GENOMICS 14, 585-589 (1992)

Evidence for a Third Transcript from the Human Factor VIII Gene

BARBARA LEVINSON, SUSAN KENWRICK, PAMELA GAMEL, 1 KAREN FISHER,* AND JANE GITSCHIER 2

Howard Hughes Medical Institute and Department of Medicine, University of California, San Francisco, California 94743; and *Genentech, Inc., South San Francisco, California 94080

Received April 10, 1992; revised July 27, 1992

I n t r o n 2 2 o f t h e h u m a n f a c t o r VIII g e n e w a s r e c e n t l y f o u n d to c o n t a i n a g e n e , a s s o c i a t e d w i t h a CpG i s land , w h i c h is t r a n s c r i b e d in t h e d i r e c t i o n o p p o s i t e to fac tor VIII . W e n o w repor t t h a t a n o t h e r t r a n s c r i p t e m a n a t e s f r o m the i s l a n d a n d is t r a n s c r i b e d in the s a m e d i r e c t i o n as f a c t o r VIII . T h e d i v e r g e n t t r a n s c r i p t s o r i g i n a t e w i t h i n 1 2 2 b a s e s o f e a c h o ther . T h e n e w l y i d e n t i f i e d 5' e x o n in i n t r o n 2 2 p o t e n t i a l l y co de s for e i g h t a m i n o ac ids and is s p l i c e d to e x o n s 2 3 - 2 6 , w i t h the fac tor VIII r e a d i n g f r a m e m a i n t a i n e d . T h e p r o t e i n e n c o d e d b y th i s t r a n s c r i p t w o u l d i n c l u d e the fac tor VIII C2 d o m a i n , re- s p o n s i b l e for p h o s p h o l i p i d b i n d i n g a n d e s s e n t i a l for co- a g u l a n t a c t i v i t y . © 1992 Academic Press, Inc.

I N T R O D U C T I O N

Hemophilia is an X-linked bleeding disorder resulting from a defect in coagulation factor VIII. The gene en- coding factor VIII has 26 exons and spans almost 200 kb. Recently we found a gene nested within the largest fac- tor VIII intron by virtue of association with a CpG island at its 5' end (Levinson e t al., 1990). The gene, which we refer to here as factor VIII-associated gene A (F8A), is intronless and is transcribed in the direction opposite of factor VIII. Although the function of this gene is un- known, it has the capacity to code for a protein of 365 amino acids and is conserved in the mouse (Levinson e t al., 1992).

For some CpG islands, divergent transcripts have been observed (Lavia e t al., 1987; Williams et al., 1988; Sturm e t al., 1988). Typically, the transcripts start within a few hundred basepairs of each other. GC boxes, presumed Spl binding sites, have been noted in a num- ber of cases (Poschl et al., 1988; Burbelo e t al., 1988), and in several instances, the promoter has been proven to be bidirectional (Burbelo e t al., 1988; Linton e t al., 1989; Lennard and Fried, 1991).

The sequence of the cDNA reported in this article has been depos- ited with GenBank under Accesion No. M90707.

1 Present address: Sanofi Diagnostics Pasteur, Inc., Chaska, MN 55318.

2 To whom correspondence should be addressed at U-426, Box 0724, University of California, San Francisco, CA 94143. Fax: 415-566-4969.

This report describes a second transcript, termed FSB, that originates from the CpG island in intron 22 of the factor VIII gene and is transcribed in the same direc- tion as factor VIII. It utilizes one unique exon in addi- tion to factor VIII exons 23-26 and was discovered by hybridization of the factor VIII cDNA probe to North- ern blots.

M A T E R I A L S A N D M E T H O D S

Cells and cell culture. A human B cell line containing four X chro- mosomes was obtained from the American Type Culture Collection ("4X," GM1202A). Two other Epstein-Barr virus-immortalized B cell lines derived from hemophilia A patients RH and H96 have been described elsewhere (Lillicrap et al., 1986; Gitschier et al., 1985). The cell lines were cultured in RPMI supplemented with 15% fetal calf serum. A human fibroblast cell line was obtained from the UCSF Cell Culture Facility and grown in Dulbecco high-glucose MEM with 10% fetal calf serum.

R N A preparat ion and Nor thern blot analysis. RNA was extracted from the cultured cell lines as described by Laski et al. (1982). RNA from human liver was isolated by a LiC1 procedure (Cathala et al., 1983; Fig. 1B) or the method of Chomczynski and Sacchi (1987). Poly(A) + RNA was isolated and Northern blots were prepared as de- scribed in Levinson et al. (1990). The blots shown in Figs. 1A, C, and D contained 2 #g of RNA and were hybridized and washed as described (Levinson et al., 1990). The blot in Fig. 1B was hybridized at 60°C and washed at 62°C under conditions described previously (Wion et al., 1987).

Probes. Factor VIII cDNA probes were derived from plasmid sub- clones of the 9-kb cDNA (Wood et al., 1984) and labeled by random- priming using calf thymus primers (Feinberg and Vogelstein, 1983). The riboprobe used in Fig. 1B was prepared using a 3958-bp S s t I / X b a I fragment from the factor VIII cDNA cloned into pSP64 and linearized with SstI; it was labeled as described previously (Gitschier et al., 1984).

c D N A library preparation. Poly(A) + RNA was extracted from RH cultured B cells, and a cDNA library was synthesized using the cDNA Synthesis Kit from Pharmacia and oligo(dT) as the primer. The cDNAs were ligated to Lambda ZAP II (Stratagene) EcoRI-d iges ted arms and packaged using a Gigapack Gold packaging kit (Stratagene). The library was amplified by growth on plates, giving a final titer of 101° PFU/ml.

Ampli f icat ion and sequencing of F8B. cDNA was amplified in a 50-#1 PCR reaction that contained 2 ttl of the RH cDNA library, 4 mM MgC12, 10 mM Tris-HC1, pH 8.3, 50 mM KC1, 200 ttM dNTPs, 20 pmol of each primer, and 2 units AmpliTaq (Perkin-Elmer-Cetus). The amplification consisted of an initial 5-min denaturation step at 94°C, followed by 30 cycles of 94°C for 15 s, 55°C for 15 s, 72°C for 30 s to 2 min, and a final elongation step of 7 min at 72°C. The PCR products were electrophoresed on a 5% polyacrylamide gel and puri-

585 0888-7543/92 $5.00 Copyright © 1992 by Academic Press, Inc.

All rights of reproduction in any form reserved.

586 LEVINSON ET AL.

$ $

• - ~ ¢~ ~ ~ 2 ~, ' - -~ ~ ~ ~ x z o~ , , > = ~ , , ~ . _ = 2= :~ ~ < ,- , - ~ , , -" = =

~ 9 k b

2.5 kb

- - g k b

D 2.5 kb

~ 9 k b

- - 2.5 kb

~ 9 k b

m 2.5 kb

A tissue distribution B direction of transcription C exon probes D deletion analysis

FIG. 1. Northern blots hybridized with factor VIII cDNA probes reveal a 2.5-kb mRNA. (A) A Northern blot containing poly(A) + RNA from a variety of human tissues was purchased from Clontech and hybridized to a partial factor VIII cDNA probe. (B) A Northern blot of RNA from bovine liver, the AL-7 cell line (Wood et al., 1984), and human liver was hybridized to an anti-sense factor VIII riboprobe. (C) Factor VIII cDNA probes, specific for three different sets of exons (15-18, 18-22, and 23-25), were hybridized to Northern blots containing poly(A) + RNA from HeLa cells. (D) A Northern blot containing poly(A) + RNA derived from cultured B cells from a 4X cell line, hemophilia patients (RH and H96) with partial deletions of factor VIII gene, a fibroblast cell line, and human liver was probed with factor VIII exon 26. The intermediate size band in B and D is due to nonspecific hybridization to contaminating 28S RNA.

fled by electroelution, phenol-chloroform extraction, and ethanol pre- cipitation. The fragments were sequenced directly using [~2P]dATP and a Sequenase Version 2.0 Kit from U.S. Biochemical.

Preparation o[ cell extracts. Cell extracts were prepared by two dif- ferent methods, a triple detergent lysis protocol (Sambrook et al., 1989) and a Triton-extraction procedure described by Keating and Williams (1987).

Antibodies. Plasma from a hemophiliac with antibodies to the C2 domain of factor VIII (Scandella et al., 1989) and a series of polyclonal rabbit antibodies against synthetic peptides corresponding to the fac- tor VIII C2 domain (Foster et al., 1990) were provided by Carol Fulcher, Scripps Clinic. Polyclonal rabbit antibodies were also pre- pared against a synthetic peptide of sequence RIQDPGKVFFGN, corresponding to the junction between the novel exon and exon 23 (CalTag Lab).

Imrnunoblotting. Protein from cell lysates (25-200 ~g) was elec- trophoresed on discontinuous, 10% polyacrylamide-SDS gels. Two expressed polypeptides corresponding to amino acids 1560-2052 and 1974-2332 of the factor VIII protein (Scandella et al., 1989) were pro- vided by Carol Fulcher and were used as negative and positive control samples, respectively. Purified human factor VIII (20-200 ng), pro- vided by Pamela Esmon at Miles Laboratory, was included in some experiments as a positive control. For detection by the anti-polypep- tide antibodies, protein samples were boiled in buffer containing di- thiothreitol; however, for detection with the human antibodies, the samples were not reduced.

Immunoblotting was performed as described by Scandella et al. (1989), except that alkaline phosphatase-conjugated anti-rabbit or anti-human IgG was used for detection (ProtoBlot, Promega).

RESULTS

As part of a control experiment for another project, the factor VIII cDNA probe was hybridized to a North- ern blot of RNA from a variety of human tissues. Figure 1 shows that in addition to the expected 9-kb factor VIII mRNA, a 2.5-kb poly(A) + RNA, present in all tissues, hybridized to the probe. The 2.5-kb transcript is likely to come from within the factor VIII gene itself since the gene is unique and has no known pseudogenes.

Hybridization with an anti-sense factor VIII ribo- probe showed that the 2.5-kb message is transcribed in the same direction as factor VIII (Fig. 1B). By hybridiz- ing portions of the factor VIII cDNA to Northern blots, it was determined that only the 3' end of the factor VIII gene is transcribed. Further hybridization with smaller probes showed that the mRNA did not contain exons 15-22, but did include exons 23-25 (Fig. 1C).

Northern blot analysis of hemophilia patients with partial deletions of the factor VIII gene proved that the 2.5-kb transcript comes from the factor VIII gene. Fig- ure 1D shows that the 2.5-kb transcript is missing from B cells derived from patient H96, whose deletion extends from intron 21 to intron 25 (Gitschier et al., 1985). In contrast, the transcript is present in B cells from patient RH, whose deletion extends from beyond the 5' end of the factor VIII gene to the CpG island in intron 22 (Lilli- crap et al., 1986), as well as in a control B cell line, a fibroblast line, and human liver. These results led to the hypothesis that the transcript, referred to as F8B, origi- nates with a novel exon in the CpG island contained in intron 22.

To test this hypothesis, we isolated and mapped the 5' end of the F8B message. An oligo(dT)-primed cDNA li- brary was synthesized from RNA extracted from RH B cells. The deletion in patient RH precludes synthesis of the factor VIII 9-kb transcript, therefore eliminating the potential ambiguity of contaminating factor VIII cDNAs. To isolate the 5'-end of the F8B sequence, the cDNA library was amplified with a reverse primer for exon 24 (primer 16.3) in combination with a T7 primer, which is located in one of the vector arms. A 350-bp fragment was produced. A significant fraction of the se- quence was expected to be derived from the lambda arm, linker, and factor VIII exons 23 and 24, with the remain- ing sequence unique to the F8B transcript. The frag-

A THIRD TRANSCRIPT FROM HUMAN FACTOR VIII GENE 587

4FSA 1 TGC AGC CGC TGC CGC CAT GCTCGCCGCCCCAAGCACTTCCCGACGCGCCGCCGC

ala ala ala ala ala met

55 AGCTGGCGGGCGGGCCGGGGCGGGGCGACGTGCCCTGCGTCCCCCTCGGCGGGCTGCCGC

115 CGTGCCCGCGCCGGCTCCCCAGCCCGAGCCTGCCCCTTGCCCTGATGAGGTGCAAAGAGC

175 GGGATCGGAGGCGGGGCCTGGCCGGGCTGTGAGCGGCGTATGCAAATCGAGGGTCTCGGG

F8B

235 G ATG CGG ATC CAA GAC CCT GGG AAG GTACGCGGGGCCTGGCGGGGCACCAG met arg ile gln asp pro gly lys

FIG. 2. The sequence of the CpG island region containing the first exon of F8B. The sequence shown here is the reverse complement

of part of the sequence described in Levinson e t al. (1990), from nt -267 to + 18. The solid lines indicate the extent and direction of tran- scription of the F8A and F8B mRNAs in the sequence presented. The derived amino acid sequence is displayed beneath the nucleotide se- quence. Note that the "codons" shown for F8A are the reverse comple- ment of the coding strand. The GT following the lysine codon in the F8B mRNA is part of the splice-donor site; the new F8B-specific exon is spliced to the factor VIII exon 23.

me n t was labeled and hybridized to a Sou the rn blot of genomic clones from the factor VIII gene to de termine the location of the new exon. In addi t ion to a hybridizing band corresponding to exons 23 and 24, the 9.6-kb E c o R I f ragment tha t conta ins the CpG island in in t ron 22 was observed (data not shown).

Direct sequencing of the f ragment revealed, in addi- t ion to the expected flanking sequences, a novel 64-bp sequence. Inspect ion of the previously repor ted in t ron 22 sequence showed tha t the 64-bp is conta ined within the CpG island (Levinson e t al., 1990). Figure 2 shows the posi t ion of the sequence, which comprises a new exon followed by a spl ice-donor site, in re la t ion to the F8A gene. The F8A and F8B t ranscr ip ts originate within 122 bp of each other.

The new exon codes for eight amino acids, ini t ia ted by a methionine . T h e meth ionine codon is preceded at the - 3 posi t ion by a guanine, one of the two prefer red bases for t rans la t ion ini t ia t ion (Kozak, 1987). Splicing of the new exon to exon 23 produces the same reading frame used by factor VIII. I t is likely tha t this reading frame would be used, as the o ther reading frames conta in multi- ple stop codons.

We de te rmined tha t exons 23, 24, 25, and 26 are a par t of the F8B t ranscr ip t by P C R amplif icat ion of the R H cDNA library using a pr imer specific for F8B exon 1 in combina t ion with reverse pr imers specific for each fac- tor VIII exon (Table 1). Lanes 1 th rough 4 of Fig. 3A show tha t f ragments of the expected sizes for junct ion to exon 23 (205 bp), exon 24 (353 bp), exon 25 (536 bp), and exon 26 (704 bp) were produced. Direct sequencing of the four amplif ied f ragments conf i rmed tha t the splice junct ions used for factor VIII are mainta ined. An addi- t ional amplif icat ion with exon 26-specific pr imers (lane 5) indicated tha t the ent i re exon 26 is present . Figure 3B summarizes the s t ruc ture of the F8B gene, based on these data, and shows its posi t ion in re la t ion to F8A. T h e size of the 2.5-kb F8B t ranscr ip t reflects the inclu- sion of the new exon (64 bp), exon 23 (145 bp), exon 24 (149 bp), exon 25 (177 bp), and exon 26 (1958 bp).

Figure 4 presents the derived sequence of the puta t ive F8B protein. T h e carboxy- te rmina l 160 amino acids of the 216-residue prote in comprise the C2 domain of fac- tor VIII. Th is region is responsible for phosphol ip id binding and is required for factor VIII act ivi ty (Arai e t al., 1989; Foster e t al., 1990).

A series of exper iments were conducted to de termine whether a F8B prote in is synthesized. We chose to exam- ine B cell lysates as the potent ia l source for F8B for a number of reasons. F8B m R N A is expressed abundan t ly in B cells, bu t factor VIII m R N A is not detectable by N o r th e rn blot, thus prevent ing factor VIII pro te in from obscuring the analysis. B cells f rom hemophi l ia pa t ien ts deleted for this region were also available to serve as negative controls. Cell lysates, r a the r t han media, were examined because the predic ted prote in does not include a typical hydrophobic leader sequence.

A var ie ty of ant ibodies were used to assay the lysates for the puta t ive prote in by Wes te rn blot analysis. These included several rabbit polyclonal antibodies, p repared against synthet ic C2 domain peptides. In our hands, these antibodies reacted with the factor VIII control sample as well as the expressed polypept ide correspond- ing to the carboxy- terminus of factor VIII, bu t did not exhibi t any react ivi ty with the cell lysates under identi- cal conditions. Antibodies against the C2 domain from a hemophil ic " inhib i tor" pa t ien t also recognized the con- trol factor VIII protein, but did not reveal a pro te in of a size corresponding to F8B in the ex t rac t samples. Fi- nally, rabbit polyclonal ant ibodies were p repared against a synthet ic peptide conta in ing seven novel amino acids of the puta t ive F8B protein. These ant ibod- ies did not show any reactivity.

Its difficult to conclude from these exper iments tha t the F8B prote in does not exist. A number of explana- t ions could account for our negative findings. First, the assays may not be sensitive enough to detect the small quant i ty of F8B. Second, the pro te in may have been de- graded. Thi rd , our assumptions could have been incor- rect. I t is possible tha t F8B pro te in is not produced in B cells, or t ha t it is secreted. Other exper iments would be needed to explore these contingencies.

DISCUSSION

We describe the isolation and character iza t ion of a second t ranscr ip t associated with the CpG island in in- t ron 22 of the human factor VIII gene. This new gene, F8B, shares the final four exons with factor VIII and is t ranscr ibed in the same direction. I t is closely l inked to ano ther gene, F8A, which is t ranscr ibed in the opposite direct ion and is complete ly embedded in in t ron 22. The genomic organizat ion of the F8A, F8B, and factor VIII genes is uncommon. Although there are a number of ex- amples of nes ted genes, and m an y instances of a l terna- t ively spliced genes or a l ternat ive promoters , it is rare to find a p romote r located near the 3' end of a gene tha t directs synthesis of an addit ional t ranscr ipt .

A number of features suggest t ha t the F8A and F8B t ranscr ip ts may funct ion as housekeeping genes. Bo th are expressed in all h u m an tissues tested, with the levels

588 LEVINSON ET AL.

T A B L E 1

P r i m e r Sequences

Primer Location Sequence Length

16.3 Exon 24 5'-TCTGTCGACCTGATATTGCTTTACTCTCCATTCC 34-mer T7 Vector arm 5'-AATACGACTCACTATAG 17-mer P26 Exon 1 of FSB 5'-CTGTGAGCGGCGTATGCAAATC 22-mer 13.5 Exon 23 5'-CTACTTAAGTCACAGCCCATCAACTC 26-mer 16.2 Exon 24 5'-CTGAGGTCTCCAGGCATTAC 20-mer 13.2 Exon 25 5'-GCTAAGCTTTACTTTGCCATTCTG 24-mer 6.6 Exon 26 5'-GTGCTGCAGTGGCCACCCTCAG 22-mer 6.5 Exon 26 5'-GTTTTTCAGGGAAATCAAGACTC 23-mer 6.2 Exon 26 5'-AAAGAGCTAGTTCCATGAAC 20-mer

of FSA R N A being signif icantly higher t h a n those of FSB. The genes are associa ted with a CpG-r ich region, which we previously showed had proper t ies of a CpG island (Levinson et al., 1990). T h e u p s t r e a m sequences lack T A T A boxes but con ta in several GC boxes, one of which is identical to a p roven S p l b inding site.

These findings fur ther suggest t ha t F8A and F8B share a bidirect ional p romoter . Al though no a t t e m p t has been made to define the p r o m o t e r or to prove its bidirec- t ionali ty, the p rox imi ty of the genes, the i r paral le l ex- pression, and the presence of mul t ip le pu ta t ive S p l bind- ing e lements are charac ter i s t ic of genes wi th p roven bidi- rect ional p romoters . Example s of such genes include the dhfr locus (L in ton et al., 1989), Surfei t locus (Lenna rd and Fried, 1991), and the a l ( I V ) and a2(IV) collagen genes (Burbelo et al., 1988).

The possibi l i ty of a c o m m o n p r o m o t e r is given fur ther suppor t by the inves t igat ion of the F8A and F8B genes in

M 1 2 3 4 5

-1900

-704 -536

-353

-205

8 F8A F8B

22 ~ -~ 23 24 25 26 :::iiiiiiil]{iliii!iiii!i[ i i i i i i i i i ! } ] i i i [ i i i i i [ ! i i ] i ] i i i } I ~ii::~ii!!i

F I G . 3 . Ana lys i s of the processed F8B t ranscr ip t . (A) A p r imer a t t he 5 ' -most exon of the F8B gene, P26, was used in con junc t ion wi th each of four p r imer s f rom factor VIII exons 23-26 to ampl i fy D N A f rom a c D N A library der ived f rom pa t i en t RH. T h e p r imer s were the following: 13.5 for exon 23 ( lane 1); 16.2 for exon 24 (lane 2); 13.2 for exon 25 (lane 3); a n d 6.6 for exon 26 ( lane 4). In lane 5 , the l ibrary was amplif ied wi th exon 26 p r imer s 6.5 and 6.2. (B) Schemat ic dia- g r am of a por t ion of t he factor VIII gene inc luding t he F8A and F8B t ransc r ip t s . T h e compos i te sequence for the F8B c D N A has been de- pos i ted wi th G e n B a n k u n d e r Access ion No. M90707.

mice. Our findings are twofold: (1) The re is no evidence for F8B m R N A in any mur ine tissue, as assayed by a N o r t h e r n blot hybridized to a h u m a n probe conta in ing the new exon and exon 23 (Levinson, unpubl i shed ob- servat ion) . (2) T h e F8A gene exists as a single copy in the mouse genome, bu t it is not located wi th in the factor VI I I gene (Levinson et al., 1992). These resul ts suggest to us t ha t it is the presence of the CG-r ich p romote r , associa ted with the F8A gene, t h a t leads to t r ansc r ip t ion of F8B in man. As bovine liver lacks the F8B t r ansc r ip t (demons t r a t ed in Fig. 1B), we fu r the r speculate t h a t the F8A gene lies outside the factor VI I I gene in cattle.

T h e possibi l i ty of regula tory re la t ionships a m o n g the three t r ansc r ip t s should be considered. T ransc r ip t i on of F8A and F8B could influence the level of fac tor V I I I m R N A , which is p resen t a t much lower levels. In addi- t ion, the p r i m a r y t r ansc r ip t for fac tor VI I I conta ins the ent i re F8B t ranscr ip t ; thus exon 23 could splice inappro- pr ia te ly to the F8B-specific exon ra the r t h a n to exon 22. I t is possible t ha t mu ta t i ons affect ing this choice could give rise to hemophi l i a in some individuals.

T h e t r ans la t ed sequence of the F8B t r ansc r ip t pre- dicts a small p ro te in consis t ing p r imar i ly of the phospho- lipid b inding domain of fac tor VIII . Despi te our inabi l i ty to detect the F8B pro te in in B cell lysates, it seems likely to us t h a t such a p ro te in is produced, given conformance with Kozak ' s rule in conjunct ion with an ini t ia t ing me- th ionine codon, ma in t enance of the reading f rame, and ident i ty to a funct ional domain of a known prote in . A n u m b e r of hemophi l i a pa t i en t s who are deleted for exons

1 MRIQDPGI~VF FGNVDSSGIK HNIFNPPIIA RYIRLHPTHY SIRSTLR-MEL I

23

51 MGCDLNSCSM PLGMESKAIS DAQITASSYF TNMFATWSPS KARLHLQGRS I

24

i01 NAWRPQIVIN-NP KEWLQVDFQK TMKVTGVTTQ GVKSLLTSMY VKEFLISSSQ l

25

151 DGHQWTLFFQ NGKVKIVFQGN QDSFTPVVIqS LDPPLLTRYL RIHPQSWVHQ 26

201 IALRMEVLGC EAQDLY*

FIG. 4. Sequence of the putative FSB protein. The first eight

amino acids are derived from the first exon, as shown in Fig. 2. Posi- tions corresponding to the factor VIII exons 23-26 are indicated. The C2 domain of factor VIII starts at the beginning of exon 24 and con-

sists of 160 amino acids.

A THIRD TRANSCRIPT FROM HUMAN FACTOR VIII GENE 589

2 3 - 2 6 h a v e b e e n d e s c r i b e d . T h e y h a v e n o r e p o r t e d p h e -

n o t y p e o t h e r t h a n t h e i r h e m o p h i l i a ( T u d d e n h a m e t al.,

1991) , s u g g e s t i n g t h a t i f p u t a t i v e F 8 B p r o t e i n d o e s e x i s t ,

i t h a s a n o n e s s e n t i a l f u n c t i o n .

A C K N O W L E D G M E N T S

We are grateful to Marie Doherty for preparing oligonucleotides, Aida Metzenberg for computer analysis, William Wood for communi- cating unpublished data, David Lillicrap and Edward Tuddenham for providing the RH and H96 cell lines, Pamela Esmon for providing purified factor VIII, Carol Fulcher and Wendy Fantl for providing reagents and advice, and members of our laboratory for helpful com- ments on this manuscript.

R E F E R E N C E S

Arai, M., Scandella, D., and Hoyer, L. W. (1989). Molecular basis of factor VIII inhibition by human antibodies: Antibodies that bind to the factor VIII light chain prevent the interaction of factor VIII with phospholipid. J. Clin. Invest. 83: 1978-1984.

Burbelo, P. D., Martin, G. R., and Yamada, Y. (1988). al(IV) and ~2(IV) collagen genes are regulated by a bidirectional promoter and a shared enhancer. Proc. Natl. Acad. Sci. USA 85: 9679-9682.

Cathala, G., Savouret, J. F., Mendez, B., West, B., Karin, M., Martial, J., and Baxter, J. (1983). Laboratory methods: A method for isola- tion of intact translationally active ribonucleic acid. DATA 2: 329- 335.

Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform ex- traction. Anal. Biochem. 162: 156-159.

Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabel- ing DNA restriction endonuclease fragments to high specific activ- ity. Anal. Biochem. 132: 6-13.

Foster, P. A., Fulcher, C. A., Houghten, R. A., and Zimmerman, T. S. (1990). Synthetic factor VIII peptides with amino acid sequences contained within the C2 domain of factor VIII inhibit factor VIII binding to phosphotidylserine. Blood 75: 1999-2004.

Gitschier, J., Wood, W. I., Goralka, T. M., Wion, K. L., Chen, E. Y., Eaton, D. E., Vehar, G. A., Capon, D. J., and Lawn, R. M. (1984). Characterization of the human factor VIII gene. Nature 312: 326- 330.

Gitschier, J., Wood, W. I., Tuddenham, E. G. D., Shuman, M. A., Goralka, T. M., Chen, E. Y., and Lawn, R. M. (1985). Detection and sequence of mutations in the factor VIII gene of haemophiliacs. Nature 315: 427-430.

Keating, M. T., and Williams, L. T. (1987). Processing of the platelet- derived growth factor receptor. J. Biol. Chem. 262: 7932-7937.

Kozak, M. (1987). An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15: 8124-8148.

Laski, F. A., Alzner-DeWeerd, B., RajBhandary, U. L., and Sharp, P. A. (1982). Expression of a X. laevis tRNA Tyr gene in mammalian cells. Nucleic Acids Res. 10: 4609-4626.

Lavia, P., Macleod, D., and Bird, A. (1987). Coincident start sites for divergent transcripts at a randomly selected CpG-rich island of mouse. EMBO J. 6: 2773-2779.

Lennard, A. C., and Fried, M. (1991). The bidirectional promoter of the divergently transcribed mouse Surf-1 and Surf-2 genes. Mol. Cell. Biol. 11: 1281-1294.

Levinson, B., Bermingham, J., Metzenberg, A., Chapman, V., and Gitschier, J. (1992). The sequence of the human factor VIII asso- ciated gene is conserved in mouse. Genomics 13: 862-865.

Levinson, B., Kenwrick, S., Lakich, D., Hammonds, G., and Gitschier, J. (1990). A transcribed gene in an intron of the human factor VIII gene. Genomics 7: 1-11.

Lillicrap, D. P., Taylor, S. A. M., Grover, H., Teitel, J., Giles, A. R., Holden, J. J. A., and White, B. N. (1986). Genetic analysis in hemo- philia A: Identification of a large factor VIII gene deletion in patient with high titre antibodies to human and porcine factor VIII. Blood 68: 337A:

Linton, J. P., Yen, J.-Y., J., Selby, E., Chen, Z., Chinsky, J. M., Liu, K., Kellems, R. E., and Crouse, G. F. (1989). Dual bidirectional promoters at the mouse dhfr locus: Cloning and characterization of two mRNA classes of the divergently transcribed Rep-1 gene. Mol. Cell. Biol. 9: 3058-3072.

Poschl, E., Pollner, R., and Kuhn, K. (1988). The genes for the al(IV) and ~2(IV) chains of human basement membrane collagen type IV are arranged head-to-head and separated by a bidirectional pro- moter of unique structure. EMBO J. 7: 2687-2695.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). "Molecular Cloning: A Laboratory Manual," Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Scandella, D., Mattingly, M., de Graaf, S., and Fulcher, C. A. (1989). Localization of epitopes for human factor VIII inhibitor antibodies by immunoblotting and antibody neutralization. Blood 74: 1618- 1626.

Sturm, R. A., Dalton, S., and Wells, J. R. E. (1988). Conservation of histone H2A/H2B intergene regions: A role for the H2B specific element in divergent transcription. Nucleic Acids Res. 16: 8571- 8586.

Tuddenham, E. G. D., Cooper, D. N., Gitschier, J., Higuchi, M., Hoyer, L. W., Yoshioka, A., Peake, I. R., Schwaab, R., Olek, K,, Kazazian, H. H., Lavergne, J. M., Giannelli, F., and Antonarakis, S. E. (1991). Haemophilia A: Database of nucleotide substitutions, deletions, insertions and rearrangements of the factor VIII gene. Nucleic Acids Res. 19: 4821-4833.

Williams, T., Yon, J., Huxley, C., and Fried, M. (1988). The mouse surfeit locus contains a very tight cluster of four "housekeeping" genes that is conserved through evolution. Proc. Natl. Acad. Sci. USA 85: 3527-3530.

Wion, K., Kirchgessner, T., Lusis, A., Shotz, M., and Lawn, R. (1987). Human lipoprotein lipase complementary DNA sequence. Science 235: 1638-1641.

Wood, W. I., Capon, D. J., Simonsen, C. C., Eaton, D. L., Gitschier, J., Keyt, B., Seeburg, P. H., Smith, D. L., Hollingshead, P., Wion, K. L., Delwart, E., Tuddenham, E. G. D., Vehar, G. A., and Lawn, R. M. (1984). Expression of active human factor VIII from recombi- nant DNA clones. Nature 312: 330-337.