Evolution of OTP-Independent Larval SkeletonPatterning in the Direct-Developing Sea Urchin,Heliocidaris erythrogramma

NA ZHOU 1, KEEN A. WILSON 1, 2, MARY E. ANDREWS 1, JEFFERY S.KAUFFMAN 1, and RUDOLF A. RAFF1*1Department of Biology, Indiana University, Bloomington, Indiana, 474052Department of Genetics, Life Sciences Bldg, University of Georgia,Athens, Georgia, 30602

ABSTRACT Heliocidaris erythrogramma is a direct-developing sea urchin that has evolved amodified ontogeny, a reduced larval skeleton, and accelerated development of the adult skeleton. TheOrthopedia gene (Otp) encodes a homeodomain transcription factor crucial in patterning the larvalskeleton of indirect-developing sea urchins. We compare the role of Otp in larvae of the indirect-developing sea urchin Heliocidaris tuberculata and its direct-developing congener H. erythrogramma.Otp is a single-copy gene with an identical protein sequence in these species. Expression of Otp isinitiated by the late gastrula, initially in two cells of the oral ectoderm in H. tuberculata. These cellsare restricted to oral ectoderm and exhibit left-right symmetry. There are about 266 copies of OtpmRNA per Otp- expressing cell in H. tuberculata. We tested OTP function in H. tuberculata and H.erythrogramma embryos by microinjection of Otp mRNA. Mis-expression of Otp mRNA in H.tuberculata radialized the embryos and caused defects during larval skeletogenesis. Mis-expression ofOtp mRNA in H. erythrogramma embryos did not affect skeleton formation. This is consistent withthe observation by in situ hybridization of no concentration of Otp transcript in any particular cells orregion of the H. erythrogramma larva, and measurement of a level of less than one copy of endogenousOtp mRNA per cell in H. erythrogramma. OTP plays an important role in patterning the larvalskeleton of H. tuberculata, but this role apparently has been lost in the evolution of the H.erythrogramma larva, and replaced by a new patterning mechanism. J. Exp. Zool. (Mol. Dev. Evol.)300B:58–71, 2003. r 2003 Wiley-Liss, Inc.

INTRODUCTION

Heliocidaris tuberculata and H. erythrogrammaare congeneric sea urchins that diverged approxi-mately four million years ago (Zigler et al., 2003).H. tuberculata is an indirect-developing specieswith a pluteus larva that has skeletal-rod-sup-ported ciliated arms, a mouth, and an anus. Anadult rudiment forms in the pluteus and meta-morphosis occurs at about six weeks. The pluteusis the primitive larval form in sea urchins(Strathmann, ’78), and the majority (80%) ofechinoids are indirect developers (Raff, ’87; Emletet al., ’87). In contrast, H. erythrogramma is adirect developer with a non-feeding larva. Struc-tures of the pluteus involved in feeding have beenlost, and development of the adult is accelerated(Raff, ’96). Metamorphosis occurs four days afterfertilization.A crucial difference between H. tuberculata and

H. erythrogramma is that the ectoderm of the H.

tuberculata larva differentiates into oral andaboral ectoderm, whereas the H. erythrogrammalarva lacks oral ectoderm (Nielsen et al., 2000).The extra-vestibular ectoderm that makes upmost of the surface of the H. erythrogramma larvais likely aboral in its evolutionary origin (Raff andSly, 2000). Oral ectoderm plays a vital role inpatterning the pluteus, particularly the larvalskeleton, which is secreted by the primary me-senchyme cells (PMCs) that migrate into theblastocoel during gastrulation (Okazaki, ’75a). Arole for ectoderm signaling was shown to beessential in regulating skeleton formation in thepluteus (Ettensohn and Malinda, ’93; Guss andEttensohn, ’97; Armstrong et al., ’93). In indirect

Grant support: NSF; Grant number: IBN–0234576 to R. A. R.*Correspondence to Dr. Rudolf A. Raff, 150 Myers Hall, 915 E.

Third Street, Bloomington, IN 47405. E-mail: rraff@bio.indiana.eduReceived 12 August 2003; Accepted 30 October 2003Published online in Wiley InterScience (www.interscience.wiley.

com). DOI: 10.1002/jez.b. 00046

r 2003 WILEY-LISS, INC.

JOURNAL OF EXPERIMENTAL ZOOLOGY (MOL DEV EVOL) 300B: 58–71 (2003)

developing species, the homeodomain containinggenes Msx and Orthopedia (Otp) are expressed inrestricted regions of oral ectoderm, and areinvolved in signaling skeletogenesis (Dobias et al.,’97; Tan et al., ’98; Di Bernardo et al., ’99). H.erythrogramma lays down a rudimentary larvalskeleton oriented to the larval axes, followed byaccelerated development of adult skeletal ele-ments (Emlet, ’95) (Fig. 1).The skeleton of the pluteus is produced by

primary mesenchyme cells (PMCs). These aredescendants of the micromeres, four small cellsat the vegetal pole segregated at the 16–cell stageby an unequal cell division. The PMCs ingress intothe blastocoel and migrate along the wall of theblastocoel. During gastrulation, they form a ringof cells around the archenteron, and fuse witheach other to form a cable-like syncytium (Hodorand Ettensohn, ’98). Two groups of PMCs formventrolateral clusters along the ring at theboundary between oral and aboral ectodermterritories. Skeletogenesis initiates within thesetwo clusters and produces a triradiate spicule ineach cluster. The two spicules grow into skeletonrods by elongating and branching, and eventuallyform the entire bilateral larval skeletal system(Fig. 1A; Okazaki, ’75b).Ectodermal signals to the PMCs affect several

steps in skeletogenesis (Ettensohn et al., ’97),including migration of the PMCs to target sites(Harkey and Whiteley, ’80; Malinda and Etten-sohn, ’94), the formation of the two-triradiatespicules (Ettensohn, ’90), local control of skeletonrod structure, elongation rate, and the size of the

skeleton (Ettensohn, ’90; Ettensohn and Malinda,’93; Armstrong and McClay, ’94; Amstrong et al.,’93). Lastly, an ectoderm signal is responsible forthe regulation of levels of expression of PMC-specific mRNAs (Guss and Ettensohn, ’97). Genesencoding the transcription factors MSX and OTPin the oral ectoderm are involved in the generationof these signals (Dobias et al., ’97; Tan et al., ’98;Di Bernardo et al., ’99). The oral ectoderm hasbeen lost in H. erythrogramma, so it is not knownif genes expressed in the oral ectoderm of indirectdevelopers play similar roles in H. erythrogramma,and if skeleton formation in the direct developerH. erythrogramma is regulated in the same way asindirect developers.

Skeletogenesis has been modified considerablyin H. erythrogramma. Over 2,000 mesenchymecells ingress into the blastocoel at late blastulastage, vs. 32 cells for H. tuberculata (Parks et al.,’88). Mesenchyme cells do not form a ring pattern,and only a remnant skeleton is formed. Two pairsof triradiate spicules are formed, one afteranother, in the larva considerably later than thefirst spicule formation in H. tuberculata (Emlet,’95). One pair of spicules becomes fenestrated(Fig. 1B). These spicules are inferred to behomologous to the reduced form of skeleton rodsfound in pluteus. The initiation of expression ofthe msp130 gene involved in skeletogenesis isdelayed in H. erythrogramma. The delay isregulated by changes in trans-acting factorscontrolling expression of this gene (Klueg et al.,’97). At about two days after fertilization, numer-ous spicules that contribute to the adult skeletonhave begun to form. The pentameral pattern ofadult skeleton is distinctly different from thelarval skeleton, and is composed mainly of testplates and spines. It is not known if an ectodermalsignal plays a role in keletogenesis in H. erythro-gramma larva.

One component of the signaling process where-by the oral ectoderm regulates skeletogenesis is ahighly conserved homeobox-containing transcrip-tion factor, Otp. Otp is expressed in the developingCNS and sensory tissues in a number of phyla(Wang and Lufkin, 2000; Simeone et al., ’94; Linet al., ’99; Umesono et al., ’99; Nederbragt et al.,2002). The Otp homolog was cloned from a seaurchin species Paracentrotus lividus (Di Bernardoet al., ’99). PlOtp has a unique and highlyrestricted expression pattern. PlOtp transcriptswere first detected by whole-mount in situhybridization at the mid-gastrula stage, whenPlOtp is expressed in two pairs of oral ectoderm

Fig.1. H. tuberculata and H. erythrogramma 2-day oldlarvae showing larval skeletal elements. (A) Early pluteus ofH. tuberculata, showing typical 4–arm pluteus skeleton. (B)Early larva of H. erythrogramma viewed by polarized lightshowing four remnant larval skeletal elements. The H.erythrogramma larva was slightly crushed for better view ofskeleton.

EVOLUTION OF SKELETAL PATTERNING 59

cells that overlie the PMC ventrolateral clusters.The cells expressing PlOtp increase in number asdevelopment proceeds, exhibit left/right symmetryand a restriction to oral ectoderm. At the earlypluteus stage, PlOtp transcripts are found adja-cent to the site where the oral arms will bud offand near the tips of the budding anal arms, whereskeletal rods grow actively. In NiCl2–treatedembryos, PlOtp expressing cells are increased innumber and adopt a radialized pattern.Skeleton pattern was severely affected when

PlOtp mRNA was injected into P. lividus eggs (DiBernardo et al., ’99). PlOtp-injected embryos forma radial skeleton, which initiates at multiple sitesinstead of the two seen in normal embryos.Injection of myc-tagged PlOtp mRNA showed thatPlOtp protein was expressed uniformly in radia-lized embryos.As the oral ectoderm has been lost in the

evolution of H. erythrogramma, we asked if therole of Otp was conserved in skeletogenesis, and ifso where it was expressed. In this study the Otpgene was cloned from H. tuberculata and H.erythrogramma. It is a single copy gene in bothspecies. The expression pattern of Otp in H.tuberculata is like that seen in P. lividus.Misexpression of PlOtp in H. tuberculata radia-lized the embryos as it does in P. lividus. However,expression of Otp was undetectable by in situhybridization in H. erythrogramma, and micro-injection of PlOtp did not cause any visibleabnormality in larval development in H. erythro-gramma. These results suggest that H. erythro-gramma has lost the skeletogenic role for Otp, andhas evolved a new larval skeletal patterningmechanism.

MATERIALS AND METHODS

Embryo culture, fixation, and embedding

H. tuberculata and H. erythrogramma werecollected near Sydney, N. S. W., Australia, andinduced to spawn by intracoelomic injection of0.55 M KCl. Eggs were collected in filtered seawater (FSW) and rinsed three times with FSW.Sperm were collected ‘‘dry’’ and stored at 41Cuntil diluted with FSW for fertilization of eggs.Embryos were cultured at 20–231C. Embryos werefixed in 2% paraformaldehyde in FSW for 2.5hours, rinsed in 0.56M NaCl twice, dehydratedthrough a series of 30%, 50%, and 70% ethanoland stored in 70% ethanol. Fixation in glutaralde-hyde was done as described by Angerer andAngerer (’91).

RNA isolation

RNA was isolated from embryos using guanidi-nium thiocyanate RNA extraction method asdescribed by Chomcynski and Sacchi (’87).

Southern blotting

Genomic DNA was prepared from sperm asdescribed by Bisgrove and Raff (’93). DNA wasdigested by EcoRI, HindIII, or XbaI. Gels wereblotted to nylon membrane (Nytran, Schleicher,and Schuell) by capillary transfer (Sambrook et al.,’89). Templates for probes were made by PCRusing primers, Nest 3’ 621 and 3’OTP rt 4/22/01(Table 1) . H. erythrogramma Otp cDNA was usedas template for the PCR. Probe was labeled with32P by random priming. Hybridization of probesto blots was done over night at 391C in the bufferdescribed by Haag and Raff (’98). Wash stringencywas to 0.5�SSC/0.1% SDS at 651C.

Cloning and reverse-transcriptionpolymerase chain reaction (RT-PCR)

To obtain full-length Otp coding sequence, RT-PCR was performed using Qiagen OneStep RT-PCR Kit, using H. tuberculata 28hr RNA and H.erythrogramma 48hr RNA. RNA templates weretreated with DNaseI (Tokoya) prior to the RT-PCRreaction. The 5’primer, 5’XRT4/10 (Table 1), wasdesigned according to the sequence of PlOtp,including a start codon and 16bp of PlOtp 5’UTR.The 3’primers were designed according to thesequence of an H. erythrogramma Otp clone(including partial coding sequence and 3’UTR).The 3’primer was made to a region of H.erythrogramma 3’UTR 50bp downstream of thestop codon. The 3’primer used for H. tuberculata,3’XRT4/22 (Table 1), is immediately upstream ofthe stop codon. Otp sequences are accessibleonline. The Genbank accession numbers for HeOtpare AY 452139 and AY 452141; the GenBankaccession number for HtOtp is AY 452140.

Quantitative RT-PCR was done using QiagenOneStep RT- PCR Kit with primers, qutRT64fand 3’OTPrt4/22/01 (Table 1). H. erythrogrammaOtp cDNA was used as template for PCR withprimers, qutRT64f and qutRT8/1/02, producing afragment truncated from HeOtp by 107 bases(Table 1). The PCR product was inserted into T-easy vector (Promega), and linearized to serve astemplate to make control RNA by in vitrotranscription using the MaxiScript Kit (Ambion).RT-PCR products were analyzed on a 1% agarosegel, stained in 0.5 ag/ml ethidium bromide, and

N. ZHOU ET AL.60

destained with double distilled water. Gel imageswere taken by Polaroid MP4 Land Camera,scanned using UMAX PowerLook III scanner,and saved as JPEG files. The densities of DNAbands were quantified using NIH image software.The ratio of the densities of DNA bands obtainedfrom target and control RNA was calculated andplotted by Microsoft Excel.

To obtain copy number of Otp mRNA in totalRNA, the amount of target RNA in 100ng of totalRNA was divided by the molecular weight of thetarget RNA, which gives the moles of target RNA.The molecular weight was obtained by multiplyingthe number of bases in target RNA by 340 daltons/base (Ausubel et al., ’88). Moles of RNA isconverted to copy number by multiplying byAvagadro’s number (6.022� 1023). The copy num-ber of target RNA equals the copy number of OtpmRNA.

In situ hybridization

Whole-mount in situ hybridization for H. tuber-culata was performed using digoxigenin (DIG)labeled RNA probes following Wilson and Raff(unpublished observations). The color reactiontest to detect alkaline phosphatase activity wasdone with NBT and BCIP (Roche). Probes weremade by in vitro transcription using linearizedclones, which contain DNA fragments generatedby PCR using primers 5’OTPrt4/22/01 and3’OTPrt4/22/01 (Table 1), with H. tuberculatagenomic DNA as template. In situ hybridizationof H. erythrogramma on sections followed themethod described by Angerer and Angerer (’91),as modified for H. erythrogramma (Kissinger andRaff, ’98). Glutaraldehyde-fixed and paraffin-em-bedded embryos were serially sectioned into 8mmsections.

Linearized templates containing the full-lengthOtp coding sequence were used to generate probeslabeled by 33P-UTP to a specific activity of 1�109cpm/mg using the Maxiscript kit (Ambion). Sec-tions were viewed using dark and light fieldmicroscopy (Axioplan, Zeiss), and images capturedwith a Sony 3ccd digital camera.

Otp constructs

Myc-tagged Otp was generated by PCR with theprimers, MYCf10/16 and 3’XRT4/10 (Table 1),using H. erythrogramma Otp cDNA as template.The PCR product was inserted into pGEM Teasyvector (Promega), and excised by EcoRI, theninserted into pCMV-Tag3A expression vector

TABLE1.

Primer

Seque

nces

Primer

Nam

eOrigin

Primer

Sequ

ence

Nest3’621

H.

eryt

hro

gra

mm

aO

tp5’-G

TCAGGACACACGAGGC-3

3’OTPrt

4/22/01

H.

eryt

hro

gra

mm

aO

tp5’-CGGTCACGGGAGATTCG-3’

5’OTPrt

4/22/01

H.

eryt

hro

gra

mm

aO

tp5’-G

AACCGCAGAGCCAAGTG-3’

5’XRT4/10

P.

livid

us

Otp

5’GGGTA

TCTTTGATA

GGATG

3’3’XRT4/10

H.

eryt

hro

gra

mm

aO

tp5’-ATGCAGAAATCAGCAACGC-3’

3’XRT4/22

H.

eryt

hro

gra

mm

aO

tp5’-CTGAAGATA

CCGTTGAGCG-3’

qutR

T64

fH

.er

yth

rog

ram

ma

Otp

5’-G

GTGGATTGGATA

ATA

CG-3’

qutR

T8/1/02

H.

eryt

hro

gra

mm

aO

tp5’-CGGTCACGGGGAGATTCGGAGAGCGTGTTGAGACCC-3’

MYCf10/16

H.

eryt

hro

gra

mm

aO

tpwithMyc

tag

5’-ATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAAATGGAGCGTA

CTCTCGCC-3’

ENG/E

co/F

H.

eryt

hro

gra

mm

aO

tpwithNLS

5’-CGGAATTCCTTCATTCAAGTCCTCTTCAGAAATGAGCTTTTGCTCCATCTTGCGCTTCTTCCACTT-3’

ENG/E

co/R

H.

eryt

hro

gra

mm

aO

tpwithMyc

tag

5’-CGGAATTCCTTCATTCAAGTCCTCTTCAGAAATGAGCTTTTGCTCCATCTTGCGCTTCTTCCACTT-3’

VP16f10/16

H.

eryt

hro

gra

mm

aO

tpwithMyc

tag

5’GCCTCTA

GAAATGGAGCAAAAGCTCATTTCTGAAGAGGACTTGAATGAACAGAAGCGACATCGAACC-3’

CONr10/16

H.

eryt

hro

gra

mm

aO

tpwithNLS

5’-G

CTCTA

GATTA

TACCTTA

CGCTTCTTCTTTGGAGCCATCTTGCGCTTCTTCCACTT-3’

EVOLUTION OF SKELETAL PATTERNING 61

(Stratagene), which carries a Myc-tag. The plas-mid was linearized by MluI, and in vitro tran-scription was carried out using mMessagemMachine kit (Ambion). To make an Engrailed-Otp fusion construct, a DNA fragment encodingthe Otp homeodomain was generated by PCR withENG/Eco/F and ENG/Eco/R (Table 1) as primers,and H. erythrogramma Otp cDNA as template. Anuclear localization signal (NLS) was included inthe forward primer and a Myc tag in the reverseprimer (Li et al., ’99). PCR products were digestedwith EcoRl and inserted in frame into EcoRIdigested pCS2-ENG-N vector, which has an En-grailed repressor domain (Kessler, ’97). TheEngrailed-Otp fusion was transferred to pCMV -Tag3A vector, and linearized by MluI, serving astemplate for making mRNA by the mMessagemMachine kit.To generate the VP16–Otp construct, a DNA

fragment encoding the Otp homeodomain asgenerated by PCR with VP16f10/16 and CONr10/16 (Table 1) as primers, and H. erythrogrammaOtp cDNA as template. The Nuclear localizationsignal (NLS) was included in the reverse primerand Myc tag was included in the forward primer(Li et al., ’99). The PCR product was digested withXbal and inserted in frame into XbaI digestedpCS2–VP16–N, which has an VP16 activatordomain (Kessler, ’97). The plasmid was linearizedwith NotI, and served as template to make mRNAby mMessage mMachine kit.

Microinjection of mRNA

The microinjection of mRNA into H. erythro-gramma eggs followed the method described byKauffman and Raff (unpublished observations).The concentration of mRNA injected was 0.5–1mg/ml. The microinjection of mRNA into H. tubercu-lata eggs followed the method of Cameron et al.,(’96). The concentration of mRNA injected was200ng/ml.

Immunocytology

The immunostaining of H. tuberculata was donein whole mount (Stander,’99). Fixed embryos wererehydrated and washed three times in PBT(20mM Na2HPO4, 140mM NaCl, 0.1% Tween–20,pH 7.2). Embryos were blocked in 10% normalgoat serum (NGS; Sigma) in PBT for one to threehours at room temperature. Mouse anti-MSP130(B2C2 hybridoma supernatant, Leaf et al., ’87),was diluted 1:100 in 10% normal goat serum inPBT and incubated with the embryos for one to

two hours at room temperature or at 41C over-night. After three washes in PBT, the secondaryantibody, a goat anti-mouse conjugated to fluor-escein (HyClone), was diluted (1:100) and incu-bated with embryos for one to two hours at roomtemperature. After three washes in PBT, theembryos were mounted in Aquapolymount (Poly-sciences) and the samples were viewed the nextday using a Bio-Rad MRC–600 laser scanningconfocal fluorescence microscope.

To recover Myc epitopes, 8mm H. erythrogram-ma sections were dewaxed and rehydrated. Anti-gen heat retrieval was performed by boilingsections in 0.01M citrate buffer (PH 6.0) using a1.25kw microwave oven. Three boiling cycles wereused, five minutes each, at 80%, 30%, and 30%power level respectively (Taylor et al., ’96). Aftercooling for 30 minutes, sections were rinsed inPBT or TMB (0.04M Tris-HCl, 0.05M Na2S2O5,0.14 M NaCl, 0.1% Triton X–100, pH 7.5) threetimes. Embryos were blocked in 10% normal goatserum (NGS; Sigma) in PBT or TMB for one totwo hours at room temperature. Mouse anti-MSP130 (diluted 1:100) or anti-c-Myc antibody(Zymed, diluted 1:500) in 10% normal goat serumin PBT or TMB and incubated with the embryosfor one to two hours at room temperature.After three washes in PBT or TMB, secondaryantibody, conjugated to alkaline phosphatase(Zymed), was diluted (1:100) and incubated withembryos for one to two hours at room tempera-ture. Sections were washed three times in PBT orTMB. Color reaction to detect alkaline phospha-tase activity was done with NBT and BCIP(Roche). The color reaction was 20 minutes withanti-MSP130 antibody, and 18 hours with anti-c-Myc antibody.For general tissue staining, paraformaldehydefixed H. erythrogramma were embedded inparaffinand sectioned. The resulting 8mm sections werestained by eriochrome cyanin (Chapman, ’77).

RESULTS

Heliocidaris Otp genes

cDNA sequences of Otp from H. tuberculata andH. erythrogramma are 96% identical for the first230 base pairs and 99% for the rest of the gene(data not shown). The protein sequences of OTPfrom the two Heliocidaris species are identical,and Heliocidaris OTP protein is 96% identical toPlOTP. The homeodomain, the 12 amino acidsimmediately downstream of the homeodomain,and the OAR domain are highly conserved in Otp

N. ZHOU ET AL.62

of different species (Simeone et al., ’94; Galliotet al., ’99). The three conserved domains inthe OTP proteins of sea urchin species arecompared with those domains in the OTP proteinsof other taxa (Mus, Drosophila, Danio). It appearsthat only five amino acids of the homeodomainare changeable across several phyla. The home-odomains of the two sea urchin OTP proteins(Heliocidaris and Paracentrotus lividus) areidentical, and four amino acids different fromthe homeodomain of either mouse or fly. The 12amino acids immediately downstream of home-odomain are identical in OTP of Heliocidaris,Paracentrotus. Fly and mouse OTP differs fromthem by two amino acids. In the OAR domain, onedeletion/insertion was found between Heliocidarisand Paracentrotus OTP; the OAR domain ofHeliocidaris is identical to that of mouse andzebrafish.

Otp gene number and expression

Otp is a single-copy gene in both H. tuberculataand H. erythrogramma, and possibly two copies inStrongylocentrotus purpuratus (Fig. 2A). Otptranscrips were not detectable in the egg orblastula stage (Fig. 2C). In H. uberculata, Otp isexpressed in the late gastrula stage, and persists inthe prism, two-day and three-day pluteus. In H.erythrogramma, Otp expression begins by the lategastrula stage (28 hours), and continues in two-day and three-day larva.

Otp transcript localization inH. tuberculata larva

At the late gastrula stage of H. tuberculata, Otptranscripts are expressed in two cells, one on eachside of the archenteron, exhibiting left-rightsymmetry (Fig. 3A, D). At the early pluteus stage,the number of cells expressing Otp increases tofour (Fig. 3H), with some embryos, in the transi-tion from gastrula to prism, expressing Otp inthree cells (Fig. 3E). The Otp-expressing cells arelocated in the oral ectoderm (Fig. 3G), as reportedin P. lividus (Di Bernardo et al., ’99). At thepluteus stage, Otp-expressing cells are found atthe tips of the growing arms (Fig. 3C, F, I). Asstained cells increase in number, they are stillrestricted to oral ectoderm, and are symmetricabout the left-right axis. There is no staining incontrol embryos hybridized to a sense probe (datanot shown).

Otp Mis-expression and PMC Patterning inH. tuberculata Larva

Mis-expression of PlOtp mRNA in H. tubercu-lata causes defects in embryonic development.Most embryos are radialized from the gastrulastage on. Control embryos injected with dyedevelop normally. In many of the radialized

Fig. 2. Gene number and expression of Otp. (A) Southernblot of DNA from sperm of H. erythrogramma (He), H.tuberculata (Ht), and Strongylocentrotus purpuratus (Sp)digested with EcoRI (R), HindIII (H), XbaI (X). (B) Thestructure of full-length coding Otp cDNA (1092 bp) and aregion 3’ of the homeodomain used as the probe for theSouthern blot (350 bp). (C) Otp expression during embry-ogenesis shown by developmental RT-PCR. H. erythrogram-ma: E1, unfertilized egg; E2, blastula; E3, late gastrula /earlylarva (28hr); E4, two-day larva; E5, three-day larva. (Meta-morphosis is at 3.5 – 4 days). H. tuberculata: T1, unfertilizedegg; T2, blastula; T3, late gastrula; T4, prism (28hr); T5, two-day pluteus; T6, three-day pluteus. L, ladder. The arrowsindicate 500bp and 400bp bands in the ladder. The size of theRT-PCR product is 479bp, 28 cycles.

EVOLUTION OF SKELETAL PATTERNING 63

embryos, skeletogenesis initiates from three trir-adiate spicules, instead of the normal two. At 41hours after fertilization, the spicules elongatearound the archenteron, and start to branch(Fig. 4A, B). By 48 hours, the random branchingof the skeleton distorts the shape of some embryos(Fig. 4E), and some embryos develop morebilaterally symmetric skeletons (Fig. 4D). By thistime injected PlOtp mRNA may have decayed,allowing some release from the radialized pheno-type. However, even after 66 hours of develop-ment, a large number of injected embryos stillremained spherical, with some branching of theradial skeleton and some fenestration (Fig. 4G, H).The location of PMCs in PlOtp injected embryoswas examined by performing immunostainingusing an anti-MSP130 antibody, which stainsPMCs specifically. As shown in Fig. 4J, K, PMCsrevealed a radialized pattern. Most were arrangedaround the archenteron and at the animal pole ofthe embryo.

Otp localization in the H. erythrogrammalarva

In situ hybridization was performed on H.erythrogramma sections using radioactive probes.Serial sections hybridized with anti-sense probeshowed that grains are evenly distributed (Fig. 5B),and expression is at background level. There is nosignificant difference in the density of grainsbetween the sections hybridized with sense andanti-sense probes (Fig. 5B, D). The experiment wasperformed four times with identical results, in-dicating that there is no enrichment of Otp mRNAin a few cells as observed in indirect developers.

Mis-expression of Otp inH. erythrogramma larva

Unlike H. tuberculata, we observe no defectsin embryonic development when PlOtp mRNAis microinjected into H. erythrogramma eggs.

Fig. 3. Otp transcript localization in H. tuberculata larvadetected by whole-mount in situ hybridization. (A, D).Lateral-view of gastrula stage embryos, showing staining intwo cells, one on each side of the archenteron. (B, E) Lateral-view of gastrula/prism transition stage embryos, showingstaining in three or four cells. (G) Prism stage embryo viewedalong the animal-vegetal axis, showing that stained cells are inthe oral ectoderm (top). (H) Prism stage embryo, oral sideview, showing staining in four cells. (C, F, I). Pluteus stageembryos, showing stained cells in the oral ectoderm. The redarrows point to the expression at the arm tips. The bluearrows point to the mouth of the embryos. The black arrowindicates non-specific staining.

Fig. 4. Otp mis-expression and PMC patterning in the H.tuberculata larva. Eggs were injected with PlOtp mRNA andfertilized. Embryos were observed 41 hours (A, B), 48 hours(D, E), and 66 hours (G, H) after fertilization. The controlembryos were injected with dye, fertilized, and observed 41hours, 48 hours (F), and 66 hours (I) after fertilization.Skeletons were view under polarized light. Immunostainingby anti-MSP130 antibody showing localization of PMCs inPlOtp injected (J, K) and control embryos (L) 48 hours afterfertilization.

N. ZHOU ET AL.64

Embryos injected with PlOtp mRNA developidentically to control embryos injected with dye.Embryos injected with PlOtp mRNA appearnormal in external shape, and the larval (Fig.6A, B) and adult skeleton develop normally. Thereis no delay in timing of skeletogenesis nor are anysupernumerary spicules observed. The internal

structures of sectioned embryos are normal, andthe adult rudiment develops normally (Fig. 6C).

To determine whether the injected mRNA isexpressed and translated into protein in H.erythrogramma embryos, Myc-tagged full-lengthcoding H. erythrogramma Otp mRNA was micro-injected into H. erythrogramma eggs. The injec-tion did not cause any defects in larvaldevelopment (data not shown). Immunostainingwith an anti-Myc antibody indicates that mostof the ectoderm cells exhibit nuclear staining

Fig. 5. Otp localization in the H. erythrogramma larva. Insitu hybridization on sections using 33P labeled anti-sense (A,B) and sense (C, D) probes. (A, C) brightfield images, (B, D)darkfield images. The dark patch in (A, lower right) and thebright patch in (B, lower right) are artifacts and not present inadjacent sections.

Fig. 6. Mis-expression of Otp mRNA in the H. erythro-gramma larva. (A, B) H. erythrogramma embryos wereinjected with PlOtp mRNA (A) or dye (B), fertilized andobserved 48 hours after fertilization. Embryos were lightlycrushed to better view skeletal elements in polarized light.The skeletal structures are remnant larval arms (Emlet, ’95).(C) 48–hour PlOtp injected H. erythrogramma embryos werefixed, embedded, sectioned, and stained, one section is shownin lateral view. (D, E, F, G). Immunostaining by anti-Mycantibody was performed on Myc-tagged Otp mRNA injected(D, F) and non-injected (E, G) 26–hour H. erythrogrammaembryos. Whole sections are shown in (F, G), and part of theectoderm is shown in (D, E), nuclear staining (n) is observed in(D) and not in (E). (H, I) Immunostaining using anti-MSP130antibody was done on Engrailed-Otp fusion mRNA injected64–hour (F) and noninjected 69–hour (G) H. erythrogrammaembryos. The two sections are at 90 degree to each other. (H) alateral view. (I) a face on view. g ¼ gut; hy ¼ hydrocoel; n ¼nuclear; sp ¼ spine; tf ¼ tube foot; v ¼ vestibule.

EVOLUTION OF SKELETAL PATTERNING 65

(Fig. 6D), consistent with accumulation of thetranscription factor OTP protein in the nuclei.Uninjected control embryos show no detectablenuclear staining (Fig. 6E).Expression constructs using the Otp homeodo-

main were made with either the VP16 activatordomain (Triezenberg et al., ’88) or the Drosophilaengrailed repressor domain (Han and Manley, ’93;Badiani et al., ’94; Kessler, ’97). Otp is atranscriptional activator (Simeone, ’94). Microin-jection of the mRNA transcribed from thoseconstructs into H. erythrogramma eggs shouldmimic either Otp knockout (Engrailed- Otp) orover-expression (VP16–Otp). Injection of either ofthe constructs caused no defects in embryonicdevelopment. Immunostaining with anti- MSP130antibody was performed on embryos injected withEngrailed- Otp fusion mRNA. The injected em-bryos showed the same staining pattern as con-trols (Fig. 6E, F), with moderate msp130 staininginside the tube feet and dark staining in thespines.

Quantitation of Otp mRNA in embryos

A quantitative measurement of Otp expressionwas performed on prism stage H. tuberculata and28–hour early H. erythrogramma larval RNAsamples. For quantifying mRNA, a defined quan-tity of internal control RNA was added to a knownamount of total RNA, which was used as templatefor RT-PCR reaction. The resulting control cDNAwas co-amplified with the same primers as theendogenous target RNA (part of the Otp mRNA).The control cDNA is about 100bp smaller than thecDNA amplified from the target RNA. The ratio ofthe density of the two bands on gels represents theratio of the amount of the two PCR products.Since the amplification efficiency is identical forboth the control and the target RNA in one tube,the input amount of the two RNA templates areequal when the amount of the two PCR productsare equal (Siebert and Larrick, ’92; Gilliland et al.,’90; Nedelman et al., ’92).The cDNA template for making control RNA

was obtained by PCR using a 3’primer designed sothat the control RNA has an internal deletioncompared with target RNA (Fig. 7A). To quanti-tate Otp mRNA, we performed a series of RT-PCRreactions by adding 200ng total RNA and differentamounts of control RNA in each reaction (Fig. 7B).We plotted logs of the ratios of target to controlband density values against the logs of the amountof control RNA added to the reactions (Fig. 7C). A

Fig. 7. Quantitation of Otp mRNA in embryos. (A)Structure of full-length coding Otp mRNA, the position ofthe target RNA (the part of Otp mRNA amplified by RT- PCR)in Otp mRNA, and the construction of control RNA using 5’and 3’ primers. (B) Image of an agarose gel showing theresults of the RT-PCR using 200ng H. erythrogramma RNA(28hr) and different amount of control RNA as template. Lane1, ladder (arrows showing 1000bp and 850bp bands); Lane 2,0.1 pg of control RNA; Lane 3, 0.05pg; Lane 4, 0.025pg; Lane 5,0.0125pg; Lane 6, 0.00625pg. The cycle number was 35. Thesizes of the two products are 904bp (from target RNA) and797bp (from control RNA). (C) A plot by Microsoft Excel basedon the RT-PCR reaction with H. erythrogramma RNA (28hr)and different amounts (0.1, 0.05, 0.025, 0.0125, 0.00625pg) ofcontrol RNA as template. The logs of the ratios of target tocontrol band density versus the logs of the amounts of inputcontrol RNA. The trend line and the R square value areshown. (D) The table showing the results of the amount andcopy number of RNA. Numbers are presented in the form of‘‘Average 7 Standard Deviation’’ based on three trials ofRTPCR.

N. ZHOU ET AL.66

trend line was obtained for the plot. When the yvalue equals zero, the ratio is 1:1. The x value isthe log of the amount of the control RNA thatequals the amount of target RNA input in thereaction, 200ng total RNA (Celi et al., ’93;Schneeberger et al., ’95). We calculated the copynumber of Otp mRNA in 200ng of total RNA.Knowing the amount of total RNA per embryo,3.85ng for H. tuberculata and 123ng for H.erythrogramma (Wilson and Raff unpublishedobservations), the copy number of Otp mRNAper embryo can also be calculated. We calculatedthe copy numbers of Otp mRNAs per cell based onthe in situ hybridization result that Otp tran-scripts are observable only in four cells in H.tuberculata at prism stage, and that the Otptranscripts are equally distributed (at very lowconcentration) in every cell in H. erythrogrammaat late gastrula stage. The number of cells in lategastrula stage H. erythrogramma is 20,000 to30,000 (Parks et al., ’88). The calculations showthat there are 266 copies of Otp mRNA per Otp-expressing cell in H. tuberculata, and a very lowlevel of one copy per cell in H. erythrogramma(expression is calculated for total cell number asno localization was observed) (Fig. 7D).

DISCUSSION

There are dramatic differences in expressionpatterns and testable functions of Otp in theindirect developer H. tuberculata and in thederived direct-developing ontogeny of H. erythro-gramma. Otp is expressed in H. tuberculata at adetectable level from late gastrula stage onwardsand in sites of expression that agree with thosereported for Otp in P. lividus (Di Bernardo et al.,’99). These expression sites correlate with initia-tion of skeleton formation. At the late gastrulastage, expression of Otp is in the ventrolateralregion in two ectodermal cells that lie over the sitewhere the two clusters of PMCs (ventrolateralclusters) collect and formation of the larvalspicular skeleton begins. In the pluteus, Otp isexpressed in arm tips, where the skeleton rodsgrow actively. In P. lividus, signals from the oralectoderm are responsible for initiating skeletogen-esis in ventrolateral PMCs. We tested for thatfunction in H. tuberculata by injection of OtpmRNA, and observed a conserved involvement ofOtp in skeleton formation of H. tuberculata, whichundergoes the same skeletal radialization pre-viously demonstrated in P. lividus by Di Bernardoet al. (’99). Skeletogenesis initiates from super-

numerary spicules, instead of the two observed innormal embryos, and the pattern of PMCs isdisrupted. This result suggests that mis-expres-sion of Otp disrupts skeleton formation by affect-ing the role of oral ectoderm cells in PMCpatterning in H. tuberculata. Similar skeletaldevelopment defects also have been observed inNiCl2–treated embryos (Hardin et al., ’92, Minsukand Raff, unpublished observations). Overall, therole of Otp in patterning skeletal initiation in H.tuberculata shows that this mechanism is con-served in pluteus development over the 45–50 mythat separate H. tuberculata from P. lividus. Theconserved mechanism among indirect developersserves as a basis for examining the effects of loss ofmodules in change of developmental mode in H.erythrogramma, which diverged relatively rapidlyfrom H. tuberculata approximately four mya(Zigler et al., 2003).

Profound changes have taken place as part ofthe evolution of direct development in the H.erythrogramma lineage despite its relatively shorttime of divergence from H. tuberculata. Losses ofpluteus larval features as well as gains of novelmaternal features have occurred (Raff et al., ’99).For this study, the key changes lie in twointeracting components. The first is the extensivemodification of the mesenchymal skeletogenicpatterning system. In H. erythrogramma theseinclude a vast increase in number of primarymesenchyme cells (Parks et al., ’88), reduction insize of rudimentary larval skeletal elements(Emlet, ’95), and pronounced acceleration offormation of adult skeletal elements (Parks et al.,’88). The second interacting component is the oralectoderm, and its Otp- expressing cells. The oralectoderm module is conserved in H. tuberculata,and retains gene expression patterns and func-tions that are highly similar to those reported forindirect-developing sea urchins of other families(Wilson et al., unpublished observations).

Evolutionary loss of an overtly differentiatedoral ectoderm represents the loss of a majordevelopmental module of indirect-developing seaurchins (Raff, ’96; Raff and Sly, 2000). Themodifications to both PMCs and oral ectodermmodules in H. erythrogramma represent largechanges in larval ontogeny, and have taken placein no more than the approximately four my thatseparate the two Heliocidaris species. Develop-mental modules are characterized by a number offeatures, including unique patterns of gene ex-pression, and the ability to evolve (Raff, ’96;Wagner, ’96). Gene regulatory networks for such

EVOLUTION OF SKELETAL PATTERNING 67

modules are beginning to be defined. Davidsonet al. (2002) have defined the gene regulatorynetwork of the vegetal plate-derived endo-meso-dermal territories in the indirect developing seaurchin S. purpuratus. It is likely that analogousgene regulatory networks underlie the differentia-tion and function of other embryonic modules,such as the aboral ectoderm. The evolutionary lossof a developmental module means the dissipationof the regulatory network in the descendantontogeny. It does not mean that individual genesare necessarily lost, nor does it mean thatinteractions carried out by the lost module withother modules in the embryo are necessarilyeliminated (Raff, ’96). The fates of genes andfunctions that are parts of lost regulatory net-works have to be investigated on an individualbasis. Several fates are possible: elimination of agene altogether, elimination of its embryonicexpression with retention of its function in someother module or stage in development, eliminationof a part of its overall embryonic expression, andfinally, co-option of expression and function into anovel module with gain of a concomitant novelexpression pattern. We are exploring the fates oforal-ectoderm expressed transcription factorgenes to seek major effect genes in the evolutionof a novel developmental mode, and to ask howregulatory genes from an evolutionarily dissipatedmodule behave (Raff et al., 2003, this study;Wilson et al., unpublished observations). As shownin Table 2, the fates of genes involved in thecontrol of functions of modules of indirect-devel-oping sea urchin embryos vary. Some, Wnt–8, andTcf, are generally conserved in their roles (Kauff-man and Raff, 2003). Others, notably Msx and Gsc,which, like Otp, play major roles in the oralectoderm of indirect-developers, but have novel

sites of expression and function in H. erythro-gramma. It is already clear from other studies thatgenes downstream of module specific regulatorysystems can be lost. Thus, CyIII actin has becomea pseudogene (Kissinger et al., ’97) and EctoVprotein expression is lost (Raff et al., ’99). Otp is anintact and expressed gene, but we are unable todemonstrate an expression domain or function inH. erythrogramma embryos. Loss of oral ectodermand other feeding larval features is thus accom-panied by a complex set of gene regulatorychanges, not simply loss of gene expression (Fig.8).

The oral ectoderm-expressed transcription fac-tor encoding genes Msx and Gsc show changes inexpression pattern in H. erythrogramma, but arestill prominently expressed in the direct develop-ing embryo and larva, albeit in novel sites (Wilsonet al., unpublished observations). Mis-expressionand knockout studies of these genes show thatMsx and Gsc are dissociated in expression andfunction with the loss of the oral ectoderm.

However, they retain important functions in H.erythrogramma. These expression changes in Gschave been important in the evolutionary remodel-ing of larval forms. We draw a dramaticallydifferent conclusion from Otp, which illustrates adifferent evolutionary fate for a module-limitedregulatory gene in the evolution of larval mode.We were not able to detect the expression of Otp inH. erythrogramma by in situ hybridization,although it was shown by RT- PCR that Otptranscripts are present by late gastrula stage in H.erythrogramma. We found that the number of Otptranscripts per unit of H. erythrogramma totalRNA of late gastrula stage is close to that of H.tuberculata at prism stage.

As skeleton is being patterned by both species atthat time (Parks et al., ’88), we expected to find

TABLE 2. Regulatory gene function assessed in H. erythrogramma by RNAmicroinjection

Gene Mis-expression Knockout Roles comparedto H. tuberculata

Reference

Msx + nd di¡erent Wilson and Ra¡ unpub.Gsc + + di¡erent Wilson and Ra¡ unpub.Wnt8 + + same Kau¡man and Ra¡ ‘03Tcf + + same Kau¡man and Ra¡ ‘03SoxB21 + + di¡erent Kau¡man and Ra¡, unpub.Runt + nd di¡erent Nielson et al.‘03Otp - - lost this studyCyIII actin nd nd pseudogene Kissinger et al.‘97

+ microinjection of RNA causes abnormality to embryo development.- microinjection of RNA has no e¡ect on embryo development.- nd, not determined.

N. ZHOU ET AL.68

that the localization of Otp transcripts in H.erythrogramma would also be limited to a fewcells associated with the skeletogenic process.However, although the Otp transcripts weredetected in four cells in prism stage H. tuberculataoral ectoderm, in H. erythrogramma, Otp tran-scripts are diffused at very low levels per cell in thewhole embryo. We saw no cells with a concentra-tion of Otp mRNA in H. erythrogramma. Theradioactive in situ method is capable in sections ofH. erythrogramma of revealing single cells (e.g.primary mesenchyme cells) labeled with cell-specific probes (unpublished observations). Mis-expression of Otp in H. erythrogramma did notaffect skeleton formation, and no other abnorm-ality was observed in embryonic development. Alack of response might have been due to lack oftranslation of the injected mRNA into an OTPprotein. However, injection of a Myc antigentagged Otp mRNA into H. erythrogramma showsthat synthesis of the protein from the injectedmRNA takes place, and that the protein isproperly localized to the nuclei of injected em-bryos. Thus, failure to produce a phenotype doesnot arise from instability or failure of expressionof injected Otp mRNA. The possibility that H.erythrogramma embryos could be incapable of

radialization is eliminated by evidence fromNiCl2–treatment, which causes radialization.However, Otp mis -expression has no effect,suggesting that the radialization caused by theseagents is dissociable.

H. erythrogramma retains an intact Otp gene,which is likely required in later development ofneural or other adult tissues. However, loss of theoral ectoderm has been accompanied by a loss of arole of Otp in patterning of the relict larvalskeleton of H. erythrogramma. The relict larvalskeleton is made up of discrete elements with abilateral pattern (Emlet, ’95). This leaves us withthe interesting conclusion that patterning of thelarval skeleton in H. erythrogramma implicatesthe evolution of a new pathway not involving Otp.There is precedence for regulatory gene changes inwhich gene functions can change in development,but morphologically homologous features stillarise (Wray, ’99). Some examples show the likelyprevalence of evolution of regulatory systems,even among related animals. The gene bicoid,whose maternal transcripts pattern the anteriorregion of drosophilid fly embryos, is a recentlymodified Hox3 homolog incorporated into thisprocess. Other dipterans make heads without it(Stauber et al., 2002).

Analogously, the tailless gene functions differ-ently in beetles than in flies to determine elementsof posterior development (Schroeder et al., 2000).In nematodes, Jungblut et al. (2001) noted thatinduction of the homologous vulvas in two soilnematodes, Caenorhabditis elegans and Pris-tionchus pacificus differs in its cellular mechan-ism. In addition, several transcription factor genesplay different roles in formation of homologousvulva and sex muscle cells in the two species.

Finally, an enormous part of animal develop-ment requires signaling between modules of theembryo. A vast number of patterns arise fromthese inductive interactions, but only a fewsignaling pathways are involved, indicating anoverwhelming amount of co-option of signal path-ways into divergent patterning processes (Pires-daSilva and Sommer, 2003). It is possible that thepatterning of the relict larval skeleton of H.erythrogramma comes under the influence of alater patterning mechanism for adult skeletonthat may not involve Otp. As a result of a recentco-option event, skeletal patterning in H. erythro-gramma may thus lie downstream of a regulatorygene system distinct from the oral ectoderm-Otplinked signaling system of indirect-developingsea urchins.

Fig. 8. A diagram for loss (gray boxes) and gain ofdevelopmental features (black boxes) in the evolutionaryhistory of the three sea urchin species in which Otp has beenstudied. P. lividus and H. tuberculata are indirect-developers.

EVOLUTION OF SKELETAL PATTERNING 69

ACKNOWLEDGEMENTS

This work was supported by a grant from theNSF to R. A. R., K. A. W. was supported by an NIHpredoctoral training grant, and J. S. K. wassupported by an NSF IGERT fellowship. We thankthe School of Biological Sciences, University ofSydney, and the Sydney Aquarium for generouslyproviding resources. We thank E. C. Raff for thephotographs used in Fig. 1.

LITERATURE CITED

Angerer LM, Angerer RC. 1991. Localization of mRNAs by insitu hybridization. Methods Cell Biol 35: 37–71.

Armstrong N, McClay DR. 1994. Skeletal pattern is specifiedautonomously by the primary mesenchyme cells in seaurchin embryos. Dev Biol 162: 329–338.

Armstrong N, Hardin J, McClay DR. 1993. Cell-cell interac-tions regulate skeleton formation in the sea urchin embryo.Development 119: 883–840.

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG,Smith JA, Struhl K, editors. 1988. Current Protocols inMolecular Biology. New York: Greene Publishing Associatesand Wiley-Interscience.

Badiani P, Corbella P, Kioussis D, Marvel J, Weston K. 1994.Dominant interfering alleles define a role for c-Myb in T-celldevelopment. Genes Dev 8:770–782.

Bisgrove BW, Raff RA. 1993. The SpEGF III gene encodes amember of the fibropellins: EGF repeat-containing proteinsthat form the apical lamina of the sea urchin embryo. DevBiol 157: 526–538.

Cameron RA, Zeller RW, Coffman JA, Davidson EH. 1996.Microinjection of sea urchin eggs. In: Ferraris JD, PalumbiSR, editors. Molecular Zoology Advances, Strategies, andProtocols. Hoboken, New Jersey: John Wiley and Sons, Inc.p 441–442.

Celi FS, Zenilman ME, Shuldiner AR. 1993. A rapid andversatile method to synthesize internal standards forcompetitive PCR. Nucleic Acids Res 21: 1047.

Chapman DM. 1977. Eriochrome Cyanin as a Substitute forHaematoxylin and Eosin. Canad J Med Tech 39: 65–66.

Chomcynski P, Sacchi N. 1987. Single-step method of RNAisolation by acid guanidinium thiocyanate-phenol-chloro-form extraction. Anal Biochem 162: 156–159.

Davidson EH, Rast JP, Oliveri P, Ransick A, Calestani C, YuhC-H, Minokawa T, Amore G, Hinman V, Arenas-Mena C,Otim O, Brown CT, Livi CB, Lee PY, Revilla R, SchilstraMJ, Clarke PJC, Rust AG, Pan Z, Arnone MI, Rowen L,Cameron RA, McClay DR, Hood L, Bolouri H. 2002. AProvisional Regulatory Gene Network for Specification ofEndomesoderm in the Sea Urchin Embryo. Dev Biol 246:162–190.

Di Bernardo M, Castagnetti S, Bellomonte D, Oliveri P, MelfiR, Palla F, Spinelli G. 1999. Spatially restricted expressionof PlOtp, a Paracentrotus lividus Orthopedia related homeo-box gene, is correlated with oral ectodermal patterning andskeletal morphogenesis in late-cleavage sea urchin embryos.Development 126: 2171–2179.

Dobias SL, Ma L, Wu H, Bell JR, Maxon R. 1997. Theevolution of Msx gene function: expression and regulation ofa sea urchin Msx class homeobox gene. Mech Dev 61: 37–48.

Emlet RB. 1995. Larval spicules, cilia, and symmetry asremnants of indirect development in the direct developingsea urchin Heliocidaris erythrogramma. Dev Biol 167:405–415.

Emlet RB, McEdward LR, Strathmann RR. 1987. Echinodermlarval ecology viewed from the egg. In: Jangoux M,Lawrence JM, editors. Echinoderm Studies, Vol 2. Rotter-dam: Balkema. p 55–136.

Ettensohn CA. 1990. The regulation of primary mesenchymecell patterning. Dev Biol 140: 261–271.

Ettensohn CA, Malinda KM. 1993. Size regulation andmorphogenesis: a cellular analysis of skeletogenesis in thesea urchin embryo. Development 119: 155–167.

Ettensohn CA, Guss KA, Hodor PG, Malinda KM. 1997. Themorphogenesis of the skeletal system of the sea urchinembryo. In: Collier JR, editors. Reproductive Biology ofInvertebrates, Vol. VII. New Delhi: Oxford and IBHPublishing Co. Pvt. Ltd. p 225–265.

Galliot B, de Vargas C, Miller D. 1999. Evolution of homeoboxgenes: Q50 Paired-like genes founded the Paired class. DevGenes Evol 209: 186–197.

Gilliland G, Perrin S, Blanchard K, Bunn HF. 1990. Analysisof cytokine mRNA and DNA: detection and quantitation bycompetitive polymerase chain reaction. Proc Natl Acad SciUSA 87: 2725–2729.

Guss KA, Ettensohn CA. 1997. Skeletal morphogenesis in thesea urchin embryo: regulation of primary mesenchyme geneexpression and skeletal rod growth by ectoderm derivedcues. Development 124: 1899–1908.

Haag ES, Raff RA. 1998. Isolation and characterization ofthree mRNAs enriched in embryos of the direct-developingsea urchin Heliocidaris erythrogramma: evolution of larvalectoderm. Dev Genes Evol 208: 188–204.

Han K, Manley JL. 1993. Functional domains of theDrosophila engrailed protein. EMBO J 12: 2723–2733.

Hardin J, Coffman JA, Black SD, McClay DR. 1992. Commit-ment along the dorsoventral axis of the sea urchin embryo isaltered in response to NiCl2. Development 116: 671–685.

Harkey MA, Whiteley AH. 1980. Isolation, culture, anddifferentiation of echinoid primary mesenchyme cells.Wilhelm Roux’s Arch 189: 111–122.

Hodor PG, Ettensohn CA. 1998. The dynamics and regulationof mesenchymal cell fusion in the sea urchin embryo. DevBiol 199: 111–124.

Jungblut B, Pires-daSilva A, Sommer RJ. 2001. Formation ofthe egg-laying system in Pristionchus pacificus requirescomplex interactions between gonadal, mesodermal, andepidermal tissues and does not rely on single cell inductions.Development 128: 3395–3404.

Kauffman JS, Raff RA. 2003. Patterning mechanisms in theevolution of derived developmental life histories: the role ofWnt signaling in axis formation of the direct developing seaurchin Heliocidaris erythrogramma. Dev Genes Evo. in press.

Kessler DS. 1997. Siamois is required for formationof Spemann’s organizer. Proc Natl Acad Sci USA 94:13017–13022.

Kissinger JC, Raff RA. 1998. Evolutionary changes in sites andtiming of actin gene expression in embryos of the direct- andindirect-developing sea urchins, Heliocidaris erythrogram-ma and H. tuberculata. Dev Genes Evol 208: 82–93.

Kissinger JC, Hahn JH, Raff RA. 1997. Rapid evolution in aconserved gene family. Evolution of the actin gene family inthe sea urchin genus Heliocidaris and related genera. MolBiol Evol 14:654–665.

N. ZHOU ET AL.70

Klueg KM, Harkey MA, Raff RA. 1997. Mechanisms ofevolutionary changes in timing, spatial expression, andmRNA processing in the msp130 gene in a direct-developingsea urchin, Heliocidaris erythrogramma. Dev Biol 182:121–133.

Leaf DS, Anstrom JA, Chin JE, Harkey MA, Showman RM,Raff RA. 1987. Antibodies to a fusion protein identify acDNA clone encoding msp 130, a primary mesenchymespecific cell surface protein of the sea urchin embryo. DevBiol 121: 29–40.

Li X, Wikramanayake AH, Klein WH. 1999. Requirement ofSpOtx in cell fate decisions in the sea urchin embryo andpossible role as a mediator of beta-catenin signaling. DevBiol 212: 425–439.

Lin X, State MW, Vaccarino FM, Greally J, Hass M, LeckmanJF. 1999. Identification, chromosomal assignment, andexpression analysis of the human homeodomain containinggene Orthopedia (OTP). Genomics 60: 96–104.

Malinda KM, Ettensohn CA. 1994. Primary mesenchyme cellmigration in the sea urchin embryo: distribution of direc-tional cues. Dev Biol 164: 562–578.

Nedelman J, Heagerty P, Lawrence C. 1992. QuantitativePCR with internal controls. Comput Appl Biosci 8: 65–70.

Nederbragt AJ, de Welscher P, van den Driesche S, van LoonAE, Dictus WJ. 2002.

Novel and conserved roles for orthodenticle/ otx and orthope-dia/ otp orthologs in the gastropod mollusc Patella vulgata.Dev Genes Evol 212: 330–337.

Nielsen MG, Wilson KA, Raff EC, Raff RA. 2000. Novel geneexpression patterns in hybrid embryos between species withdifferent modes of development. Evol Dev 2:133–144.

Okazaki K. 1975a. Normal development to metamorphosis. In:Czihak G, editor. The Sea Embryo: Biochemistry andMorphogenesis. New York: Springer-Verlag. p 177–232.

Okazaki K. 1975b. Spicule formation by isolated micromeresof the sea urchin embryo. Am Zool 15: 567–581.

Parks AL, Parr BA, Chin J-E, Leaf DS, Raff RA. 1988.Molecular analysis of heterochronic changes in the evolutionof direct developing sea urchins. J Evol Biol 1: 27–44.

Pires-da Silva A, Sommer RJ. 2003. The evolution of signalingpathways in animal development. Nature Rev Gen 4: 39–49.

Raff RA. 1987. Constraint, flexibility, and phylogenetic changein the evolution of direct development in sea urchins. DevBiol 119: 6–19.

Raff RA. 1996. The Shape of Life: Genes, Development, andthe Evolution of Animal Form. Chicago: University ofChicago Press.

Raff RA, Sly BJ. 2000. Modularity and dissociation in theevolution of gene expression territories in development.Evol Dev 2:102–113.

Raff EC, Popodi EM, Sly BJ, Turner FR, Villinski JT, Raff RA.1999. A novel ontogenetic pathway in hybrid embryosbetween species with different modes of development.Development 126: 1937–1945.

Raff EC, Popodi EM, Kauffman JS, Sly BJ, Turner FR, MorrisVB, Raff RA. 2003. Regulatory punctuated equilibrium andconvergence in the evolution of developmental pathways indirect-developing sea urchins. Evo Dev 5: 478–493.

Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning.Cold Spring Harbor, NY: Cold Spring Harbor LaboratoryPress.

Schneeberger C, Speiser P, Kury F, Zeillinger R. 1995.Quantitative detection of reverse transcriptase-PCR pro-ducts by means of a novel and sensitive DNA stain. PCRMethods Appl 4: 234–238.

Siebert PD, Larrick JW. 1992. Competitive PCR. Nature 359:557–558.

Simeone A, D’Apice MR, Nigro V, Casanova J, Graziani F,Acampora D, Avantaggiato V. 1994. Orthopedia, a novelhomeobox-containing gene expressed in the developing CNSof both mouse and Drosophila. Neuron 13: 83–101.

Stander MC. 1999. Regulation and evolution of skeletogenesisin sea urchin development. Masters Thesis, IndianaUniversity.

Stauber M, Prell A, Schmidt-Ott U. 2002. A single Hox3 genewith composite bicoid and zerknult expression character-istics in non-Cyclorrhaphan flies. Proc Natl Acad Sci USA99: 274–279.

Strathmann RR. 1978. The evolution and loss of feeding larvalstages of marine invertebrates. Evolution 32: 894–906.

Tan H, Ransick A, Wu H, Dobias S, Liu YH, Maxson R. 1998.Disruption of primary mesenchyme cell patterning bymisregulated ectodermal expression of SpMsx in sea urchinembryos. Dev Biol 201: 230–246.

Taylor RC, Shi SR, Chen C, Young L, Yang C, Cote RJ. 1996.Comparative study of antigen retrieval heating methods:microwave, microwave and pressure cooker, autoclave, andsteamer. Biotech Histochem 71: 263–270.

Triezenberg SJ, Kingsbury RC, McKnight SL. 1988. Func-tional dissection of VP16, the trans-activator of herpessimplex virus immediate early gene expression. Genes Dev2: 718–729.

Umesono Y, Watanabe K, Agata K. 1999. Distinct structuraldomains in the planarian brain defined by the expression ofevolutionarily conserved homeobox genes. Dev Genes Evol209: 31–39.

Wagner GP. 1996. Homologies, natural kinds and theevolution of modularity. Amer Zool 36: 36–43.

WangW, Lufkin T. 2000. The murine Otp homeobox gene playsan essential role in the specification of neuronal cell lineagesin the developing hypothalamus. Dev Biol 227: 432–449.

Wray GA. 1999. Evolutionary dissociations between homo-logous genes and homologous structures. Novartis FoundSymp 222:189–203; discussion 203–206.

Zigler KS, Raff EC, Popodi E, Raff RA, Lessios HE. 2003.Adaptive evolution of binding in the genus Heliocidaris iscorrelated with the shift to direct development. Evolution57: 2293–2302.

EVOLUTION OF SKELETAL PATTERNING 71