expression of neuropeptide y and pro-opiomelanocortin in hypothalamic arcuate nucleus in...

Expression of neuropeptide Y and pro-opiomelanocortinin hypothalamic arcuate nucleus in 17α-ethinylestradiol-induced intrahepatic cholestasis pregnantrat offspring

Qingyun Shi1, Jingjing Wang2, Shi Yan3, Jin Zhao1 and Hongxia Li1

1Department of Obstetrics and Gynecology, Beijing Shi Jitan Hospital, Capital Medical University, 2Department of LaboratoryAnimal Sciences, Capital Medical University, Beijing, and 3Department of clinical Medical, West China Medical School,Sichuan University, Chendu, China

Abstract

Aim: The purpose of this study was to investigate the expression of neuropeptide Y (NPY) and pro-opiomelanocortin (POMC) in the hypothalamic arcuate nucleus of intrahepatic cholestasis pregnant (ICP)offspring.Methods: The model of ICP rats was established by injecting s.c. 17α-ethinyl estradiol. The expression of NPYand POMC in female offspring was determined by quantitative real-time reverse transcription polymerasechain reaction, western blotting and immunohistochemistry at birthday and 6 months.Results: ICP group offspring had lower bodyweight at birthday. ICP offspring were markedly heavier thancontrol offspring after 6 months. mRNA and protein expression of NPY and POMC significantly increased at6 months as compared with the birthday among control offspring. Among ICP offspring, mRNA and proteinexpression of NPY and POMC also were higher at 6 months than at birthday. The mRNA and proteinexpression of NPY were higher in ICP offspring than that of control offspring at birthday. The mRNA andprotein expression of POMC were decreased in ICP offspring than that of control offspring. After 6 months,the mRNA expression and protein expression of NPY also were higher in ICP offspring than that of controloffspring. The mRNA expression and protein expression of POMC also were decreased in ICP offspring thanthat of control offspring. The results were confirmed by immunohistochemistry.Conclusion: ICP offspring demonstrated evidence of persistent appetite stimulation with significantlyupregulated NPY expression and reduced POMC expression at birthday and 6 months. ICP offspring showeda hunger state and then gained weight.Key words: arcuate nucleus, intrahepatic cholestasis of pregnancy, neuropeptides, rat.

Introduction

Intrahepatic cholestasis of pregnancy (ICP) is themost common liver disease seen in pregnancy,1 withreported incidence rates of between 0.4% and 15%

in difference countries and populations.2,3 ICP ischaracterized by pruritus, elevated bile acids andtransaminases in the late second and third trimesterof pregnancy. ICP is relatively benign in women,but it has been reported to have important fetal

Received: April 2 2013.Accepted: June 9 2013.Reprint request to: Qingyun Shi, Department of Obstetrics and Gynecology, Beijing Shi Jitan Hospital, Capital Medical University,Beijing 100038, China. Email:[email protected] of interest: None of the authors have a relationship with any company that may have a financial interest in this manuscript.

bs_bs_banner

doi:10.1111/jog.12206 J. Obstet. Gynaecol. Res. Vol. 40, No. 2: 445–452, February 2014

© 2013 The Authors 445Journal of Obstetrics and Gynaecology Research © 2013 Japan Society of Obstetrics and Gynecology

mailto:[email protected]

complications, including spontaneous preterm birth(12–44% of pregnancies), antenatal passage of meco-nium (16–58%) and fetal distress (10–44%) (compre-hensively reviewed by Geenes and Williamson).3

Preterm birth contributes to low birthweight. Epide-miological studies have shown that adverse environ-mental factors during pregnancy leading to lowbirthweight may predispose offspring to adult diseasedevelopment (such as diabetes, cardiovascular diseaseand obesity).4–6 More recently, investigations have alsodemonstrated that slow growth in early childhoodcould have a similar effect on acquiring adult-onsetdiseases.7,8 To determine the mechanisms responsiblefor this phenomenon, various investigators have useddifferent animal models of intrauterine growth restric-tion (IUGR) to determine the effect of hypothalamicorexigenic and anorexigenic neuropeptides in malesand females.8–10 Energy homeostasis depends on acomplex regulatory mechanism controlled by thehypothalamus. Within the hypothalamus, the arcuatenucleus (ARC) is a key target of appetite regulatoryfactors and contains subsets of neuropeptide Y (NPY)and pro-opiomelanocortin (POMC).11 NPY has beendemonstrated to promote feeding and inhibit energyexpenditure. POMC is the precursor of α-melanocytestimulating hormone, which reduces food intake andincreases catabolic processes.12,13 Evidence in supportof the critical role of these factors includes animalmodels of obesity in which levels of NPY messengerRNA expressions are increased.14,15 The research, whichused a baboon model of IUGR, also showed thatIUGR alters term fetal baboon hypothalamic appetitivepeptide balance. In this study, they found that IUGRincreased NPY expression and decreased POMCexpression.16

We hypothesized that hyperphagia associated withICP offspring results, in part, from alteration in thebalance of hypothalamic orexigenic and anorexigenicpeptides. Accordingly, we examined the expression ofNPY and POMC in ICP and control offspring ARC atbirthday and 6 months in order to clarify the mecha-nisms of ICP offspring phenotypes in adulthood.

MethodsMaterials

TriZol reagent and SuperScript II were purchased fromInvitrogen. The primers were obtained from AppliedBiosystems. Unless otherwise indicated, all otherchemical products cited in this work were purchasedfrom Sigma-Aldrich.

Animal treatment

The studies were approved by the animal researchcommittee of Capital University of Medicine in Beijingand were conducted in accordance with approvednational institutional guidelines for the care anduse of laboratory animals. Experimental intrahepaticcholestasis induced by 17α-ethinyl estradiol (EE) treat-ment in rodents is a widely used in vivo model toexamine molecular mechanisms involved in estrogen-induced cholestasis.17 First time, pregnant Sprague–Dawley rats were kept under a constant dark : lightcycle and in a controlled temperature (21–23°C) envi-ronment and had free access to laboratory chow andtap water throughout the experiment. Pregnant ratswere divided into two groups (n = 12 per group). In thecontrol group, rats were injected s.c. with one dailydose of olive oil (2.0 mg/kg bodyweight) from preg-nancy day 15 to day 21 during pregnancy. In theICP groups, rats were injected s.c. daily with EE(1.25 mg/kg bodyweight) dissolved in corn oil frompregnancy day 15 to day 21. Blood samples were taken,and sera were stored at −80°C. Serum alkaline phos-phatase (ALP), serum total bilirubin and total bile acidswere measured.

Offspring

Following birth, at day 1 of age, the pups in the controlgroup (nine females) and ICP group (nine females)were killed. Offspring were decapitated underisoflurane inhalation anesthesia, brains collected andhypothalamus dissected. At the same time, femaleswere distinguished morphologically from males by thepresence of uterus duplex. Subsequently, ARC tissuewas used for immunohistochemistry, quantitative real-time reverse transcription polymerase chain reaction(RT–PCR) and western blot analysis. Other offspring inthe control and ICP group were nursed by ad libitum-fed dams. For the present study, only female rats (n = 9per group) were used. At 6 months of age, all animalswere killed. ARC tissue were obtained and used forimmunohistochemistry, quantitative real time RT–PCRand western blot analysis. In the present experiment,males were killed for use in alternative studies unre-lated to this topic.

Western blotting

Total cellular protein was extracted in lysis buffer(50 mmol HEPES, 1 mmol Mgcl2, 10 mmol ethylene-diaminetetraacetic acid, 1% Tris X-100, pH 6.4) andprotein levels were quantified using a BCA Protein

Q. Shi et al.

446 © 2013 The AuthorsJournal of Obstetrics and Gynaecology Research © 2013 Japan Society of Obstetrics and Gynecology

Assay kit (Beyotime Biotechnology). The proteinexpression levels of NPY and POMC in ARC wereanalyzed by western blot. Total protein (30 μg) wasloaded on to a 12% sodium dodecylsulfate polyacryl-amide gel. After electrophoresis, proteins were trans-ferred to a nitrocellulose membrane. The membranewas probed with antibodies against NPY (1:1000,Santa Cruz Biotechnology) and POMC (1:500, SantaCruz Biotechnology), and the secondary horsera-dish peroxidase-conjugated antibody was antirabbit(1:10 000, Santa Cruz Biotechnology). Protein bandswere visualized using the diaminobenzidine detectionkit. The densities of sample bands were analyzed withQuantity One analysis software (Bio-Rad).

Quantitative real time RT–PCR

Total RNA was prepared from rat brain tissue usingan Easy Total RNA kit from Invitrogen. Reversetranscription with 5 μg of total RNA was performedusing the StrataScript qPCR cDNA synthesis kit(Stratagene). Real-time quantitative polymerase chainreaction (qRT–PCR) amplification was performed inan iCycler Spectrofluorometric thermal cycler (Bio-Rad) using RT2SYBR Green qPCR Master Mix andprimer sets optimized for tested targets for SYBRGreen-based real-time PCR from SuperArray Biosci-ence. The sequences of the PCR primers are describedin Table 1. The thermal cycling program consisted of45 cycles of denaturation for 30 s at 90°C, 30 s anneal-ing at 58°C and 40 s extension at 72°C. The relativeamount of target mRNA was calculated using thecomparative cycle threshold (CT) method by normal-izing target mRNA CT to those of glyceraldehyde3-phosphate dehydrogenase. There were nine animalsper treatment group and each sample was analyzedin duplicate.

Serum analysis

Blood was taken from the left ventricle of the maternalheart, directly drawn into a centrifuge tube that con-tained no anticoagulant, promptly centrifuged (3000 gfor 15 min at 4°C and stored at −80°C until analysis).

Markers of hepatocellular damage, alkaline phospha-tase (ALP), aspartate aminotransferase (AST), alanineaminotransferase (ALT) and total bile acid (TBA), aswell as total bilirubin in serum were determined byenzyme-linked immunosorbent assay.

Immunohistochemistry

Hypothalami from the control female offspring group(n = 3) and ICP female offspring group (n = 3) weredissected, fixed in 4% paraformaldehyde at 4°C for24 h, transferred to 0.1 mmol phosphate buffer (pH 7.4)containing 30% sucrose and 0.01% sodium azide. TheARC was obtained by dissecting the ventral part ofthe medial hypothalamus with anterior and dorsalmargins (0.5 mm from the ventral surface of the medialhypothalamus) and posterior margin (border withmammillary body) as detail in the rat brain atlas.18 Forimmunohistochemistry staining, 5-μm sections werecut on a cryotome at −27°C in the coronal plane. Weused the anteroposterior coordinates from Paxinos andWason18 as guides to select the appropriate histologicalsections and equated the levels of the hypothalamus inboth groups. After washing, the sections were blockedfor non-specific binding with 10% donkey serum for2 h at room temperature. Sections were then incubatedwith rabbit anti-NPY (1:500, Santa Cruz Biotechnol-ogy) or Goat anti-POMC (1:500, Santa Cruz Biotechnol-ogy). Sections were subsequently incubated withsecondary antibody for NPY (1:200, antirabbit immu-noglobulin [Ig]G; Alexa488; Invitrogen) or POMC(1:200, antirabbit IgG; Alexa488; Invitrogen) at 4°Covernight. After rinses, sections were counterstainedwith 4′,6′-diamidino-2-phenylindole dihydrochloride(DAPI). The tissue was mounted on the slide withvector anti-fade medium. The anti-NPY antibodylabeled neuron fibers (green color) and POMC anti-bodies labeled the perinuclear region (red color). Fluo-rescence images around hypothalamic ARC areas weretaken via florescence microscopy (Axioskop 40, Zeiss).Images of the slides were taken using a microscope at×10 magnification to show the expression of NPY andPOMC. In order to make sure that the signals were

Table 1 Genes and primer sequences used for real-time polymerase chain reaction

Gene symbol GenBank Forward primer (5′-3′) Reverse primer (3′–5′) Size (bp)

NPY M_20373 TATCCCTGCTCGTGTGTTTG GGGCATTTTCTGTGCTTTCT 102POMC NM_139326 AGTTCAAGAGGGAGCTGGAA CTTGATGATGGCGTTCTTGA 112GAPDH NM_017008 ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 116

GAPDH, glyceraldehyde 3-phosphate dehydrogenase; NPY, neuropeptide Y, POMC, pro-opiomelanocortin.

NPY and POMC in ICP rat offspring


specific, the NPY/POMC images were merged withthe DAPI (nuclei) picture. For the quantification analy-ses, we used Image Pro Plus software ver. 4.5 (MediaCybernetic). The grayscale image (brighter pixels indi-cating stronger labeling) resulting from this procedurewas used in the quantification.

Statistical analysis

The statistical significance of induced or repressedgenes in relation to control animals was determinedusing one-way anova. Variability is expressed asmean ± standard error of the mean (sSEM). For graph-ing purposes, the relative expression levels were scaledbased on the expression level of the control groupdefined as 1. The statistical analysis for serum sampleswas carried out using anova (SPSS ver. 10.0). anova

following by post-hoc analysis and Student–Newman–Keuls test for paired dates was used when appropriate.Results are presented as means ± SEM and consideredsignificant at P < 0.05.

Results17α-Ethinyl estradiol-induced cholestasis

To investigate the effect of EE on hepatic function in thepregnant rat, we measured the concentration of serumhepatic toxicity markers ALT, AST, ALP, TBA and totalbilirubin (TBIL) in pregnant rats after treatment withEE. Our results demonstrated that serum ALT, AST,ALP, TBA and TBIL were significantly elevated inEE-treated pregnant rats as compared with the controlgroup (Table 2). Similarly, serum levels of TBA, cholicacid and deoxycholic acid, critical markers ofcholestasis, were also markedly higher in EE-treatedpregnant rats compared with the control group. These

results support the hypothesis that estrogen induceshepatotoxicity and cholestasis in the pregnant rat.

Phenotypic characteristics of offspring at birthand 6 months

In this study, at 1 day of age, the ICP group offspringhad lower bodyweights as compared to the controlgroup (5.73 ± 0.24 vs 7.27 ± 0.11 g). However, at6 months of age, the ICP group offspring were mark-edly heavier than control offspring (345.12 ± 9.43 vs312.45 ± 10.32 g) (Table 3).

NPY and POMC gene expression in ARC

We next examined the expression of NPY and POMCgenes involved in energy balance functions. Among

Table 2 Effect of 17α-ethinyl estradiol treatment in pregnant rats

Serum markers Control ICP13 days 21 days 13 days 21 days

ALT (U/L) 41.32 ± 2.87 42.21 ± 2.42* 41.21 ± 1.24 70.43 ± 5.61*AST (U/L) 44.41 ± 3.65 43.40 ± 1.61* 43.17 ± 2.54 68.72 ± 3.72TBA (μmol/L) 17.13 ± 2.07 18.12 ± 3.63* 20.10 ± 3.37 64.20 ± 3.61*TBIL (mg/dL) 2.41 ± 0.12 2.63 ± 0.10* 2.58 ± 0.02 6.21 ± 0.04*ALP (U/L) 20.64 ± 2.32 22.02 ± 3.53* 21.16 ± 1.32 58.49 ± 3.13*Cholic (μmol/L) 6.71 ± 0.34 6.45 ± 1.02* 7.42 ± 0.17 18.02 ± 0.52*Deoxy (μmol/L) 1.11 ± 0.01 1.14 ± 0.12* 1.21 ± 0.03 2.75 ± 0.02*

*P < 0.05 versus control. ICP: pregnant rats were injected s.c. daily with 17α-ethynyl estradiol at a dose of 1.25 mg/kg·bodyweight·per dayfrom day 15 to day 21 of pregnancy. Control group: rats were injected s.c. with one daily dose of olive oil (2.0 mg/kg bodyweight) frompregnancy day 15 to day 21 during pregnancy. Before injection (at day 13 of pregnancy) and after the last injection (at day 21 of pregnancy),serum was extracted and serum markers were measured. Data represent mean ± standard error of the mean of n = 12 rats per treatment group.ALP, alkaline phosphatase; ALT, alanine aminotransferase; AST, aspartate aminotransferase; cholic, cholic acid; Deoxy, deoxycholic acid; TBA,total bile acid; TBIL, total bilirubin.

Table 3 Offspring phenotypic characteristics at birthand 6 months

Controloffspring,n = 9

ICPoffspring,n = 9

Birthweight (g) 7.27 ± 0.11 5.73 ± 0.24*Weight at 6 months (g) 312.45 ± 10.32 345.12 ± 9.43*Body length at birth (cm) 4.63 ± 0.21 3.54 ± 0.2*Body length at 6 months

(cm)22.12 ± 0.31 26.43 ± 0.42*

Tail length at birth (cm) 1.55 ± 0.02 1.49 ± 0.11Tail length at 6 months

(cm)16.41 ± 0.11 21.65 ± 0.34*

*P < 0.05 versus control. ICP: pregnant rats were injected s.c.daily with 17α-ethynyl estradiol at a dose of 1.25 mg/kg·bodyweight·per day from day 15 to day 21 of pregnancy.Control group: rats were injected s.c. with one daily dose of oliveoil (2.0 mg/kg·bodyweight) from pregnancy day 15 to day 21during pregnancy. Following birth, at day 1 of age and 6 monthsold, female offspring weight and length were measured. Datarepresent mean ± standard error of the mean of n = 9 rats pertreatment group.

Q. Shi et al.


control female offspring, significantly increased NPY(2.2-fold) and POMC (1.7-fold) mRNA expression at6 months as compared with the birthday state wasobserved. Among ICP female offspring, NPY (2.6-fold)and POMC (1.4-fold) mRNA expression also washigher at 6 months than at birthday. At birthday, themRNA expression of NPY (2.1-fold) was higher in theICP offspring group than that of the control groupoffspring. However, the mRNA expression of POMC(0.6-fold) was decreased in the ICP offspring groupcompared to that of the control group offspring.After 6 months, the mRNA expression of NPY (2.6-fold) was higher in the ICP offspring group than that ofcontrol group offspring. The mRNA expression ofPOMC (1.4-fold) also was decreased in the ICP off-spring group compared with that of control groupoffspring (Fig. 1).

Protein expression of NPY and POMC in ARC

We also used western blot analysis for the proteinexpression of NPY and POMC in ARC.

Among the control female offspring, protein expres-sion of NPY (1.8-fold) and POMC (2.5-fold) signi-ficantly increased at 6 months as compared withthe birthday state. Among the ICP female offspring,protein expression of NPY (2.1-fold) and POMC (1.6-fold) also was higher at 6 months than at birthday. Atbirthday, the protein expression of NPY (1.3-fold) washigher in the ICP offspring group than in control group

offspring. However, the protein expression of POMC(0.6-fold) was decreased in the ICP offspring groupthan that of control group offspring. After 6 months,the protein expression of NPY (2.1-fold)was higher inthe ICP offspring group than control group offspring.The protein expression of POMC (0.6-fold) also wasdecreased in the ICP offspring group than controlgroup offspring (Fig. 2).

Immunohistochemistry for NPY and POMC

Immunohistochemistry for NPY demonstrated thatICP offspring presented a more intense staining(Fig. 3b,f) as compared with the control group(Fig. 3a,e) at birthday and 6 months, as observed onthe part of ARC. In contrast, immunohistochemistryfor POMC indicated that ICP offspring, at birthdayand 6 months, presented decreased intense staining(Fig. 3d,h) as compared with the control group(Fig. 3c,g), as observed on the part of ARC (Figs 3,4).

Figure 1 NPY and POMC mRNA expression in ARC. At1 day of age, the pups in the control group weredefined as 1.o-fold. *Comparisons of 1 day of age pupsversus 6 months of age offspring within the controland ICP group. #Comparisons of ICP versus control(1 day and 6 months). Date are mean ± standard errorof n = 9 rats per group. 1d, 1 day of age the offspring;6m, 6 months of age offspring; ARC, arcuate nucleus;ICP, intrahepatic cholestasis of pregnancy; NPY,neuropeptide Y; POMC, pro-opiomelanocortin.

Figure 2 Protein expression (western blotting) of NPYand POMC. At 1 day of age, the pups in the controlgroup were defined as 1.o-fold. *Comparisons of 1 dayof age pups versus 6 months of age offspring withincontrol and ICP groups. #Comparisons of ICP versuscontrol (1 day and 6 months). Date are mean ± stan-dard error of n = 9 rats per group. (a) One day of agepups in the control group; (b) 6 months of age off-spring in the control group; (c) 1 day of age pups in theICP group; (d) 6 months of age offspring in the ICPgroup. 1d, 1 day of age the offspring; 6m, 6 monthsof age offspring; ICP, intrahepatic cholestasis ofpregnancy; NPY, neuropeptide Y; POMC, pro-opiomelanocortin.



Discussion

Although ICP is relatively benign to the mother, it isknown that the risk of fetal complications is increasedin pregnancies affected by ICP. These include increasedrisk of meconium-stained amniotic fluid, pretermdelivery, fetal distress and intrauterine fetal demise.Recent studies in humans and animals have provided

convincing evidence that adverse utero environmentmay have an impact on fetal development processesand may alter homeostatic regulatory mechanismsamong the offspring.19,20 In the present study, we firstanalyzed the changes in various markers of cholestasisin sera of both ICP and control groups. Serum TBIL,ALP and TBA were significantly elevated in the ICPgroup compared with controls. Anthropometric mea-surements, such as birthweight, represent the sumeffect of genetic and epigenetic influence coupled withthe intrauterine. We have shown that both birthweightand body length in ICP offspring were significantlylower as compared to control group offspring at 1 dayof age. However, after 6 months, birthweight and bodylength in ICP offspring were significantly higher ascompared to control group offspring. These results alsosupport that adverse environmental cues can influencethe programming of the body and provide evidence ofrapid catch-up growth in low birthweight animals.21,22

The evidence indicates that a striking 25–63% ofadult diabetes and hypertension can be attributed tothe effects of low birthweight with acceleratednewborn to adolescent weight gain.23 Obesity is poten-tiated by alteration in appetite regulation and byincreased adipogenesis. The ARC has been recognizedas a key target of appetite regulatory factors andresponds to both satiety and hunger signals. TheARC contains at least two distinct populations ofneurons with opposing actions on food intake: NPYand POMC. There is significant cross-talk between

Figure 3 Immunohistochemistry images of rat coronalhypothalamic sections stained for NPY (green) andPOMC (red). Expression of NPY in control group (a)and ICP group (b) female offspring hypothalamicarcuate nucleus at birthday. NPY merged with DAPI(original magnification ×10). Expression of POMC incontrol group (c) and ICP group (c) female offspringhypothalamic arcuate nucleus at birthday. POMCmerged with DAPI (×10). Expression of NPY in controlgroup (e) and ICP group (f) female offspring hypotha-lamic arcuate nucleus at 6 months. NPY merged withDAPI (×10). Expression of POMC in control group (g)and ICP group (h) female offspring hypothalamicarcuate nucleus at 6 months. POMC merged with DAPI(×10). 3V, third ventricle; DAPI, 4′,6′-diamidino-2-phenylindole dihydrochloride; ICP, intrahepaticcholestasis of pregnancy; NPY, neuropeptide Y;POMC, pro-opiomelanocortin. Scale bar, 5 μm.

Figure 4 Quantitative data concerning NPY and POMCin the arcuate nucleus. NPY and POMC immuno-staining as indicated by pixel density. n = 3 rats pergroup. *Mean value was significantly different fromthat of the control group (P < 0.05). NPY, neuropeptideY; POMC, pro-opiomelanocortin.

Q. Shi et al.


these nuclei: NPY-containing neurons act to inhibitPOMC-containing neurons.24,25 A large body of animalstudies have shown that adverse environmental factorsduring pregnancy are associated with the postnatalchanges in the expression of NPY and POMC in theARC.9,26,27 In the present study, we sought to examinewhether ICP offspring exhibit evidence of endogenousalterations in central an orexigenic signaling includingNPY and POMC, which regulate food intake, energyexpenditure and physical activity within the ARC. Weshowed an increase in NPY mRNA and protein expres-sion in ICP offspring at birthday as compared withcontrol offspring and decrease in POMC mRNA andprotein expression in ICP offspring at birthday as com-pared with control offspring. NPY play an activerole in energy homeostasis, simulating food intake andfeeding, but POMC decreases food intake andfeeding.28–30 Our findings indicate that the ICP off-spring perceive hunger despite a fed state at birthday.In accordance with appetite drive, the present studyconfirmed that ICP offspring at 6 months displayedheavy bodyweight and longer body length as com-pared with control offspring. The expression of NPYmRNA and protein in the ICP group were also higherthan that of control group. However, POMC mRNAand protein expression decreased more in the ICPgroup than in the control group at 6 months. Theimpaired POMC expression suggests a failed ‘satiety’response to feeding. This result indicates a persistentupregulation of NPY and downregulation of POMCdrive in programmed obese offspring.

Next, we used immunohistochemistry assays tofurther investigate the change of NPY and POMC inARC.

The immunohistochemistry assays showed that ICPoffspring, at birthday and 6 months, presented a moreintense staining in comparison with the control group,as observed on the part of ARC. In contrast, immuno-histochemistry for POMC indicated that ICP offspring,at birthday and 6 months, presented decreased intensestaining in comparison with the control group asobserved on the part of ARC. It is interesting that thesehypothalamic alterations regarding NPY and POMCremained well into 6 months, as confirmed by immu-nohistochemistry and western blotting.

In the present study, we did not control for theeffects of the estrus cycle, which may somewhat modu-late appetite. Rats typically have a 4-day estrus cycle(proestrus, estrus, metestrus and diestrus) with estro-gen peaking during proestrus. Twenty-four-hour foodintake decreases during the estrous phase compared to

the other phases.31 Consistent with this physiologicalresponse, NPY expression in the hypothalamus wasreduced in proestrus–estrus, but POMC remained con-stant throughout the estrous cycle.32 Pre-proNPYmRNA levels measured by in situ hybridization in therat ARC during estrus were only 25–30% lower thanother periods.33 In the present study, NPY mRNAand protein levels significantly increased, not only at6 months old but also at birthday, in the ICP groupcompared to control. Although study days were arbi-trarily selected in both groups, the changes make itunlikely that the findings are a result of random estrusphase differences.

In conclusion, this study demonstrates that ICP off-spring at birthday and 6 months exhibit upregulatedNPY expression and reduced POMC expression. Atbirthday and 6 months old, ICP offspring showed ahunger state and then gained weight. It remains uncer-tain whether the primary aberration in ICP offspring isa result of altered ARC receptor expression, receptorsignal coupling, or an earlier programmed dysfunctionin female fetuses exposed to estradiol levels, a study ofwhich showed that estrogen injection induces insulinresistance.34 These findings provide insight into howthe mechanism of adverse utero environment influ-ences fetal development and adult disease develop-ment. When related to ICP, because of the adverse uteroenvironment, 33% of the pregnancies resulted in peri-natal complications.35 The interventional care providedto these infants, especially preterm birth, may have aprofound influence on their overall health later in life.

Acknowledgments

This work was supported by the National NaturalScience Foundation of China (no. 81170588).

References

1. Joshi D, James A, Quaglia A, Westbrook RH, Heneghan MA.Liver disease inpregnancy. Lancet 2010; 375: 594–605.

2. Lammert F, Marschall HU, Glantz A, Matern S. Intrahepaticcholestasis of pregnancy: Molecular pathogenesis, diagnosisand management. J Hepatol 2000; 33: 1012–1021.

3. Geenes V, Williamson C. Intrahepatic cholestasis of preg-nancy. World J Gastroenterol 2009; 15: 2049–2066.

4. Ravelli GP, Stein ZA, Susser MW. Obesity in young men afterfamine exposure in utero and early infancy. N Engl J Med1976; 295: 349–353.

5. Shiell AW, Campbell DM, Hall MH, Barker DJ. Diet in latepregnancy and glucose-insulin metabolism of the offspring40 years later. Br J Obstet Gynaecol 2000; 107: 890–895.



6. Barker DJ. The developmental origins of adult disease. Eur JEpidemiol 2003; 18: 733–736.

7. Godfrey KM, Gluckman PD, Hanson MA. Developmentalorigins of metabolic disease: Life course and inter-generational perspectives. Trends Endocrinol Metab 2010; 21:199–205.

8. Fukami T, Sun X, Li T, Desai M, Ross MG. Mechanism ofprogrammed obesity in intrauterine fetal growth restrictedoffspring: Paradoxically enhanced appetite stimulation in fedand fasting states. Reprod Sci. 2012; 19: 423–430.

9. Delahaye F, Breton C, Risold PY et al. Maternal perinatalundernutrition drastically reduces postnatal leptin surge andaffects the development of arcuate nucleus proopiome-lanocortin neurons in neonatal male rat pups. Endocrinology2008; 149: 470–475.

10. Stevens A, Begum G, Cook A et al. Epigenetic changes in thehypothalamic proopiomelanocortin and glucocorticoidreceptor genes in the ovine fetus after periconceptionalundernutrition. Endocrinology 2010; 151: 3652–3664.

11. Remmers F, Delemarre-van deWaal HA. Developmental pro-gramming of energy balance and its hypothalamic regula-tion. Endocr Rev 2011; 32: 272–311.

12. Gautron L, Elmquist JK. Sixteen years and counting: Anupdate on leptin in energy balance. J Clin Invest 2011; 121:2087–2093.

13. Sanchez-Lasheras C, Konner AC, Bruning JC. Integrativeneurobiology of energy homeostasis-neurocircuits, signalsand mediators. Front Neuroendocrinol 2010; 31: 4–15.

14. Hahm S, Fekete C, Mizuno TM et al. VGF is requiredfor obesity induced by diet, gold thioglucose treat-ment, and agouti and is differentially regulated in ppro-opiomelanocortin-and neuropeptide y-containing arcuateneurons in response to fasting. J Neurosci 2002; 22: 6929–6938.

15. Bluher S, Ziotopoulou M, Bullen JW Jr et al. Responsivenessto peripherally administered melanocortins in lean and oesemice. Diabetes 2004; 53: 82–90.

16. Li C, McDonald TJ, Wu G, Nijland MJ, Nathanielsz PW. Intra-uterine growth restriction alters term fetal baboon hypotha-lamic appetitive peptide balance. J Endocrinol 2013; 217:275–282.

17. Rodriguez-Garay EA. Cholestasis: Human diseaseandexperimental animal models. Ann Hepatol 2003; 2: 150–158.

18. Paxinos G, Watson C. The Rat Brain in Stereotaxic Coordinates,5th edn. San Diego, CA: Academic Press, 2004.

19. Barker DJ. In utero programming of chronic disease. Clin Sci1998; 95: 115–128.

20. Rogers LK, Velten M. Maternal inflammation, growth retar-dation, and preterm birth:insights in adult cardiovasculardisease. Life Sci 2011; 89: 417–421.

21. Anguita RM, Sigulem DM, Sawaya AL. Intrauterine foodrestricton is associated with obesity in young rats. J Nutr 1993;123: 1421–1428.

22. Vickers MH, Breier BH, Cutfield WS, Hofman PL, GluckmanPD. Fetal origins of hyperphagia, obesity, and nutrition. Am JPhysiol Endocrinol Metab 2000; 279: E83–E87.

23. Barker DJ, Eriksson JG, Forsen T, Osmond C. Fetal origins ofadult disease:strength of effects and biological basis. Int JEpidemiol 2002; 31: 1235–1239.

24. Elmquist JK, Flier JS. Neuroscience. The fat-brain axis enters anew dimension. Science 2004; 304: 63–64.

25. Broberger C, Landry M, Wong H, Walsh JN, Hokfelt T.Subtypes Y1 and Y2 of the neuropeptide Y receptorare respectively expressed in pro-opiomelanocortin-andneuropeptide –y – Containing neurons of the rathypothalamic arcuate nucleus. Neuroendocrinology 1997; 66:393–408.

26. Rajakumar PA, He J, Simmons RA, Devaskar SU. Effect ofuteroplacental insufficiency upon brain neuropeptide Y andcorticotropin-releasing factor gene expression and concentra-tions. Pediatr Res 1998; 44: 168–174.

27. Puglianiello A, Germani D, Cianfarani S. Exposure touteroplacental insufficiency reduces the expression ofsignal transducer and activator of transcription 3 andproopiomelanocortin in the hypothalamus of newborn rats.Pediatr Res 2009; 66: 208–211.

28. Beck B. Neuropeptide Y in normal eating and in genetic anddietary-induced obesity. Pbilos Trans R Soc Lond B Biol Sci2006; 361: 1159–1185.

29. Dube MG, Xu B, Crowley WR, Kalra PS, Kalra SP. Evidencethat neuropeptide Y is a physiological signal for normal foodintake. Brain Res 1994; 646: 341–344.

30. Cowley MA, Smart JL, Rubinstein M et al. Leptin activatesanorexigenic POMC neurons through a neural network in thearcuate nucleus. Nature 2001; 411: 480–484.

31. Spary EJ, Maqbool A, Batten TF. Changes in oestrogen recep-tor alpha expression in the nucleus of the solitary tract ofthe rat over the oestrous cycle and following ovariectomy.J Neuroendocrinol 2010; 22: 492–502.

32. Olofsson LE, Pierce AA, Xu AW. Functional requirementof AgRP and NPY neurons in ovarian cycle-dependentregulation of food intake. PNAS 2009; 16: 15932–15937.

33. Pelletier G, Rhéaume E, Simard J. Variations of pre-proNPYmRNA in the arcuate nucleus during the rat estrous cycle.Neuroreport 1992; 3: 253–255.

34. Alexanderson C, Eriksson E, Stener-Victorin E et al.Postnatal testosterone exposure results in insulin resistanceenlarged mesenteric adipocytes, and an atherogenic lipidprofile in adult female rats: Comparisons with estradioland dihydrotestosterone. Endocrinology 2007; 148: 5369–5376.

35. Rook M, Vargas J, Caughey A, Bacchetti P, Rosenthal P, BullL. Fetal outcomes in pregnancies complicated by intrahepaticcholestasis of pregnancy in a Northern California Cohort.PloS ONE 2012; 7: e28343.

Q. Shi et al.


expression of neuropeptide y and pro-opiomelanocortin in hypothalamic arcuate nucleus in...

Documents