genetic engineering biotechnology the manipulation of a trait in an organism to create a desired...

41
Genetic Engineering Biotechnology

Upload: christina-davidson

Post on 11-Jan-2016

219 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Genetic EngineeringBiotechnology

Page 2: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

The manipulation of a trait in an organism to create a

desired change

What is Genetic Engineering?

Page 3: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

We have been manipulating DNA for generations! Artificial breeding

creating new breeds of animals & new crop plants to improve our food

Page 4: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Animal breeding

Page 5: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Breeding food plants “Descendants” of the wild mustard

the “Cabbage family”

Page 6: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Breeding food plants

Evolution of modern corn (right) from ancestral teosinte (left).

Page 7: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

A Brave New World

Page 8: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

The code is universal Since all living

organisms… use the same

DNA use the same

code book read their

genes the same way

Page 9: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT

human genome3.2 billion bases

Page 10: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Can we mix genes from one creature to another?

YES!

Green Fluorosceint Protein (GFP)

Page 11: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

How do we do mix genes? Genetic engineering

find gene _______ DNA in both organisms _______ gene from one creature into other

creature’s DNA _______ new chromosome into organism organism _______ new gene as if it were its

own organism _______ gene as if it were its own _____________________________________:

Remember: we all use the same genetic code!

Page 12: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Uses of genetic engineering Genetically modified organisms

(GMO) enabling plants to produce new

proteins ___________________________: BT corn

corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)

___________________________: fishberries strawberries with an anti-freezing gene from

flounder

___________________________: golden rice rice producing vitamin A

improves nutritional value

Page 13: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Basic steps in genetic engineering

1. Isolate the gene2. Insert it in a host using a vector3. Produce as many copies of the

host as possible4. Separate and purify the product

of the gene

Page 14: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Gene Cloning Techniques

1- Grow the target microorganism

2.Extract/isolate DNA

DNA target

3- Digest fragment DNA

with restriction enzymes

4- Insert DNA fragments in a

plasmid cloning vector

Recombinant

Page 15: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Each bacteria will grow to form an individual colony

Continued

“Vibrio DNA library”

5- Transform E. coli with

library

Each bacteria will receive a single plasmid from the

library

Page 16: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Tools

1. DNA you want to clone2. Restriction endonucleases (molecular

scissors)

3. Cloning vector (e.g. pGEM, pBR322…)

4. Ligase enzyme (molecular glue)

Page 17: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Step 1: Isolating the gene

Page 18: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Step 1: Isolating the gene

Page 19: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Cutting DNA DNA “scissors”

____________________________ ____________________________

used by bacteria to cut up DNA of attacking viruses

EcoRI, HindIII, BamHI

cut DNA at specific sites enzymes look for specific base

sequencesGTAACGAATTCACGCTTCATTGCTTAAGTGCGAAGTAACG|AATTCACGCTTCATTGCTTAA|GTGCGAA

Page 20: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Restriction enzymes Cut DNA at specific sites

____________________________

GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA

GTAACGAATTCACGCTTCATTGCTTAAGTGCGAA

restriction enzyme cut site

restriction enzyme cut site

Page 21: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Sticky ends Cut other DNA with same enzymes

leave “sticky ends” on both can glue DNA together at “sticky ends”

GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA

gene you want

GGACCTG AATTCCGGATACCTGGACTTAA GGCCTAT

chromosome want to add

gene to

GGACCTG AATTCACGCTTCCTGGACTTAA GTGCGAA

combinedDNA

Page 22: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Restriction Endonucleases

• Restriction endonucleases, a.k.a. “restriction enzymes” or “enzymes” by

molecular biologists.

• Type II restriction enzymes recognize and cut specific DNA sequences

5’-NNNAAGCTTNNN-3’3’-NNNTTCGAANNN-5’

Page 23: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Example

• Hind III (Haemophilus influenza Rd)– Recognizes: AAGCTT

– Cuts in between the two A’s

AAGCTT A AGCTTTTCGAA TTCGA A

Page 24: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Types of Sticky Ends

5’ overhangs (HindIII)

5’AAGCTT 3’ 5’A 5’ AGCTT3’

3’TTCGAA 5’ 3’TTCGA 5’ A 5’

3’ overhangs (KpnI)

5’ GGTACC 3’ 5’ GGTAC 3’ C 3’

3’ CCATGG 5’ 3’ C 3’ CATGG 5’

Page 25: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Types of Overhangs

Sticky ends Examples include HindIII & KpnI

Blunt Ends Example SmaI Recognize CCCGGG Cut between C and G

CCCGGG CCC GGGGGGCCC GGG CCC

Page 26: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Sticky ends help glue genes togetherTTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTTAACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA

gene you want cut sitescut sites

AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTTTTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA

chromosome want to add gene tocut sites

AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene

sticky ends

chromosome with new gene addedTAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC

CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

sticky ends stick together

DNA ligase joins the strands ________________ DNA molecule

Page 27: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Why mix genes together?

TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC

CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC

Gene produces protein in different organism or different individual

aa aaaa aa aa aa aa aa aa aa

“new” protein from organism ex: human insulin from bacteria

human insulin gene in bacteria

bacteria human insulin

How can bacteria read human DNA?

Page 28: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Step 2: Inserting gene into vector

Vector – molecule of DNA which is used to carry a foreign gene into a host cell

Page 29: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Plasmid Vector: pBR322

First modern cloning vector (1976)

Page 30: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

pBR322

• Contains: 1. colE1 origin of replication (ORI)

Page 31: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Bacteria plus plasmid

Non-transformed bacteria

Nutrient media plus antibiotic

Overnight growth

Only coloniesfrom bacteria that

have plasmid

pBR322

• Contains: 2. Selectable Markers:

• Ampicillin Resistance (β-lactamase gene)• and Tetracycline

Resistance (tet gene)

Page 32: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

pBR322

• Contains: 3. A few good restriction sites for

inserting foreign DNA

PstI

EcoRI Bam

HI

BamH1

BamH1

Your favorite DNA

Digest

with BamH

1

and ligate

PstI

EcoRI Bam

HI BamHI

Your favorite

DNA

Page 33: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

pBR322

• Nice Features: √ 200 copies per E. coli cell√ Makes double stranded DNA√ All modern cloning vectors are

based on pBR322

Page 34: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

• Advantages over pBR3221. Makes 1000’s of copies/cell

2. Small size at 2.7 kilobase pairs (kb) = easier uptake by E. coli

Next Generation: pUC Plasmids

Page 35: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Step 3: inserting vector into host

Page 36: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Bacteria Bacteria are great!

one-celled organisms reproduce by mitosis

easy to grow, fast to grow generation every ~20 minutes

Page 37: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

A way to get genes into bacteria easily insert new gene into plasmid insert plasmid into bacteria bacteria now expresses new gene

bacteria make new protein

+

transformedbacteriagene from

other organism

plasmid

cut DNA

recombinantplasmid

vector

glue DNA

Page 38: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Blue/White SelectionBacteria plus empty

plasmid Non-transformed bacteria

Only coloniesfrom bacteria that

have plasmid

Nutrient media plus antibiotic plus X-Gal

Overnight growth

Bacteria with plasmid plus insert

Colonies with insert - whiteColonies w/o insert - blue

Page 39: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Grow bacteria…make more

growbacteria

harvest (purify)protein

transformedbacteria

plasmid

gene fromother organism

+

recombinantplasmid

vector

Page 40: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

Applications of biotechnology

Page 41: Genetic Engineering Biotechnology The manipulation of a trait in an organism to create a desired change What is Genetic Engineering?

any Questions?