M�1 cm�1.

Determination of protein content

Protein concentrations were determined by the

Lowry’s method36 using bovine serum albumin

(BSA) as a standard.

Determination of Hb concentration

The conversion of Hb to cyanomethemoglobin by

Drabkin reagent was measured against a standard

curve using a known procedure.37 The results are

expressed as grams per 100 ml Hb.

Statistical analysis

The samples were coded at the time of preparation

and they were decoded before statistical analysis for

comparison. All experiments were carried out in

duplicate. Student’s t test was used for comparisons

between control and exposed groups. The data are

expressed as means + SD, further differences

between control and pesticide worker endpoints

means were analyzed using the Mann–Whitney non-

parametric test and was used to compare the demo-

graphic characteristics of studied populations. The

level of significance was set at p < 0.05. All analyses

were performed with the Prism 5.01 (GraphPad soft-

ware, Inc., La Jolla, CA, USA) statistical software

package.

Results

The mRNA expression pattern in pesticidesprayers

The results of the analysis of messenger RNA

(mRNA) expression of CYP1A1 gene as shown in

Figure 1(a) indicated that it was not significantly

affected in the pesticide-exposed individuals when

compared with healthy controls. The expression pro-

file of a housekeeping gene, GAPDH, has been used

as a reference. The band density ratio of CYP1A1 to

that of GAPDH presented in Figure 1(b) illustrates

the similar pattern. In contrast, the levels of mRNA

expression of CYP2E1 and GST-pi genes were

observed to be increased in the pesticide-exposed

individuals when compared with healthy control.

The CYP2E1 mRNA expression is found to be sig-

nificantly increased in comparison with the control

(Figure 2(a)). The band density ratio of CYP2E1 to

that of GAPDH presented in Figure 2(b) also reflects

the similar effect. GST-pi mRNA expression is also

more in the WBCs of pesticide-exposed individuals

than the normal controls (Figure 3(a)). The band

density ratio of GST-pi to that of GAPDH presented

in Figure 3(b) also corroborate this increasing

expression pattern of GST-pi gene in occupationally

pesticide-exposed individuals.

1218 Human and Experimental Toxicology 32(11)

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

Ban

d de

nsit

y ra

tio

(CY

P1A

1/G

AP

DH

)

0

2

4

6

8

10

12

14

C1

pM r

esor

ufin

/min

/mg

prot

ein

(a)

(b)

(c)

C1 C2 C3 C4 C5 E1 E2 E3 E4 E5

CYP1A1 (367 bp)

GAPDH (787 bp)

C2 C3 C4 C5 E1 E2 E3 E4 E5

C1 C2 C3 C4 C5 E1 E2 E3 E4 E5

Figure 1. Expression profiles of CYP1A1 gene (a, upper panel) and a housekeeping gene, GAPDH (a, lower panel). Thefigures shown in (a) represent levels of mRNA expressed from these genes in the randomly selected control and thesprayer subjects. C1–C5 represent control group and E1–E5 represent group of pesticide-exposed individuals. (b) Bardiagram showing band density ratio of CYP1A1 and GAPDH. (c) Bar diagram showing EROD activity as a spectrofluoro-metric measurement of CYP1A1 activity in the lymphocytes of the control and sprayer subjects. EROD activity was deter-mined as described in Materials and Methods section. GAPDH: glyceraldehyde 3-phosphate dehydrogenase; EROD:ethoxy resorufin-o-deethylase; mRNA: messenger RNA; CYP1A1: cytochrome P450 isoform 1A1.

Sharma RK et al. 1219

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

Ban

d de

nsit

y ra

tio

(CY

P2E

1/G

AP

DH

)

0

0.02

0.04

0.06

0.08

0.1

0.12

0.14

0.16

0.18

nM/m

in/m

g pr

otei

n

(a)

(b)

(c)

C1 C2 C3 C4 C5 E1 E2 E3 E4 E5

CYP2E1 (77 bp)

GAPDH (787 bp)

C1 C2 C3 C4 C5 E1 E2 E3 E4 E5

C1 C2 C3 C4 C5 E1 E2 E3 E4 E5

Figure 2. Expression profiles of CYP2E1 gene (a, upper panel) and a housekeeping gene, GAPDH (a, lower panel). Thefigures shown in (a) represent levels of mRNA expressed from these genes in the randomly selected control and thesprayer subjects. C1–C5 represent control group and E1–E5 represent group of pesticide-exposed individuals. (b) Bardiagram showing band density ratio of CYP2E1 and GAPDH. (c) Bar diagram showing p-nitrophenol-o-hydroxylation(PNPH) activity as a spectrophotometric measurement of the activity of CYP2E1 in the lymphocytes of the control andsprayer subjects. PNPH activity was determined as described in Materials and Methods section. GAPDH: glyceraldehyde3-phosphate dehydrogenase; mRNA: messenger RNA; CYP2E1: cytochrome P450 isoform 2E1.

1220 Human and Experimental Toxicology 32(11)

Levels of the activities of CYP1A1 and CYP2E1 inpesticide sprayers

The activities of CYP1A1 and CYP2E1 from the

WBCs were assayed by monitoring EROD and extent

of p-nitrophenol hydroxylation (PNPH), respectively,

as described in Materials and Methods section. The

results presented in Figure 1(c) indicated almost no

alteration in the activity of CYP1A1 in pesticide

sprayers. In contrast, the activity of CYP2E1 exhib-

ited significant increase in the pesticide sprayers (Fig-

ure 2(c)) with a good correlation with mRNA

expression pattern (Figure 2(b)).

GSH content in pesticide sprayers

The GSH content in the RBCs was found to be dras-

tically decreased to about half in the pesticide-

exposed individuals when compared with the healthy

controls. The results presented in Table 3 indicated

that the decrease was consistent in all the pesticide-

exposed individuals and was found statistically signif-

icant (p < 0.001).

SOD activity profile in pesticide sprayers

The activity of SOD in the RBCs was found to be

markedly increased to almost two folds in the pesti-

cide sprayers when compared with the healthy con-

trols. The data presented in Table 3 indicated that

this alteration was consistent in all the exposed sub-

jects and was found statistically significant

(p < 0.001).

CAT activity profile in pesticide sprayers

Similar to the trend in the activity of SOD, the CAT

activity in the RBCs was also found to be increased

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

C1 C2 C3 C4 C5 E1 E2 E3 E4 E5

Ban

d de

nsit

y ra

tio

(GST

-pi/G

AP

DH

)

(a)

(b)

C1 C2 C3 C4 C5 E1 E2 E3 E4 E5

GST-pi (246 bp)

GAPDH (787 bp)

Figure 3. Expression profile of GST-pi gene (a, upper panel) and a housekeeping gene, GAPDH (a, lower panel). Thefigures shown in (a) represent levels of mRNA expressed from these genes in the randomly selected control and thesprayer subjects. C1–C5 represent control group and E1–E5 represent group of pesticide-exposed individuals. (b) Bardiagram showing band density ratio of GST-pi and GAPDH. GST: glutathione-S-transferase isoform pi; GAPDH: glycer-aldehyde 3-phosphate dehydrogenase; mRNA: messenger RNA.

Sharma RK et al. 1221

by more than 50% in the exposed individuals than

healthy controls (Table 3). This increase was recorded

to be statistically significant (p < 0.01).

Patterns of the activities of GST and GPx inpesticide sprayers

The data presented in Table 3 indicated that the activ-

ities of GST and GPx in the RBCs of pesticide

sprayers were sharply increased when compared with

those of healthy controls; the fold increase in their

activities being about 2 and 1.5, respectively. The

analysis of the data suggests that the increase in these

indices was consistent and statistically significant

(p < 0.001 for GST and p < 0.01 for GPx).

Lipid peroxidation

In order to investigate the level of oxidative damage

due to LPO, the assay for measurement of MDA for-

mation in the RBCs of pesticide sprayers was con-

ducted as described in Materials and Methods

section. The results presented in Table 3 demon-

strated significant (p < 0.001) increase in the level

of LPO in the pesticide sprayers when compared

with the healthy controls. The increase was consis-

tent in all the representative exposed subjects ana-

lyzed in the study.

Level of total antioxidant capacity in pesticidessprayers in terms of FRAP

The total antioxidant capacity in the pesticides

sprayers was measured in terms of FRAP by the

method of Benzie and Strain34 as described in Mate-

rials and Methods section. The results of the present

study indicated significant (p < 0.001) decline of

51.97% in the blood plasma antioxidation potential

of pesticide-exposed individuals than the normal as

shown in Figure 4.

Level of AChE activity in the human RBCs ofpesticide sprayers

Since the alterations in the AChE activity during oxi-

dative stress have also been reported, the present

study therefore is an attempt to assess the status of the

activity of AChE in the RBCs isolated from occupa-

tionally exposed pesticides sprayers. The data pre-

sented in Figure 5 show low level of AChE activity

in the pesticides sprayers when compared with that

of controls. The pesticides sprayers registered 35%lower level of AChE activity in the RBCs than the

normal individuals.

Correlation between AChE activity and totalantioxidant capacity of plasma (measured asFRAP)

The results shown in Figure 6 represent the correla-

tion between the activity of AChE in the RBCs and

total plasma antioxidant capacity, measured in terms

of FRAP values. The decrease in AChE correlates sig-

nificantly (p < 0.001; r2 ¼ 0.2568) with decrease in

the antioxidant capacity of the plasma in the blood

of pesticide sprayers. These results indicated that the

decline in plasma antioxidant capacity due to

Table 3. Effect of pesticides on the levels of antioxidative indices.a

Subjects

Levels of antioxidative indices

GST(U mg�1 Hb)b

SOD(U mg�1 Hb)c

CAT(U mg�1 Hb)d

GPx(U mg�1 Hb)e

GSH(mg dl�1 prbc)

LPO(nmol ml�1)

Control (70) 4.51 + 0.25 7.74 + 0.22 81.35 + 1.99 17.5 + 0.61 70.66 + 2.01 5.85 + 0.52Pesticide sprayer (70) 9.42 + 0.52f 13.38 + 0.14g 129.38 + 3.3g 27.1 + 0.76g 33.22 + 1.95f 12.1 + 1.31f

GSH: glutathione; SOD: superoxide dismutase; CAT: catalase; GST: glutathione-S-transferase; GPx: glutathione peroxidase; LPO: lipidperoxidation; CDNB: 1-chloro-2,4-dinitrobenzene; H2O2: hydrogen peroxide; Hb: hemoglobin.aThe quantitative estimations of the parameters studied were made in the control as well as the pesticide sprayer subjects as describedin Materials and Methods section. The results represent the average values after conducting three independent experiments. Values areexpressed as means + SEM.bMicromoles of GSH-CDNB conjugate formed per minute per milligram of Hb.cOne unit is equal to 50% inhibition pyrogallol autoxidation per minure per milligram of Hb.dMicromoles of H2O2 consumed per minute per milligram of Hb.eMicromoles of GSH utilized per minute per milligram of Hb.fSignificant changes are expressed as p < 0.001.gSignificant changes are expressed as p < 0.01.

1222 Human and Experimental Toxicology 32(11)

increased pesticides-induced oxidative stress might

be contributing in significant reduction in the activity

of AChE in association with those of pesticides in the

pesticide sprayers (Figure 6).

Discussion

Pesticides are known to cause free radical-mediated

toxicity in organisms via production of ROS.8 The

detrimental effects caused by ROS occur as a conse-

quence of an imbalance between the oxidative and

antioxidant indices in an individual due to

pesticide-induced toxicity.10 Inactivation and

removal of ROS depend on the reactions involving

the antioxidant defense system.5 The capacity of

antioxidant defense is determined by the contribu-

tions of certain vitamins, reduced GSH and antioxi-

dant enzymes.15 The large human population

variations may exist regarding antioxidative capac-

ity of each individual, thus affecting individual’s

susceptibility against deleterious oxidative reac-

tions. However, very limited information exists con-

cerning the biological variation in antioxidative

enzymes in representative population samples.

The pesticides exposures may directly or indirectly

modify the antioxidant defense capability of exposed

subjects and thus affect their susceptibility to oxida-

tive stress. Oxidative damage, therefore, may be

attributed to the consequences of insufficient antioxi-

dant potential. Pesticides are well known to target

RBCs by altering their intactness and fluidity of cell

membranes.13 The susceptibility of RBCs and lym-

phocytes to oxidative stress due to exposure to pesti-

cides is a function of overall balance between the

degree of oxidative stress and the antioxidant defense

capability.10,16 Because of the potential deleterious

effects of free radicals and hydroperoxides, perturba-

tions that stimulate LPO and weaken antioxidant

defense capability may cause an increase in cellular

susceptibility to oxidative damage.12,14

The involvement of oxidative stress in the altera-

tion of membrane integrity has been well documen-

ted. The endogenous cellular antioxidants (GSH) and

antioxidant enzymes such as SOD, CAT, GST, GPx

and so on are involved in the regulation of dynamic

homeostasis and are therefore target of various xeno-

biotics.21 Efforts made in past have shown positive

Figure 4. Level of antioxidant potential in the RBCs ofpesticides sprayers by assaying FRAP; the values are shownas a function of antioxidant potential in pesticides sprayerswhen compared with control. Student’s t test was used forcomparison between control and exposed groups. Theresults are presented as mean + SD values derived from70 control and 70 pesticide-exposed individuals. FRAP val-ues are expressed as micromoles of Fe (II) per milliliter ofplasma. FRAP: ferric-reducing ability of plasma; RBC: redblood cell.

Figure 5. Level of AChE activity in the erythrocytes ofpesticides sprayers. AChE activity was assayed using theprocedure as described in Materials and Methods section.Student’s t test was used for comparison between controland exposed groups. The results are presented asmean + SD value derived from 70 control and 70 pesticide-exposed individuals. The unit of AChE activity is expressedas micromoles of acetylthiocholine iodide hydrolyzed perminute per gram of hemoglobin at 37�C. **The level of sig-nificance at p < 0.01. AChE: acetylcholinesterase.

Sharma RK et al. 1223

association of antioxidant defense system with mem-

brane LPO under the influence of pesticide.38,39

Among various antioxidant mechanisms in the body,

SOD, CAT, GPx and GST are thought to be the major

enzymes that protect cells from ROS. There is a sug-

gestion that the activity of antioxidant enzymes may

play an important role in determining the pesticide-

induced toxicity in occupational sprayers.4,8,16

We assessed the level of endogenous cellular anti-

oxidant (GSH) and membrane LPO. GSH is actively

involved in the removal of LPO products. Enhanced

susceptibility of cell damage following exposure to

toxic chemicals could be related to the efflux of GSH

precursors and hence diminished GSH biosynth-

esis.40,41 The concentration of GSH is the key deter-

minant of the extent of toxicant-induced cellular

injury. On the other hand, increased peroxide level

is linked with membrane disruption in various tissue

and organs and has been positively correlated with the

gravity of the disease and extent of cellular damage.42

The results from the present study showed a

decreased level of GSH in pesticide-exposed individu-

als when compared with healthy controls, which could

cause accumulation of LPO products that in turn may

increase oxidative burden to cellular homeostasis

resulting in enhanced cellular damage. This observa-

tion got support by the examination of membrane LPO

(present investigation) that was considerably increased

in sprayers when compared with healthy controls.

GST is a phase II enzyme, which is involved in the

detoxification of the products of the phase I reactions.

An increased expression of GST-pi and the activity of

total GST in sprayers as observed in present study could

be a compensatory response to overcome the toxic reac-

tions following pesticide exposure.19 It may be further

supported by the fact that GST has high affinity for the

LPO products and help reduce the ROS burden.39,43

Another enzyme, GPx, is the major antioxidant

molecule involved in the catalysis of detoxification

of endogenous metabolic peroxides and H2O2. Addi-

tionally, it is involved in the redox cycling of GSH

in the presence of GR and NADPH as a coen-

zyme.43,44 The increased activity of GPx in human

RBCs (sprayers) as observed in present study could

be due to decreased GSH level and/or increased GPx

activity. It probably indicates an adaptive measure to

tackle any ROS-mediated toxicity due to pesticide

accumulation. However, the increased activity of GPx

as detected in the present study also could be due to

increased production of H2O2 in pesticide-exposed

individuals.45

Furthermore, other antioxidant enzymes such as

SOD and CAT along with GSH, GST and GPx are

also known to efficiently scavenge toxic-free radicals

and are partly responsible for protection against LPO

due to acute or chronic pesticide exposure.46

Increased levels of these enzymes in the present study

reflect an activation of the compensatory mechanism

for the protection against ROS through the effects of

pesticides on progenitor cells.

Alteration in the activity of phase II and antioxidant

enzymes prompted us to assess the expression and

activity of CYPs that have been reported previously

to be involved in free radical generation and oxidative

stress.19,20 CYP2E1 is reported to enhance the toxic

effect of many toxicologically important substrates,

including ethanol, carbon tetrachloride and acetamino-

phen by their biotransformation into reactive metabo-

lites. It is directly associated with free radical

production such as superoxides and H2O2 in some pre-

vious studies.47–49 However, CYP1A1 is reported to be

potentially involved in the metabolism of various

drugs, carcinogens and xenobiotics.50 CYPs are also

involved in organophosphorus activation through oxi-

dative desulfuration of P¼S bonds and the increase

in their activity could also represent another contribut-

ing factor to the imbalance between injuries and

defenses. CYP2E1 are reported to activate N-alkyl-

20 22 24 26 28 30 32 34 36 38 400.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

1.0

AchE activity(µmol acetylcholine iodide hydrolysed/ min/g Hb)

FR

AP

(µ m

ole

Fe(

II)/

ml p

lasm

a)

p< 0.001r2= 0.2568

Figure 6. Correlation plot between AChE activity andtotal antioxidant capacity of plasma (measured as FRAP).AChE activity and FRAP assays were conducted asdescribed in Materials and Methods section. The unit ofAChE activity has been expressed as micromoles of acet-ylthiocholine iodide hydrolyzed per minute per gram ofhemoglobin at 37�C. FRAP values are expressed asmicromoles of Fe (II) per milliliter of plasma. p < 0.001;r2 ¼ 0.2568. AChE: acetylcholinesterase; FRAP: ferric-reducing ability of plasma.

1224 Human and Experimental Toxicology 32(11)

nitrosamines, substances also present in tobacco,

whereas there are no strong evidences that CYP1A1

is also involved in this process.51–53 In the present

investigation, the increased activity of CYP2E1

appeared to constitute a risk factor only for sprayers

who smoke because its activity increased in sprayers

and not in controls, possibly by the formation of carci-

nogenic DNA adduct with nitrosamines activation

products.11 Moreover, they can also cause type I dia-

betes mellitus by their cytotoxic effects on pancreatic

beta-cells.2,54

In the present study, the mRNA expressions of

CYP1A1, CYP2E1 and GST-pi were monitored in

some randomly selected controls and pesticides-

exposed subjects. The results displayed no significant

alteration in the expression and activity of CYP1A1,

which clearly indicated that this CYP isoform was not

involved in this process. However, mRNA expressions

and activities of CYP2E1 and GST-pi were consider-

ably increased in pesticide-exposed individuals when

compared with the healthy controls, which reflected

the ROS-mediated peroxidative damage in pesticide

sprayers. The role of CYP2E1 and GST in regulating

the level of free radical production is well documented

in alcoholics.47–49 The present study clearly indicates

that the occupationally pesticide-exposed population

may be under threat of oxidative stress.

OPs and CMs are known pesticides extensively

being used in agricultural practices and fields. They

are known inhibitors of the activity of AChEs as they

modulate the serine residue present at the active site

of the enzyme. It results in an excessive accumulation

of the neurotransmitter, acetylcholine, at the nerve

endings and cause blockade of nerve impulse trans-

mission. The activity of AChE in human RBCs may

be considered as a biomarker for evaluating the cen-

tral cholinergic status.2 In addition, the alterations in

the AChE activity during oxidative stress have also

been reported. The results of the present study are in

consonance with these reports as it reflected low level

of AChE activity in the pesticide sprayers when com-

pared with the healthy controls.

Conclusion

The results of present study are indicative of impair-

ment in the balance between the oxidative and antiox-

idant indices resulting in altered cellular homeostasis

and physiology in the pesticides sprayers. The

enzymes such as CYP2E1 and GST-pi were found

to be over expressed, whereas CYP1A1 remained

uninfluenced. The present findings also emphasize

the need to study the expression profiles of these

genes in large population of different ethnic groups

occupationally exposed to different pesticides and

residing in various parts of world in order to ascertain

their roles in ROS-mediated toxicity. Since the occu-

pationally exposed subjects involved in this study also

used tobacco, smoking and alcohols infrequently, the

contribution of these factors to whatsoever extent in

eliciting negative impact of the pesticides may not

be ruled out. The information obtained from this study

may be used to guide public health laws and policies

in the work place and residential communities. It may

also be exploited for proper strategy design to mini-

mize the risk of pesticide-mediated occupational

health hazards to pesticide users as well as toward

adequate pesticide formulation and usage for better

environmental management.

Funding

Financial support in the form of research fellowship from

University Grant Commission (UGC), New Delhi, India,

was provided to RKS. This research was supported in part

by a grant to NJS from the Research Center, Center for

Female Scientific and Medical Colleges, Deanship of Sci-

entific Research, King Saud University, Riyadh, Saudi

Arabia.

Conflict of interest

The authors declared no conflicts of interest.

References

1. Anwar WA. Biomarker and human exposure to pes-

ticides. Environ Health Perspect 1997; 105:

801–806.

2. Agrawal A and Sharma B. Pesticide induced oxidative

stress in mammalian systems. Int J Biol Med Res 2010;

1(3): 90–104.

3. Remor AP, Totti CC, Moreira DA, Dutra GP, Heuser

VD and Boeira JM. Occupational exposure of farm

workers to pesticides: biochemical parameters and

evaluation. Environ Int 2009; 35: 273–278.

4. Bhanti M and Taneja A. Contamination of vegetables

of different seasons with organophosphorous pesti-

cides and related health risk assessment in northern

India. Chemosphere 2007; 69: 63–68.

5. McCauley LA, Anger WK, Keifer M, Langley R, Rob-

son MG and Rohlman D. Studying health outcomes in

farmworker populations exposed to pesticides.

Environ Health Perspect 2006; 114: 953–960.

Sharma RK et al. 1225

6. Banerjee BD, Seth V and Ahmed RS. Pesticide-induced

oxidative stress: perspectives and trends. Rev Environ

Health. 2001; 16(1): 1–40.

7. Kamel F and Hoppin JA. Association of pesticide

exposure with neurologic dysfunction and disease.

Environ Health Perspect 2004; 112: 950–958.

8. Muniz JF, McCauley L, Scherer J, Lasarev M, Koshy

M, Kow YW, et al. Biomarkers of oxidative stress and

DNA damage in agricultural workers: a pilot study.

Toxicol Appl Pharmacol 2008; 227: 97–107.

9. Sharma RK and Sharma B. In-vitro carbofuran

induced genotoxicity in human lymphocytes and its

mitigation by vitamins C and E. Dis Markers 2012;

32: 153–163.

10. Zeljezic D, Vrdoljak AL, Kopjar N, Radic B and

Kraus SM. Cholinesterase inhibiting and genotoxic

effect of acute carbofuran intoxication in man: a case

report. Basic Clin Pharmacol Toxicol 2008; 103:

329–335.

11. Das PP, Shaik AP and Jamil K. Genotoxicity induced

by pesticide mixtures: in-vitro studies on human per-

ipheral blood lymphocytes. Toxicol Ind Health 2007;

23: 449–458.

12. Mansour SA, Mossa AT and Heikal TM. Effects of

methomyl on lipid peroxidation and antioxidant

enzymes in rat erythrocytes: in vitro studies. Toxicol

Ind Health 2009; 25: 557–563.

13. Rai DK, Rai PK, Rizvi SI, Watal G and Sharma B.

Carbofuran-induced toxicity in rats: protective role of

vitamin C. Exp Toxicol Pathol 2009; 61: 531–535.

14. Singh M, Sandhir R and Kiran R. Erythrocyte antiox-

idant enzymes in toxicological evaluation of com-

monly used organophosphate pesticides. Indian J Exp

Biol 2006; 44: 580–583.

15. Hernandez AF, Gomez MA, Perez V, Garcıa-Lario JV,

Pena G, Gil F, et al. Influence of exposure to pesticides

on serum components and enzyme activities of cyto-

toxicity among intensive agriculture farmers. Environ

Res 2006; 102: 70–76.

16. Prakasam A, Sethupathy S and Lalitha S. Plasma and

RBC antioxidant status in occupational male pesticide

sprayers. Clin Chim Acta 2001; 310: 107–112.

17. Upadhyay G, Kumar A and Singh MP. Effect of sily-

marin on pyrogallol and rifampicin-induced hepato-

toxicity in mouse. Eur J Pharmacol 2007; 565:

190–201.

18. Upadhyay G, Singh AK, Kumar A, Prakash O and

Singh MP. Resveratrol modulates pyrogallol-induced

changes in hepatic toxicity markers, xenobiotic metabo-

lizing enzymes and oxidative stress. Eur J Pharmacol

2008; 596: 146–152.

19. Patel S, Singh V, Kumar A, Gupta YK and Singh MP.

Status of antioxidant defense system and expression of

toxicant responsive genes in striatum of maneb and

paraquat-induced Parkinson’s disease phenotype in

mouse: mechanism of neurodegeneration. Brain Res

2006; 1081: 9–18.

20. Singh C, Ahmad I and Kumar A. Pesticides and metals

induced Parkinson’s disease: involvement of free radi-

cals and oxidative stress. Cell Mol Biol 2007; 53: 19–28.

21. Lopez O, Hernandez AF, Rodrigo L, Gil F, Peno G,

Serrano JL, et al. Changes in antioxidant enzymes in

humans with long-term exposure to pesticides. Toxicol

Lett 2007; 171: 146–153.

22. Fasco MJ, Treanor CP, Spivack S, Figge HL and

Kaminsky LS. Quantitative RNA-polymerase chain

reaction-DNA analysis by capillary electrophoresis

and laser-induced fluorescence. Anal Biochem 1995;

224: 140–147.

23. Furukawa M, Nishimura M, Ogino D, Chiba R, Ikai I,

Ueda N, et al. Cytochrome p450 gene expression levels

in peripheral blood mononuclear cells in comparison

with the liver. Cancer Sci 2004; 95: 520–529.

24. Kuzma M, Jamrozik Z and Baranczyk-Kuzma A.

Activity and expression of glutathione S-transferase

pi in patients with amyotrophic lateral sclerosis. Clin

Chim Acta 2006; 364: 217–221.

25. Beutler E. Red cell metabolism: a manual of biochemical

methods. 3rd ed. Orlando, FL: Grune and Stratton, 1984.

26. Marklund S and Marklund G. Involvement of the

superoxide anion radical in the autoxidation of pyro-

gallol and a convenient assay for superoxide dismu-

tase. Eur J Biochem 1974; 47: 469–474.

27. Aebi HE. Catalase in-vitro. Meth Enzymol 1984; 105:

121–126.

28. Boyum A. Isolation of mononuclear cells and granulo-

cytes from human blood. Scand J Clin Lab Invest

1968; 21: 77.

29. Pohl RJ and Fouts JR. A rapid method for assaying the

metabolism of 7-ethoxyresorufin by microsomal sub-

cellular fractions. Anal Biochem 1980; 107: 150–155.

30. Koop DR. Hydroxylation of p-nitrophenol by rabbit

ethanol-inducible cytochrome-P450 isozyme 3a. Mol

Pharmacol 1986; 29: 399–404.

31. Habig WH, Pabst MJ and Jakoby WB.

Glutathione-S-transferase, the first enzymatic step in

mercapturic acid formation. J Biol Chem 1974; 249:

7130–7139.

32. Paglia DE and Valentine WN. Studies on the quantita-

tive and qualitative characterization of erythrocyte glu-

tathione peroxidase. J Lab Clin Med 1967; 70:

158–169.

1226 Human and Experimental Toxicology 32(11)

33. Esterbauer H and Cheeseman KH. Determination of

aldehyde lipid peroxidation products: malonaldehyde

and 4-hydroxynonenal. Meth Enzymol 1990; 186:

407–421.

34. Benzie IFF and Strain JJ. The ferric reducing ability

of plasma (FRAP) as a measure of antioxidant

power ‘‘the FRAP assay’’. Anal Biochem 1996;

239: 70–76.

35. Ellman GL, Courtney KD, Andres V Jr, and Feath-

erstone RM. A new and rapid colorimeteric determi-

nation of acetylcholinesterase activity. Biochem

Pharmacol 1961; 7: 88–95.

36. Lowery OH, Rosebrough NJ, Farr AL and Randall RJ.

Protein measurement with the folin phenol reagent.

J Biol Chem 1951; 193: 265–275.

37. Drabkin D. The standardization of hemoglobin mea-

surement. Am J Med Sci 1949; 217: 710–711.

38. Rai DK, Sharma RK, Rai PK, Watal G and Sharma B.

Role of aqueous extract of Cynodon dactylon in pre-

vention of carbofuran induced oxidative stress and

acetyl cholinesterase inhibition in rat brain. Cell Mol

Biol 2011; 57(1): 135–142.

39. Tavazzi B, Pierro D and Amorini AM. Energy metabo-

lism and lipid peroxidation of human erythrocytes as a

function of increased oxidative stress. Eur J Biochem

2000; 267: 684–689.

40. Ross D. Glutathione, free radicals and chemotherapeu-

tic agents. Pharmacol Ther 1988; 37: 231–249.

41. Sener G, Toklu HZ, Sehirli AO, Ogunc AV, Cetinel S

and Gedik N. Protective effects of resveratrol against

acetaminophen-induced toxicity in mice. Hepatol Res

2006; 35: 62–68.

42. Guven A and Gulmez M. The effect of kefir on the

activities of GSH-Px, GST, CAT, GSH and LPO levels

in carbon tetrachloride-induced mice tissues. J Vet

Med B 2003; 50: 412–416.

43. Hubatsch I, Ridderstrom M and Mannervik B.

Human glutathione transferase-A4-4: an alpha class

enzyme with high efficiency in the conjugation of

4-hydroxynonenal and other genotoxic products of

lipid peroxidation. Biochem J 1998; 330: 175–179.

44. Mirault ME, Tremblay A, Beaudoin N and Tremblay

M. Overexpression of seleno-glutathione peroxidase

by gene transfer enhances the resistance of T47D

human breast cells to clastogenic oxidants. J Biol

Chem 1991; 266: 20752–20760.

45. Geiger PG, Lin F and Girotti AW. Selenoperoxidase-

mediated cytoprotection against the damaging effects

of tert-butyl hydroperoxide on leukemia cells. Free

Radic Biol Med 1993; 14: 251–266.

46. Agrawal D, Sultana P and Gupta GSD. Oxidative

damage and changes in the glutathione redox system

in erythrocytes from rats treated with hexachiorocyclo-

hexane. Food Chem Toxicol 1991; 29: 459–462.

47. Lieber CS. Cytochrome P-4502E1: its physiological

and pathological role. Physiol Rev 1997; 77: 517–544.

48. Mari M and Cederbaum AI. Induction of catalase,

alpha, and microsomal glutathione S-transferase in

CYP2E1 over-expressing HepG2 cells and protection

against short-term oxidative stress. Hepatology 2001;

33: 652–661.

49. Montoliu C, Sancho-Tello M, Azorin I, Burgal M,

Valles S, Renau-Piqueras J, et al. Ethanol increases

cytochrome P450 2E1 and induces oxidative stress in

astrocytes. J Neurochem 1995; 65: 2561–2570.

50. Guengerich FP and Shimada T. Oxidation of toxic and

carcinogenic chemicals by human cytochrome P-450

enzymes. Chem Res Toxicol 1991; 4: 391–407.

51. Camus AM, Geneste O, Honkakoski P, Bereziat JC, Hen-

derson CJ, Wolf RC, et al. High variability of nitrosamine

metabolism among individuals: role of cytochromes

P450 2A6 and 2E1 in the dealkylation of N-nitrosodim

ethylamine and N-nitrosodiethylamine in mice and

humans. Mol Carcinogenesis 1993; 7: 268–275.

52. Kushida H, Fujita KI, Suzuki A, Yamada M, Endo T,

Nohmi T and Kamataki T. Metabolic activation of

N-alkylnitrosamines in genetically engineered Salmo-

nella typhimurium expressing CYP2E1 or CYP2A6

together with human NADPH-cytochrome P450

reductase. Carcinogenesis 2000; 21: 1227–1232.

53. Hou DF, Wang SL, He ZM, Yang F and Chen ZC.

Expression of CYP2E1 in human nasopharynx and its

metabolic effect in vitro. Mol Cell Biochem 2007; 298:

93–100.

54. Murdock L, Barnett DJ, Arnett CR and Barnett Y. DNA

damage and cytoxicity in pancreatic b-cells expressing

human CYP2E1 following exposure to N-nitroso com-

pounds. Biochem Pharmacol 2004; 68: 523–530.

Sharma RK et al. 1227