Et

Ma

b

a

ARRAA

KCSA

yAttofslmstBdto

c

1

t2H

0h

Immunology Letters 151 (2013) 68– 70

Contents lists available at SciVerse ScienceDirect

Immunology Letters

jou rn al h om epa ge: www.elsev ier .com/ locate / immlet

vidence of complement genes in the sea-star Asterias rubens. Comparisons withhe sea urchin

ichel Leclerca,∗, Nicolas Kresdornb, Björn Rotterb

Immunologie des Invertébrés Université d‘Orléans 45100, Orleans Cedex 2, FranceGenXpro, Franckfurt, Germany

r t i c l e i n f o

rticle history:eceived 17 November 2012eceived in revised form 4 January 2013

a b s t r a c t

The axial organ of the sea star Asterias rubens is a primitive immune organ. The B-like cells, whenstimulated by various antigens, produce antibody substances correlating with Ig kappa genes, .On theother hand,component complement genes were found. For each component, one or several contigs were

ccepted 7 February 2013vailable online 27 February 2013

eywords:omplement genesea star

analyzed.It is said that Asterias forbesi, another sea-star, in earlier results, showed complement-like activity.A brief comparison with the complement system in sea urchin was performed, especially about the C3

component.© 2013 Published by Elsevier B.V.

xial organ

A large number of investigations performed in the last fewears,in our Laboratory, have provided evidence that the sea starsterias rubens (echinoderma) possesses a primitive immune sys-em with cellular and humoral responses functionally similar tohose of the immune system of vertebrates. When isolated axialrgan cells were stimulated “in vitro” by hapten-carriers, a solubleactor was secreted in the culture medium, that specifically lysedheep red cells sensitived with the corresponding antigen [1]. Thisytic reaction required the presence of thermolabile factor (comple-

ent) present in mammal serum and in the coelomic fluid of theea-star. Moreover, it could be demonstrated that this antibody fac-or [2], «unknown» in the sea urchin system [3] was produced by the-like cells but only, when T-like and phagocytic cells were presenturing the antigenic stimulation [4]. We have now observed thathe antibody factor was correlated with Ig Kappa genes [5]. On thether hand, complement genes were found.

In earlier studies [6] in Asterias forbesi, another sea star,omplement-like activity was shown.

. Material and methods

Sea stars Asterias rubens were obtained from the Biology Insti-ute (Gothenburg University). Immunizations were performed on0 animals, in an aquarium with sea water at 10 ◦C by usingorse-radish peroxydase (HRP) (Sigma Products) as antigen at a

∗ Corresponding author. Tel.: +33 0238410209.E-mail address: mleclerc45@gmail.com (M. Leclerc).

165-2478/$ – see front matter © 2013 Published by Elsevier B.V.ttp://dx.doi.org/10.1016/j.imlet.2013.02.003

concentration of 1 mg/ml. Twenty non-injected animals were usedas controls. The axial organs were removed; RNA was extracted,using Trizol (Invitrogen) according to manufacturer instructions,from immunized sea stars (HRP) and controls (C). cDNA wasnormalized using double strand specific nuclease essentially asdescribed by Zhulidov et al. [8]. cDNA was fragmented using DNAFragmentase (New England Biolabs), according to the manufac-turer’s instructions. After ligation of adapters for illumina’s GSIIsequencing system, the cDNA was sequenced on the illumina GSIIplatform sequencing 1 × 100 bp from one side of the approximately200 bp fragments. Sequences were assembled using Velvet (Zerbinoet al. [7]). Assembled nodes were used for further assembly includ-ing Beta vulgaris EST-Data from NCBI in MIRA.

2. Results

First, components of the classical pathway as compared to mam-mals, are given with

a) Control – Complement C1q subcomponent subunit A: One con-tig (NODE 55223 length 184 cov 8.456522) could be annotatedvia BLASTX to mouse “Complement C1q subcomponent subunitA” from the SWISSPROT database, had an e-value of 8.55742e-06. On an aligned region of 72 amino acids, 29 positive and 25identical amino acids were found.

b) HRP – Complement C1q subcomponent subunit A: No contigmatched, no hit was found.

Then,

M. Leclerc et al. / Immunology Letters 151 (2013) 68– 70 69

Animals injected with HRP( Horse -radish Pero xidase):

One contig (NODE_17513_length_212_cov_60.353775) could be annotated via BLASTX to mouse "e-kapp a chain V-III region MOPC63 " from the SWISSPR OT d atabase, with an e-value of 0.00070943. On an aligned region of 39 amino acids, 21 positive and 16 identical amino acids were found.>NODE_17513_length _212_cov_60.353775GCGTCCCAAAAGT TTCCC ATTAATG TCAC CTG TTT GGGATAGTATGGCTG GGACGCGTTTTCGCAGTCGTAAAC AAAAAAAAACC AATAACTGTTTTGGT TGAATT GGC CTTTGGT TAATCACTGGCTAATG ACTGAAACTG TTATT TGTTACAGCCGC CAAAACGCACCCC AGTG GGGG

CGG

kapp

b

b

“t7a

b

iao

“t

b

TAGTTTGACAACTTATTTTGCACCATCAAT

Fig. 1. DNA sequence Ig

a) Control – Complement C1q subcomponent subunit B: One contig(NODE 48557 length 161 cov 19.316771) could be annotatedvia BLASTX to mouse “Complement C1q subcomponent subunitB” from the SWISSPROT database,had an e-value of 8.55742e-06. On an aligned region of 57 amino acids, 33 positive and 19identical amino acids were found.

) HRP – Complement C1q subcomponent subunit B: One contig(NODE 68235 length 178 cov 7.724719) could be annotated viaBLASTX to mouse “Complement C1q subcomponent subunit B”from the SWISSPROT database, had an e-value of 3.97232e-10.On an aligned region of 44 amino acids, 39 positive and 28 iden-tical amino acids were found.

Then

a) Control – Complement C1q subcomponent subunit C: One contig(NODE 37343 length 278 cov 12.356115). On an aligned regionof 39 amino acids, 25 positive and 19 identical amino acids werefound.

) HRP – Complement C1q subcomponent subunit C: Three con-tigs could be annotated via BLASTX to mouse “Complement C1qsubcomponent subunit C” from the SWISSPROT database. Thebest contig (NODE 29181 length 277 cov 7.790614) had an e-value of 3.67148e-09. On an aligned region of 45 amino acids,27 positive and 22 identical amino acids were found.

We observe now the C2 Component:Five contigs could be annotated via BLASTX to mouse

Complement C2” from the SWISSPROT database. The best con-ig (NODE 23089 length 519 cov 15.136802) had an e-value of.65302e-07. On an aligned region of 153 amino acids, 59 positivend 38 identical amino acids were found. And now

what about the component C4?

a) Control – Complement C4-B: One contig (NODE 95392 length215 cov 10.818604) could be annotated via BLASTX to mouse“Complement C4-B” from the SWISSPROT database, had an e-value of 3.48532e-06. On an aligned region of 76 amino acids,40 positive and 21 identical amino acids were found.

) HRP – Complement C4-B: One contig (NODE 58696 length164 cov 11.884147) could be annotated via BLASTX to mouse“Complement C4-B” from the SWISSPROT database, had an e-value of 7.51259e-05. On an aligned region of 44 amino acids,26 positive and 21 identical amino acids were found.

Then, we have a look about the C3 component which is central,n mammals, to both the classical and alternative pathways. We try,t the end of this chapter to attempt a comparison with the SpC3

f the sea urchin.

Seven contigs could be annotated via BLASTX to mouseComplement C3” from the SWISSPROT database. The best con-ig (NODE 25262 length 1200 cov 21.958334) had an e-value of

AACAATATG TGA AGGATATTCCC

a MOPC 63 (A. rubens).

3.2395e-49. On an aligned region of 355 amino acids, 128 positiveand 173 identical amino acids were found.

) HRP – Complement C3: Eleven contigs could be annotatedvia BLASTX to mouse “Complement C3” from the SWIS-SPROT database. The best contig (NODE 15219 length 398cov 19.402010) had an e-value of 4.96748e-24. On an alignedregion of 146 amino acids, 79 positive and 59 identical aminoacids were found. It must be noted that C3 belongs to, also, theALTERNATE pathway.

c) Comparisons with the sea urchin (Strongylocentrotus purpuratus):Fig. 1

NODE 25262 length 1200 cov 21.958334>gi|47551023|ref|NP 999686.1| complement component C3 pre-cursor [Strongylocentrotus purpuratus]e-value: 1e-70indetique aa: 260positive aa: 410>NODE 25262 length 1200 cov 21.958334

TCACTGTCTGGCTCTGGGATGTGGTAGCTTGACTCAAACTTCAGC-TGGCCAACTCCTGTC

CCTGAAGAGTCAAAATGAACACGGAATTCCGGCTCATTTCCTGG-AATCACAAGTTTAGAG

TGCTGTCTGACGATTGCGTTGAACGGTTGCAGAACGAACTCATC-TTCAAATTGACTCTCA

ATACAACTGACCTGGCAATTGATATCAATGTTGCTCGTCTCGGAC-TTGATAGCATACTCC

GACAACGCCTGCAGAGCTATAACTGTATCCTGAGAAGACACAAA-TCCACCTTCATAATTC

TCTTGTTCCGTGAGCCAATTAACAATGGCATGACTGTAGGGCAGG-

TCGTCCAGCTGAAGTAAAGCCAGCAGTGCATAGCTTGTCATCTCTACATCAATGGCTTTCG-

GCCGGTTGATGTACCAATATGGTTTCGGACCCGCGCCAAAGGACGAGTCGTCTGCTCCC-

CAGTGACGATAATTGGTTGCTCTATCGTACGTAGCGATGTCTTTGAGCATCGTGAGAGCT-

TCATCAGCTTTGTTGCTATTGGCCAGAGCGAGGGCGTATGCGGTGATGGCAATGGCGTA-

AGGTCTCGTCAATTGTTGCAGTTGACCCTCTAAGAAAGCCGTAGCTGAAGCAACAGAGTCA-

GTCTTACTTACTGTTTCACATTCACACTCCAGAAGAGCTATCAGCACGTATGCAGTAAGC-

GAGGCGTCACCTTGC

ACACCACCAATCATTTCTTGGTGATGCACTTTGTACAATTCCCCGA-

ACGCACCGTTGTCATTCTGTGTCTCCTCTATCAGCCATCTCATAGCATTACAGGTGATGC-

TTCCATCAATGTAG

7 ology

C

C

A

A

C

T

o

b

b

[[[[

0 M. Leclerc et al. / Immun

GCAAATTCTTTGGCCTGGCAGAACACCTTGCTGACAAAGGCCGT-AACCAGGTACTGCTT

GGATACTGTAAATTATCTCCCCATACTGAAAATGAACCGTCCGAA-GACGATGCGTCAAT

TCTTGAGTTATACCGCCTCCGATGTACTGCTGAGCGGACACCTCC-GCTCAGCCGTGAAC

TGATTAGTGTGCTTCAGATACCGGTAGACGTAGACGTTGGGTGCT-

GGGTGATCATCGTTTGTTCACCACACCCTCGAGGGATCTGCAAAATGTCGCCCAACCCA-

TGATGACCGTGTCGATGACGTTACCCAAAATATTTCCCATGATGCTGATATGGGTTTGA-

GGGTACCAGGGATAGCGTCACTATGCAAGGAGTATCGTWe give now the obtained results concerning the components

f the membrane-attack complex as compared to mammals.So with the C9 component:

a) Control – Complement component C9: Three contigs couldbe annotated via BLASTX to mouse “Complement compo-nent C9” from the SWISSPROT database. The best contig(NODE 46472 length 143 cov 10.104895) had an e-value of1.41746e-05. On an aligned region of 31 amino acids, 17 positiveand 15 identical amino acids were found.

) HRP – Complement component C9: No contig matched, no hit wasfound.

As for the C5 component:

a) Control – Complement C5: One contig (NODE 75605 length236 cov 32.677967) could be annotated via BLASTX to mouse“Complement C5” from the SWISSPROT database, with an e-value of 0.000634854. On an aligned region of 55 amino acids,27 positive and 19 identical amino acids were found.

) HRP – Complement C5: Two contigs could be annotated viaBLASTX to mouse “Complement C5” from the SWIS-SPROT database. The best contig (NODE 7717 length665 cov 13.831579) had an e-value of 6.42528e-17. On analigned region of 212 amino acids, 99 positive and 57 identicalamino acids were found.

At last we observe the C8 Component and we find:

a) Control – Complement component C8 alpha chain: Twelve contigscould be annotated via BLASTX to mouse “Complement com-

ponent C8 alpha chain” from the SWISSPROT database. The bestcontig (NODE 68667 length 311 cov 10.845659) had an e-valueof 6.7995e-15. On an aligned region of 95 amino acids, 33 posi-tive and 42 identical amino acids were found.

[[[[[

Letters 151 (2013) 68– 70

b) HRP – Complement component C8 alpha chain: Six contigs couldbe annotated via BLASTX to mouse “Complement componentC8 alpha chain” from the SWISSPROT database. The best con-tig (NODE 43169 length 2163 cov 11.209893) had an e-value of6.36046e-14. On an aligned region of 45 amino acids, 42 positiveand 33 identical amino acids were found.

3. Discussion and conclusion

The main components of Complement as compared to mam-mal ones were found in the sea star: How genes are expressed? Bywhich pathway? In the present time we have no answers to thesequestions.

It could be a working hypothesis which needs to be explored.Nevertheless these observations indicate that certain mammalstructures are present in the immune system of the sea star: andthis finding strongly supports the idea that an effective immunesystem is already present in Echinoderma.

Since the typical immune system is not present in invertebrates,it can be suggested that it was developed at this point in evo-lution. The main acquisition of Asterids seems to be the cellulardifferentiation in two subpopulations of cells, ancestral to T and Blymphocytes, and their interplay with phagocytes resulting in thesynthesis of specific humoral antibody factor [2] in relation withthe Complement to be expressed.

Alternative and direct pathway genes correlated with«mammal» genes were discovered in this work, at the differ-ence of another Echinoderma: the sea-urchin: Strongylocentrotuspurpuratus [9] which shows only two components of the comple-ment such as a homologue of C3, called SpC3, having similaritieswith sea star C3 component (to see Fig. 1) and factor Bf pos-sessing significant similarity to the vertebrate Bf/C2 family.No humoral immune reaction occur in the sea urchin at ourknowledge.

At last, It could be expected that the sea-star specific immunereaction needs all the genes (7 components) from C1 to C9 to beexpressed.

This work reveals a true progress in the comprehension of theimmune system in Echinoderma.

References

1] Brillouet C, et al. Cell Immunol 1984;84:138–44.2] Delmotte F, et al. Eur J Immunol 1986;16(132):5–1330.3] Hibino T, et al. Dev Biol 2006;300(1):349–65.4] Leclerc M, et al. Bull Instit Pasteur 1986;84(31):1–330.

5] Leclerc M, et al. Immunol Lett 2011;138(19):7–198.6] Leonard LA, et al. Dev Comp Immunol 1990;14(1):9–30.7] Zerbino DR, et al. Gen Res 2007;18:821–9.8] Zhulidov PA, et al. Nucleic Acid Res 2004;3:32–7.9] Smith LC, et al. Immunol Rev 2001;180:16–34.