Heinrich & Corless Laboratories

GIST Research Updates: May 2012

GIST Research Updates: May 2012

• Corless– Will discuss new technologies for DNA sequencing– The goal is to further subclassify GISTs and better

understand the genes that contribute to malignancy

• Heinrich– Will discuss studies aimed at understanding how

to kill persistent GIST cells that imatinib and sunitinib cannot always control

‘Next Generation’ DNA Sequencing

• Traditional DNA sequencing is limited to just one part of one gene at a time

• Second- and third-generation DNA sequencers are now available at OHSU

• We have been using these new technologies to study GISTs

Second-Generation DNA Sequencing

Sequencing GIST ‘Exomes’

• Human genome consists of 3.2 billion letters (A, C, T, G)

• Genes comprise only ~2% of our DNA (about 64 million letters)

• We ‘pre-select’ the genes, so that only the 64 million letters of interest get sequenced – this is the ‘exome’

• Cost: $2,000 per sample

GIST Exome SequencingSpecimen Summary

Genotype Sequencing completed Sequencing in progress AvailablePatients Specimens Patients Specimens Pts Specimens

KIT exon 9 5 8 1 1

KIT exon 11 9 13 4 6

PDGFRA 3 3 1 1

Wildtype 1 1 3 3

BRAF 1 3

unknown 1 1

TOTAL 18 25 5 11 8 10

Additional matched normal specimens: 19 completed; 5 in progress; 8 available

Sequencing results: Mutant genes by group

• 25 specimens from 18 patients• 285 non-synonymousmutations• 276 unique genes

Apoptosis, autophagy , 6

Cell adhesion, 5 Cell cycle, 1 DNA damage response, 4

Epigenetic regulation, 8

GTPase regulation (Ras family) , 6

Golgi, intracellular transport , 7

Kinase, adaptor, RTK regulation , 15

Ribosome biogenesis, RNA Polymerase, RNA

splicing, 13Transcription

factor, 15

Tumor suppressor, TP53-related , 6

Ubiquitin , 9

Misc potentially interesting , 8

unknown, analysis in progress, 173

GIST AnalysisUsing Third-Generation DNA Sequencing

• The Knight Labs have partnered with Ion Torrent/Life Tech on the development of genotyping panels using third-generation DNA sequencing technology

• Sequencing is performed on a semiconductor chip

Sequencing Directly On A Chip

Traditional Sequence

ACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCTGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAGACTGGTCCAGCTGGTTAG

3rd Generation Sequence

GIST Panel

Knight Diagnostic Labs

AKT1 PDGFRAAKT2 PIK3CAAKT3 PTENATM PTPN11BRAF SDHACDKN2A SDHAF1HRAS SDHAF2KIT SDHBKRAS SDHCMAP2K1 SDHDNF1 TP53NRAS

Important in WT GISTs

Common GIST mutations

Predicting GIST prognosis

Rare GIST mutations of research interest