Effects of pH in irrigation water on plant growth and flower quality in herbaceous peony (Paeonia lactiflora Pall.)

Download Effects of pH in irrigation water on plant growth and flower quality in herbaceous peony (Paeonia lactiflora Pall.)

Post on 08-Dec-2016

215 views

Category:

Documents

3 download

TRANSCRIPT

Scientia Horticulturae 154 (2013) 4553Contents lists available at SciVerse ScienceDirectScientia Horticulturaejourna l h o me page: www.elsev ier .comEffects th herbacDaqiu ZhJiangsu Key Lab Yangza r t i c lArticle history:Received 11 DReceived in reAccepted 25 FKeywords:Herbaceous pepHFlower qualityGene expressionall.) i to dewatemeteng char, hypH 4.ive enat thpH in irrigation water, and the most serious stress to P. lactiora was caused under pH 10.0 treatment.Compared with plants irrigated with water at pH 7.0, 26.78% and 27.82% reduction were found in owerdiameter and ower fresh weight of plants irrigated with water at pH 4.0. Likely, ower color fade underpH 4.0 treatment was attributed to decreased anthocyanin content and increased pH value of petal, whichwere coordinately regulated by nine anthocyanin biosynthetic genes and a vacuolar Na+/H+ antiporter1gene (NHX1), respectively. The results would provide a theoretical guidance for the use of irrigation water1. IntroduHerbacePaeoniacea2002), and as China, NWaltona etower whicers with trhistory. Owtic, colorfulimportant mple all overbeginning gcultivationsapplied in udevelopme CorresponE-mail add1 These auth0304-4238/$ http://dx.doi.oin practical production of P. lactiora. 2013 Elsevier B.V. All rights reserved.ctionous peony (Paeonia lactiora Pall.), belonging to thee family, originates in temperate Eurasia (Eason et al.,is widely cultivated in many countries and areas, suchew Zealand, Europe, North America (Jia et al., 2008; al., 2010). In China, P. lactiora is a traditional famoush has shared the name the king and minister of ow-ee peony and has more than 4000 years of cultivationing to its excellent ornamental values including gigan-, chic-type and fragrant owers as well as extremelyedicinal values, it has been deeply favored by peo- the world. Meanwhile, it has been expanded from thearden cultivation to the potted ower and cut ower. Moreover, it has been paid more attention and widelyrban green space with the advance of ower industrynt.ding author. Tel.: +86 514 87997219; fax: +86 514 87347537.ress: taojun@yzu.edu.cn (J. Tao).ors contributed equally to this work.With the acceleration of urbanization, industrial and miningenterprises develop rapidly, which is followed by all kinds ofpollutant discharge making water polluted. The lack of depend-able supplies of good-quality water in many regions has becomea concern as the competition among agricultural, urban, indus-trial, environmental, and recreational groups continues to increase(Valdez-Aguilar et al., 2009). The change of pH value is an importantfeature of polluted water. Predecessors have reported the effectsof different pH treatments on plant growth in Metroxylon sagu(Anugoolprasert et al., 2012), Camellia sinensis (Ruan et al., 2007),Chlamydomonas acidophila (Gerloff-Elias et al., 2005), Anabaenopsiselenkini (Santos et al., 2011) and so on, and their results are not iden-tical. Plants irrigated with pH changed water will bring the changeof rhizosphere pH, which affects plant growth including morphol-ogy, photosynthesis, nutrient absorption (Clark and Burge, 2002;Gerloff-Elias et al., 2005; Ruan et al., 2007; Valdez-Aguilar et al.,2009; Kang et al., 2011; Santos et al., 2011; Anugoolprasert et al.,2012). But for ower plants, the ornamental value of ower qual-ity, especially ower color is more concerned besides plant growth.However, little is known about the effects of pH in irrigation wateron ower color performance.Flower color is determined by two major factors, pigmentspresent in the vacuole and intra-vacuolar environment (vacuolar see front matter 2013 Elsevier B.V. All rights reserved.rg/10.1016/j.scienta.2013.02.023 of pH in irrigation water on plant groweous peony (Paeonia lactiora Pall.)ao1, Zhaojun Hao1, Jing Wang, Jun Tao oratory of Crop Genetics and Physiology, College of Horticulture and Plant Protection, e i n f oecember 2012vised form 23 February 2013ebruary 2013onya b s t r a c tHerbaceous peony (Paeonia lactiora Pvalues. The objective of this study wasaffected by extreme pH in irrigation a decrease in all morphological parawaters. Physiological indices includimalondialdehyde (MDA), soluble sugresponse to irrigation with waters at Moreover, activities of three protecttreatments. These results indicated th/ locate /sc ihor t iand ower quality inhou University, Yangzhou 225009, PR Chinas an excellent landscape plant because of its great ornamentaltermine if plant growth and ower quality of P. lactiora werer. Compared with the control (pH 7.0), P. lactiora exhibitedrs except leaf number when irrigated with pH 4.0 and 10.0lorophyll a, chlorophyll b, chlorophyll a+b, soluble protein,drogen peroxide (H2O2) and free proline were increased in0 and 10.0, while the decline was occurred in chlorophyll a/b.zymes were also decreased in response to pH 4.0 and 10.0e growth of P. lactiora was signicantly affected by extreme46 D. Zhao et al. / Scientia Horticulturae 154 (2013) 4553pH and metal ion content) (Reuveni et al., 2001). Several reportsdemonstrated the importance of vacuolar pH in determining owercolor (Asen et al., 1975; Markham and Ofman, 1993). Na+/H+antiporters (NHXs), membrane proteins, are localized in plasmamembrane of Na+ for Hgradient (Yaantiporter gsis thalianabeen identiica (Du et aHalostachys2012). Overplant vacuoating salt stLiu et al., 2blue coloramutant deuolar pH toet al., 2000results demin regulatinP. lactioChina to nostudies havwhen the ptheoretical we presentP. lactiora 2. Materia2.1. Plant MPotted Peld in thetection Coll(3230 N, 1growing suter, 1.72 g/k84.83 mg/kpeat moss were manafertilizers, a45 consisteAfter leaf ex(KClHCl) aand tap watof plant moleaves wereprotective eower qualliquid nitro2.2. MorphPlant hstick (Zhejistem diameshangliang determined2.3. PhysiolChloropwere deter(2000). Soluble protein, soluble sugar and hydrogen peroxide(H2O2) contents were measured by reagent kits (Nanjing JianchengBioengineering Institute, China), and anthocyanin content was per-formed with the method reported by Meng and Wang (2004).nall was hai Pugatotecttly, 0d exttractultinllectxidethe EC 1idatioC 1.ng Bowerer fandeasu werenta* anted aVossfect oL 9petaded repaed an nm.A exal RNotoc was xpreere ting tropholatioationer. 2catiwereThe and ith prim 5--CCmersand vacuolar membrane which catalyze the exchange+ across membranes using the proton electrochemicalmaguchi et al., 2003). In NHXs, the rst vacuolar Na+/H+ene (NHX) in higher plant was isolated from Arabidop- (Apse et al., 1999). Subsequently, a series of NHX haded from various plant species, including Zoysia japon-l., 2010), Salicornia brachiata (Anupama et al., 2011), caspica (Guan et al., 2011), Karelinia caspica (Liu et al.,expression and RNA interference of NHX suggested thatlar Na+/H+ antiporter played an essential role in allevi-ress (Apse et al., 1999; Qiao et al., 2007; An et al., 2008;012). Meantime, an increase in vacuolar pH enhancedtion of Japanese morning glory (Ipomoea nil), but in thecient in the NHX1 gene was unable to increase its vac- create the normal bright blue petals (Fukada-Tanaka; Yamaguchi et al., 2001; Ohnishi et al., 2005). Theseonstrated that the vacuolar NHX1 played a crucial roleg pH.ra can grow in different conditions from south-centralrthern China (Wang and Zhang, 2005). However, fewe compared the growth characteristics of P. lactioraH in irrigation water is changed. In order to provide aguidance for the use of irrigation water in P. lactiora,ed our work on the effects of pH in irrigation water onplant growth and ower quality in this study.ls and methodsaterials. lactiora cultivar Zifengyu was placed on an open germplasm repository of Horticulture and Plant Pro-ege, Yangzhou University, Jiangsu Province, P.R. China1925 E). These plants were potted in October 2009,bstrate was garden soil (29.83 g/kg soil organic mat-g total nitrogen, 13.87 mg/kg available phosphorus,g available potassium and pH 6.17) and pH balanced(Klasmann-Deilmann, Germany) (1:1, v/v), and theyged in accordance with the eld management withouts well as using tap water as irrigation water. Until 2012,nt growth plants were selected as the study materials.pansion, plants were irrigated thoroughly using pH 4.0nd pH 10.0 (KClNaOH) buffer solutions once a week,er (pH 7.0) was used as the control. After determinationrphological parameters in the full-bloom stage, their taken for determination of physiological indices andnzyme activities, owers were taken and used to studyity and color. All samples were immediately frozen ingen, and then stored at 80 C until analysis.ological parameters measurementseight and crown width were measured by meterang Yuyao Sanxin Measuring Tools Co., Ltd., China),ter was measured by micrometer scale (Taizhou Xin-Measuring Tools Co., Ltd., China), and leaf area was according to a paper weighing method.ogical indices determinationshyll, malondialdehyde (MDA) and free proline contentsmined according to the method reported by ZouAdditiowhich(Shangcentrif2.4. PrFirsgen anThe exthe reswas coSuperousing (POD: col ox(CAT: EJianche2.5. FlFlowance (Gwas mindicesInstruming L*, calcula1992; 2.6. Ef10 mto 1 g was adwere pobservof 5302.7. RNTottion prleavesgene eples waccorda spect2.8. IsIsolSet VAmplitions lines. RNA, ed winner 3 andwere 5sal priy, 1 g petal was ground with 8 ml deionized water,used for pH value measurement with PHS-3C pH meterrecision & Scientic Instrument Co., Ltd., China) afterion.ive enzyme activities measurements.5 g leaf was ground to a ne powder with liquid nitro-racted with ice-cold 50 mM phosphate buffer (pH 7.8).s were centrifuged at 4 C for 15 min at 10,000 g andg supernatants; thereafter referred to as crude extracts,ed and used for enzyme activities assay (Zou, 2000). dismutase (SOD: EC 1.15.1.1) activity was measuredphotochemical NBT method (Zou, 2000), peroxidase.11.1.7) activity was evaluated following the guaia-n method (Maehly and Chance, 1954), and catalase11.1.6) activity was evaluated by a reagent kit (Nanjingioengineering Institute, China). quality and color indices measurementsresh weight was the average value of ten owers by bal-g Testing Instrument Factory, China), and its diameterred by micrometer scale. In addition, the ower colore measured on a TC-P2A chroma meter (Beijing Optical Factory, China), using three color parameters includ-d b* values. The hue angle (H = arctangent (b*/a*)) wasccording to the methods reported previously (McGuire,, 1992).f pH on anthocyanin stability9% methanol1% HCL extracting solution was addedl to extract anthocyanins. 1 mL anthocyanin solutionto 9 mL pH 4.0, 5.0, 6.0 and 7.0 buffer solutions whichred using Na2HPO4C6H8O7. After 1 h, its color wasd anthocyanin content was obtained at the wavelengthtraction and puricationA was extracted according to a modied CTAB extrac-ol used in our laboratory (Zhao et al., 2011). The RNA ofused for gene isolation, and RNA of owers was used forssion analysis. Prior to reverse-transcription, RNA sam-reated with DNase using DNase I kit (TaKaRa, Japan),o the manufacturers guidelines, and then quantied byotometer (Eppendorf, Germany) at 260 nm.n of NHX1 gene of cDNA was performed by 3 full RACE Core.0 (TaKaRa, Japan) and SMARTerTM RACE cDNAon Kit (Clontech, Japan), and the specic opera- performed according to the manufactures guide-rst strand cDNA was synthesized from totalthen the 3 and 5 ends of cDNAs were ampli-the designed gene-specic primers (the outer anders of 3 RACE were 5-GGAGGCGGATACAATGGC-ACCTCCTTCCGCCTATTA-3; the primers of 5 RACEAGGACAGTGCTCGCAAGAAATAGGT-3) and the univer- provided by the kits. In addition, PCR conditions wereD. Zhao et al. / Scientia Horticulturae 154 (2013) 4553 47in accordance with request of kits and the annealing temperatureof primers.2.9. Purifying, cloning and sequencingPCR prodand the inciGel DNA Exucts were ctransformeChina). TheBiological EChina) to se2.10. Gene Gene trative polymeReal-Time ScDNA was reagent Kit(JN105299)All gene-spTable 1. qRT(Perfect Remix Ex TaqTsolution as a8 L ddH2Oried out unby an initiafor 15 s, 51of target geold cycle (Cammonialyvalues of thCFX Manag2.11. SequeSequencMAN 5.0 schemical ptool (http:/analysis wcgi-bin/prodone by Tservices/TMthe GenBangenetic treeAll data werations. Datathe SAS/STAtute, Cary, Duncans te3. Results3.1. MorphP. lactioirrigation wP. lactioradecrease innode numbover, signiplant crownDifferent pH treamentsSOD activity (U g-1 FW)300apH 4.0 pH 7.0 pH 10.0CAT activity (U g-1 FW)015bbPOD activity (U g-1 FW)ffect of pH of irrigation water on activities of three protective enzymes inra. which, plant crown width was signicantly decreased by and 17.61%, respectively. As far as only pH treatments werened, morphological parameters of treated plants were not consistent, such as leaf area, stem diameter, branch num-d plant crown width when irrigated with pH 4.0 water werethan with pH 10.0 water.ysiological indices and protective enzyme activities state of plant growth and the activity of internal metabolismbe exactly evaluated by physiological indices. As shown in, chlorophyll a, chlorophyll b and chlorophyll a+b contentsll increased in plants irrigated with pH 4.0 and 10.0 waters,lorophyll b content was underwent the largest increase of and 16.84% in contrast to the control, respectively. On thery, the decrease was found in chlorophyll a/b with 6.08%1%. Soluble protein, soluble sugar, MDA, H2O2 and free pro-ntents presented an increased trend in response to irrigationaters at pH 4.0 and 10.0.sequently, activities of three protective enzymes in P. lacti-cluding SOD, POD and CAT were measured (Fig. 1). Among SOD activity was the highest and POD activity was the low-e former was 32.4 times the activity of the latter in thel. Meanwhile, P. lactiora under different treatments showeducts were separated by 1% agarose gel electrophoresis,sed gels were puried using TaKaRa MiniBEST Agarosetraction Kit Ver.3.0 (TaKaRa, Japan). The extracted prod-loned into pEASYTM-T5 Zero vector (Trans, China) andd into competent Escherichia coli Trans1-T1 cells (Trans, recombinant plasmids were sent Shanghai Sangonngineering Technology & Services Co., Ltd. (Shanghai,quence.expression analysisnscript levels were analyzed using real-time quantita-rase chain reaction (qRT-PCR) with a BIO-RAD CFX96TMystem (C1000TM Thermal Cycler) (Bio-Rad, USA). Thesynthesized from 1 g RNA using PrimeScript RT With gDNA Eraser (TaKaRa, Japan). P. lactiora Actin had been used as an internal control (Zhao et al., 2012a).ecic primers in this study for qRT-PCR were shown in-PCR was performed using the SYBR Premix Ex TaqTMal Time) (TaKaRa, Japan) and contained 2 SYBR Pre-M 12.5 L, 50 ROX Reference Dye II 0.5 L, 2 L cDNA template, 2 L mix solution of target gene primers and in a nal volume of 25 L. The amplication was car-der the following conditions: 50 C for 2 min followedl denaturation step at 95 C for 5 min, 40 cycles at 95 CC for 15 s, and 72 C for 40 s. Relative expression levelsnes were calculated by the 2Ct comparative thresh-t) method, and the expression level of phenylalaninease gene (PAL) in pH 4.0 was used as the control. The Cte triplicate reactions were gathered using the Bio-Rader V1.6.541.1028 software.nce and statistical analysise splicing and analysis were performed by DNA-oftware (Lynnon Corporation, Canada). Physical andarameters of proteins were detected using ProtParam/us.expasy.org/tools/protparam.html). Hydrophobicityas performed on ProtScale (http://www.expasy.org/tscale.pl) and transmembrane topology prediction wasMHMM Server version 2.0 (http://www.cbs.dtu.dk/HMM/). Homology analysis was carried out usingk BLAST (http://www.ncbi.nlm.nih.gov/blast/). Phylo- were constructed by MEGA 5.05 (Tamura et al., 2011).e means of three replicates at least with standard devi- were subjected to analysis of variance (ANOVA) usingT statistical analysis package (version 6.12, SAS Insti-NC, USA) and the differences were compared by thest with a signicance level of P < 0.05.ological parametersra morphology was seriously inuenced by the pH inater (Table 2). Compared with the control (pH 7.0), irrigated with pH 4.0 and 10.0 waters exhibited a plant height, leaf area, stem diameter, branch number,er and plant crown width except leaf number. More-cant levels were reached by plant height, leaf area and width between two pH treatments and the control,Fig. 1. EP. lactioamong32.66%conceralwaysber anlower 3.2. PhThecould Table 3were aand ch14.74%contraand 5.4line cowith wSubora inwhich,est, thcontrob050250b3045a0.02.55.07.510.0acb48 D. Zhao et al. / Scientia Horticulturae 154 (2013) 4553Table 1Primers sequence for detection by qRT-PCR.Gene GenBank accession number Forward primer (5-3) Reverse primer (5-3) Length of amplication (bp)Actin JN105299 GCAGTGTTCCCCAGTATT TCTTTTCCATGTCATCCC 169PAL CTTCCGAAATTCCTCCAC 157CHS CCCTTTGTTGTTCTCTGC 178CHI AACTCTGCTTTGCTTCCG 183F3H CAATCTCGCACAGCCTCT 109F3H CCAAACGGTATAACCTCAA 171DFR CCAAAAACAAACCAGAGATC 198ANS ACAAAGAAGCACAAAGGCAC 190F3GT AGCCACCCATCACTAAAT 175F5GT CTCCTTGTCTCCATCTCG 119NHX1 GTGCTCGCAAGAAATAGGTA 175Table 2Effect of pH of d mean SE, and different letters mark signicant differences at P < 0.05 byDuncans test.Morphologic pH 7.0 pH 10.0Plant height 80.20 1.72a 62.86 5.01bLeaf number 868 190.90a 967.75 262.76aLeaf area (cm 22.52 2.00a 13.30 1.63b41.94 5.37a 24.72 2.86bStem diameBranch numNode numbePlant crownTable 3Effect of pH oDuncans test.PhysiologicaChlorophyll Chlorophyll Chlorophyll Chlorophyll Soluble protMDA (nmol Soluble sugaH2O2 (mol gFree prolinethe same trcontrol coumoreover, tthat pH 4.0with pH 10nicant diffreduced bythe control.3.3. FlowerWith thcould not uower qualgated with Table 4, ogated with and 27.82%expressed a90 for yellet al., 1994;a*/b*, the mdisplayed thJQ070801 ACATTCTCGCCACTACCAJN132108 CACCCACCTTGTTTTCTG Jn119872 TCCCACCTGGTTCTTCTA JQ070802 AGTTCTTCGCTTTACCGC JQ070803 TGGCTACTACATTCCAAAAG JQ070804 CTTCCTGTGGAAAAGAACC JQ070805 AGGAGAAGATCATACTCAAG JQ070806 AACACCGAATGCCTAAACJQ070807 GAAGCGTCTCTGTTTTACC JX524227 TAAATCAGGATGAGACGCC irrigation water on morphological parameters of P. lactiora. The values representeal parameters pH 4.0 (cm) 65.83 2.36b 896 217.48a2) Top 13.04 1.90bMiddle 17.42 2.86cBottom 17.15 2.09bter (cm) Top 0.31 0.03aMiddle 0.63 0.07aBottom 0.75 0.04aber 11.67 2.66ar 10.50 1.29a width (cm) 63.75 4.27cf irrigation water on physiological indices of P. lactiora. The values represented mean l indices pH 4.0 pH 7a (mg g1) 3.02 0.22ab 2.8b (mg g1) 1.09 0.05a 0.9a/b 2.78 0.07a 2.9a+b (mg g1) 4.10 0.28ab 3.7ein (mg g1) 5.21 0.13a 3.1g1) 20.77 0.39a 11.9r (mmol g1) 0.17 0.00b 0.11 prot) 0.76 0.11a 0.7 (g g1) 403.34 3.93a 23.4ends in activities of three protective enzymes, and theld grow normally with highest activities of enzymes,he lower pH for plants irrigated with water indicated was more detrimental than it was in plants irrigated.0 water. In three protective enzymes, POD had sig-erence among different treated P. lactiora, which was 47.46% and 25.74% at pH 4.0 and 10.0 compared with quality and color indicese growth and development of plants, p. lactiora budsnfold into owers under pH 10.0 treatment, therefore,ity and color indices were only studied in plants irri-waters at pH 4.0 and the control (Fig. 2). As shown inwer diameter and ower fresh weight of plants irri-water at pH 4.0 were signicantly reduced by 26.78% in contrast to the control. The color differences weres H and a*/b*. H was as follows: 0 for reddish-purple,ow, 180 for bluish-green and 270 for blue (Crisosto Intelmann et al., 2005). In addition, the larger value ofore red was (Rodrigo et al., 2004). Both H and a*/b*at ower color of plants irrigated with water at pH 4.0was lighterdifferencesAmong cyanin conplants irrigFig. 2. Flowerwater.26.85 3.99a 17.46 1.10b0.34 0.05a 0.33 0.02a0.64 0.07a 0.63 0.06a0.78 0.09a 0.77 0.09a14.00 4.38a 13.83 2.79a10.75 0.96a 10.00 0.82a94.67 3.51a 78.00 2.58b SE, and different letters mark signicant differences at P < 0.05 by.0 pH 10.01 0.10b 3.09 0.02a5 0.05b 1.11 0.05a6 0.10a 2.80 0.14a6 0.14b 4.20 0.03a2 0.26c 4.66 0.06b6 0.06c 19.65 0.23b3 0.00c 0.18 0.00a0 0.10a 0.90 0.24a1 1.25c 262.77 20.26b and brighter compared with the control. And signicant in all the ower quality and color indices were reached.physiological indices related to ower color, antho-tent and pH value of petal were measured. Inated with water at pH 4.0, anthocyanin content wass of P. lactiora in full bloom stage was affected by pH of irrigationD. Zhao et al. / Scientia Horticulturae 154 (2013) 4553 49Table 4Effect of pH of irrigation water on ower quality of P. lactiora. The values repre-sented mean SE, and different letters mark signicant differences at P < 0.05 byDuncans test.Flower quality indices pH 4.0 pH 7.0Flower diameter (cm) 8.75 0.91b 11.95 0.40aFlower fresh weight (g) 6.98 1.03b 9.67 0.86aFlower colorH 52.99 4.26a 49.18 2.10ba*/b* 0.76 0.11b 0.87 0.06asignicantly lower with 58.93%, while pH value was signicantlyhigher with 1.62% than those of control (Fig. 3).3.4. Stability of anthocyanins in pH buffer solutionsAnthocyanins extracted from P. lactiora were added to differentpH buffer solutions, its color began to change from red to white, andthen to yellowish-brown at a pH ranging from 4.0 to 7.0. And theanthocyanin content was signicantly reduced by 13.33%, whichwas consistent with color changes (Fig. 4).3.5. Isolation and sequence analysis of NHX1 geneIn order to further clarify the relationship between pH value ofpetal and ower color, we aimed to isolate NHX1 gene which reg-ulated pH value of petal in previous reports. Gene-specic primerswere used for rapid amplication of cDNA ends (RACE) of NHX1gene, which resulted in an approximate 1500 and 1000-bp bandof 3 and 5 cDNA ends, respectively. The spliced results showedthat 2105 bp NHX1 cDNA contained an untranslated region (UTR)Anthocyanin content (OD530 g-1 FW)0.0.2.4.6 aapH value5.505.555.605.655.70Fig. 3. Effect olactiora petalpH value4 5 6 7Absorbance value (OD530) 0.0.2.4.6a b cdFig. 4. Changes of P. lactiora anthocyanin content under different pH buffer solu-tions.of 339 bp in 5 end, a 1612-bp open reading frame (ORF) encoding536 amino acids, a 3-UTR of 154 bp and a poly (A) tail.Amino acid sequence analysis demonstrated that the putativemolecular weight was 59.46 kDa, the theoretical isoelectric point(pI) was 8.07, and total number of negatively charged residues(Asp + Glu) and positively charged residues (Arg + Lys) was 36 and38, respectively. Its instability index (II) was computed to be35.48 which classied this protein as stable. Hydrophobicity andtransmembrane topology analysis revealed that it had a stronghydrophobtein containamino acidthat this pity with NH(ADB80440gia (AAO487460n of a HtNHX1 HvNHX1 OsNHX1 ZmNHX1 TaNHX1 BnSOS1 ThSOS1 AtSOS1bbba(ADB2domaiDif ferent p H tr eamentspH 4.0 pH 7.0f pH of irrigation water on anthocyanin content and pH value of P..Fig. 5. Phylogother species.icity and high hydrophobic amino acid content; this pro-ed 8 transmembrane topological structures with 2023s each one. Meanwhile, homology analysis revealedrotein shared 7477% identity and 8285% similar-X1 from Salicornia europaea (AAN08157), Malus zumi), Citrus reticulata (AAT36679), Atriplex dimorphoste-271), Atriplex gmelini (BAB11940) and Medicago falcata), and contained a high conservative sequence-bindingmiloride (LFFIYLLPPI). GoNHX1 MsNHX1 CkNHX1 GmNHX1 RhNHX1 PlNHX1 CmNHX1 Le SOS1 PeSOS1 OsSOS1 PtSOS1 TaSOS1enetic tree of NHXs amino acid sequences from P. lactiora and some50 D. Zhao et al. / Scientia Horticulturae 154 (2013) 4553Phylogenetic tree was drawn by MEGA software (Fig. 5). Thesegenes were divided into two types (vacuolar Na+/H+ antiporter andplasma membrance Na+/H+ antiporter). Moreover, the rst typecould be classied into monocotyledons and dicotyledons, and Rosahybrid was concordantcould be coPlNHX1 wit3.6. Gene eTo exampH treatmbiosynthetithetic genesynthase g3-hydroxyldihydroavgene (ANS),(F3GT) and (F5GT)) (Zhawere analytheir levels of PlCHS watreatmentssignicant PlDFR and Pmaximum rother geneit could bewith PlPAL,the formatision level oand decreasthe control 4. DiscussiThe wayscale calledproductionplant growtous for diffea compreherange (Zhaoeffect of hipanicle lengrain size wpH 10.3. Vaof all threeand shoot dwith salinereductions otranspiratio2011). In thgated with morphologand 10.0 thwere reachemight be caby H+, Al3+cause the lation, the eff(Zhao, 2003of pH valueignored besWhen the plant is subjected to serious stress, its various phys-iological processes will be affected. MDA, H2O2 and free prolinecontents are usually served as physiological indices of plant stressresponse. In P. lactiora, these three indices were signicantlyd byher terse hestn, choropat pHchlorith e conitselfsis w prod simd thehysiosequate 4.0 tith th4.0 trts ird chd, anar asnalyzni eyaniantlyanided .0 toas fpomovar. rso hiis Thurigateeatlynt we disX1 geemb in th Andalizaing atanda NaomoelonHX1 ved ais of ent w agreuld fctor ressid fadyanind Pthe one most similar to P. lactiora. These results were with traditional classication. Therefore, this sequencenrmed NHX1 gene in P. lactiora, which was appointedh GenBank accession number JX524227.xpression analysisine whether anthocyanin content and pH value underents could be related to the expression of relatedc genes, transcript levels of nine anthocyanin biosyn-s we had isolated from P. lactiora (PAL, chalconeene (CHS), chalcone isomerase gene (CHI), avanonease gene (F3H), avonoid 3-hydroxylase gene (F3H),onol 4-reductase gene (DFR), anthocyanindin synthase UDP-glucose: avonoid 3-O-glucosyltransferase geneUDP-glucose: avonoid 5-O-glucosyltransferase geneo et al., 2012b,c) and PlNHX1 gene isolated in this paperzed by qRT-PCR. All detected genes could express, butwere various (Fig. 6). Among which, the expression levels the highest, and the lowest was in PlF5GT. When pH were concerned, expression levels of all genes reachedlevels except CHI, the expression levels of PlPAL, PlCHI,lF5GT were reduced in contrast to the control, and theeduction was observed in PlDFR with 41.66%, while the expression levels all increased to some extent. Thus seen that the faded ower color was closely related PlCHI, PlDFR and PlF5GT, especially PlDFR controllingon of colorless ower pigment. In addition, the expres-f PlNHX1 was adversely affected by pH 4.0 treatment,ed pH in irrigation water caused a rise about twice asin its expression level.on of measuring how acidic or alkaline environment is a pH, which not only affects the nutrient availability and of harmful materials, but also plays an important role inh. The suitable range of environmental pH value is vari-rent plant species, moreover, the plant only can absorbnsive nutrition and grow normally in its suitable pH, 2003). Singh and Singh (2005) found the inhibitorygh soil pH on growth of Oryza sativa, for instance, itsgth, rachis branches, total spikelets, lled grains andere all adversely affected by higher soil alkalinity atldez-Aguilar et al. (2009) discovered that plant growth cultivars in Tagetes erecta including plant height, leafry weight were all decreased in response to irrigation waters at pH 6.4. Similarly, soil pH 4.0 caused moref transpiration rates, stomatal conductance, and evapo-n than pH 6.0 did in Lycopersicon esculintum (Kang et al.,is study, P. lactiora was obviously damaged when irri-pH 4.0 and 10.0 waters, which was directly indicated byy. All morphological parameters were lower at pH 4.0an at pH 7.0 except leaf number, and signicant levelsd by plant height, leaf area and plant crown width. Thisused by the reason that the plants would be poisonedand Mn2+ in acidic condition, as well as low pH wouldck of Mg, Ca, K, P and Mo elements; in alkaline condi-ectiveness of various trace elements would be reduced; Rosas et al., 2007). These results showed that the role in soil or irrigation water in plant growth could not beides nutrient substance.affecteall higin advthe higadditiosis, chlwater while plant walkalinrepair synthesolubletrende7.0, anwith pSubgated wthe pHtent wby pH In planora hareduceAs fwere a(Reuveanthocsignicanthocwas fafrom 4iora wwith Inense was alBerberwas irwas grronmeand thNHuolar mresults2005).lar alkexplorundersstudy, ora, hgene bwith Nconseranalystreatmwas inthis cotant faExpshoweanthocPlPAL a changed pH in irrigation water, and their values werehan those of the control, suggesting P. lactiora wascircumstances under pH 4.0 and 10.0 treatments, and levels of stress was shown under pH 4.0 treatment. Inlorophyll content directly affectd plant photosynthe-hyll a, b and a+b contents in P. lactiora irrigated with 4.0 and 10.0 were higher than those of the control,ophyll a/b was dropped indicating P. lactiora was aacid-alkali resistance to some extent. And in acid andditions, P. lactiora might produce stress response to, improve leaf chlorophyll content, and enhance photo-hich resulted in the accumulation of soluble sugar andtein. Meantime, activities of three protective enzymesilarly which were lower at pH 4.0 and 10.0 than at pH lowest activities were at pH 4.0 which was consistentlogical indices.ently, ower quality of P. lactiora was analyzed. Irri-r at pH 10.0 prevented buds unfolding into owers, butreatment was opposite. This phenomenon was inconsis-e former conclusion that the highest stress was causedeatment, and the specic reason needed further study.rigated with water at pH 4.0, ower quality of P. lacti-anged. Its ower diameter and ower fresh weight wered ower color was faded. ower color was concerned, two main impact factorsed including anthocyanin content and pH value of petalt al., 2001). In plants irrigated with water at pH 4.0,n content was signicantly lower, while pH value wasy higher than those of the control. When the extractedns were put in different pH buffer solutions, its colorand anthocyanin content was reduced at a pH ranging 7.0, which helped explain why ower color in P. lact-aded under pH 4.0 treatment. This result was identicalea nil (Fukada-Tanaka et al., 2000), Loropetalum chi-ubrum (Tao et al., 2003). Moreover, pH value of petalgher under pH 4.0 treatment, which also occurred innbergii Cv. Atropurpurea (Gao, 2011). When P. lactiorad by pH 4.0 water, the original growing environment changed and the enzyme activities in rhizosphere envi-ere damaged, so P. lactiora showed abnormal growthorder of pH value might occur.ne is required for the exchange of Na+ for H+ across vac-ranes and compartmentalizes Na+ into vacuoles whiche vacuolar alkalization (Nass et al., 1997; Ohnishi et al., some reports indicated NHX1 mediated partial vacuo-tion in the owers (Yamaguchi et al., 2001). Therefore,nd studying this gene was extremely important foring the formation mechanism of ower color. In this+/H+ antiporter gene had been isolated from P. lacti-logy analysis and phylogenetic tree all suggested thisged to NHX1, which shared high identity and similarityin other plants. Additionally, PlNHX1 had a high degreemiloride binding-site sequence LFFIYLLPPI. ExpressionPlNHX1 showed that relative high level under pH 4.0as reached compared with the other treatments, whichement with the tendency of petal pH value. Therefore,urther indicate that increased pH value was one impor-for faded ower color in P. lactiora.on analysis of nine anthocyanin biosynthetic genesed ower color was also coordinately regulated by alln biosynthetic genes. Low expression levels of upstreamlCHI genes decreased the upstream synthetic products,D. Zhao et al. / Scientia Horticulturae 154 (2013) 4553 51PlPA L.81.2PlCHS2030a aand the expof colorlesssignicant dfound that pinnatisectulation (Lu an.4b0.0PlCHI0.0.4.81.2PlF3'HRelative expression level0.00.01.02.03PlANS0.0.2.4.6PlF5GTpH 4.0 pH 7 .00.000.002.004.006Different pH trea mentspHaaaabbbbaFig. 6. Effect of pH of irrigation water on the expression patterns of nine anression level of the key PlDFR controlling the formation ower pigment was reduced by 41.66%, which causedecline of colored ower pigment content. Lu and YangDFR was induced expression in tuber skins of Solanumm by white light, and followed by anthocyanin accumu-d Yang, 2006). Park et al. discovered that the expressionlevel of DFRwhite skin Helianthus dark color vfore, PlDFR when P. lac10b0PlF3H0.0.2.4.6PlDFRRelative expression level0.0.3.6.9PlF3GT0.0.2.4.6PlNHX1 4.0 pH 7 .00.0.2.4.6aaaabbbthocyanin biosynthetic genes and PlNHX1. was higher in red skin of Raphanus sativus than that of(Park et al., 2011). In Dendranthema grandiorum andannuus, DFR showed a higher gene expression level inarieties (Zhang et al., 2009; Chen et al., 2010). There-was a key gene which limited anthocyanin biosynthesistiora was irrigated with water at pH 4.0. The results of52 D. Zhao et al. / Scientia Horticulturae 154 (2013) 4553this experiment would provide a theoretical basis for further clar-ity the effects of pH in irrigation water on plant growth and owerquality in P. lactiora.5. ConclusIn concluiological inall indicatewere seriouover, fadeddecreased athese two wmolecular bance for thlactiora.AcknowledThis wo& Technolo(CX[11]101of Jiangsu Pdemic ProgReferencesAn, B.Y., Luo, Yuolar Na+/ArabidopsAnugoolpraserpH on the Palm in a hAnupama, J., Cloning agene SbN1965197Apse, M.P., Ahaby overex1256125Asen, S., Stements, an2677268Chen, S.M., ZhExpressionvars with d(in ChinesClark, G.E., Band tuber127134.Crisosto, C.H., delayed coHortSciencDu, Y., Hei, Q., of a putati53, 25125Eason, J., Pinknture and hcultivars. NFukada-TanakenhancingGao, H.M., 201color of Becultural UGerloff-Elias, the growtdomonas aCell EnviroGuan, B., Hu, and functiHalostachyIntelmann, D.,tomato caJia, N., Shu, cation achromatogpeony speKang, Y.I., Park, J.M., Kim, S.H., Kang, N.J., Park, K.S., Lee, S.Y., Jeong, B.R., 2011. Effectsof root zone ph and nutrient concentration on the growth and nutrient uptakeof tomato seedlings. J. Plant Nutr. 34, 640652.Liu, L., Zeng, Y., Pan, X., Zhang, F., 2012. Isolation, molecular characterization, andfunctional analysis of the vacuolar Na+/H+ antiporter genes from the halophytelinia c, Yangic gen818. P.C., d.), Mand, p, R.Kng the, R.G.,125.C., Win ac137., Cunn novebran, M., FacteriNHX2easing267..I., Xu, S.U.ynthe603.H., ZHX1, , confe167, M., Eng petnt Ph, M.J., rotenlopm., Rength, caer. J. P Geren-zone. Bot. (K.R., dth an from126..P., Seral m674. K., Peecularnary 273., Chenges innol. 3guilar affeScienH., 19icultu, E.F.,dyna Pall.)146.G., Zha.), Chichi, T planlates 012chi, Tka, Yanger.J., Panexpreer. AcQ., Haucosys in hhttp://ionssion, the investigated morphological parameters, phys-dices, protective enzyme activities and ower qualityd that plant growth and ower quality of P. lactiorasly affected by extreme pH in irrigation water. More- ower color under pH 4.0 treatment was attributed tonthocyanin content and increased pH value of petal,ere mainly controlled by PlNHX1 and PlDFR genes iniology. The results would provide a theoretical guid-e use of irrigation water in practical production of P.gmentsrk was nancially supported by Agricultural Sciencegy Independent Innovation Fund of Jiangsu Province7), Agricultural Science & Technology Support Projectrovince (BE2011325, BE2012468) and the Priority Aca-ram Development from Jiangsu Government.., Li, J.R., Qiao, W.H., Zhang, X.S., Gao, X.Q., 2008. Expression of a vac-H+ antiporter gene of Alfalfa enhances salinity tolerance in transgenicis. Acta Agron. Sin. 34, 557564.t, O., Kinoshita, S., Naito, H., Shimizu, M., Ehara, H., 2012. Effect of lowgrowth, physiological characteristics and nutrient absorption of Sagoydroponic System. Plant Prod. Sci. 15, 125131.Mukul, J., Narendra, S.Y., Pradeep, K.A., Bhavanath, J., 2011.nd characterization of the Salicornia brachiata Na+/H+ antiporterHX1 and its expression by abiotic stress. Mol. Biol. Rep. 38,3.ron, G.S., Snedden, W.A., Blumwald, E., 1999. Salt tolerance conferredpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 285,8.wart, R.N., Norris, K.H., 1975. Anthocyanin, avonol copig-d pH responsible for larkspur ower color. Phytochemistry 14,2.u, X.R., Chen, F.D., Luo, H.L., Lv, G.S., Fang, W.M., Zhang, Z., 2010. proles of anthocyanin biosynthetic genes in chrysanthemum culti-ifferent ower colors. Acta Bot. Boreal. Occident. Sin. 30, 04530458e).urge, G.K., 2002. Effects of soilless media pH on cut ower production in Sandersonia aurantiaca. N. Z. J. Crop. Hort. 30,Garner, D., Crisosto, G.M., Sibbett, S., Day, K.R., 1994. Late harvest andoling induce internal browning of Ya Li and Seuri Chinese pears.e 29, 667670.Liu, Y., Zhang, H., Xu, K., Xia, Tao., 2010. Isolation and characterizationve vacuolar Na+/H+ antiporter gene from Zoysia japonica L. J. Plant Biol.8.ey, T., Heyes, J., Brash, D., Bycroft, B., 2002. Effect of storage tempera-arvest bud maturity on bud opening and vase life of Paeonia lactiora. Z. J. Crop. Hort. 30, 6167.a, S., Inagaki, Y., Yamaguchi, T., Saito, N., Iida, S., 2000. Colour- protein in blue petals. Nature 407, 581.1. Study on the effect of soil pH and fertilization treatments to leafrberis Thunbergii Cv. Atropurpurea. Master dissertation, Sichuan Agri-niversity, Chengdu, China (in Chinese).A., Spijkerman, E., Prschold, T., 2005. Effect of external pH onh, photosynthesis and photosynthetic electron transport of Chlamy-cidophila Negoro, isolated from an extremely acidic lake (pH 2.6). Plantn. 28, 12181229.Y., Zeng, Y., Wang, Y., Zhang, F., 2011. Molecular characterizationonal analysis of a vacuolar Na+/H+ antiporter gene (HcNHX1) froms caspica. Mol. Biol. Rep. 38, 18891899. Jaros, D., Rohm, H., 2005. Identication of color optima of commercialtsup. Eur. Food Res. Technol. 22, 662666.Q.Y., Wang, D.H., Wang, L.S., Liu, Z.A., Ren, H.X., 2008. Identi-nd characterization of anthocyanins by high-performance liquidraphy-electrospray ionizationmass spectrometry in herbaceouscies. J. Am. Soc. Hortic. Sci. 133, 418426.KareLu, Q.N.thet811Maehly,D. (EEnglMarkhamenciMcGuire1254Meng, Xcyan131Nass, R.by amemOhnishiCharof Inincr259Park, NParkbios6034Qiao, WAeNtum1663ReuveniduriJ. PlaRodrigoof cadeveRosas, AgrowclovRuan, J.,rootAnnSantos, growlated119Singh, Hmin669Tamura,mollutio2731Tao, Q.RchanTechValdez-AwateHortVoss, D.HortWaltonaThe ora142Wang, J.(EdsYamaguof aregu1251YamaguTanaexchZhang, Land owZhao, D.O-glgene(6), aspica. Mol. Biol. Rep. 39, 71937202., Q., 2006. cDNA cloning and expression of anthocyanin biosyn-es in wild potato (Solanum pinnatisectum). Afr. J. Biotechnol. 5,Chance, M., 1954. The assay of catalase and peroxidases. In: Gluck,ethods of Biochemical Analysis. Interscience Publishers, New York,p. 357424.., Ofman, D.J., 1993. Lisianthus avonoid pigments and factors inu-ir expression on ower colour. Phytochemistry 43, 679685. 1992. Reporting of objective colour measurements. HortScience 27,5.ang, X.J., 2004. Regulation of ower development and antho-cumulation in Gerbera hybrida. J. Hortic. Sci. Biotechnol. 79,ingham, K.W., Rao, R., 1997. Intracellular sequestration of sodiuml Na+/H+ exchanger in yeast is enhanced by mutations in the plasmae H+-ATPase. J. Biol. Chem. 272, 2614526152.ukada-Tanaka, S., Hoshino, A., Takada, J., Inagaki, Y., Iida, S., 2005.zation of a novel Na+/H+ antiporter gene InNHX2 and comparison with InNHX1, which is responsible for blue ower coloration by the vacuolar pH in the Japanese morning glory. Plant Cell Physiol. 46,, H., Li, X., Jang, I.H., Park, S., Ahn, G.H., Lim, Y.P., Kim, S.J.,, 2011. Anthocyanin accumulation and expression of anthocyanintic genes in radish (Raphanus sativus). J. Agric. Food Chem. 59,9.hao, X.Y., Li, W., Luo, Y., Zhang, X.S., 2007. Overexpression ofa root-specic vacuolar Na+/H+ antiporter from Agropyron elonga-rs salt tolerance to Arabidopsis and Festuca plants. Plant Cell Rep. 26,2.venor, D., Artzi, B., Perl, A., Erner, Y., 2001. Decrease in vacuolar pHunia ower opening is reected in the activity of tonoplast H+-ATPase.ysiol. 158, 991998.Marcos, J.F., Zacaras, L., 2004. Biochemical and molecular analysisoid biosynthesis in avedo of orange (Citrus sinensis L.) during fruitent and maturation. J. Agric. Food Chem. 52, 67246731.el, Z., de la Luz Mora, M., 2007. Manganese supply and pH inuencerboxylate exudation and peroxidase activity of ryegrass and whitelant Nutr. 30, 253270.ds, J., Hrdter, R., Sattelmacher, B., 2007. Effect of nitrogen form and pH on growth and nitrogen uptake of tea (Camellia sinensis) plants.Lond.) 99, 301310.e, S., Jacinavicius, F.R., Santanna, C.L., 2011. Effects of the pH ond morphology of Anabaenopsis elenkinii Miller (Cyanobacteria) iso- the alkaline shallow lake of the Brazilian Pantanal. Fottea 11,ingh, T.N., 2005. Inhibitory effect of high soil pH on growth andetabolism of rice and its reversal by zinc. J. Environ. Biol. 26,terson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: evolutionary genetics analysis using maximum likelihood, evo-distance, and maximum parsimony methods. Mol. Biol. Evol. 28,9., Y.Y., Zhou, P.H., 2003. Study on the stability of anthocyanin and pH cell sap of leaves in Loropetalum chinense var. rubum. Hunan For. Sci.0, 2425 (in Chinese).r, L.A., Grieve, C.M., Poss, J., 2009. Salinity and alkaline pH in irrigationct marigold plants: I. Growth and shoot dry weight partitioning.ce 44, 17191725.92. Relating colourimeter measurement of plant colour to the Royalral Society colour chart. HortScience 27, 12561260. Boldinghb, H.L., McLarenc, G.F., Williamsa, M.H., Jackman, R., 2010.mics of starch and sugar utilisation in cut peony (Paeonia lacti- stems during storage and vase life. Postharvest Biol. Tecnol. 58,ng, Z.S., 2005. Herbaceous peonies of China. In: Wang, J.G., Zhang, Z.S.na Forestry Publishing House, Beijing, China, p. 3 (in Chinese).., Apse, M.P., Shi, H., Blumwald, E., 2003. Topological analysist vacuolar Na+/H+ antiporter reveals a luminal C terminus thatantiporter cation selectivity. Proc. Natl. Acad. Sci. U.S.A. 100,515.., Fukada-Tanaka, S., Inagaki, Y., Saito, N., Yonekura-Sakakibara, K.,., Kusumi, T., Iida, S., 2001. Genes encoding the vacuolar Na+/H+ and ower coloration. Plant Cell Physiol. 42, 451461., D.R., Zhou, Y.F., Wang, Z.C., Hua, S.M., Hou, L.L., Sui, F.F., 2009. Cloningssion of genes involved in anthocyanins synthesis in ornamental sun-ta Hortic. Sin. 36, 7380 (in Chinese).n, C.X., Ge, J.T., Tao, J., 2012b. Isolation of a UDP-glucose: avonoid 5-ltransferase gene and expression analysis of anthocyanin biosyntheticerbaceous peony (Paeonia lactiora Pall.). Electron. J. Biotechnol. 15dx.doi.org/10.2225/vol15-issue6-fulltext-7.D. Zhao et al. / Scientia Horticulturae 154 (2013) 4553 53Zhao, D.Q., Tao, J., Han, C.X., Ge, J.T., 2012a. Actin as an alternative internal controlgene for gene expression analysis in herbaceous peony (Paeonia lactiora Pall.).Afr. J. Agric. Res. 7, 21532159.Zhao, D.Q., Tao, J., Han, C.X., Ge, J.T., 2012c. Flower color diversity revealed bydifferential expression of avonoid biosynthetic genes and avonoid accu-mulation in herbaceous peony (Paeonia lactiora Pall.). Mol. Biol. Rep. 39,1126311275.Zhao, D.Q., Zhou, C.H., Kong, F., Tao, J., 2011. Cloning of phytoene desaturase andexpression analysis of carotenogenic genes in persimmon (Diospyros kaki L.)fruits. Mol. Biol. Rep. 38, 39353943.Zhao, J.X., 2003. Relation of Soil acidity and plant growth. Inner Mongolia Agric. Sci.Technol. 6, 33 (in Chinese).Zou, Q., 2000. Plant physiology experimental guidance. In: Zou, Q. (Ed.), China Agri-cultural Press, Beijing, China, pp. 102103 (in Chinese).Effects of pH in irrigation water on plant growth and flower quality in herbaceous peony (Paeonia lactiflora Pall.)1 Introduction2 Materials and methods2.1 Plant Materials2.2 Morphological parameters measurements2.3 Physiological indices determinations2.4 Protective enzyme activities measurements2.5 Flower quality and color indices measurements2.6 Effect of pH on anthocyanin stability2.7 RNA extraction and purification2.8 Isolation of NHX1 gene2.9 Purifying, cloning and sequencing2.10 Gene expression analysis2.11 Sequence and statistical analysis3 Results3.1 Morphological parameters3.2 Physiological indices and protective enzyme activities3.3 Flower quality and color indices3.4 Stability of anthocyanins in pH buffer solutions3.5 Isolation and sequence analysis of NHX1 gene3.6 Gene expression analysis4 Discussion5 ConclusionsAcknowledgmentsReferences

Recommended

View more >