Eh

DJ

a

ARRA

KHpFG

1

P2aWflehtipbcad

0h

Scientia Horticulturae 154 (2013) 45–53

Contents lists available at SciVerse ScienceDirect

Scientia Horticulturae

journa l h o me page: www.elsev ier .com/ locate /sc ihor t i

ffects of pH in irrigation water on plant growth and flower quality inerbaceous peony (Paeonia lactiflora Pall.)

aqiu Zhao1, Zhaojun Hao1, Jing Wang, Jun Tao ∗

iangsu Key Laboratory of Crop Genetics and Physiology, College of Horticulture and Plant Protection, Yangzhou University, Yangzhou 225009, PR China

r t i c l e i n f o

rticle history:eceived 11 December 2012eceived in revised form 23 February 2013ccepted 25 February 2013

eywords:erbaceous peonyHlower qualityene expression

a b s t r a c t

Herbaceous peony (Paeonia lactiflora Pall.) is an excellent landscape plant because of its great ornamentalvalues. The objective of this study was to determine if plant growth and flower quality of P. lactiflora wereaffected by extreme pH in irrigation water. Compared with the control (pH 7.0), P. lactiflora exhibiteda decrease in all morphological parameters except leaf number when irrigated with pH 4.0 and 10.0waters. Physiological indices including chlorophyll a, chlorophyll b, chlorophyll a+b, soluble protein,malondialdehyde (MDA), soluble sugar, hydrogen peroxide (H2O2) and free proline were increased inresponse to irrigation with waters at pH 4.0 and 10.0, while the decline was occurred in chlorophyll a/b.Moreover, activities of three protective enzymes were also decreased in response to pH 4.0 and 10.0treatments. These results indicated that the growth of P. lactiflora was significantly affected by extremepH in irrigation water, and the most serious stress to P. lactiflora was caused under pH 10.0 treatment.

Compared with plants irrigated with water at pH 7.0, 26.78% and 27.82% reduction were found in flowerdiameter and flower fresh weight of plants irrigated with water at pH 4.0. Likely, flower color fade underpH 4.0 treatment was attributed to decreased anthocyanin content and increased pH value of petal, whichwere coordinately regulated by nine anthocyanin biosynthetic genes and a vacuolar Na+/H+ antiporter1gene (NHX1), respectively. The results would provide a theoretical guidance for the use of irrigation waterin practical production of P. lactiflora.

© 2013 Elsevier B.V. All rights reserved.

. Introduction

Herbaceous peony (Paeonia lactiflora Pall.), belonging to theaeoniaceae family, originates in temperate Eurasia (Eason et al.,002), and is widely cultivated in many countries and areas, suchs China, New Zealand, Europe, North America (Jia et al., 2008;altona et al., 2010). In China, P. lactiflora is a traditional famous

ower which has shared the name “the king and minister of flow-rs” with tree peony and has more than 4000 years of cultivationistory. Owing to its excellent ornamental values including gigan-ic, colorful, chic-type and fragrant flowers as well as extremelymportant medicinal values, it has been deeply favored by peo-le all over the world. Meanwhile, it has been expanded from theeginning garden cultivation to the potted flower and cut flowerultivations. Moreover, it has been paid more attention and widely

pplied in urban green space with the advance of flower industryevelopment.

∗ Corresponding author. Tel.: +86 514 87997219; fax: +86 514 87347537.E-mail address: taojun@yzu.edu.cn (J. Tao).

1 These authors contributed equally to this work.

304-4238/$ – see front matter © 2013 Elsevier B.V. All rights reserved.ttp://dx.doi.org/10.1016/j.scienta.2013.02.023

With the acceleration of urbanization, industrial and miningenterprises develop rapidly, which is followed by all kinds ofpollutant discharge making water polluted. The lack of depend-able supplies of good-quality water in many regions has becomea concern as the competition among agricultural, urban, indus-trial, environmental, and recreational groups continues to increase(Valdez-Aguilar et al., 2009). The change of pH value is an importantfeature of polluted water. Predecessors have reported the effectsof different pH treatments on plant growth in Metroxylon sagu(Anugoolprasert et al., 2012), Camellia sinensis (Ruan et al., 2007),Chlamydomonas acidophila (Gerloff-Elias et al., 2005), Anabaenopsiselenkini (Santos et al., 2011) and so on, and their results are not iden-tical. Plants irrigated with pH changed water will bring the changeof rhizosphere pH, which affects plant growth including morphol-ogy, photosynthesis, nutrient absorption (Clark and Burge, 2002;Gerloff-Elias et al., 2005; Ruan et al., 2007; Valdez-Aguilar et al.,2009; Kang et al., 2011; Santos et al., 2011; Anugoolprasert et al.,2012). But for flower plants, the ornamental value of flower qual-ity, especially flower color is more concerned besides plant growth.

However, little is known about the effects of pH in irrigation wateron flower color performance.

Flower color is determined by two major factors, pigmentspresent in the vacuole and intra-vacuolar environment (vacuolar

4 orticu

pdcamogasbiH2paLbmueri

CswtwP

2

2

fit(gt8pwf4A(aolpfll

2

sssd

2

w

6 D. Zhao et al. / Scientia H

H and metal ion content) (Reuveni et al., 2001). Several reportsemonstrated the importance of vacuolar pH in determining flowerolor (Asen et al., 1975; Markham and Ofman, 1993). Na+/H+

ntiporters (NHXs), membrane proteins, are localized in plasmaembrane and vacuolar membrane which catalyze the exchange

f Na+ for H+ across membranes using the proton electrochemicalradient (Yamaguchi et al., 2003). In NHXs, the first vacuolar Na+/H+

ntiporter gene (NHX) in higher plant was isolated from Arabidop-is thaliana (Apse et al., 1999). Subsequently, a series of NHX hadeen identified from various plant species, including Zoysia japon-

ca (Du et al., 2010), Salicornia brachiata (Anupama et al., 2011),alostachys caspica (Guan et al., 2011), Karelinia caspica (Liu et al.,012). Overexpression and RNA interference of NHX suggested thatlant vacuolar Na+/H+ antiporter played an essential role in allevi-ting salt stress (Apse et al., 1999; Qiao et al., 2007; An et al., 2008;iu et al., 2012). Meantime, an increase in vacuolar pH enhancedlue coloration of Japanese morning glory (Ipomoea nil), but in theutant deficient in the NHX1 gene was unable to increase its vac-

olar pH to create the normal bright blue petals (Fukada-Tanakat al., 2000; Yamaguchi et al., 2001; Ohnishi et al., 2005). Theseesults demonstrated that the vacuolar NHX1 played a crucial rolen regulating pH.

P. lactiflora can grow in different conditions from south-centralhina to northern China (Wang and Zhang, 2005). However, fewtudies have compared the growth characteristics of P. lactiflorahen the pH in irrigation water is changed. In order to provide a

heoretical guidance for the use of irrigation water in P. lactiflora,e presented our work on the effects of pH in irrigation water on

. lactiflora plant growth and flower quality in this study.

. Materials and methods

.1. Plant Materials

Potted P. lactiflora cultivar ‘Zifengyu’ was placed on an openeld in the germplasm repository of Horticulture and Plant Pro-ection College, Yangzhou University, Jiangsu Province, P.R. China32◦30′ N, 119◦25′ E). These plants were potted in October 2009,rowing substrate was garden soil (29.83 g/kg soil organic mat-er, 1.72 g/kg total nitrogen, 13.87 mg/kg available phosphorus,4.83 mg/kg available potassium and pH 6.17) and pH balancedeat moss (Klasmann-Deilmann, Germany) (1:1, v/v), and theyere managed in accordance with the field management without

ertilizers, as well as using tap water as irrigation water. Until 2012,5 consistent growth plants were selected as the study materials.fter leaf expansion, plants were irrigated thoroughly using pH 4.0

KCl–HCl) and pH 10.0 (KCl–NaOH) buffer solutions once a week,nd tap water (pH 7.0) was used as the control. After determinationf plant morphological parameters in the full-bloom stage, theireaves were taken for determination of physiological indices androtective enzyme activities, flowers were taken and used to studyower quality and color. All samples were immediately frozen in

iquid nitrogen, and then stored at −80 ◦C until analysis.

.2. Morphological parameters measurements

Plant height and crown width were measured by metertick (Zhejiang Yuyao Sanxin Measuring Tools Co., Ltd., China),tem diameter was measured by micrometer scale (Taizhou Xin-hangliang Measuring Tools Co., Ltd., China), and leaf area wasetermined according to a paper weighing method.

.3. Physiological indices determinations

Chlorophyll, malondialdehyde (MDA) and free proline contentsere determined according to the method reported by Zou

lturae 154 (2013) 45–53

(2000). Soluble protein, soluble sugar and hydrogen peroxide(H2O2) contents were measured by reagent kits (Nanjing JianchengBioengineering Institute, China), and anthocyanin content was per-formed with the method reported by Meng and Wang (2004).Additionally, 1 g petal was ground with 8 ml deionized water,which was used for pH value measurement with PHS-3C pH meter(Shanghai Precision & Scientific Instrument Co., Ltd., China) aftercentrifugation.

2.4. Protective enzyme activities measurements

Firstly, 0.5 g leaf was ground to a fine powder with liquid nitro-gen and extracted with ice-cold 50 mM phosphate buffer (pH 7.8).The extracts were centrifuged at 4 ◦C for 15 min at 10,000 × g andthe resulting supernatants; thereafter referred to as crude extracts,was collected and used for enzyme activities assay (Zou, 2000).Superoxide dismutase (SOD: EC 1.15.1.1) activity was measuredusing the photochemical NBT method (Zou, 2000), peroxidase(POD: EC 1.11.1.7) activity was evaluated following the guaia-col oxidation method (Maehly and Chance, 1954), and catalase(CAT: EC 1.11.1.6) activity was evaluated by a reagent kit (NanjingJiancheng Bioengineering Institute, China).

2.5. Flower quality and color indices measurements

Flower fresh weight was the average value of ten flowers by bal-ance (Gandg Testing Instrument Factory, China), and its diameterwas measured by micrometer scale. In addition, the flower colorindices were measured on a TC-P2A chroma meter (Beijing OpticalInstrument Factory, China), using three color parameters includ-ing L*, a* and b* values. The hue angle (H◦ = arctangent (b*/a*)) wascalculated according to the methods reported previously (McGuire,1992; Voss, 1992).

2.6. Effect of pH on anthocyanin stability

10 mL 99% methanol–1% HCL extracting solution was addedto 1 g petal to extract anthocyanins. 1 mL anthocyanin solutionwas added to 9 mL pH 4.0, 5.0, 6.0 and 7.0 buffer solutions whichwere prepared using Na2HPO4–C6H8O7. After 1 h, its color wasobserved and anthocyanin content was obtained at the wavelengthof 530 nm.

2.7. RNA extraction and purification

Total RNA was extracted according to a modified CTAB extrac-tion protocol used in our laboratory (Zhao et al., 2011). The RNA ofleaves was used for gene isolation, and RNA of flowers was used forgene expression analysis. Prior to reverse-transcription, RNA sam-ples were treated with DNase using DNase I kit (TaKaRa, Japan),according to the manufacturer’s guidelines, and then quantified bya spectrophotometer (Eppendorf, Germany) at 260 nm.

2.8. Isolation of NHX1 gene

Isolation of cDNA was performed by 3′ full RACE CoreSet Ver. 2.0 (TaKaRa, Japan) and SMARTerTM RACE cDNAAmplification Kit (Clontech, Japan), and the specific opera-tions were performed according to the manufacture’s guide-lines. The first strand cDNA was synthesized from totalRNA, and then the 3′ and 5′ ends of cDNAs were ampli-fied with the designed gene-specific primers (the outer and

inner primers of 3′ RACE were 5′-GGAGGCGGATACAATGGC-3′ and 5′-ACCTCCTTCCGCCTATTA-3′; the primers of 5′ RACEwere 5′-CCAGGACAGTGCTCGCAAGAAATAGGT-3′) and the univer-sal primers provided by the kits. In addition, PCR conditions were

orticulturae 154 (2013) 45–53 47

io

2

aGutCBC

2

tRcr(AT(ms8rbfooavC

2

MctacdstgAattD

3

3

iPdnop

b

Different pH treaments

SO

D a

ctivity (

U g

-1 F

W)

0

50250

300

a

b

pH 4.0 pH 7.0 pH 10.0

CA

T a

ctivity (

U g

-1 F

W)

0

15

30

45

a

b

b

PO

D a

ctivity (

U g

-1 F

W)

0.0

2.5

5.0

7.5

10.0

a

c

b

D. Zhao et al. / Scientia H

n accordance with request of kits and the annealing temperaturef primers.

.9. Purifying, cloning and sequencing

PCR products were separated by 1% agarose gel electrophoresis,nd the incised gels were purified using TaKaRa MiniBEST Agaroseel DNA Extraction Kit Ver.3.0 (TaKaRa, Japan). The extracted prod-cts were cloned into pEASYTM-T5 Zero vector (Trans, China) andransformed into competent Escherichia coli Trans1-T1 cells (Trans,hina). The recombinant plasmids were sent Shanghai Sangoniological Engineering Technology & Services Co., Ltd. (Shanghai,hina) to sequence.

.10. Gene expression analysis

Gene transcript levels were analyzed using real-time quantita-ive polymerase chain reaction (qRT-PCR) with a BIO-RAD CFX96TM

eal-Time System (C1000TM Thermal Cycler) (Bio-Rad, USA). TheDNA was synthesized from 1 �g RNA using PrimeScript® RTeagent Kit With gDNA Eraser (TaKaRa, Japan). P. lactiflora ActinJN105299) had been used as an internal control (Zhao et al., 2012a).ll gene-specific primers in this study for qRT-PCR were shown inable 1. qRT-PCR was performed using the SYBR® Premix Ex TaqTM

Perfect Real Time) (TaKaRa, Japan) and contained 2 × SYBR Pre-ix Ex TaqTM 12.5 �L, 50× ROX Reference Dye II 0.5 �L, 2 �L cDNA

olution as a template, 2 �L mix solution of target gene primers and �L ddH2O in a final volume of 25 �L. The amplification was car-ied out under the following conditions: 50 ◦C for 2 min followedy an initial denaturation step at 95 ◦C for 5 min, 40 cycles at 95 ◦Cor 15 s, 51 ◦C for 15 s, and 72 ◦C for 40 s. Relative expression levelsf target genes were calculated by the 2−��Ct comparative thresh-ld cycle (Ct) method, and the expression level of phenylalaninemmonialyase gene (PAL) in pH 4.0 was used as the control. The Ctalues of the triplicate reactions were gathered using the Bio-RadFX Manager V1.6.541.1028 software.

.11. Sequence and statistical analysis

Sequence splicing and analysis were performed by DNA-AN 5.0 software (Lynnon Corporation, Canada). Physical and

hemical parameters of proteins were detected using ProtParamool (http://us.expasy.org/tools/protparam.html). Hydrophobicitynalysis was performed on ProtScale (http://www.expasy.org/gi-bin/protscale.pl) and transmembrane topology prediction wasone by TMHMM Server version 2.0 (http://www.cbs.dtu.dk/ervices/TMHMM/). Homology analysis was carried out usinghe GenBank BLAST (http://www.ncbi.nlm.nih.gov/blast/). Phylo-enetic tree were constructed by MEGA 5.05 (Tamura et al., 2011).ll data were means of three replicates at least with standard devi-tions. Data were subjected to analysis of variance (ANOVA) usinghe SAS/STAT statistical analysis package (version 6.12, SAS Insti-ute, Cary, NC, USA) and the differences were compared by theuncan’s test with a significance level of P < 0.05.

. Results

.1. Morphological parameters

P. lactiflora morphology was seriously influenced by the pH inrrigation water (Table 2). Compared with the control (pH 7.0),. lactiflora irrigated with pH 4.0 and 10.0 waters exhibited a

ecrease in plant height, leaf area, stem diameter, branch number,ode number and plant crown width except leaf number. More-ver, significant levels were reached by plant height, leaf area andlant crown width between two pH treatments and the control,

Fig. 1. Effect of pH of irrigation water on activities of three protective enzymes inP. lactiflora.

among which, plant crown width was significantly decreased by32.66% and 17.61%, respectively. As far as only pH treatments wereconcerned, morphological parameters of treated plants were notalways consistent, such as leaf area, stem diameter, branch num-ber and plant crown width when irrigated with pH 4.0 water werelower than with pH 10.0 water.

3.2. Physiological indices and protective enzyme activities

The state of plant growth and the activity of internal metabolismcould be exactly evaluated by physiological indices. As shown inTable 3, chlorophyll a, chlorophyll b and chlorophyll a+b contentswere all increased in plants irrigated with pH 4.0 and 10.0 waters,and chlorophyll b content was underwent the largest increase of14.74% and 16.84% in contrast to the control, respectively. On thecontrary, the decrease was found in chlorophyll a/b with 6.08%and 5.41%. Soluble protein, soluble sugar, MDA, H2O2 and free pro-line contents presented an increased trend in response to irrigationwith waters at pH 4.0 and 10.0.

Subsequently, activities of three protective enzymes in P. lacti-

flora including SOD, POD and CAT were measured (Fig. 1). Amongwhich, SOD activity was the highest and POD activity was the low-est, the former was 32.4 times the activity of the latter in thecontrol. Meanwhile, P. lactiflora under different treatments showed

48 D. Zhao et al. / Scientia Horticulturae 154 (2013) 45–53

Table 1Primers sequence for detection by qRT-PCR.

Gene GenBank accession number Forward primer (5′-3′) Reverse primer (5′-3′) Length of amplification (bp)

Actin JN105299 GCAGTGTTCCCCAGTATT TCTTTTCCATGTCATCCC 169PAL JQ070801 ACATTCTCGCCACTACCA CTTCCGAAATTCCTCCAC 157CHS JN132108 CACCCACCTTGTTTTCTG CCCTTTGTTGTTCTCTGC 178CHI Jn119872 TCCCACCTGGTTCTTCTA AACTCTGCTTTGCTTCCG 183F3H JQ070802 AGTTCTTCGCTTTACCGC CAATCTCGCACAGCCTCT 109F3′H JQ070803 TGGCTACTACATTCCAAAAG CCAAACGGTATAACCTCAA 171DFR JQ070804 CTTCCTGTGGAAAAGAACC CCAAAAACAAACCAGAGATC 198ANS JQ070805 AGGAGAAGATCATACTCAAG ACAAAGAAGCACAAAGGCAC 190F3GT JQ070806 AACACCGAATGCCTAAAC AGCCACCCATCACTAAAT 175F5GT JQ070807 GAAGCGTCTCTGTTTTACC CTCCTTGTCTCCATCTCG 119NHX1 JX524227 TAAATCAGGATGAGACGCC GTGCTCGCAAGAAATAGGTA 175

Table 2Effect of pH of irrigation water on morphological parameters of P. lactiflora. The values represented mean ± SE, and different letters mark significant differences at P < 0.05 byDuncan’s test.

Morphological parameters pH 4.0 pH 7.0 pH 10.0

Plant height (cm) 65.83 ± 2.36b 80.20 ± 1.72a 62.86 ± 5.01b

Leaf number 896 ± 217.48a 868 ± 190.90a 967.75 ± 262.76a

Leaf area (cm2) Top 13.04 ± 1.90b 22.52 ± 2.00a 13.30 ± 1.63b

Middle 17.42 ± 2.86c 41.94 ± 5.37a 24.72 ± 2.86b

Bottom 17.15 ± 2.09b 26.85 ± 3.99a 17.46 ± 1.10b

Stem diameter (cm) Top 0.31 ± 0.03a 0.34 ± 0.05a 0.33 ± 0.02a

Middle 0.63 ± 0.07a 0.64 ± 0.07a 0.63 ± 0.06a

Bottom 0.75 ± 0.04a 0.78 ± 0.09a 0.77 ± 0.09a

Branch number 11.67 ± 2.66a 14.00 ± 4.38a 13.83 ± 2.79a

Node number 10.50 ± 1.29a 10.75 ± 0.96a 10.00 ± 0.82a

Plant crown width (cm) 63.75 ± 4.27c 94.67 ± 3.51a 78.00 ± 2.58b

Table 3Effect of pH of irrigation water on physiological indices of P. lactiflora. The values represented mean ± SE, and different letters mark significant differences at P < 0.05 byDuncan’s test.

Physiological indices pH 4.0 pH 7.0 pH 10.0

Chlorophyll a (mg g−1) 3.02 ± 0.22ab 2.81 ± 0.10b 3.09 ± 0.02a

Chlorophyll b (mg g−1) 1.09 ± 0.05a 0.95 ± 0.05b 1.11 ± 0.05a

Chlorophyll a/b 2.78 ± 0.07a 2.96 ± 0.10a 2.80 ± 0.14a

Chlorophyll a+b (mg g−1) 4.10 ± 0.28ab 3.76 ± 0.14b 4.20 ± 0.03a

Soluble protein (mg g−1) 5.21 ± 0.13a 3.12 ± 0.26c 4.66 ± 0.06b

MDA (nmol g−1) 20.77 ± 0.39a 11.96 ± 0.06c 19.65 ± 0.23b

−1 b c a

tcmtwnrt

3

cflgTgae9ead

Among physiological indices related to flower color, antho-cyanin content and pH value of petal were measured. Inplants irrigated with water at pH 4.0, anthocyanin content was

Soluble sugar (mmol g ) 0.17 ± 0.00H2O2 (mol g−1 prot) 0.76 ± 0.11a

Free proline (�g g−1) 403.34 ± 3.93a

he same trends in activities of three protective enzymes, and theontrol could grow normally with highest activities of enzymes,oreover, the lower pH for plants irrigated with water indicated

hat pH 4.0 was more detrimental than it was in plants irrigatedith pH 10.0 water. In three protective enzymes, POD had sig-ificant difference among different treated P. lactiflora, which waseduced by 47.46% and 25.74% at pH 4.0 and 10.0 compared withhe control.

.3. Flower quality and color indices

With the growth and development of plants, p. lactiflora budsould not unfold into flowers under pH 10.0 treatment, therefore,ower quality and color indices were only studied in plants irri-ated with waters at pH 4.0 and the control (Fig. 2). As shown inable 4, flower diameter and flower fresh weight of plants irri-ated with water at pH 4.0 were significantly reduced by 26.78%nd 27.82% in contrast to the control. The color differences werexpressed as H◦ and a*/b*. H◦ was as follows: 0◦ for reddish-purple,

0◦ for yellow, 180◦ for bluish-green and 270◦ for blue (Crisostot al., 1994; Intelmann et al., 2005). In addition, the larger value of*/b*, the more red was (Rodrigo et al., 2004). Both H◦ and a*/b*isplayed that flower color of plants irrigated with water at pH 4.0

0.13 ± 0.00 0.18 ± 0.000.70 ± 0.10a 0.90 ± 0.24a

23.41 ± 1.25c 262.77 ± 20.26b

was lighter and brighter compared with the control. And significantdifferences in all the flower quality and color indices were reached.

Fig. 2. Flowers of P. lactiflora in full bloom stage was affected by pH of irrigationwater.

D. Zhao et al. / Scientia Horticulturae 154 (2013) 45–53 49

Table 4Effect of pH of irrigation water on flower quality of P. lactiflora. The values repre-sented mean ± SE, and different letters mark significant differences at P < 0.05 byDuncan’s test.

Flower quality indices pH 4.0 pH 7.0

Flower diameter (cm) 8.75 ± 0.91b 11.95 ± 0.40a

Flower fresh weight (g) 6.98 ± 1.03b 9.67 ± 0.86a

Flower color

sh

3

ptaw

3

puwgot

Fl

pH value4 5 6 7

Ab

so

rba

nce

va

lue

(O

D53

0)

0.0

.2

.4

.6

a b c

d

H◦ 52.99 ± 4.26a 49.18 ± 2.10b

a*/b* 0.76 ± 0.11b 0.87 ± 0.06a

ignificantly lower with 58.93%, while pH value was significantlyigher with 1.62% than those of control (Fig. 3).

.4. Stability of anthocyanins in pH buffer solutions

Anthocyanins extracted from P. lactiflora were added to differentH buffer solutions, its color began to change from red to white, andhen to yellowish-brown at a pH ranging from 4.0 to 7.0. And thenthocyanin content was significantly reduced by 13.33%, whichas consistent with color changes (Fig. 4).

.5. Isolation and sequence analysis of NHX1 gene

In order to further clarify the relationship between pH value ofetal and flower color, we aimed to isolate NHX1 gene which reg-lated pH value of petal in previous reports. Gene-specific primersere used for rapid amplification of cDNA ends (RACE) of NHX1

ene, which resulted in an approximate 1500 and 1000-bp bandf 3′ and 5′ cDNA ends, respectively. The spliced results showedhat 2105 bp NHX1 cDNA contained an untranslated region (UTR)

b

An

tho

cya

nin

co

nte

nt

(OD

53

0 g

-1 F

W)

0.0

.2

.4

.6 a

a

Dif ferent p H tr eaments

pH 4.0 pH 7.0

pH

va

lue

5.50

5.55

5.60

5.65

5.70

b

b

a

ig. 3. Effect of pH of irrigation water on anthocyanin content and pH value of P.actiflora petal.

Fig. 4. Changes of P. lactiflora anthocyanin content under different pH buffer solu-tions.

of 339 bp in 5′ end, a 1612-bp open reading frame (ORF) encoding536 amino acids, a 3′-UTR of 154 bp and a poly (A) tail.

Amino acid sequence analysis demonstrated that the putativemolecular weight was 59.46 kDa, the theoretical isoelectric point(pI) was 8.07, and total number of negatively charged residues(Asp + Glu) and positively charged residues (Arg + Lys) was 36 and38, respectively. Its instability index (II) was computed to be35.48 which classified this protein as stable. Hydrophobicity andtransmembrane topology analysis revealed that it had a stronghydrophobicity and high hydrophobic amino acid content; this pro-tein contained 8 transmembrane topological structures with 20–23amino acids each one. Meanwhile, homology analysis revealedthat this protein shared 74–77% identity and 82–85% similar-ity with NHX1 from Salicornia europaea (AAN08157), Malus zumi(ADB80440), Citrus reticulata (AAT36679), Atriplex dimorphoste-gia (AAO48271), Atriplex gmelini (BAB11940) and Medicago falcata

(ADB27460), and contained a high conservative sequence-bindingdomain of amiloride (LFFIYLLPPI).

GoNHX1 MsNHX1 CkNHX1 GmNHX1 RhNHX1 PlNHX1 CmNHX1 HtNHX1 HvNHX1 OsNHX1 ZmNHX1 TaNHX1 BnSOS1 ThSOS1 AtSOS1 Le SOS1 PeSOS1 OsSOS1 PtSOS1 TaSOS1

Fig. 5. Phylogenetic tree of NHXs amino acid sequences from P. lactiflora and someother species.

5 orticu

gpchccP

3

pbts3dg((wtotsPmoiwtsat

4

sppoarepgpoawrt2gmawmbct(oi

0 D. Zhao et al. / Scientia H

Phylogenetic tree was drawn by MEGA software (Fig. 5). Theseenes were divided into two types (vacuolar Na+/H+ antiporter andlasma membrance Na+/H+ antiporter). Moreover, the first typeould be classified into monocotyledons and dicotyledons, and Rosaybrid was the one most similar to P. lactiflora. These results wereoncordant with traditional classification. Therefore, this sequenceould be confirmed NHX1 gene in P. lactiflora, which was appointedlNHX1 with GenBank accession number JX524227.

.6. Gene expression analysis

To examine whether anthocyanin content and pH value underH treatments could be related to the expression of relatediosynthetic genes, transcript levels of nine anthocyanin biosyn-hetic genes we had isolated from P. lactiflora (PAL, chalconeynthase gene (CHS), chalcone isomerase gene (CHI), flavanone-hydroxylase gene (F3H), flavonoid 3′-hydroxylase gene (F3′H),ihydroflavonol 4-reductase gene (DFR), anthocyanindin synthaseene (ANS), UDP-glucose: flavonoid 3-O-glucosyltransferase geneF3GT) and UDP-glucose: flavonoid 5-O-glucosyltransferase geneF5GT)) (Zhao et al., 2012b,c) and PlNHX1 gene isolated in this paperere analyzed by qRT-PCR. All detected genes could express, but

heir levels were various (Fig. 6). Among which, the expression levelf PlCHS was the highest, and the lowest was in PlF5GT. When pHreatments were concerned, expression levels of all genes reachedignificant levels except CHI, the expression levels of PlPAL, PlCHI,lDFR and PlF5GT were reduced in contrast to the control, and theaximum reduction was observed in PlDFR with 41.66%, while the

ther gene expression levels all increased to some extent. Thust could be seen that the faded flower color was closely related

ith PlPAL, PlCHI, PlDFR and PlF5GT, especially PlDFR controllinghe formation of colorless flower pigment. In addition, the expres-ion level of PlNHX1 was adversely affected by pH 4.0 treatment,nd decreased pH in irrigation water caused a rise about twice ashe control in its expression level.

. Discussion

The way of measuring how acidic or alkaline environment is acale called pH, which not only affects the nutrient availability androduction of harmful materials, but also plays an important role inlant growth. The suitable range of environmental pH value is vari-us for different plant species, moreover, the plant only can absorb

comprehensive nutrition and grow normally in its suitable pHange (Zhao, 2003). Singh and Singh (2005) found the inhibitoryffect of high soil pH on growth of Oryza sativa, for instance, itsanicle length, rachis branches, total spikelets, filled grains andrain size were all adversely affected by higher soil alkalinity atH 10.3. Valdez-Aguilar et al. (2009) discovered that plant growthf all three cultivars in Tagetes erecta including plant height, leafnd shoot dry weight were all decreased in response to irrigationith saline waters at pH 6.4. Similarly, soil pH 4.0 caused more

eductions of transpiration rates, stomatal conductance, and evapo-ranspiration than pH 6.0 did in Lycopersicon esculintum (Kang et al.,011). In this study, P. lactiflora was obviously damaged when irri-ated with pH 4.0 and 10.0 waters, which was directly indicated byorphology. All morphological parameters were lower at pH 4.0

nd 10.0 than at pH 7.0 except leaf number, and significant levelsere reached by plant height, leaf area and plant crown width. Thisight be caused by the reason that the plants would be poisoned

y H+, Al3+ and Mn2+ in acidic condition, as well as low pH wouldause the lack of Mg, Ca, K, P and Mo elements; in alkaline condi-

ion, the effectiveness of various trace elements would be reducedZhao, 2003; Rosas et al., 2007). These results showed that the rolef pH value in soil or irrigation water in plant growth could not begnored besides nutrient substance.

lturae 154 (2013) 45–53

When the plant is subjected to serious stress, its various phys-iological processes will be affected. MDA, H2O2 and free prolinecontents are usually served as physiological indices of plant stressresponse. In P. lactiflora, these three indices were significantlyaffected by changed pH in irrigation water, and their values wereall higher than those of the control, suggesting P. lactiflora wasin adverse circumstances under pH 4.0 and 10.0 treatments, andthe highest levels of stress was shown under pH 4.0 treatment. Inaddition, chlorophyll content directly affectd plant photosynthe-sis, chlorophyll a, b and a+b contents in P. lactiflora irrigated withwater at pH 4.0 and 10.0 were higher than those of the control,while chlorophyll a/b was dropped indicating P. lactiflora was aplant with acid-alkali resistance to some extent. And in acid andalkaline conditions, P. lactiflora might produce stress response torepair itself, improve leaf chlorophyll content, and enhance photo-synthesis which resulted in the accumulation of soluble sugar andsoluble protein. Meantime, activities of three protective enzymestrended similarly which were lower at pH 4.0 and 10.0 than at pH7.0, and the lowest activities were at pH 4.0 which was consistentwith physiological indices.

Subsequently, flower quality of P. lactiflora was analyzed. Irri-gated water at pH 10.0 prevented buds unfolding into flowers, butthe pH 4.0 treatment was opposite. This phenomenon was inconsis-tent with the former conclusion that the highest stress was causedby pH 4.0 treatment, and the specific reason needed further study.In plants irrigated with water at pH 4.0, flower quality of P. lacti-flora had changed. Its flower diameter and flower fresh weight werereduced, and flower color was faded.

As far as flower color was concerned, two main impact factorswere analyzed including anthocyanin content and pH value of petal(Reuveni et al., 2001). In plants irrigated with water at pH 4.0,anthocyanin content was significantly lower, while pH value wassignificantly higher than those of the control. When the extractedanthocyanins were put in different pH buffer solutions, its colorwas faded and anthocyanin content was reduced at a pH rangingfrom 4.0 to 7.0, which helped explain why flower color in P. lact-iflora was faded under pH 4.0 treatment. This result was identicalwith Ipomoea nil (Fukada-Tanaka et al., 2000), Loropetalum chi-nense var. rubrum (Tao et al., 2003). Moreover, pH value of petalwas also higher under pH 4.0 treatment, which also occurred inBerberis Thunbergii Cv. Atropurpurea (Gao, 2011). When P. lactiflorawas irrigated by pH 4.0 water, the original growing environmentwas greatly changed and the enzyme activities in rhizosphere envi-ronment were damaged, so P. lactiflora showed abnormal growthand the disorder of pH value might occur.

NHX1 gene is required for the exchange of Na+ for H+ across vac-uolar membranes and compartmentalizes Na+ into vacuoles whichresults in the vacuolar alkalization (Nass et al., 1997; Ohnishi et al.,2005). And some reports indicated NHX1 mediated partial vacuo-lar alkalization in the flowers (Yamaguchi et al., 2001). Therefore,exploring and studying this gene was extremely important forunderstanding the formation mechanism of flower color. In thisstudy, a Na+/H+ antiporter gene had been isolated from P. lacti-flora, homology analysis and phylogenetic tree all suggested thisgene belonged to NHX1, which shared high identity and similaritywith NHX1 in other plants. Additionally, PlNHX1 had a high degreeconserved amiloride binding-site sequence LFFIYLLPPI. Expressionanalysis of PlNHX1 showed that relative high level under pH 4.0treatment was reached compared with the other treatments, whichwas in agreement with the tendency of petal pH value. Therefore,this could further indicate that increased pH value was one impor-tant factor for faded flower color in P. lactiflora.

Expression analysis of nine anthocyanin biosynthetic genesshowed faded flower color was also coordinately regulated by allanthocyanin biosynthetic genes. Low expression levels of upstreamPlPAL and PlCHI genes decreased the upstream synthetic products,

D. Zhao et al. / Scientia Horticulturae 154 (2013) 45–53 51

PlPA L

0.0

.4

.8

1.2

PlCHS

0

10

20

30

PlCHI

0.0

.4

.8

1.2

PlF3H

0.0

.2

.4

.6

PlF3'H

Re

lative

exp

ressio

n le

ve

l

0.00

.01

.02

.03

PlANS

0.0

.2

.4

.6

PlDFR

Re

lative

exp

ressio

n le

ve

l

0.0

.3

.6

.9

PlF3GT

0.0

.2

.4

.6

PlF5GT

pH 4.0 pH 7 .00.000

.002

.004

.006

PlNHX1

Different pH trea ments

pH 4.0 pH 7 .00.0

.2

.4

.6

b

a a

aa

aa

aa

a

a

b

b

b

b

b

b

b

b

a

patte

aosfpl

Fig. 6. Effect of pH of irrigation water on the expression

nd the expression level of the key PlDFR controlling the formationf colorless flower pigment was reduced by 41.66%, which caused

ignificant decline of colored flower pigment content. Lu and Yangound that DFR was induced expression in tuber skins of Solanuminnatisectum by white light, and followed by anthocyanin accumu-ation (Lu and Yang, 2006). Park et al. discovered that the expression

rns of nine anthocyanin biosynthetic genes and PlNHX1.

level of DFR was higher in red skin of Raphanus sativus than that ofwhite skin (Park et al., 2011). In Dendranthema grandiflorum and

Helianthus annuus, DFR showed a higher gene expression level indark color varieties (Zhang et al., 2009; Chen et al., 2010). There-fore, PlDFR was a key gene which limited anthocyanin biosynthesiswhen P. lactiflora was irrigated with water at pH 4.0. The results of

5 orticu

tiq

5

iawodtmal

A

&(od

R

A

A

A

A

A

C

C

C

D

E

F

G

G

G

I

J

2 D. Zhao et al. / Scientia H

his experiment would provide a theoretical basis for further clar-ty the effects of pH in irrigation water on plant growth and floweruality in P. lactiflora.

. Conclusions

In conclusion, the investigated morphological parameters, phys-ological indices, protective enzyme activities and flower qualityll indicated that plant growth and flower quality of P. lactifloraere seriously affected by extreme pH in irrigation water. More-

ver, faded flower color under pH 4.0 treatment was attributed toecreased anthocyanin content and increased pH value of petal,hese two were mainly controlled by PlNHX1 and PlDFR genes in

olecular biology. The results would provide a theoretical guid-nce for the use of irrigation water in practical production of P.actiflora.

cknowledgments

This work was financially supported by Agricultural Science Technology Independent Innovation Fund of Jiangsu Province

CX[11]1017), Agricultural Science & Technology Support Projectf Jiangsu Province (BE2011325, BE2012468) and the Priority Aca-emic Program Development from Jiangsu Government.

eferences

n, B.Y., Luo, Y., Li, J.R., Qiao, W.H., Zhang, X.S., Gao, X.Q., 2008. Expression of a vac-uolar Na+/H+ antiporter gene of Alfalfa enhances salinity tolerance in transgenicArabidopsis. Acta Agron. Sin. 34, 557–564.

nugoolprasert, O., Kinoshita, S., Naito, H., Shimizu, M., Ehara, H., 2012. Effect of lowpH on the growth, physiological characteristics and nutrient absorption of SagoPalm in a hydroponic System. Plant Prod. Sci. 15, 125–131.

nupama, J., Mukul, J., Narendra, S.Y., Pradeep, K.A., Bhavanath, J., 2011.Cloning and characterization of the Salicornia brachiata Na+/H+ antiportergene SbNHX1 and its expression by abiotic stress. Mol. Biol. Rep. 38,1965–1973.

pse, M.P., Aharon, G.S., Snedden, W.A., Blumwald, E., 1999. Salt tolerance conferredby overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 285,1256–1258.

sen, S., Stewart, R.N., Norris, K.H., 1975. Anthocyanin, flavonol copig-ments, and pH responsible for larkspur flower color. Phytochemistry 14,2677–2682.

hen, S.M., Zhu, X.R., Chen, F.D., Luo, H.L., Lv, G.S., Fang, W.M., Zhang, Z., 2010.Expression profiles of anthocyanin biosynthetic genes in chrysanthemum culti-vars with different flower colors. Acta Bot. Boreal. Occident. Sin. 30, 0453–0458(in Chinese).

lark, G.E., Burge, G.K., 2002. Effects of soilless media pH on cut flowerand tuber production in Sandersonia aurantiaca. N. Z. J. Crop. Hort. 30,127–134.

risosto, C.H., Garner, D., Crisosto, G.M., Sibbett, S., Day, K.R., 1994. Late harvest anddelayed cooling induce internal browning of ‘Ya Li’ and ‘Seuri’ Chinese pears.HortScience 29, 667–670.

u, Y., Hei, Q., Liu, Y., Zhang, H., Xu, K., Xia, Tao., 2010. Isolation and characterizationof a putative vacuolar Na+/H+ antiporter gene from Zoysia japonica L. J. Plant Biol.53, 251–258.

ason, J., Pinkney, T., Heyes, J., Brash, D., Bycroft, B., 2002. Effect of storage tempera-ture and harvest bud maturity on bud opening and vase life of Paeonia lactifloracultivars. N. Z. J. Crop. Hort. 30, 61–67.

ukada-Tanaka, S., Inagaki, Y., Yamaguchi, T., Saito, N., Iida, S., 2000. Colour-enhancing protein in blue petals. Nature 407, 581.

ao, H.M., 2011. Study on the effect of soil pH and fertilization treatments to leafcolor of Berberis Thunbergii Cv. Atropurpurea. Master dissertation, Sichuan Agri-cultural University, Chengdu, China (in Chinese).

erloff-Elias, A., Spijkerman, E., Pröschold, T., 2005. Effect of external pH onthe growth, photosynthesis and photosynthetic electron transport of Chlamy-domonas acidophila Negoro, isolated from an extremely acidic lake (pH 2.6). PlantCell Environ. 28, 1218–1229.

uan, B., Hu, Y., Zeng, Y., Wang, Y., Zhang, F., 2011. Molecular characterizationand functional analysis of a vacuolar Na+/H+ antiporter gene (HcNHX1) fromHalostachys caspica. Mol. Biol. Rep. 38, 1889–1899.

ntelmann, D., Jaros, D., Rohm, H., 2005. Identification of color optima of commercial

tomato catsup. Eur. Food Res. Technol. 22, 662–666.

ia, N., Shu, Q.Y., Wang, D.H., Wang, L.S., Liu, Z.A., Ren, H.X., 2008. Identi-fication and characterization of anthocyanins by high-performance liquidchromatography-electrospray ionization–mass spectrometry in herbaceouspeony species. J. Am. Soc. Hortic. Sci. 133, 418–426.

lturae 154 (2013) 45–53

Kang, Y.I., Park, J.M., Kim, S.H., Kang, N.J., Park, K.S., Lee, S.Y., Jeong, B.R., 2011. Effectsof root zone ph and nutrient concentration on the growth and nutrient uptakeof tomato seedlings. J. Plant Nutr. 34, 640–652.

Liu, L., Zeng, Y., Pan, X., Zhang, F., 2012. Isolation, molecular characterization, andfunctional analysis of the vacuolar Na+/H+ antiporter genes from the halophyteKarelinia caspica. Mol. Biol. Rep. 39, 7193–7202.

Lu, Q.N., Yang, Q., 2006. cDNA cloning and expression of anthocyanin biosyn-thetic genes in wild potato (Solanum pinnatisectum). Afr. J. Biotechnol. 5,811–818.

Maehly, P.C., Chance, M., 1954. The assay of catalase and peroxidases. In: Gluck,D. (Ed.), Methods of Biochemical Analysis. Interscience Publishers, New York,England, pp. 357–424.

Markham, R.K., Ofman, D.J., 1993. Lisianthus flavonoid pigments and factors influ-encing their expression on flower colour. Phytochemistry 43, 679–685.

McGuire, R.G., 1992. Reporting of objective colour measurements. HortScience 27,1254–1255.

Meng, X.C., Wang, X.J., 2004. Regulation of flower development and antho-cyanin accumulation in Gerbera hybrida. J. Hortic. Sci. Biotechnol. 79,131–137.

Nass, R., Cunningham, K.W., Rao, R., 1997. Intracellular sequestration of sodiumby a novel Na+/H+ exchanger in yeast is enhanced by mutations in the plasmamembrane H+-ATPase. J. Biol. Chem. 272, 26145–26152.

Ohnishi, M., Fukada-Tanaka, S., Hoshino, A., Takada, J., Inagaki, Y., Iida, S., 2005.Characterization of a novel Na+/H+ antiporter gene InNHX2 and comparisonof InNHX2 with InNHX1, which is responsible for blue flower coloration byincreasing the vacuolar pH in the Japanese morning glory. Plant Cell Physiol. 46,259–267.

Park, N.I., Xu, H., Li, X., Jang, I.H., Park, S., Ahn, G.H., Lim, Y.P., Kim, S.J.,Park, S.U., 2011. Anthocyanin accumulation and expression of anthocyaninbiosynthetic genes in radish (Raphanus sativus). J. Agric. Food Chem. 59,6034–6039.

Qiao, W.H., Zhao, X.Y., Li, W., Luo, Y., Zhang, X.S., 2007. Overexpression ofAeNHX1, a root-specific vacuolar Na+/H+ antiporter from Agropyron elonga-tum, confers salt tolerance to Arabidopsis and Festuca plants. Plant Cell Rep. 26,1663–1672.

Reuveni, M., Evenor, D., Artzi, B., Perl, A., Erner, Y., 2001. Decrease in vacuolar pHduring petunia flower opening is reflected in the activity of tonoplast H+-ATPase.J. Plant Physiol. 158, 991–998.

Rodrigo, M.J., Marcos, J.F., Zacarías, L., 2004. Biochemical and molecular analysisof carotenoid biosynthesis in flavedo of orange (Citrus sinensis L.) during fruitdevelopment and maturation. J. Agric. Food Chem. 52, 6724–6731.

Rosas, A., Rengel, Z., de la Luz Mora, M., 2007. Manganese supply and pH influencegrowth, carboxylate exudation and peroxidase activity of ryegrass and whiteclover. J. Plant Nutr. 30, 253–270.

Ruan, J., Gerendás, J., Härdter, R., Sattelmacher, B., 2007. Effect of nitrogen form androot-zone pH on growth and nitrogen uptake of tea (Camellia sinensis) plants.Ann. Bot. (Lond.) 99, 301–310.

Santos, K.R., de, S., Jacinavicius, F.R., Sant’anna, C.L., 2011. Effects of the pH ongrowth and morphology of Anabaenopsis elenkinii Miller (Cyanobacteria) iso-lated from the alkaline shallow lake of the Brazilian Pantanal. Fottea 11,119–126.

Singh, H.P., Singh, T.N., 2005. Inhibitory effect of high soil pH on growth andmineral metabolism of rice and its reversal by zinc. J. Environ. Biol. 26,669–674.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5:molecular evolutionary genetics analysis using maximum likelihood, evo-lutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28,2731–2739.

Tao, Q.R., Chen, Y.Y., Zhou, P.H., 2003. Study on the stability of anthocyanin and pHchanges in cell sap of leaves in Loropetalum chinense var. rubum. Hunan For. Sci.Technol. 30, 24–25 (in Chinese).

Valdez-Aguilar, L.A., Grieve, C.M., Poss, J., 2009. Salinity and alkaline pH in irrigationwater affect marigold plants: I. Growth and shoot dry weight partitioning.HortScience 44, 1719–1725.

Voss, D.H., 1992. Relating colourimeter measurement of plant colour to the RoyalHorticultural Society colour chart. HortScience 27, 1256–1260.

Waltona, E.F., Boldinghb, H.L., McLarenc, G.F., Williamsa, M.H., Jackman, R., 2010.The dynamics of starch and sugar utilisation in cut peony (Paeonia lacti-flora Pall.) stems during storage and vase life. Postharvest Biol. Tecnol. 58,142–146.

Wang, J.G., Zhang, Z.S., 2005. Herbaceous peonies of China. In: Wang, J.G., Zhang, Z.S.(Eds.), China Forestry Publishing House, Beijing, China, p. 3 (in Chinese).

Yamaguchi, T., Apse, M.P., Shi, H., Blumwald, E., 2003. Topological analysisof a plant vacuolar Na+/H+ antiporter reveals a luminal C terminus thatregulates antiporter cation selectivity. Proc. Natl. Acad. Sci. U.S.A. 100,12510–12515.

Yamaguchi, T., Fukada-Tanaka, S., Inagaki, Y., Saito, N., Yonekura-Sakakibara, K.,Tanaka, Y., Kusumi, T., Iida, S., 2001. Genes encoding the vacuolar Na+/H+

exchanger and flower coloration. Plant Cell Physiol. 42, 451–461.Zhang, L.J., Pan, D.R., Zhou, Y.F., Wang, Z.C., Hua, S.M., Hou, L.L., Sui, F.F., 2009. Cloning

and expression of genes involved in anthocyanins synthesis in ornamental sun-

flower. Acta Hortic. Sin. 36, 73–80 (in Chinese).

Zhao, D.Q., Han, C.X., Ge, J.T., Tao, J., 2012b. Isolation of a UDP-glucose: flavonoid 5-O-glucosyltransferase gene and expression analysis of anthocyanin biosyntheticgenes in herbaceous peony (Paeonia lactiflora Pall.). Electron. J. Biotechnol. 15(6), http://dx.doi.org/10.2225/vol15-issue6-fulltext-7.

orticu

Z

Z

D. Zhao et al. / Scientia H

hao, D.Q., Tao, J., Han, C.X., Ge, J.T., 2012a. Actin as an alternative internal controlgene for gene expression analysis in herbaceous peony (Paeonia lactiflora Pall.).

Afr. J. Agric. Res. 7, 2153–2159.

hao, D.Q., Tao, J., Han, C.X., Ge, J.T., 2012c. Flower color diversity revealed bydifferential expression of flavonoid biosynthetic genes and flavonoid accu-mulation in herbaceous peony (Paeonia lactiflora Pall.). Mol. Biol. Rep. 39,11263–11275.

lturae 154 (2013) 45–53 53

Zhao, D.Q., Zhou, C.H., Kong, F., Tao, J., 2011. Cloning of phytoene desaturase andexpression analysis of carotenogenic genes in persimmon (Diospyros kaki L.)

fruits. Mol. Biol. Rep. 38, 3935–3943.

Zhao, J.X., 2003. Relation of Soil acidity and plant growth. Inner Mongolia Agric. Sci.Technol. 6, 33 (in Chinese).

Zou, Q., 2000. Plant physiology experimental guidance. In: Zou, Q. (Ed.), China Agri-cultural Press, Beijing, China, pp. 102–103 (in Chinese).