hpma copolymer nanocarrier targets tumor- associated … · small molecule therapeutics...

Small Molecule Therapeutics

HPMA–Copolymer Nanocarrier Targets Tumor-Associated Macrophages in Primary andMetastatic Breast CancerMelissa N. Zimel1, Chloe B. Horowitz1, Vinagolu K. Rajasekhar1, Alexander B. Christ2,Xin Wei3, Jianbo Wu3, Paulina M.Wojnarowicz4, Dong Wang3, Steven R. Goldring2,P. Edward Purdue2, and John H. Healey1,5

Abstract

Polymeric nanocarriers such as N-(2-hydroxypropyl) metha-crylamide (HPMA) copolymers deliver drugs to solid tumors andavoid the systemic toxicity of conventional chemotherapy.Because HPMA copolymers can target sites of inflammation andaccumulate within innate immune cells, we hypothesized thatHPMA copolymers could target tumor-associated macrophages(TAM) in both primary and metastatic tumor microenviron-ments. We verified this hypothesis, first in preliminary experi-ments with isolated bone marrow macrophage cultures in vitroand subsequently in a spontaneously metastatic murine breastcancer model generated from a well-established, cytogeneticallycharacterized 4T1 breast cancer cell line. Using our standardizedexperimental conditions, we detected primary orthotopic tumorgrowth at 7 days andmetastatic tumors at 28 days after orthotopictransplantation of 4T1 cells into the mammary fat pad. We

investigated the uptake of HPMA copolymer conjugated withAlexa Fluor 647 and folic acid (P-Alexa647-FA) and HPMAcopolymer conjugated with IRDye 800CW (P-IRDye), followingtheir retroorbital injection into the primary andmetastatic tumor-bearing mice. A significant uptake of P-IRDye was observed atall primary and metastatic tumor sites in these mice, and the P-Alexa647-FA signal was found specifically within CD11bþ

TAMs costained with pan-macrophage marker CD68. Thesefindings demonstrate, for the first time, a novel capacity of aP-Alexa647-FA conjugate to colocalize to CD11bþCD68þ TAMsin both primary and metastatic breast tumors. This underscoresthe potential of this HPMA nanocarrier to deliver functionaltherapeutics that specifically target tumor-promotingmacrophageactivation and/or polarization during tumor development.Mol Cancer Ther; 16(12); 2701–10. �2017 AACR.

IntroductionNanomedicine-based strategies that enhance the effectiveness

and limit the systemic and local toxicity of traditional chemo-therapy and radiotherapy are of increasing interest for the deliveryof anticancer therapeutics (1, 2). These strategies exploit the well-known enhanced permeability and retention effect (EPR), where-by solid tumors preferentially take up and retain nanoparticles viapermeable tumor vasculature andpoor lymphatic drainage (2–4).Originally developed in the 1970s, N-(2-hydroxypropyl) metha-crylamide (HPMA) copolymers have been extensively evaluatedas potential nanomedicine carriers for the treatment of tumors(5–7). HPMA copolymers display good biocompatibility, andtheir conjugates with therapeutic drugs demonstrate increased

bioavailability, prolonged drug retention time, reduced systemictoxicity, and enhanced therapeutic efficacy (8, 9). Numerous invitro and animal model studies have shown the potential oftargeting tumor cells with HPMA copolymers (1, 10). However,early human trials of cytotoxic drugs linked to hydrophilic poly-mers, e.g., HPMA-doxorubicin targeting tumoral tissues in breastcancer, have shown mixed clinical results (11, 12).

We have recently characterized a novel capability of HPMAcopolymers to passively target sites of inflammation in a murinemodel by means of a mechanism called "extravasation throughleaky vasculature and inflammatory cell-mediated sequestration"(ELVIS), which is related to, but temporally distinct from, EPR(13). In a variety of preclinical murine models of inflammatorydisease, HPMA copolymers efficiently extravasated at sites ofinflammation and, more importantly, were subsequently seques-tered by resident and infiltrating inflammatory cells, includingmacrophages (14–16). HPMA conjugated to dexamethasone wasused to enable sustained drug delivery to myeloid inflammatorycells, with resulting reduced systemic glucocorticoid toxicity,repression of inflammation at the cellular and tissue levels, andclinical improvements in animalmodels of inflammatory arthritisand inflammatory bone loss (17–19). We believe that the com-bination of EPR and ELVIS may account for targeting of HPMA tomyeloid populations, distinct frommechanisms whereby HPMAtargets tumoral tissue.

Innate immune cells in the tumor microenvironment, specif-ically myeloid populations, play a critical role in the local controlof tumor cell growth and patient survival and prognosis (20).

1Orthopaedic Service, Department of Surgery, Memorial Sloan Kettering CancerCenter, NewYork, NewYork. 2Hospital for Special Surgery, NewYork, NewYork.3Department of Pharmaceutical Sciences, University of Nebraska Medical Cen-ter, Omaha, Nebraska. 4Department of Cancer Biology and Genetics, SloanKettering Institute, New York, New York. 5Department of Surgery, Weill CornellMedical College, New York, New York.

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

Corresponding Author: John H. Healey, Orthopaedic Service, Department ofSurgery, Memorial Sloan Kettering Cancer Center, 1275 York Avenue, New York,NY 10065. Phone: 212-639-7610; Fax: 212-794-4015; E-mail: [email protected]

doi: 10.1158/1535-7163.MCT-15-0995

�2017 American Association for Cancer Research.

MolecularCancerTherapeutics

www.aacrjournals.org 2701

on June 29, 2020. © 2017 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst August 22, 2017; DOI: 10.1158/1535-7163.MCT-15-0995

http://crossmark.crossref.org/dialog/?doi=10.1158/1535-7163.MCT-15-0995&domain=pdf&date_stamp=2017-11-15

http://mct.aacrjournals.org/

Macrophage recruitment andmobilization into the tumormicro-environment occurs secondarily to a complex interaction ofcytokines, chemokines, extracellular matrix components, andhypoxia. Based on functional characteristics, two types of mac-rophage phenotypes are categorized: (i) classically activated (M1)macrophages, which can display antitumor activity and (ii) alter-natively activated (M2)macrophages, which have been associatedwith tumor-promoting functions (21, 22). Tumor-associatedmacrophages (TAM) closely resembleM2-polarizedmacrophagesand promote a favorable environment for tumor growth, survival,and angiogenesis, whereas M1 macrophages initiate an inflam-matory response and antitumor immunity (23–28). Therapeuticagents targeting macrophage polarization have been studied insome cancer models and offer a promising new mechanism fortreating malignancy (24, 29).

Theoretically, synergism between the well-characterized EPReffect and the newly discovered ELVIS-mediated targeting ofHPMA copolymers to myeloid cells (13–16) may be exploitedto specifically and efficiently target TAMs during primary andmetastatic tumor development. Here, we investigate thehypothesis that HPMA-based polymers preferentially localizeto the tumor microenvironment, evaluating at tissue and cel-lular levels, the distribution of HPMA copolymers in a murinemetastatic breast cancer model generated by orthotopic trans-plantation of the murine 4T1 breast cancer cell line into themammary fat pad (MFP).

For these studies, we utilized two varieties of fluorescent-labeled HPMA copolymers: HPMA copolymer conjugated withAlexaFluor 647 and folic acid (P-Alexa647-FA) and HPMAcopolymer conjugated with IRDye 800CW (P-IRDye). Thestrategy of incorporating FA into the P-Alexa647 construct isbased upon the prior studies that activated macrophages ingeneral, including TAMs, are associated with upregulation offolate receptor beta (FRb) on the cell surface (30). We sought todemonstrate, in vitro and in vivo, the preferential uptake ofHPMA copolymers by TAMs utilizing in vivo infrared imaging,flow cytometry, qPCR, confocal fluorescent microscopy, andimmunofluorescence modalities.

Materials and MethodsSynthesis of poly (HPMA-co-APMA)

HPMA (400 mg, 2.79 mmol/L; ref. 7), N-(3-aminopropyl)methacrylamide hydrochloride (APMA, 5.1 mg, 0.029 mmol,Polysciences, Inc.), azobisisobutyronitrile (AIBN, 3.38 mg,0.021 mmol/L, Sigma-Aldrich), and S,S'-bis(a,a'-dimethyl-a''-acetic acid)-trithiocarbonate (CTA, 3.23 mg, 0.011 mmol/L,Sigma-Aldrich; ref. 31) were dissolved in 8 mL methanol, placedin an ampoule, and purged with argon for 5 minutes. Theampoule was flame-sealed and maintained at 45�C for 48 hours.The product was purified using a Sephadex LH-20 liquid chro-matography column (GE HealthCare) to remove unreacted low-molecular-weight compounds and then lyophilized. The finalyield was 207.8mg and hereafter referred to as HPMA copolymer.The amine content of the copolymer was determined as 7.47 �10�5 mol/g using the ninhydrin assay (32). The weight-averagemolecular weight (Mw ¼ 36.1 kDa) and number-average molec-ular weight (Mn ¼ 24.9 kDa) of copolymers were determinedbased on anHPMAhomopolymer calibration using an €AKTA FastProtein Liquid Chromatography (FPLC) system (GE HealthCare)equipped with ultraviolet (UV) and infrared (IR) detectors. The

composition of all synthesized copolymers is summarized inSupplementary Table S1.

Synthesis of IRDye 800CW-labeled HPMAcopolymer (P-IRDye)

Poly (HPMA-co-APMA) (50 mg, containing 0.0037 mmol/Lof amine) and IRDye 800CW NHS Ester (LI-COR Biosciences;1.25mg, 0.001075mmol) were dissolved in 900 mL of DMF with15 mL of N, N-diisopropylethylamine (DIPEA) added. The solu-tion was stirred overnight in darkness at room temperature. Theproduct was then purified on an LH-20 column and lyophilized.The final product yield was 43.2 mg. The IRDye 800CW contentwas determined as 0.79 � 10�5 mol/g using Lambda 10 UV/VisSpectrometer (PerkinElmer; Supplementary Table S1).

Synthesis of HPMA copolymer FA conjugate (P-FA)HPMA (400mg, 2.79mmol/L) was copolymerized with APMA

(31.9 mg, 0.18 mmol/L) according to the same proceduredescribed above to yield 212.6 mg of white foamy solid. Its Mw

and Mn were determined as 45.5 and 37.30 kDa, respectively.Amino content of the copolymer was determined as 4.15� 10�4

mol/g. To a solution of FA (7.6 mg, 0.0172 mmol/L) indry dimethylformamide (DMF; 1.5 mL) in a light-shieldedbottle were added 1-ethyl-3-(3-dimethylaminopropyl)carbodii-mide hydrochloride (EDC) (4.0 mg, 0.0209mmol/L) and hydro-xybenzotriazole (HOBT) (2.9 mg, 0.0189 mmol/L). After stirringat room temperature for 30 minutes, a solution of poly(HPMA-co-APMA) (50 mg, containing 0.02075 mmol/L of amino) andDIPEA (16mg, 0.1238mmol/L) inDMF (0.5mL)was added. Theresulting reaction mixture was stirred at room temperature over-night. The product was then purified on an LH-20 column andlyophilized. The final product yield was 37 mg of foamy yellowsolid. FA content was determined as 1.89 � 10�4 mol/g usingLambda 10 UV/Vis Spectrometer (PerkinElmer; SupplementaryTable S1). FAwas utilized to enhance uptake ofHPMA copolymerby TAMs (33–35).

Synthesis of Alexa Fluor 647-labeled FA-containing HPMAcopolymer conjugate (P-Alexa647-FA)

PHPMA-FA (27 mg) was dissolved in 1 mL of dry DMF,followed by addition of Alexa Fluor 647 NHS Ester (0.5 mg,0.0004 mmol/L) and DIPEA (3 mg, 0.0232 mmol/L). The result-ing mixture was stirred in darkness at room temperature over-night. The product was then purified on a Sephadex LH-20column and lyophilized. The final product yield was 26 mg. TheAlexa Fluor 647 content was determined as 1.57 � 10�5 mol/gusing Lambda 10 UV/Vis Spectrometer (PerkinElmer; Supple-mentary Table S1). The molecular structure of P-Alexa647-FA ispresented in Supplementary Figure S1.

In vitro assessment of P-Alexa647-FA uptake by macrophagesBone marrow macrophages from 6- to 8-week-old C57BL/6

female mice (The Jackson Laboratory) were isolated essentially asdescribed previously (36). Briefly, macrophages were incubatedwith P-Alexa647-FA for 48 hours. Hoechst 33342 (Thermo FisherScientific) was applied for nuclear staining, and confocal fluores-cent microscopy was used to visualize intracellular uptake of P-Alexa647-FA by the bone marrow macrophages. Flow cytometricanalysis was performed using an LSRII FACScan flow cytometer(BD Biosciences). Cells were labeled with 0.4 mg/mL of PE-conjugated Rat Anti-Mouse CD11b antibody (BD Biosciences).

Zimel et al.

Mol Cancer Ther; 16(12) December 2017 Molecular Cancer Therapeutics2702




CD11b-positive macrophages were gated based on forward- andside-scatter variables. Data analysis was performed using thecytometry software FlowJo (FlowJo).

Authentication of cell line for mouse model developmentThe 4T1murine breast cancer cell line is a thioguanine-resistant

variant selected from the cell line 410.4, one of four sublinesisolated from a single spontaneously arising mammary tumorfrom a BALB/cfC3Hmouse (37, 38). We obtained this cell line inSeptember 2014, and since then used it extensively and confirmedthe metastatic properties described for this cell line. Since aliterature search failed to reveal a published STR profile or kar-yotype for 4T1 or the parental cell line 410.4, we purchasedthe 4T1 cell line on July 15, 2016, from a commercial source(ATCC-2539; ATCC) and compared the karyotype of the 4T1 lineobtained from our colleagues (MSKCC) with the karyotype of thecommercially available 4T1 line (ATCC). The cell lines werecultured and harvested according to standard procedures (39).Briefly, the cell lineswere culturedwithColcemid (0.1mg/mL) andfollowing a 60-minute incubation, trypsinized,washed in 1�PBS,incubated in prewarmed 0.075mol/L KCl for 10minutes at 37�C,and then fixed in methanol-acetic acid (3:1). The fixed cellsuspension was dropped on slides, stained in 0.08 mg/mL DAPIin 2�SSC for 3 minutes, and mounted in an antifade medium(Vectashield; Vector Laboratories). Metaphase spreads were cap-tured using the Nikon Eclipse E800 epifluorescence microscopeequipped with GenASI Cytogenetic Suite (Applied Spectral Imag-ing). For each sample, a minimum of 20 inverted DAPI-stainedmetaphases were fully karyotyped and analyzed according to theInternational System of Human Cytogenetic Nomenclature(ISCN) 2013 (40).

Both cell lines revealed a near-tetraploid or hypertetraploidkaryotype with ongoing chromosomal instability and presenceof Robertsonian fusion between chromosomes 9 and 16 [rob(9;16)(pA1;pA1)] in 100% of the cells (Supplementary Tables S2and S3; Supplementary Fig. S2). Both cell lines contained addi-tional clonal and non-clonal abnormalities, some of which werecommon but were observed at varying frequency (most likely dueto further clonal selection/evolution). Cultured 4T1 (MSKCC)appeared to be more homogeneous, with clonal selection of cellscontaining two additional structural abnormalities: an unbal-anced translocation between chromosomes 1 and 8 resulting ina segmental gain of chromosome 1 [der(8)t(1;8)(qD;qC3)] andan abnormal chromosome 15 with additional chromosomalmaterial of uncertain origin on 15q [add(15)(qE)]. Karyotypetesting of the cell lines was performed in July 2016, and resultswere confirmed again in March 2017.

4T1 cell cultureFrom original cryopreserved aliquots, cells were maintained in

Dulbecco's Modified Eagle Medium (DMEM) containing 10%fetal bovine serum (FBS) supplemented with 1% penicillin–streptomycin (Thermo Fisher Scientific) and were passaged nomore than 8 times prior to labeling with GFP-luciferase protein.

4T1 labeling with fluorescent protein and luciferaseexpression vectors

The 4T1 cells were transduced with a fusion protein [greenfluorescent protein (GFP) and luciferase]-expressing lentiviralvector as has been described (41–43). GFP-expressing cells wereFACS purified and employed for transplantation into MFPs.

Modeling local and systemic tumor progressionThe murine breast cancer metastasis model, approved by our

Institutional Animal Care and Use Committee (IACUC protocol#11-10-026), was created by orthotopic transplantation of 5 �104 GFP-luciferase labeled 4T1 cells (50 mL) into the fourth MFPof 8- to 10-week-old female BALB/cJ mice (The Jackson Labora-tory; refs. 37, 38). Twenty-four hours after transplantation, ani-mals were imaged to confirm tumor cell viability by visualizingthe luciferase activity with the Xenogen IVIS Optical ImagingSystem (Xenogen Corp), following retroorbital injection of thesubstrate Luciferin (Perkin Elmer). The signal intensity was quan-titatively analyzed by the imaging system's associated softwareLiving Image. Primary and metastatic tumor growth was moni-tored grossly and with weekly imaging, as described below. The4T1 cell–derived model of breast cancer reproducibly initiatedprimary tumor growth within 7 days of orthotopic transplanta-tion of the tumor cells into the fourth MFP (Fig. 1) in over 30female BALB/cJ mice. Spontaneous metastases to lung, liver,pancreas, spleen, and vertebrae were consistently observed onIVIS imaging (prior to necropsy) by about 28days after orthotopictransplantation of the 4T1 cells (Fig. 1). Animals were sacrificed atthe endpoint of metastases, typically at 4 weeks after transplan-tation, at which time primary tumors are typically larger than2 cm3.Metastatic tumors were observed grossly at necropsy, againimaged as described above immediately after harvest, and con-firmed histologically on H&E staining of the paraffin-fixed tumortissue sections.

To simulate skeletal breast cancer metastases, 5 � 104 4T1cells (50 mL) were injected into the right proximal tibia of 8- to10-week-old female BALB/cJ mice (The Jackson Laboratory). Anequal volume of sterile PBS (Thermo Fisher Scientific) wasinjected into the contralateral proximal tibia to serve as acontrol. Primary tumor growth was monitored grossly andwith weekly Faxitron (Faxitron Bioptics) imaging. Animals wereeuthanized when tumors reached 1 cm3.

In vivo live infrared imaging of primary tumor andmetastasis with P-IR dye

Infrared imaging of the P-IR dye was performed after theretroorbital delivery of 0.25 mg/kg of P-IRDye and 0.25 mg/kgP-Alexa-FA. Precisely, 24 hours after injection with P-IRDye andimmediately prior to euthanasia, the in vivo live near-infraredimaging was performed with the Pearl Trilogy small animalimaging system (LI-COR). Following the necropsy of the animal,the organs were harvested and imagedwith near-infrared imagingimmediately to confirm the gross evidence of metastasis wasindeed due to the distant spread from the primary MFP tumor.

Macrophage isolation from tumor tissueFollowing animal euthanasia and imaging, mammary and

tibial tumors were resected, minced into 1 mm3 sections inDMEM medium with 10% FBS (Thermo Fisher Scientific) and1.5 mg/mL of Collagenase Type III (Worthington Biosciences)and 0.2 mg/mL hyaluronidase (MP Biomedicals) for 2 hours at37�C per the established protocol for enzymatic dissociation ofmammary tissue (44). Tubes were gently vortexed for 5 secondsevery 20 minutes. Following the 2-hour incubation period, eachsample was passed through a 40-mm cell strainer and centrifugedat 1,500 rpm. Pellets were resuspended and incubated in ACKLysing Buffer (Thermo Fisher Scientific) for 5 minutes to removered blood cells, neutralized with phosphate buffer saline in excess

HPMA Copolymer Targets Tumor-Associated Macrophages

www.aacrjournals.org Mol Cancer Ther; 16(12) December 2017 2703




of 4 to 5 volumes and centrifuged again. The resulting pellets, freeof red blood cells, were resuspended in complete DMEM andviable cells were counted using a hemocytometer and Trypan Blue(Thermo Fisher Scientific).

To isolate macrophages expressing CD11b, resuspended cellswere labeled with CD11b-conjugated magnetic beads (MiltenyiBiotech) according to the manufacturer's protocol and separatedinto CD11b-positive macrophages and CD11b-negative cellsusing magnetic columns. CD11b-positive and CD11b-negativecells were analyzed with qRT-PCR, fluorescence activated cellsorting (FACS) analysis, and confocal fluorescence microscopy.

Quantitative real-time polymerase chain reaction(qRT-PCR) analysis

qRT-PCR analysis was used to confirm the presence of myeloidcells in CD11b magnetic column-separated samples. RNA wasprepared using the RNeasy mini kit (Qiagen) according to themanufacturer's protocol. Reverse transcription of cDNA was pre-pared using the Maxima First Strand cDNA Synthesis Kit for qRT-PCR (Life Technologies) in a 20 mL reaction. Sample cDNA wasadded to the Maxima SYBR Green/Fluorescein qPCR Master Mix(Life Technologies) with primers (Thermo Fisher Scientific;sequences as follows):

NOS2: F: CAGCTGGGCTGTACAAACCTT,R: CATTGGAAGTGAAGCGTTTCG

ARG1: F: GGAATCTGCATGGGCAACCTGTGT,R: AGGGTCTACGTCTCGCAAGCCA

FIZZ1: F: TCCCAGTGAATACTGATGAGA,R: CCACTCTGGATCTCCCAAGA

Ym 1/2: F: GGGCATACCTTTATCCTGAG,R: CCACTGAAGTCATCCATGTC

CD11b: F: GTTTCTACTGTCCCCCAGCA,R: GTTGGAGCCGAACAAATAGC

IL6: F: CCAGTTGCCTTCTTGGGAC,R: GTGTAATTAAGCCTCCGACTTG

TGFB: F: AGCCCGAAGCGGACTACTAT,R: CTCATAGATGGCGTTGTTGC

HPRT: F: AGCTACTGTAATGATCAGTCAACG,R: AGAGGTCCTTTTCACCAGCA

Analysis of qRT-PCR was performed using the Opticon 2 real-time PCR detector system and Opticon Monitor 3.1 software(BioRad). PCR reactions for each gene set were performed in25 mL/well (final volume) and in duplicate. Relative gene expres-sion was calculated according to the established comparativethreshold cycle DDCt equation normalized to the housekeepinggeneHPRT (45). Gene expression levels of CD11-positive macro-phages and CD11b-negative cells relative to HPRT were com-pared, using paired t tests to assess differences. Statistical analysiswas performed with SAS 9.3. The threshold for statistical signif-icance was P < 0.05.

Figure 1.

Breast cancer metastasis development in vivo in the 4T1 orthotopic xenografts and in situ organ imaging. A, In vivo luciferase-IVIS imaging at 1 day, 2 weeks, and 4weeks after transplantation of 4T1 cells into theMFP shows thedevelopment of spontaneousmetastases.B, IVIS imaging of harvested organs confirmed the presenceofmetastatic tumors.C, Localization of P-IRDye to the sites of primary (MFP) andmetastatic tumor (lungs) (D)was confirmed at necropsy and by infrared imaging ofharvested organs. E, Diffuse uptake was observed in the liver, but not lungs or spleen, of control mice without tumors.

Zimel et al.





Flow cytometry and quantification of marker-positive cellsTo quantify the percentage of macrophages from tumor speci-

mens retaining the copolymer P-Alexa647-FA, cells were analyzedby flow cytometry. Cells were incubated with 0.2 mg/mL PurifiedRat Anti-Mouse CD16/CD32, Clone 2.4G2, mouse BD Fc Block(BD Biosciences) for 10 minutes on ice and then stained with0.4 mg/mL of PE-conjugated Rat Anti-Mouse CD11b, Clone M1/70 (BD Biosciences), for 30 minutes on ice in the dark. Sampleswere washed and resuspended in PBS (Thermo Fisher Scientific)with 2% FBS for analysis. DAPI (1 mg/mL; Life Technologies) wasadded to samples immediately prior to analysis for dead cellexclusion. Flow-cytometric analysis was performed using an LSRIIFACScan flow cytometer (BD Biosciences). The PE-stainedCD11b-positive cell population was gated, and the DAPI positivedead cells were excluded. The CD11b-positive macrophages weregated based on forward- and side-scatter variables. Histogramanalysis was used to visualize the gated cells expressing CD11b.These cells were then analyzed for expression of Alexa Fluor 647.Data analysis was performed using FlowJo software (FlowJo).

Histochemical and immunofluorescence analysisPrimary and metastatic tumor samples not used for above

experiments were fixed in formalin before paraffin embedding.Tibial tumors were decalcified with 0.5 mol/L EDTA (MP Biome-dicals) and then embedded inparaffin. All sampleswere sectionedat 6- to 8-mm thickness. Select samples were used for immuno-fluorescence staining and analysis.

The immunofluorescence detection of CD68 antibody wasperformed using the Discovery XT processor (Ventana MedicalSystems). A rabbit polyclonal anti-CD68 antibody (Boster;cat#PA1518) was used in 5 mg/mL concentrations. The tissuesections were blocked for 30 minutes in 10% normal goatserum, 2% BSA in PBS. A 5-hour incubation with the primaryantibody was followed by a 32-minute incubation with bio-tinylated goat anti-rabbit IgG (1:200 dilution; Vector Labora-tories; cat#PK6101). Subsequently, sequential incubationswith Secondary Antibody Blocker, Blocker D, Streptavidin–HRP and Tyramide Alexa Fluor 568 (Invitrogen; Thermo Fish-er; cat#T20914) were performed.

Histology slides were digitally scanned with Pannoramic Flash(3DHistech) using 20�/0.8 NA objective. Snapshots were takenusing Pannoramic Viewer software (3DHistech). Confocal imageswere obtained using the SP5 TCS microscope with an uprightstand, using 63�/1.4 NA objective (Leica Microsystems).

ResultsWe assessed the retention of HPMA copolymer by macro-

phages, first using cultured bone marrow macrophages in vitro,and subsequently in a reproducible model of breast cancerderived from orthotopically injected 4T1 cells in BALB/cJ mice.As described indetail below, the infrared imaging,flowcytometry,qRT-PCR, confocal fluorescent microscopy, and immunofluores-cence data, taken together, demonstrated the unique capacity of

Figure 2.

Flow cytometry of binding of P-Alexa647-FA to cultured bonemarrow–derivedmacrophages in vitro.A, Cultured bonemarrowmacrophage populationwas gated.B, A positive shift for P-Alexa647-FA was observed in 95%–99% of all PE stained CD11b-positive macrophages. C, 4T1 cell population was gated. D, A small positiveshift for P-Alexa647-FA was observed, but was significantly less than that observed for bone marrow macrophages stained with P-Alexa647-FA. Confocalmicroscopy showed uptake of P-Alexa647-FA by cultured bonemarrowmacrophages (E) and also labeledwith Hoescht dye (blue) (F) after 48-hour incubationwith(G) P-Alexa647-FA. H, Cultured bone marrow macrophages without P-Alexa647-FA incubation served as a negative control.






the HPMA copolymer to localize to TAMs in both primary andmetastatic tumors, providing a potential pathway for intratu-moral delivery of therapeutic agents.

HPMA copolymer uptake by macrophagesBone marrow was isolated from the mice as described in the

Materials and Methods section. CD11b-positive cells were puri-fied as bonemarrowmacrophages by using FACS.Wemaintainedthe macrophages in culture, incubated the macrophages in vitrowith P-Alexa647-FA, and with FACS, quantified the percentageofCD11b-positive bonemarrowmacrophages that retained theP-Alexa647-FA. We detected a positive shift for P-Alexa647-FA in95%–99% of all prospectively analyzed PE-stained CD11b-pos-itive macrophages (Fig. 2). We further verified the intracellularuptake of the P-Alexa647-FA copolymer by using confocal fluo-rescent microscopy (Fig. 2).

Effect of FA on polymer uptakeFlow cytometry data of cultured bone marrow macrophages

and 4T1 cells stained with both P-Alexa647 and P-Alexa647-FAdid not show a difference in the percentage of retained copolymerwith or without the presence of FA (Supplementary Fig. S3). Thisfinding suggests that the addition of FA does not negatively affectuptake of P-Alexa647-FA by unstimulated bone marrow macro-phages nor enhance the very low levels of uptake by culturedcancer cells.

Biodistribution of HPMA copolymer in the mouse model ofmetastatic breast cancer

HPMA conjugated with IR Dye 800CW (P-IRDye) was visual-ized by infrared imaging. With in vivo infrared imaging that wasperformed 24 hours after systemic delivery of P-IR Dye throughretroorbital injection, we confirmed a consistent localization ofthe copolymer to the primary and metastatic tumor sites. Nouptake was seen on the contralateral hind leg, into which salinewas injected as a control (Fig. 1). Harvested lungs and spleen withmetastases showed uptake of P-IRDye, but nonspecific diffuseuptake was seen in all livers with or without metastatic tumors(Fig. 1). The presence of primary andmetastatic tumors visualizedas luminescence output by IVIS imaging and fluorescence outputby infrared imaging was confirmed grossly at necropsy and byhistology.

Following tumor harvest and digestion, qRT-PCR analysisconfirmed the successful separation of myeloid cells by theCD11b magnetic beads based on the expression of genes thatare characteristic of myeloid cells: Nos2, Fizz1, Arg1, Ym 1/2, andCD11b. Expression of these genes was assessed relative to thehousekeeping gene HPRT. qRT-PCR of sorted CD11bþ myeloidcells revealed statistically significant expression of M2 macro-phage markers, including CD11b (p ¼ 0.014), Fizz1 (p ¼0.022), and Arg1 (P ¼ 0.011), and significantly lower expressionof TGFb (P ¼ 0.032) than CD11b-negative cells (Table 1).

Confocal fluorescent microscopy was used to visually confirmuptake of P-Alexa647-FA by myeloid cells. The qRT-PCR-con-firmed myeloid population was additionally examined withconfocal fluorescent microscopy, which displayed intracellularuptake of P-Alexa647-FA in CD11b-positive sorted cells. No P-Alexa647-FA uptake was visualized in CD11b-negative cells. Flowcytometric analysis of the CD11b-positive–sorted cells displayeda positive shift for PE in all cells to varying degrees, suggestingdifferential expression of CD11b, and demonstrated a positiveshift for P-Alexa647-FA in 3%–10%of all CD11b-positivemacro-phages (unpublished observations).

Whole-field fluorescence scanningwas used to demonstrate thebiodistribution and presence of P-Alexa647-FA in the harvestedtumor specimens. Whole-field fluorescent scanning images dem-onstrated the presence of P-Alexa647-FA in the peritumoraltissues (Fig. 3A). Higher-power images showed the intracellularpresence of P-Alexa647-FA specifically in the TAMs (Fig. 3B).

Immunofluorescence of tumor specimens was utilized toconfirm costaining of macrophages with the HPMA copolymerP-Alexa647-FA. Immunofluorescence and confocal microscopyvisualized P-Alexa647-FA signal within TAMs costained withCD68 from both primary and metastatic tumor tissue speci-mens (Fig. 4).

Flow cytometry was performed on harvested tumor tissues toquantify the percentage of retained P-Alexa647-FA in TAMs.Following harvest and tissue digestion, primary mammaryand tibial tumors were dissociated into cells and analyzed byflow cytometry. PE-stained CD11b-positive cells were gatedand analyzed separately from the remaining cell population. Apositive shift for PE in all gated cells was observed to varyingdegrees, suggesting differential expression of CD11b (Fig. 5).Whereas the entire population of CD11b-positive cells was found

Table 1. RNA expression of macrophage markers in primary mammary tumor specimens sorted by CD11b magnetic column

CD11bphenotype Gene N Mean

Lower95% CI

Upper95% CI SD P

Folddifferencea

þ CD11b 5 7.4 0.4 14.4 5.66 0.014b 6.6� 5 1.1 �1.8 4.0 2.36þ FIZZ1 5 0.1 0.0 0.1 0.05 0.022b 5.0� 5 0.0 0.0 0.0 0.02þ ARG1 5 1.2 0.9 1.5 0.26 0.011b 1.8� 5 0.6 0.2 1.0 0.32þ NOS2 5 1.4 �0.9 3.8 1.87 0.18 6.0� 5 0.2 �0.1 0.5 0.25þ YM 1/2 5 3.3 �5.6 12.2 7.14 0.36 29.9� 5 0.1 �0.2 0.4 0.24þ IL6 5 0.3 0.1 0.4 0.14 0.28 0.5� 5 0.5 0.1 1.0 0.37þ TGFb 5 0.2 0.1 0.2 0.04 0.032b 0.02� 5 7.8 1.2 14.3 5.28

Abbreviation: CI, confidence interval.aCD11b-positive (þ) value minus CD11b-negative (�) value.bP < 0.05.

Zimel et al.





to demonstrate a low constitutive level of P-Alexa647 uptake, asubpopulation of 3% to 6% of CD11b-positive macrophagesdemonstrated a stronger positive shift for P-Alexa647-FA in flowcytometric analysis (Fig. 5).

DiscussionDevelopment of technologies to specifically localize drugs to

TAMs would represent a powerful tool in the rapidly growingfield of immunotherapy. The primary aim of this study was toevaluate whether HPMA-based copolymers, known to both

localize to tumors and sequester within inflammatory cells,would preferentially localize within TAMs at both primaryand metastatic tumor sites. In vitro experiments confirmed thatcultured bone marrow macrophages efficiently take up the P-Alexa647-FA. Similarly, in our in vivo murine metastatic breastcancer model, we also observed uptake of HPMA copolymerwithin CD68þ TAMs of the primary and metastatic breasttumor specimens. These findings suggest the potential utilityof this HPMA copolymer for preferentially targeting TAMsin primary and metastatic tumor microenvironments. Interest-ingly, whereas cultured macrophages uniformly sequestered P-Alexa647-FA, flow cytometric analysis indicated that only 3%to 10% of the CD11b-positive myeloid cells within the tumorspecimen were strongly positive for P-Alexa647-FA. This sug-gests the possibility that apart from in vitro and in vivo effects,different subpopulations of tumor-associated myeloid cellshave differing abilities to accumulate the HPMA copolymer.The specific mechanisms for preferential uptake by this subsetof macrophages, not limited to cellular heterogeneity or stageof development or differentiation, need to be explored infuture studies.

The localization of the HPMA copolymer to TAMs resultsfrom the combined effects of two distinct and unique phe-nomena—namely, the EPR effect and the ELVIS mechanism ofcellular sequestration (13). EPR is an emerging area of interestfor the targeting of therapeutics to solid tumors, but this studyrepresents the first report of exploitation of ELVIS to target thetumor microenvironment. It is possible that ELVIS, in combi-nation with EPR, contributes to the specific ability of an HPMAcopolymer to target myeloid populations, which has not beenobserved in prior studies of targeted HPMA copolymer deliveryto solid tumors.

The strategy of incorporating a FA moiety into the P-Alexa647copolymer was based on published observations that activationof macrophages, including TAMs, is associated with upregulationof folate receptor beta (FRb) on the cell surface (30). We

Figure 3.

Fluorescent scanning images of skeletal metastases. A, Whole-field scannedfluorescent image of tibial primarytumor with DAPI (blue) and P-Alexa647-FA concentrated primarily in peripheral peritumoral tissues. B, Whole-fieldfluorescent scanning images of tibial primary tumor showing DAPI (blue)and P-Alexa647-FA (pink) cellular uptake in macrophages.

Figure 4.

Confocal imaging of HPMA copolymer uptake in both primary and metastatic tumor tissues. At low and high magnification, tissue samples from both primarymetastatic tumor specimens demonstrate costaining with CD68 (red) and Alexa Fluor 647 (green) [DAPI (blue)].






speculated that inclusion of FA would favor driving the HPMAcopolymer to TAMs in vivo. Our in vitro data did not demonstrate adifference in retained P-Alexa647, with or without FA, whenincubated with both bone marrow macrophages and 4T1 cells(Supplementary Fig. S3; Supplementary Data). Thus, we haveconfirmed the findings that the addition of FA does not increaseuptake in unstimulated bone marrow macrophages, nor does itenhance the very low levels of uptake in cultured 4T1 cells. Futurein vivo studies are needed to determine whether the addition of FAenhances TAM uptake and retention of the copolymer in differentsubtypes of breast cancers.

Confocal microscopy revealed sequestration of P-Alexa647-FAwithin discrete subcellular compartments of CD68-positive TAMsthat, based upon previous observations, most likely representlysosomes/endosomes (46). Importantly, this mode of seques-tration within acidic compartments allows for development of

HPMA-conjugated therapeutic agents that incorporate engineeredacid-labile linkers, thereby providing sustained delivery of atherapeutic agent via TAMs (8, 14). A similar approach has beenshown to provide protracted anti-inflammatory effects followinglysosomal sequestration of HPMA–copolymer–dexamethasoneconjugates through gradual cleavage of acid-labile linkers andconsequent gradual prodrug activation (17–19). Future studieswill be directed toward exploiting this phenomenon to modifythe polarization and activity of TAMs. These studies are expectedto dissect the role of the FA moiety in fine-tuning cellular distri-bution patterns within tumors.

qRT-PCR analysis of total RNA in the macrophages isolatedfrom the primary tumor tissue revealed a significant increase intranscription levels of the M2 macrophage markers FIZZ1,ARG1, and YM 1/2. The presence of macrophages expressingan M2 phenotype is characteristic of TAMs in many primary

Figure 5.

Flow cytometric analysis of in vivo retentionof P-Alexa647-FAby TAMs.A,The PE-stainedCD11b-positive cell populationwas gated and,B,dead cellswere excluded.C,Histogram analysiswas used to gate cells expressing CD11b.D, 3.5% of CD11b-positive cellswere brightly labeledwith Alexa Fluor 647. A forward shift (arrow) of allCD11b-positive cells toward Alexa 647 was observed when compared to E, the Alexa 647-unstained PE single stain control, suggesting uptake of P-Alexa647-FA bythe entire CD11b-positive macrophage population to varying degrees.

Zimel et al.





and metastatic tumors where these macrophages are believed toplay a role in creating a favorable tumor environment for tumorgrowth and survival (23–28). The presence of the M2 macro-phage population in our model may be playing a similarconducive role in enhancing tumor cell growth and survival.Thus, we suggest that the capacity of HPMA copolymer tolocalize within the M2 macrophages suggests a unique oppor-tunity to exploit this copolymer nanocarrier to selectivelydeliver therapeutic agents inhibiting the macrophage polariza-tion and, consequently, tumor growth (24, 29).

Live infrared imaging has been previously used to demonstratelocalization of P-IRDye to areas of particle-induced inflammationin a murine calvaria osteolysis model described by Ren andcolleagues (14). We found that P-IRDye localized to sites ofprimary and metastatic tumor tissue, but not to control tissues,demonstrating a predilection for areas of peritumoral inflamma-tion, in line with the EPR and ELVIS effects. Nonspecific uptakewas only observed in the liver. Importantly, P-IRDye uptakematched initial Luciferase-IVIS imaging. This result suggests thatthe copolymer is equally effective at targeting primary and met-astatic sites and, therefore, has potential for treating multiplemetastases at different sites with a single systemic therapeuticadministration.

Macrophage phenotypewithin the tumormicroenvironment isheavily influenced by a complex interplay of stromal cells, hyp-oxia, and other unknown factors. Efforts are under way to identifypotential therapeutic targets that could modify the phenotype ofmacrophages, thereby slowing or halting tumor growth andmetastasis (47). Alteration of peritumoral macrophage pheno-types has been described in several in vitro studies and smallanimal models, resulting in tumor regression and prolongedsurvival (48). The optimal delivery mechanism and the idealdrug target needed to repolarize TAMs will require further inves-tigation. However, nanocarriers such as HPMA copolymers maybe the potential link between functional drug development andthe targeted delivery of therapeutic agents to this critical myeloidcell population.

In conclusion, our in vitro and in vivo studies in the currentmurine metastatic breast cancer model demonstrate the uniquecapacity of an HPMA–copolymer folate conjugate to localize toTAMs in primary and metastatic sites of cancer. These novelfindings highlight the potential utility of the HPMA copolymeras a nanocarrier system to deliver therapeutic agents that alter

macrophage activation and/or polarization as well as inhibitgrowth of both primary tumors and multiple metastases.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: M.N. Zimel, C.B. Horowitz, D. Wang, S.R. Goldring,P.E. Purdue, J.H. HealeyDevelopment of methodology: M.N. Zimel, C.B. Horowitz, V.K. Rajasekhar,A.B. Christ, J. Wu, D. Wang, S.R. Goldring, P.E. Purdue, J.H. HealeyAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): M.N. Zimel, C.B. Horowitz, V.K. Rajasekhar,A.B. Christ, X. Wei, P.M. Wojnarowicz, J.H. HealeyAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): M.N. Zimel, C.B. Horowitz, V.K. Rajasekhar,A.B. Christ, X. Wei, J. Wu, D. Wang, S.R. Goldring, P.E. Purdue, J.H. HealeyWriting, review,and/or revisionof themanuscript:M.N.Zimel,C.B.Horowitz,V.K. Rajasekhar, A.B. Christ, J. Wu, P.M. Wojnarowicz, D. Wang, S.R. Goldring,P.E. Purdue, J.H. HealeyAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): M.N. Zimel, S.R. Goldring,Study supervision: M.N. Zimel, S.R. Goldring, J.H. Healey

AcknowledgmentsWe thank Dr. Robert Benezra and his laboratory members, the Molecular

Cytogenetics Core Facility at MSKCC for karyotyping the 4T1 cell lines. We alsothank theMolecular Cytology Core Facility, JenniferWilshire and theMSK FlowCytometry Core Facility, the Flow Cytometry Core Facility at the Hospital forSpecial Surgery (New York, NY), and Dr. Adam Levin, Yen Hsun Chen, andNikita Consul for their contributions to study conception, implementation, anddata analysis for this project.

Research reported in this publication was supported in part by a grant fromthe National Institutes of Health/National Cancer Institute (NIH P30-CA008748; Memorial Sloan Kettering Cancer Center; PI of record: CraigThompson),Major Family Fellowship FundatMemorial SloanKetteringCancerCenter (J.H. Healey), NIH R01 AR062680 (D. Wang), and Center for MolecularImaging and Nanotechnology at Memorial Sloan Kettering Cancer Center(Project #302; J.H. Healey).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received December 17, 2015; revised July 24, 2017; accepted August 16,2017; published OnlineFirst August 22, 2017.

References1. Lammers T, Subr V, Ulbrich K, Peschke P, Huber PE, Hennink WE, et al.

Simultaneous delivery of doxorubicin and gemcitabine to tumorsin vivo using prototypic polymeric drug carriers. Biomaterials 2009;30:3466–75.

2. Sinha R, Kim GJ, Nie S, Shin DM. Nanotechnology in cancer therapeutics:bioconjugated nanoparticles for drug delivery. Mol Cancer Ther 2006;5:1909–17.

3. Maeda H, Matsumura Y. Tumoritropic and lymphotropic principlesof macromolecular drugs. Crit Rev Ther Drug Carrier Syst 1989;6:193–210.

4. Matsumura Y, Maeda H. A new concept for macromolecular thera-peutics in cancer chemotherapy: mechanism of tumoritropic accumu-lation of proteins and the antitumor agent smancs. Cancer Res 1986;46:6387–92.

5. Kopecek J. Soluble biomedical polymers. Polim Med 1977;7:191–221.6. Kopecek J. Controlled biodegradability of polymers–a key to drug delivery

systems. Biomaterials 1984;5:19–25.

7. Kopecek J, Bazilova H. Poly[N-(2-Hydroxypropyl)Methacrylamide]. 1.Radical polymerization and copolymerization. Eur Polym J 1973;9:7–14.

8. Kopecek J, Kopeckova P, Minko T, Lu Z. HPMA copolymer-anticancer drugconjugates: design, activity, and mechanism of action. Eur J PharmaBiopharm 2000;50:61–81.

9. Lu ZR, Shiah JG, Sakuma S, Kopeckova P, Kopecek J. Design of novelbioconjugates for targeted drug delivery. J Control Release 2002;78:165–73.

10. Omelyanenko V, Kopeckova P, Gentry C, Kopecek J. Targetable HPMAcopolymer-adriamycin conjugates. Recognition, internalization, and sub-cellular fate. J Control Rel 1998;53:25–37.

11. Seymour LW, FerryDR, Kerr DJ, ReaD,WhitlockM, Poyner R, et al. Phase IIstudies of polymer-doxorubicin (PK1, FCE28068) in the treatment ofbreast, lung and colorectal cancer. Int J Oncol 2009;34:1629–36.

12. Rihova B.Clinical experience with anthracycline antibiotics-HPMA copol-ymer-human immunoglobulin conjugates. Adv Drug Delv Rev 2009;61:1149–58.






13. Yuan F, Quan LD, Cui L, Goldring SR, Wang D. Development of macro-molecular prodrug for rheumatoid arthritis. Adv Drug Deliv Rev 2012;64:1205–19.

14. Ren K, Purdue PE, Burton L, Quan LD, Fehringer EV, Thiele GM, et al. Earlydetection and treatment of wear particle-induced inflammation and boneloss in a mouse calvarial osteolysis model using HPMA copolymer con-jugates. Mol Pharm 2011;8:1043–51.

15. PurduePE, Levin AS, RenK, Sculco TP,WangD,Goldring SR.Developmentof polymeric nanocarrier system for early detection and targeted thera-peutic treatment of peri-implant osteolysis. HSS J 2013;9:79–85.

16. Wang D, Miller SC, Liu XM, Anderson B, Wang XS, Goldring SR. Noveldexamethasone-HPMA copolymer conjugate and its potential applicationin treatment of rheumatoid arthritis. Arthritis Res Ther 2007;9:R2.

17. Quan LD, Purdue PE, Liu XM, Boska MD, Lele SM, Thiele GM, et al.Development of a macromolecular prodrug for the treatment of inflam-matory arthritis: mechanisms involved in arthrotropism and sustainedtherapeutic efficacy. Arthritis Res Ther 2010;12:R170.

18. Quan L, Zhang Y, Dusad A, Ren K, Purdue PE, Goldring SR, et al. Theevaluation of the therapeutic efficacy and side effects of a macromoleculardexamethasone prodrug in the collagen-induced arthritis mouse model.Pharm Res 2016;33:186–93.

19. Quan LD, Yuan F, Liu XM, Huang JG, Alnouti Y, WangD. Pharmacokineticand biodistribution studies of N-(2-hydroxypropyl)methacrylamidecopolymer-dexamethasone conjugates in adjuvant-induced arthritis ratmodel. Mol Pharm 2010;7:1041–9.

20. Jung KY, Cho SW, Kim YA, Kim D, Oh BC, Park DJ, et al. Cancers withhigher density of tumor-associatedmacrophageswere associatedwithpoorsurvival rates. J Pathol Transl Med 2015;49:318–24.

21. Chanmee T, Ontong P, Konno K, Itano N. Tumor-associated macrophagesas major players in the tumor microenvironment. Cancers (Basel)2014;6:1670–90.

22. Hagemann T, Lawrence T, McNeish I, Charles KA, Kulbe H, ThompsonRG, et al. "Re-educating" tumor-associated macrophages by targetingNF-kappaB. J Exp Med 2008;205:1261–8.

23. Obeid E, Nanda R, Fu YX, Olopade OI. The role of tumor-associatedmacrophages in breast cancer progression (review). Int J Oncol2013;43:5–12.

24. Ager EI, Kozin SV, Kirkpatrick ND, Seano G, Kodack DP, Askoxylakis V,et al. Blockade of MMP14 activity in murine breast carcinomas: implica-tions for macrophages, vessels, and radiotherapy. J Natl Cancer Inst2015;107:djv017.

25. Lin EY, Pollard JW.Macrophages:modulators of breast cancer progression.Novartis Found Symp 2004;256:158–69.

26. Mantovani A, Sica A. Macrophages, innate immunity and cancer: balance,tolerance, and diversity. Curr Opin Immunol 2010;22:231–7.

27. Pollard JW. Tumour-educated macrophages promote tumour progres-sion and metastasis. Nat Rev Cancer 2004;4:71–8.

28. VanGinderachter JA,Movahedi K, HassanzadehGhassabehG,MeerschautS, Beschin A, Raes G, et al. Classical and alternative activation of mono-nuclear phagocytes: picking the best of both worlds for tumor promotion.Immunobiology 2006;211:487–501.

29. Li N, Qin J, Lan L, Zhang H, Liu F, Wu Z, et al. PTEN inhibits macrophagepolarization from M1 to M2 through CCL2 and VEGF-A reduction andNHERF-1 synergism. Cancer Biol Ther 2015;16:297–306.

30. Nogueira E, Gomes AC, Preto A, Cavaco-Paulo A. Folate-targetednanoparticles for rheumatoid arthritis therapy. Nanomedicine 2016;12:1113–26.

31. Lai JT, Filla D, Shea R. Functional polymers from novel carboxyl-termi-nated trithiocarbonates as highly efficient RAFT agents. Macromolecules2002;35:6754–6.

32. Moore S, Stein WH. A modified ninhydrin reagent for the photometricdetermination of amino acids and related compounds. J Biol Chem1954;211:907–13.

33. Puig-Kroger A, Sierra-Filardi E, Dominguez-Soto A, Samaniego R,Corcuera MT, Gomez-Aguado F, et al. Folate receptor beta isexpressed by tumor-associated macrophages and constitutes a markerfor M2 anti-inflammatory/regulatory macrophages. Cancer Res 2009;69:9395–403.

34. Kurahara H, Takao S, Kuwahata T, Nagai T, Ding Q, Maeda K, et al.Clinical significance of folate receptor beta-expressing tumor-associ-ated macrophages in pancreatic cancer. Ann Surg Oncol 2012;19:2264–71.

35. Hattori Y, Yamashita J, Sakaida C, Kawano K, Yonemochi E. Evaluationof antitumor effect of zoledronic acid entrapped in folate-linked lipo-some for targeting to tumor-associated macrophages. J Liposome Res2015;25:131–40.

36. Burton L, Paget D, Binder NB, Bohnert K, Nestor BJ, Sculco TP, et al.Orthopedic wear debris mediated inflammatory osteolysis is mediatedin part by NALP3 inflammasome activation. J Orthop Res 2013;31:73–80.

37. Aslakson CJ,Miller FR. Selective events in themetastatic process defined byanalysis of the sequential dissemination of subpopulations of a mousemammary tumor. Cancer Res 1992;52:1399–405.

38. Dexter DL, Kowalski HM, Blazar BA, Fligiel Z, Vogel R, Heppner GH.Heterogeneity of tumor cells froma singlemousemammary tumor. CancerRes 1978;38:3174–81.

39. American TypeCultureCollectionT. ATCCProduct Sheet: 4T1 (ATCCCRL-2539). Manassas, VA: American Type Culture Collection; 2014.

40. Shaffer LG, McGowan-Jordan J, Schmid M. International Standing Com-mittee onHumanCytogeneticNomenclature. ISCN2013: an internationalsystem for human cytogenetic nomenclature (2013). Basel: Karger; 2013.vi, 140 p., 1 folded sheet p.

41. Granot Z, Henke E, Comen EA, King TA, Norton L, Benezra R. Tumorentrained neutrophils inhibit seeding in the premetastatic lung. CancerCell 2011;20:300–14.

42. Schvartzman JM, Duijf PH, Sotillo R, Coker C, Benezra R. Mad2 is a criticalmediator of the chromosome instability observed upon Rb and p53pathway inhibition. Cancer Cell 2011;19:701–14.

43. Stankic M, Pavlovic S, Chin Y, Brogi E, Padua D, Norton L, et al. TGF-beta-Id1 signaling opposes Twist1 and promotes metastatic colonization via amesenchymal-to-epithelial transition. Cell Rep 2013;5:1228–42.

44. Liu X, JohnsonS, Liu S, KanojiaD, YueW, SinghUP, et al.Nonlinear growthkinetics of breast cancer stem cells: implications for cancer stem celltargeted therapy. Sci Rep 2013;3:2473.

45. Livak KJ, Schmittgen TD. Analysis of relative gene expression data usingreal-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods2001;25:402–8.

46. Wang D, Goldring SR. The bone, the joints and the Balm of Gilead. MolPharm 2011;8:991–3.

47. Quail DF, Joyce JA. Microenvironmental regulation of tumor progressionand metastasis. Nat Med 2013;19:1423–37.

48. Pyonteck SM, Akkari L, Schuhmacher AJ, Bowman RL, Sevenich L, QuailDF, et al. CSF-1R inhibition alters macrophage polarization and blocksglioma progression. Nat Med 2013;19:1264–72.


Zimel et al.




2017;16:2701-2710. Published OnlineFirst August 22, 2017.Mol Cancer Ther Melissa N. Zimel, Chloe B. Horowitz, Vinagolu K. Rajasekhar, et al. Macrophages in Primary and Metastatic Breast Cancer

Copolymer Nanocarrier Targets Tumor-Associated−HPMA

Updated version

10.1158/1535-7163.MCT-15-0995doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2017/08/22/1535-7163.MCT-15-0995.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/16/12/2701.full#ref-list-1

This article cites 45 articles, 7 of which you can access for free at:

Citing articles

http://mct.aacrjournals.org/content/16/12/2701.full#related-urls

This article has been cited by 1 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/16/12/2701To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-15-0995

http://mct.aacrjournals.org/content/suppl/2017/08/22/1535-7163.MCT-15-0995.DC1

http://mct.aacrjournals.org/content/16/12/2701.full#ref-list-1

http://mct.aacrjournals.org/content/16/12/2701.full#related-urls

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/16/12/2701


hpma copolymer nanocarrier targets tumor- associated … · small molecule therapeutics...

Documents