estrogen receptor signaling promotes dendritic cell differentiation by

HEMATOPOIESIS AND STEM CELLS

Estrogen receptor signaling promotes dendritic cell differentiation by increasingexpression of the transcription factor IRF4Esther Carreras,1 Sean Turner,1 Mark Barton Frank,1,2 Nicholas Knowlton,1,2 Jeanette Osban,1,2 Michael Centola,1

Chae Gyu Park,3 Amie Simmons,4 Jose Alberola-Ila,4 and Susan Kovats1

1Arthritis & Immunology Program, and 2Microarray Research Facility, Oklahoma Medical Research Foundation, Oklahoma City; 3Laboratory of CellularPhysiology and Immunology, The Rockefeller University, New York, NY; and 4Immunobiology & Cancer Program, Oklahoma Medical Research Foundation,Oklahoma City

During inflammation, elevated granulo-cyte macrophage–colony-stimulating fac-tor (GM-CSF) directs the development ofnew dendritic cells (DCs). This pathway isinfluenced by environmental factors, andwe previously showed that physiologiclevels of estradiol, acting through estro-gen receptor alpha (ER�), promote theGM-CSF–mediated differentiation of aCD11b� DC subset from myeloid progeni-

tors (MPs). We now have identified inter-feron regulatory factor 4 (IRF4), a tran-scription factor induced by GM-CSF andcritical for CD11b� DC development invivo, as a target of ER� signaling duringthis process. In MPs, ER� potentiates andsustains GM-CSF induction of IRF4. Fur-thermore, retroviral delivery of the Irf4cDNA to undifferentiated ER��/� bonemarrow cells restored the development of

the estradiol/ER�-dependent DC popula-tion, indicating that an elevated amountof IRF4 protein substitutes for ER� signal-ing. Thus at an early stage in the MPresponse to GM-CSF, ER� signaling in-duces an elevated amount of IRF4, whichleads to a developmental program under-lying CD11b� DC differentiation. (Blood.2010;115:238-246)

Introduction

Dendritic cell (DC) subsets in vivo are distinguished based onlocation, surface markers, function, and migratory capacity, andwhether they are present in steady-state conditions or develop as aconsequence of inflammation.1 In non–lymphoid tissues such asdermis and lung, 2 major populations of CD11c� MHCII� DCshave been identified as CD11bhi CD103� and CD11blo CD103�

Langerin� or �

.2,3 These interstitial DCs derive from monocytes orblood-borne precursors that seed tissue, while a distinct populationof epidermal Langerin� DCs (LCs) are replenished slowly fromlocal self-renewing precursors. The cytokines that mediate thedevelopment of interstitial DCs during homeostasis are not defined,and may include Flt3 ligand or micro amounts of granulocytemacrophage–colony-stimulating factor (GM-CSF) or M-CSFpresent in non–lymphoid tissue.3 During inflammation, DC differ-entiation from Gr-1hi monocytes is largely mediated by elevatedamounts of GM-CSF.4 This GM-CSF–driven pathway is elevatedin infection and autoimmune disease and leads to the appearance ofde novo DC populations in lymphoid organs and tissues.1,5 Inculture models, GM-CSF mediates CD11b� DC differentiationfrom monocytes and myeloid progenitors (MPs), and a subset ofthe CD11bint DCs express Langerin.6,7 However, it remains unclearhow these DCs relate to Langerin� epidermal LCs or populationsof CD11b� or Langerin� interstitial DCs.

The lineage fate of hematopoietic progenitor cells is determinedby ordered expression of transcription factors and receptor tyrosinekinases such as Flt3, yet the molecular steps involved in thedevelopment of specific DC subtypes from common precursors,including myeloid and lymphoid progenitors, pro-DCs, and mono-cytes, are not completely defined. Genetic analyses have identified

several transcription factors, including Irf4, to be crucial fordevelopment of specific DC subsets found in lymphoid organs.3

For example, mice deficient in relB, PU.1, or interferon regulatoryfactor 4 (IRF4) lack splenic CD11bhi CD8�� CD4� DCs, whereasmice deficient in IRF8 lack splenic CD8�� CD4� CD11b� DCsand plasmacytoid DCs. IRF4 also is necessary for the developmentof MHC class II� DCs during GM-CSF–mediated differentiationfrom murine bone marrow (BM) or human monocytes in vitro.8-10

Less is known about transcription factor requirements for tissueDCs, and factors directing the development of recently definedinterstitial CD11b� or CD103� Langerin� DCs have not beenreported. Analyses of IRF4�/� mice did not include assessments oftissue DCs.8,9

Transcription factor dosage is often important in cell fatespecification. Relevant to our study, quantitatively different levelsof IRF4 protein alter B-cell differentiation pathways.11 IRF4 actsalone or dimerizes with PU.1 or Spi-B to mediate transcription.12

Quantitative differences in PU.1 in hematopoietic progenitors alsolead to alternate myeloid or lymphoid fates.13,14 Thus, IRF4 andPU.1 act as dosage-sensitive regulators to instruct distinct celldifferentiation programs, and therefore, factors (eg, hormones orother transcription factors15,16) that regulate IRF4 expression arelikely to alter IRF4-mediated developmental pathways.

Environmental stimuli can influence DC differentiation, and wepreviously have defined a role for estrogen receptor (ER) signalingin DC development.17 ERs are ligand-dependent transcriptionfactors that regulate gene expression by forming complexes withchromatin-modifying coregulators.18 Immune cells and their pro-genitors express ERs, suggesting that ER-mediated responses to

Submitted August 4, 2009; accepted October 7, 2009. Prepublished online asBlood First Edition paper, October 30, 2009; DOI 10.1182/blood-2009-08-236935.

The publication costs of this article were defrayed in part by page charge

payment. Therefore, and solely to indicate this fact, this article is herebymarked ‘‘advertisement’’ in accordance with 18 USC section 1734.

© 2010 by The American Society of Hematology

238 BLOOD, 14 JANUARY 2010 � VOLUME 115, NUMBER 2

For personal use only.on February 11, 2018. by guest www.bloodjournal.orgFrom

http://www.bloodjournal.org/

http://www.bloodjournal.org/site/subscriptions/ToS.xhtml

circulating 17-�-estradiol (E2) regulate cellular differentiation andfunction. Indeed, elevated E2 levels decrease lymphopoiesis invivo by depleting primitive hematopoietic progenitors.19 E2 andER� promote murine and human DC differentiation mediated byGM-CSF.20-22 We demonstrated that E2 specifically promotes theGM-CSF–mediated differentiation of murine CD11c� CD11bint

Ly6C� Langerin� or � DCs, a population that may represent in vivopopulations of tissue or inflammatory DCs.7 Estradiol acting viaER�, but not ER�, was required for the development of thisCD11bint Ly6C� DC population from highly purified MPs (Lin�

c-kithi sca-1� IL-7R�� flt3�),17 but the molecular mechanism ofER� action was unknown.

We now report that E2/ER� signaling increases Irf4 mRNA andprotein expression in differentiating MPs and CD11c� precursors,and promotes the development of the CD11cint Ly6C� DC subsetexpressing the highest levels of IRF4. Enforced expression of Irf4cDNA in differentiating ER��/� BM cells restored the develop-ment of the E2/ER�-dependent CD11bint Ly6C� DC population,indicating that sufficiently high levels of IRF4 alleviate therequirement for ER� signaling during GM-CSF–mediated DCdifferentiation. Thus, an elevated amount of cellular IRF4 expres-sion, which can be induced by E2/ER� signaling, is required forCD11b� and Langerin� DC differentiation mediated by GM-CSF.

Methods

Mice

Female C57BL/6 mice (CD45.2�) and congenic CD45.1� C57BL/6 mice(8 to 12 weeks old) were purchased from the NCI Animal ProductionProgram. ER�-deficient (B6.129-Esr1tm1KskN10) mice from JAX were bredat Oklahoma Medical Research Foundation. The Oklahoma MedicalResearch Foundation Institutional Animal Care and Use Committeeapproved the studies.

GM-CSF–mediated DC differentiation

The GM-CSF–driven culture model for DC differentiation, in which E2levels or ER signaling are manipulated, was used as described.17 Cultureswere initiated from total BM cells, Lin� BM cells, or purified MPs.Standard (hormone-replete) culture medium was RPMI, 10% fetal bovineserum (FBS). Steroid hormone-deficient culture medium was phenol redfree RPMI, 10% charcoal dextran stripped FBS (Omega). E2 (Sigma-Aldrich) was dissolved in EtOH (vehicle), or was in water-soluble form ascyclodextrin-encapsulated E2 with cyclodextrin as vehicle, and added to afinal concentration of 0.1nM to 1nM. ICI 182,780 was dissolved in DMSO(vehicle) and added to a final concentration of 100nM.

Flow cytometry and myeloid progenitor isolation

Cells were prepared for flow cytometry as described.17 The goat anti-IRF4antiserum M-17 (Santa Cruz Biotechnology) was detected with donkeyanti–goat Ig-Cy3, and isotype control goat IgG, or anti-IRF4 Ab preblockedwith cognate peptide, controlled for the specificity of binding.8 Theanti-Langerin mAb L31 was biotinylated and detected with streptavidin-allophycocyanin.23 Samples were run on an LSRII instrument (BectonDickinson Biosciences) and analyzed with FlowJo software Version 8.8.5(TreeStar). Lin� cells and MPs were isolated as described.17

BM chimeric mice

Mixed ER��/ER��/� BM chimeric mice were generated by transferringequal numbers of ER��CD45.1� and ER��/�CD45.2� BM cells intolethally irradiated [CD45.1xCD45.2]F1 recipients as described.24 On days 21to 24 after reconstitution, BM was isolated and placed into GM-CSF–

driven DC differentiation cultures, or DC populations in BM were analyzeddirectly ex vivo by flow cytometry.

Microarrays

MPs were incubated with 1nM E2 or vehicle for variable time periodsbetween 0 and 72 hours. Biotinylated amplified RNA was produced from175 ng of total RNA per sample using an Illumina TotalPrep RNAAmplification Kit (Ambion). Amplified RNA was hybridized overnight at58°C to Sentrix Mouse-6 Expression BeadChips Version 1.1 (Illumina).These arrays contain 50-mer oligonucleotides coupled to beads that aremounted on glass slides. Each bead has an approximately 20- to 30-foldredundancy. Microarrays were washed under high stringency, labeled withstreptavidin-Cy3, and scanned using an Illumina BeadStation 500 scanner.To gain statistical power, gene expression response over time wasparameterized through a “mixed model”25 according to the followingequation: Normalized Fluorescent Units � �*Time � �1*Trx ��2*Trx*Time, where �, �1, �2 are beta coefficients, Trx is Estrogen andNo Estrogen, and Time is in hours. The Trx*Time interaction P values wereadjusted with a False Discovery Rate (FDR).26 An FDR of 10% wasconsidered statistically significant. A first order autoregressive covariancematrix was used to account for the correlation structure inherent in thelongitudinal measurements of gene expression. All mixed model analysiswas performed in the SAS system Version 9.1.3.

qPCR

RNAand cDNAwere generated and quantitative real-time reverse transcriptase–polymerase chain reaction (qPCR) was done as described.17 Relativeexpression of genes was determined using the ��Ct method with normaliza-tion to Gapdh expression, which does not change with E2 stimulation.Specific primer sequences were: sense Gapdh 5� AGGTCGGTGTGAACG-GATTTG 3�, antisense Gapdh 5� TGTAGACCATGTAGTTGAGGTCA 3�;sense Irf4 5� GCCCAACAAGCTAGAAAG 3�, antisense Irf4 5� TCTCT-GAGGGTCTGGAAACT 3�; sense Irf8 5� GTTTACCGAATTGTC-CCCGAG 3�, antisense Irf8 5� CTCCTCTTGGTCATACCCATGTA 3�;Sense Pu.1 5� ATGTTACAGGCGTGCAAAATGG 3�, antisense Pu.1 5�TGATCGCTATGGCTTTCTCCA 3�. Id2 primers (sequences proprietary)were obtained from QIAGEN.

Retrovirus-mediated gene delivery

The Irf4 cDNA was cloned from murine DCs and inserted in front of theEgfp gene in the retroviral vector MiG.27 To generate virus, MiG wastransfected with pCL/Eco plasmid into 293T cells. Lin� BM cells fromER��/� mice were isolated and cultured for 16 hours in stem cell factor(50 ng/mL), IL-3 (20 ng/mL), and IL-6 (50 ng/mL). For viral transduction,1.5 � 105 Lin� BM cells were mixed with 2 mL of retroviral supernatantplus 10 g/mL polybrene in 12-well plates and centrifuged for 1 hour.Transduced Lin� cells were cultured in GM-CSF in E2-deficient mediumfor 5 days.

Statistical analyses

Statistical significance (P .05) of differences in IRF4 mean fluorescenceintensity (MFI) values was determined using unpaired t tests in Prismsoftware. Significant differences between ER�� and ER��/� DCs in mixedBM chimeras were determined using paired t tests.

Results

An early and brief exposure to estradiol significantly increasesDC differentiation

Two major subsets of CD11c� MHCII� DCs (CD11bhi Ly6C� andCD11bint Ly6C� Langerin� or �) differentiate from BM precursorsin GM-CSF–driven cultures.7 We previously showed that ER� andphysiologic amounts of E2 (0.1nM-1nM) were required for the

ER SIGNALING INCREASES IRF4 EXPRESSION 239BLOOD, 14 JANUARY 2010 � VOLUME 115, NUMBER 2




GM-CSF–mediated differentiation of the CD11c� CD11bint Ly6C�

subset from MPs.17 To determine the temporal window of E2exposure needed to augment DC differentiation, we incubated MPs(Lin� c-kithi sca-1� IL-7R�� flt3�) in standard (hormone-replete)medium supplemented with E2 (0.1nM) for various periods of time(6 hours to 96 hours) before blockade of ER signaling by additionof ICI 182,780, an ER antagonist that induces ER degradation.28

Cells were cultured for 7 days, and the percentage and numbers ofCD11c� MHCII� DCs were quantified by flow cytometry (Figure1A). A 6-hour E2 exposure was sufficient to augment CD11c� DCdevelopment approximately 2-fold with a marked increase in theCD11bint Ly6C� population (Figure 1B). Within 48 hours of E2exposure, the percentages of total differentiated CD11c� MHCII�

DCs and the CD11bint Ly6C� subset were comparable with that of a7-day (168-hour) E2 exposure. Within the CD11bint Ly6C� popula-tion, E2 exposure also increases the percentage of Langerin� DCs(Figure 1C). Thus, within 6 hours, E2/ER� signaling in MPs biasesthe developmental program initiated by GM-CSF toward develop-ment of the CD11c� CD11bint Ly6C� DC subset.

Estradiol increases Irf4 mRNA levels in myeloid progenitors

To identify genes induced by E2/ER� signaling, we performed amicroarray experiment in which MPs were incubated with

vehicle or E2 (1nM) for variable times between 6 hours and72 hours. This experiment identified Irf4 as an E2-inducedgene. We focused on IRF4 because it is critical for develop-ment of CD11c� CD11b� splenic DCs in vivo and in GM-CSF–driven cultures.

To confirm E2 induction of Irf4 mRNA, independently isolatedMPs were incubated with GM-CSF and 1nM E2 (or vehicle) inhormone-deficient medium for 3 to 48 hours before analysis of Irf4expression by qPCR. E2 induced a marked (� 3- to 4-fold over thevehicle control) increase in Irf4 mRNA by 3 hours, which contin-ued to increase throughout the 48-hour time point (to 6- to 7-foldover the vehicle control; Figure 2A). In contrast, in the absenceof E2, the GM-CSF–induced increase in Irf4 mRNA wassignificantly less and peaked at 6 hours. Due to these distinctkinetics, the difference in Irf4 mRNA levels in the absence orpresence of E2 at the early time points was 2-fold at 6 hours,with greater differences at 3 hours and 9 to 48 hours (Figure2B). These data show that upon stimulation with GM-CSF, ER�signaling induces greater and more sustained amounts of Irf4mRNA in MPs within 3 hours.

We investigated whether E2 exposure altered MP expression ofother transcription factors involved in DC differentiation. UnlikeIrf4, unstimulated MPs contained detectable levels of Irf8, Pu.1,

Figure 1. A 6-hour E2 exposure to myeloid progenitors yields asignificant increase in DCs after 7 days. (A) MPs were stimulatedwith GM-CSF and 0.1nM E2 in standard medium at time 0. At theindicated times (0-96 hours), ER signaling was blocked by ICI 182,780(100nM), such that E2 responsiveness was limited to the hour shown onthe x axis. All cells were analyzed by flow cytometry on day 7. Shownare the average and range of percentages (left panel) and numbers(right panel) of CD11c� MHCII� DCs in duplicate cultures. (B) Shownare the relative percentages of 2 DC subsets (CD11bhi Ly6C� andCD11bint Ly6C�) present in cultures harvested on day 7 after E2exposure for 0, 6, 48, or 168 hours. (C) Shown is the staining ofanti-Langerin mAb L31 in DCs in the absence or presence of E2.Langerin� DCs are within the CD11bint Ly6C� population. Data arerepresentative of 2 independent experiments.

240 CARRERAS et al BLOOD, 14 JANUARY 2010 � VOLUME 115, NUMBER 2




and Id2 mRNA. The mRNA levels of these factors did not changesignificantly ( 2-fold) within 24 hours of GM-CSF stimulation,nor in the presence of E2 (Figure 2C-E). Amounts of these3 mRNA decreased at 48 hours, but this did not depend on thepresence of E2. Therefore, ER� signaling rapidly and specificallyincreases Irf4 mRNA upon GM-CSF stimulation.

Estradiol increases IRF4 protein levels in differentiatingmyeloid progenitors

Within 24 hours, GM-CSF–stimulated MPs exposed to E2 showed a2-fold increase in IRF4 protein, relative to vehicle-treated MPs (Figure3A). An E2-induced increase in IRF4 protein was also detected

Figure 3. E2 exposure increases the amount of IRF4 proteinin differentiating MPs 2-fold by 24 hours. MPs were stimu-lated with GM-CSF in hormone-deficient medium plus 1nM E2or vehicle. (A) Shown is the binding of anti-IRF4 Ab to differenti-ating MPs in the absence (dotted line) or presence (solid line) ofE2 at 24 hours. The shaded histogram indicates the binding ofanti-IRF4 Ab preincubated with blocking peptide. The meanfluorescence intensity (MFI; with value for anti-IRF4 Ab bound toblocking peptide subtracted) of anti-IRF4 binding at 0 and24 hours is plotted. Data are representative of 2 experiments.(B) MPs were stimulated with GM-CSF in the presence of E2 orE2 plus ICI 182,780 (100nM). The amount of intracellular IRF4protein at 48 and 96 hours was assessed using flow cytometry.Shown are the MFI values (mean � SD) of anti-IRF4 binding(with value for anti-IRF4 Ab bound to blocking peptide sub-tracted) of cells in triplicate cultures. **P .01, n � 3.

Figure 2. E2 exposure markedly increases the amount ofIrf4 mRNA present in GM-CSF–stimulated myeloid pro-genitors. MPs were stimulated with GM-CSF and 1nM E2 orvehicle in hormone-deficient medium. At the indicated timepoints, the amount of gene-specific mRNA was quantifiedusing qPCR of the sample in triplicate. The relative expres-sion of each mRNA was calculated using the ��Ct method.(A) Irf4 mRNA was not present at time 0 and was increasedsignificantly in the presence of E2. (B) The fold increase inIrf4 mRNA due to the presence of E2 at early time points wasreproducible. Error bars represent the range in 2 indepen-dent experiments. (C) Irf8, (D) Id2, and (E) Pu.1 mRNA werepresent at time 0, as determined by the Ct values, and therelative amounts did not differ in the presence or absence ofE2. Data are representative of 2 to 4 independent experi-ments.





in undifferentiated CD11c� precursors at 48 and 96 hours(Figure 3B).

After 7 days of E2 exposure in cultures initiated from lineage-negative (Lin�) BM cells in hormone-deficient medium, CD11c�

precursors and fully differentiated CD11c� cells contained 2-foldmore IRF4 protein than vehicle-treated cells (Figure 4A).ICI 182,780 inhibited the increase in IRF4 expression in CD11c�

precursors that occurred in hormone-replete medium (Figure4B-E). Within the CD11c� cell fraction, the CD11bint Ly6C� DCsubset, whose appearance is inhibited by ICI 182,780, expressed2-fold more IRF4 than the CD11bhi Ly6C� DC subset (Figure4D-E). ER signaling also increased expression of IRF4 in theCD11bhi Ly6C� DC subset (Figure 4E). These data show that whenfully differentiated, the E2/ER�-dependent CD11bint Ly6C� DCsubset normally expresses 2-fold higher levels of IRF4 than theCD11bhi Ly6C� DC subset, suggesting that higher levels of IRF4protein are required for their development and maintenance.

ER� signaling in hematopoietic cells increases IRF4expression in a cell-autonomous manner

Comparison of differentiating ER�� and ER��/� BM cells showed thaton day 7, ER�� DCs (composed of CD11bint Ly6C� and CD11bhi

Ly6C� DCs) expressed 2-fold more IRF4 protein than ER��/� DCs(composed primarily of CD11bhi Ly6C� DCs; Figure 5A-D). One pos-sibility was that DC precursors in ER��/� mice are defective due to theabsence of factors supplied by estrogen-responsive BM stromal cells invivo.29 To determine whether the effect of ER� signaling on IRF4expression was intrinsic to hematopoietic DC precursors, we generatedER��/ER��/� mixed BM chimeric mice, and BM cells from thesechimeric mice were placed into GM-CSF–driven cultures. After 7 days,ER�� cells expressed higher amounts of IRF4 and had developed intoboth CD11bhi and CD11bint DC subsets, whereas ER��/� cells ex-pressed lower amounts of IRF4 and had developed primarily intoCD11bhi DCs (Figure 5E,F). These data show that ER� signaling acts ina cell-autonomous manner in DC precursors to increase expression ofIRF4. Thus, E2/ER� signaling in MPs or CD11c� DC precursors leadsto a reproducible 2-fold increase in IRF4 protein by 24 hours, which ismaintained throughout the 7-day culture period and in fullydifferentiated CD11c� CD11bint Ly6C� cells.

Enforced expression of IRF4 rescues the development of theER�-dependent DC population from ER��/� BM precursors

To determine whether elevated amounts of IRF4 protein weresufficient to induce differentiation of the CD11bint Ly6C� DC

Figure 4. E2/ER� signaling promotes development of DCs that harbor increased amounts of IRF4 protein. (A) Lin� BM cells were incubated with 1nM E2 or vehicle inhormone-deficient medium. On day 7, IRF4 protein expression in CD11c� and CD11c� cells was determined. Shown are: binding of anti-IRF4 Ab to cells from vehicle-treatedcultures (dotted line); binding of anti-IRF4 Ab to cells from E2-treated cultures (solid line); binding of isotype control IgG on cells from the E2-treated cultures (shaded gray). MFIvalues for anti-IRF4 binding with or without E2 are indicated (with value for isotype control IgG subtracted). Data are representative of 3 experiments. (B-E) MPs were incubated in standardmedium with ICI 182,780 (100nM) or vehicle. On day 7, the amount of IRF4 protein expression in CD11c� and CD11c� cells was determined. (B) CD11c expression on all cells; thepercentages of CD11c� and CD11c� cells are indicated. (C) Anti-IRF4 binding on CD11c� and CD11c� cells in the presence of ICI 182,780 (dotted line) or vehicle (solid line). The bindingof isotype control IgG on cells in vehicle-treated cultures is indicated (shaded gray). MFI values for anti-IRF4 binding with or without ICI 182,780 are indicated (with value for isotype controlIgG subtracted). (D) Within CD11c� cells, CD11bint DCs express higher levels of IRF4 than CD11bhi DCs. The percentage of DCs within each gate is indicated. (E) MFI values for anti-IRF4binding with or without ICI 182,780 are indicated for each DC subset. Data are representative of 2 experiments.





subset in the absence of ER� signaling, we expressed theIrf4 cDNA in Lin� ER��/� BM cells (Figure 6). Lin� ER��/�

BM cells were transduced with MiG-GFP or MiG-IRF4-GFPretroviruses and subsequently stimulated with GM-CSF. After5 days, the phenotypes of cells in GFP� and GFP� fractionswere determined by flow cytometry. Enforced expression ofthe Irf4 cDNA led to a 5-fold increase in the amount ofintracellular IRF4 protein in GFP� cells, relative to GFP� cellsin MIG-IRF4-GFP–transduced cultures (Figure 6H) or to cells inthe MIG-GFP–transduced cultures (Figure 6B). This was as-sociated with a marked increase in the percentage of CD11c�

cells (Figure 6I-K). The difference in percentage of CD11c�

cells in GFP� and GFP� MiG-GFP–transduced cultures (Figure

6C,E) was not reproducible. While the majority of DCs wasCD11bhi Ly6C� in the MiG-GFP–transduced cultures (Figure6C-F) and in the GFP� fraction of the MiG-IRF4-GFP–transduced cultures (Figure 6I-J), the majority of DCs in theGFP� fraction of the MiG-IRF4-GFP cultures was CD11bint

Ly6C� (Figure 6K-L). The CD11bint Ly6C� population con-tained both Langerin� and Langerin� DCs (not shown).Thus, increased expression of the Irf4 cDNA in differentiatingER��/� Lin� cells restores the development of the E2/ER�-dependent CD11bint Ly6C� DC population, indicating thatsufficiently high levels of IRF4 substitute for the requirementfor E2/ER� signaling during GM-CSF–mediated DCdifferentiation.

Figure 5. E2/ER� signaling acts in a cell-autonomous manner to increase expression of IRF4. (A-D) WT or ER��/� BM cells were incubated with GM-CSF in standardmedium for 7 days. (A) The percentage of CD11c� CD11b� DCs was determined. (B) WT CD11c� cells harbor both CD11bhi Ly6C� and CD11bint Ly6C� subsets, whereasER��/� CD11c� cells primarily harbor the CD11bhi Ly6C� subset. (C) Binding of anti-IRF4 Ab to WT (solid line) or ER��/� (dotted line) cells. The binding of isotype control IgGon WT cells is indicated (shaded gray). MFI values for anti-IRF4 binding to cells are indicated (with value for isotype control IgG subtracted). (D) The average fold change inIRF4 expression (anti-IRF4 Ab MFI) due to ER� in CD11c� and CD11c� is plotted; error bars represent the standard error in 5 independent experiments. (E-F) BM fromER��/ER��/� BM chimeric mice was incubated with GM-CSF in standard medium for 7 days. (E) The percentage of CD11c� DCs in the WT/CD45.1 and ER��/�/CD45.2 cellfractions was determined. (F) The bar graph shows MFI values of anti-IRF4 Ab binding to CD11c� and CD11c� cells, averaged (mean � SEM) from 4 BM chimeric micegenerated from the same BM transfer. Identical results were obtained upon analyses of 4 mice from a second BM chimera experiment. ***P .001; *P .05, n � 4.





ER� expression promotes CD11b� DC development duringinflammation in vivo

Our results in the GM-CSF–driven culture model suggest that ER�signaling promotes new DC differentiation during inflammation invivo. To determine the relative efficiency of DC differentiationfrom ER�� and ER��/� BM precursors in vivo, we analyzed theCD11c� CD11b� DC subset present in BM of mixed ER��/ER��/� BM chimeric mice at an early time point (� day 23) afterreconstitution when myeloid cells, but few lymphocytes, havedeveloped. In this model, DC development occurs in the postradia-tion inflammatory environment, which is characterized by elevatedserum IL-6 and high levels of costimulatory molecules on newlydifferentiated DCs, and normal levels of serum E2 (E.C., S. Bajana,H. Agrawal, S.K., manuscript in preparation). In the BM of thesechimeric mice, newly differentiated CD11b� DCs were derivedpreferentially from ER�� donor BM cells (� 2:1 ratio of wild type[WT] to ER��/� DCs; Figure 7). Similar results were obtainedupon analyses of splenic and lymph node DC populations in thesechimeric mice (E.C., S. Bajana, H. Agrawal, S.K., manuscript in

preparation). Thus, during radiation-induced inflammation in vivo,ER� signaling in response to physiologic levels of endogenousestrogens promotes CD11b� DC development from short-termrepopulating BM progenitors.

Discussion

We have shown that an elevated amount of IRF4 protein,induced by ER� signaling, promotes the GM-CSF–mediateddifferentiation of CD11bint Ly6C� DCs from MPs. There is aprecedent for high and low amounts of IRF4 protein directingdistinct transcriptional programs in differentiating cells. Dif-ferentiating B cells expressed graded amounts of IRF4 protein,and high or low amounts of IRF4 specified plasma cell orgerminal center gene expression programs, respectively.11 PU.1pairs with IRF4 to regulate genes and, like IRF4, is requiredfor the development of splenic CD11b� DCs.3,12 Quantita-tively different amounts (� 4-fold) of PU.1 in hematopoietic

Figure 6. Enforced IRF4 expression directs the development of the ER�/E2-dependent CD11bint Ly6C� DC subset in the absence of ER� signaling. Lin� ER��/� BMcells were transduced with MiG-GFP (A-F) or MiG-IRF4-GFP (G-L). Transduced cells were incubated in GM-CSF for 5 days before assessment of DC subsets by flowcytometry. IRF4 expression was assessed in GFP� (dotted line) and GFP� (solid line) fractions in (A-B) MiG-GFP– or (G-H) MiG-IRF4-GFP– transduced cells. The MFI ofanti-IRF4 binding to GFP� and GFP� cells is indicated in panels B and H. The shaded histogram indicates the binding of anti-IRF4 Ab precincubated with blocking peptide. InMiG-GFP–transduced cell cultures, CD11c� DCs in the GFP� (C) and GFP� (E) cell fractions are primarily CD11bhi Ly6C� (panels D and F gated on CD11c� cells shown inpanels C and E). The percentage of cells with the bar or box gates is indicated. In MiG-IRF4-GFP–transduced cultures, CD11c� DCs in the GFP� cell fraction (I) are alsoprimarily CD11bhi Ly6C� (J, gated on CD11c� cells shown in panel I). In contrast, the percentage of CD11c� DCs in the GFP� fraction (K) is significantly increased, and themajority of DCs is CD11bint Ly6C� (L, gated on CD11c� cells shown in panel K). Data are representative of 4 independent experiments.





progenitors also specify distinct myeloid and lymphoid cellfates, in some cases because the ratio of PU.1 to othertranscription factors is altered.14,30 This supports the signifi-cance of a 4- to 7-fold difference in IRF4 levels in MPs within3 to 9 hours of E2 exposure, and suggests that the ER�/E2-induced changes in IRF4 expression could lead to alteredinteractions with other transcription factors and/or to distincttranscriptional programs.

IRF4 acts alone by binding ISRE or is recruited to compositeIRF4/PU.1 binding sites by phosphorylated PU.1.12 Our data showthat in MPs, Pu.1 mRNA changed little in response to GM-CSF orE2 stimulation over the 24-hour time period in which Irf4 mRNA issignificantly increased. Therefore, it is possible that increasedamounts of IRF4 protein alter the recruitment of IRF4/PU.1complexes to target genes, as demonstrated for IRF8/PU.1 com-plexes.31 Autoregulation of the Irf4 gene also could be amplified byER� signaling because IRF4/PU.1 complexes bind to the Irf4promoter.10 Alternately, elevated levels of IRF4 might allow IRF4to act independently of PU.1 to regulate genes that promoteCD11b� DC differentiation.

ER� binds directly to DNA at consensus estrogen responseelements (EREs) proximal to genes.32 Algorithms within the ECRBrowser (www.dcode.org) at the National Center for Biotechnol-ogy Information (NCBI) identified 4 conserved EREs proximal tothe murine Irf4 gene. ER� also may complex with other factorssuch as Sp-1, NF-Y, FoxA1/HNF3�, or AP-1,18 and binding sitesfor these factors are also present proximal to the Irf4 gene.Unbiased genome-wide chromatin binding (ChIP) and sequencingapproaches to identify ER� binding sites in E2-stimulated cellsrevealed that many ER� binding sites and EREs are more than 5 kbaway from target genes.33 Intriguingly, ER� bound to a region thatis approximately 12 kb proximal to the start site of the human IRF4gene.34 This region contains a consensus ERE site, which isconserved in the same location 5� to the murine Irf4 gene. Thisinformation is consistent with the hypothesis that E2-bound ER�participates in a chromatin-modifying complex that directly regu-lates the Irf4 gene.

Alternately, ER� signaling may modulate expression or activityof an intermediate molecule such as nuclear factor– B (NF- B).Indeed, GM-CSF stimulated IRF4 expression in differentiatinghuman monocytes by activating NF- B,10 and the NF- B subunitRel induced IRF4 expression in lymphocytes.35 RelB is alsoimportant for the development of IRF4-dependent CD11b� splenicDCs.36,37 ER interactions with NF- B in other cell types have beenreported.38

In the GM-CSF–driven cultures, E2/ER� signaling promotesthe development of CD11bint DCs, some of which are Lange-rin�. These could be the correlates of either epidermal Lange-rin� DCs or populations of CD11b� and CD103� interstitialDCs found in the dermis and lung. CD103 is expressed on asignificant portion of both the CD11bhi Ly6C� and CD11bint

Ly6C� DC subsets in our cultures (data not shown), so we couldnot use differential CD103 expression to correlate them withinterstitial DC populations. A role for IRF4 in the developmentof these tissue DC populations was not studied in publishedreports of DC development in IRF4�/� mice.8,9 Our data nowlink IRF4 to the development of one or more of these tissue DCsubsets in vivo.

The higher amount of IRF4 protein in E2-dependent CD11bint

Ly6C� DCs may have functional implications. Fully developedhuman DCs, CD11b� murine DCs, and macrophages retainexpression of IRF4, and IRF4 negatively regulates Toll-likereceptor signaling.39,40 Thus, IRF4hi DCs that develop in thecontext of E2/ER� signaling may have a greater capacity toregulate the magnitude of immune responses or promotetolerance.

During inflammation and autoimmune disease, elevatedGM-CSF directs the development of new DCs from monocytesor other proliferating precursors that infiltrate tissues andsecondary lymphoid organs.5 Increased estradiol synthesis alsohas been linked to inflammation.41,42 Our data show that onephysiologic factor that regulates de novo inflammatory DCdifferentiation is E2/ER� signaling, which leads to increasedexpression of the IRF4 transcription factor that is critical toCD11b� DC development.

Acknowledgments

We thank J. Bass and D. Hamilton in the Oklahoma MedicalResearch Foundation flow cytometry core facility, Drs H. Agrawaland S. Bajana for assistance with BM chimeras, and our OklahomaMedical Research Foundation colleagues for helpful discussions.

This work was supported by the Oklahoma Center for theAdvancement of Science & Technology grants HR06-157 (S.K.)and AR081-006 (M.C.); and National Institutes of Health grantsAI079616 (S.K.), RR020143 (E.C., M.C., S.K.), RR015577 (S.K.,M.C.), and RR16478 (M.B.F.).

Authorship

Contribution: E.C. designed and performed research, analyzedand interpreted data, and wrote the manuscript; S.T. performedresearch and analyzed and interpreted data; M.B.F. designedresearch and analyzed and interpreted data; N.K. performedstatistical analysis; J.O. and A.S. performed research; M.C.analyzed and interpreted data; C.G.P. contributed vital newreagent; J.A.-I. designed research and analyzed and interpreteddata; and S.K. designed research, analyzed and interpreted data,and wrote the manuscript.

Conflict-of-interest disclosure: The authors declare no compet-ing financial interests.

Correspondence: Susan Kovats, Arthritis & Immunology Pro-gram, Oklahoma Medical Research Foundation, 825 NE 13th St,Oklahoma City, OK 73104; e-mail: [email protected].

Figure 7. ER� expression promotes DC development during inflammation invivo. Using flow cytometry, conventional CD11c� CD11b� DCs (cDCs) wereidentified in BM of ER��/ER��/� BM chimeric mice on days 21 to 24 after reconstitu-tion, a postradiation inflammatory environment. After gating on this DC population,the percentage of cells bearing CD45.1 (WT ER��) or CD45.2 (ER��/�) wasdetermined. Shown are the (A) relative percentage and (B) number of cDCs derivedfrom WT and ER��/� donor BM in individual mice (n � 13), with the mean and SEMvalues indicated by the bars. Significant differences in the percentage and numbersof WT and ER��/� DCs were calculated using paired t tests. The total number of BMcells in individual mice varied between 4 � 106 and 1 � 107.





References

1. Shortman K, Naik SH. Steady-state and inflam-matory dendritic-cell development. Nat Rev Im-munol. 2007;7(1):19-30.

2. Merad M, Ginhoux F, Collin M. Origin, homeosta-sis and function of Langerhans cells and otherlangerin-expressing dendritic cells. Nat Rev Im-munol. 2008;8(12):935-947.

3. Merad M, Manz MG. Dendritic cell homeostasis.Blood. 2009;113(15):3418-3427.

4. Geissmann F, Auffray C, Palframan R, et al.Blood monocytes: distinct subsets, how they re-late to dendritic cells, and their possible roles inthe regulation of T-cell responses. Immunol CellBiol. 2008;86(5):398-408.

5. Hamilton JA. Colony-stimulating factors in inflam-mation and autoimmunity. Nat Rev Immunol.2008;8(7):533-544.

6. Takahara K, Omatsu Y, Yashima Y, et al. Identifi-cation and expression of mouse Langerin(CD207) in dendritic cells. Int Immunol. 2002;14(5):433-444.

7. Mao A, Paharkova-Vatchkova V, Hardy J, MillerMM, Kovats S. Estrogen selectively promotes thedifferentiation of dendritic cells with characteris-tics of Langerhans cells. J Immunol. 2005;175(8):5146-5151.

8. Tamura T, Tailor P, Yamaoka K, et al. IFN regula-tory factor-4 and -8 govern dendritic cell subsetdevelopment and their functional diversity. J Im-munol. 2005;174(5):2573-2581.

9. Suzuki S, Honma K, Matsuyama T, et al. Criticalroles of interferon regulatory factor 4 inCD11bhighCD8alpha- dendritic cell development.Proc Natl Acad Sci U S A. 2004;101(24):8981-8986.

10. Lehtonen A, Veckman V, Nikula T, et al. Differen-tial expression of IFN regulatory factor 4 gene inhuman monocyte-derived dendritic cells andmacrophages. J Immunol. 2005;175(10):6570-6579.

11. Sciammas R, Shaffer AL, Schatz JH, Zhao H,Staudt LM, Singh H. Graded expression of inter-feron regulatory factor-4 coordinates isotypeswitching with plasma cell differentiation. Immu-nity. 2006;25(2):225-236.

12. Marecki S, Fenton MJ. The role of IRF-4 in tran-scriptional regulation. J Interferon Cytokine Res.2002;22(1):121-133.

13. Dakic A, Wu L, Nutt SL. Is PU. 1 a dosage-sensitiveregulator of haemopoietic lineage commitmentand leukaemogenesis? Trends Immunol. 2007;28(3):108-114.

14. Laslo P, Spooner CJ, Warmflash A, et al. Multilin-eage transcriptional priming and determination ofalternate hematopoietic cell fates. Cell. 2006;126(4):755-766.

15. Chen Q, Yang W, Gupta S, et al. IRF-4-bindingprotein inhibits interleukin-17 and interleukin-21

production by controlling the activity of IRF-4transcription factor. Immunity. 2008;29(6):899-911.

16. Gauzzi MC, Purificato C, Conti L, Adorini L,Belardelli F, Gessani S. IRF-4 expression in thehuman myeloid lineage: up-regulation duringdendritic cell differentiation and inhibition by1alpha,25-dihydroxyvitamin D3. J Leukoc Biol.2005;77(6):944-947.

17. Carreras E, Turner S, Paharkova-Vatchkova V,Mao A, Dascher C, Kovats S. Estradiol acts di-rectly on bone marrow myeloid progenitors to dif-ferentially regulate GM-CSF or Flt3 ligand-mediateddendritic cell differentiation. J Immunol. 2008;180(2):727-738.

18. Heldring N, Pike A, Andersson S, et al. Estrogenreceptors: how do they signal and what are theirtargets. Physiol Rev. 2007;87(3):905-931.

19. Medina KL, Garrett KP, Thompson LF, Rossi MI,Payne KJ, Kincade PW. Identification of veryearly lymphoid precursors in bone marrow andtheir regulation by estrogen. Nat Immunol. 2001;2(8):718-724.

20. Paharkova-Vatchkova V, Maldonado R, Kovats S.Estrogen preferentially promotes the differentia-tion of CD11c� CD11b(intermediate) dendriticcells from bone marrow precursors. J Immunol.2004;172(3):1426-1436.

21. Douin-Echinard V, Laffont S, Seillet C, et al. Es-trogen receptor alpha, but not beta, is required foroptimal dendritic cell differentiation and [cor-rected] CD40-induced cytokine production. J Im-munol. 2008;180(6):3661-3669.

22. Komi J, Lassila O. Nonsteroidal anti-estrogensinhibit the functional differentiation of humanmonocyte-derived dendritic cells. Blood. 2000;95(9):2875-2882.

23. Cheong C, Idoyaga J, Do Y, et al. Production ofmonoclonal antibodies that recognize the extra-cellular domain of mouse langerin/CD207. J Im-munol Methods. 2007;324(1-2):48-62.

24. Vremec D, Pooley J, Hochrein H, Wu L, Shortman K.CD4 and CD8 expression by dendritic cell sub-types in mouse thymus and spleen. J Immunol.2000;164(6):2978-2986.

25. Littell R, Milliken G, Stroup W, Wolfinger R,Schabenberger O. SAS for Mixed Models. 2006.Cary, NC: SAS Institute Inc.

26. Benjamini Y, Hochberg Y. Controlling the falsediscovery rate: a practical and powerful approachto multiple testing. J R Stat Soc Ser B. 1995;57:289-300.

27. Hernandez-Hoyos G, Anderson MK, Wang C,Rothenberg EV, Alberola-Ila J. GATA-3 expres-sion is controlled by TCR signals and regulatesCD4/CD8 differentiation. Immunity. 2003;19(1):83-94.

28. Long X, Nephew KP. Fulvestrant (ICI 182780)-dependent interacting proteins mediate immobili-

zation and degradation of estrogen receptor-alpha. J Biol Chem. 2006;281(14):9607-9615.

29. Yokota T, Oritani K, Garrett KP, et al. Solublefrizzled-related protein 1 is estrogen inducible inbone marrow stromal cells and suppresses theearliest events in lymphopoiesis. J Immunol.2008;181(9):6061-6072.

30. Nutt SL, Metcalf D, D’Amico A, Polli M, Wu L. Dy-namic regulation of PU. 1 expression in multipo-tent hematopoietic progenitors. J Exp Med. 2005;201(2):221-231.

31. Tamura T, Thotakura P, Tanaka TS, Ko MS, OzatoK. Identification of target genes and a unique ciselement regulated by IRF-8 in developing macro-phages. Blood. 2005;106(6):1938-1947.

32. O’Lone R, Frith MC, Karlsson EK, Hansen U.Genomic targets of nuclear estrogen receptors.Mol Endocrinol. 2004;18(8):1859-1875.

33. Kininis M, Kraus WL. A global view of transcrip-tional regulation by nuclear receptors: gene ex-pression, factor localization, and DNA sequenceanalysis. Nucl Recept Signal. 2008;6:e005.

34. Carroll JS, Meyer CA, Song J, et al. Genome-wide analysis of estrogen receptor binding sites.Nat Genet. 2006;38(11):1289-1297.

35. Grumont RJ, Gerondakis S. Rel induces inter-feron regulatory factor 4 (IRF-4) expression inlymphocytes: modulation of interferon-regulatedgene expression by rel/nuclear factor kappaB.J Exp Med. 2000;191(8):1281-1292.

36. Wu L, D’Amico A, Winkel KD, Suter M, Lo D,Shortman K. RelB is essential for the develop-ment of myeloid-related CD8alpha- dendritic cellsbut not of lymphoid-related CD8alpha� dendriticcells. Immunity. 1998;9(6):839-847.

37. Burkly L, Hession C, Ogata L, et al. Expression ofrelB is required for the development of thymicmedulla and dendritic cells. Nature. 1995;373(6514):531-536.

38. Kalaitzidis D, Gilmore TD. Transcription factorcross-talk: the estrogen receptor and NF-kappaB.Trends Endocrinol Metab. 2005;16(2):46-52.

39. Negishi H, Ohba Y, Yanai H, et al. Negative regu-lation of Toll-like-receptor signaling by IRF-4.Proc Natl Acad Sci U S A. 2005;102(44):15989-15994.

40. Honma K, Udono H, Kohno T, et al. Interferonregulatory factor 4 negatively regulates the pro-duction of proinflammatory cytokines by macro-phages in response to LPS. Proc Natl Acad SciU S A. 2005;102(44):16001-16006.

41. Cutolo M, Villaggio B, Seriolo B, et al. Synovialfluid estrogens in rheumatoid arthritis. Autoim-mun Rev. 2004;3(3):193-198.

42. Salama SA, Kamel MW, Diaz-Arrastia CR, et al.Effect of tumor necrosis factor-alpha on estrogenmetabolism and endometrial cells: potential phys-iological and pathological relevance. J Clin Endo-crinol Metab. 2009;94(1):285-293.





online October 30, 2009 originally publisheddoi:10.1182/blood-2009-08-236935

2010 115: 238-246

Centola, Chae Gyu Park, Amie Simmons, José Alberola-Ila and Susan KovatsEsther Carreras, Sean Turner, Mark Barton Frank, Nicholas Knowlton, Jeanette Osban, Michael increasing expression of the transcription factor IRF4Estrogen receptor signaling promotes dendritic cell differentiation by

http://www.bloodjournal.org/content/115/2/238.full.htmlUpdated information and services can be found at:

(5560 articles)Immunobiology and Immunotherapy (3483 articles)Hematopoiesis and Stem Cells

Articles on similar topics can be found in the following Blood collections

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requestsInformation about reproducing this article in parts or in its entirety may be found online at:

http://www.bloodjournal.org/site/misc/rights.xhtml#reprintsInformation about ordering reprints may be found online at:

http://www.bloodjournal.org/site/subscriptions/index.xhtmlInformation about subscriptions and ASH membership may be found online at:

Copyright 2011 by The American Society of Hematology; all rights reserved.of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society


http://www.bloodjournal.org/content/115/2/238.full.html

http://www.bloodjournal.org/cgi/collection/hematopoiesis_and_stem_cells

http://www.bloodjournal.org/cgi/collection/immunobiology

http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests

http://www.bloodjournal.org/site/misc/rights.xhtml#reprints

http://www.bloodjournal.org/site/subscriptions/index.xhtml





estrogen receptor signaling promotes dendritic cell differentiation by

Documents