DNA Repair and Cancer

Susceptibility

Hernan A. Flores-Rozas, PhDDyson Pharmacy 221

hernan.floresrozas@famu.edu

2

What we will address in this lecture:

1. Introduction to cancer and control of cell proliferation.

2. Oncogenes, tumor suppressors and clonal origin of cancer.

3. Mutations and the genetic origin of cancer.

4. Repair of replication errors.

5 . A Hereditary cancer syndrome caused by a defect in DNA repair.

6 . What to do with this knowledge.

Cancer Introduction• Cancer can be defined as the

uncontrolled growth and spread of cells throughout the body

• Cancer is not a single disease but is comprised of over 100 different diseases, defined on the basis of site of origin, specific characteristics and in some cases causative molecular events

• The human body contains trillions of cells, and the growth and survival of these cells must be controlled to maintain normal homeostasis

• Cancer is a breakdown of the normal mechanisms controlling cell growth and survival

Positive signalsproliferation

Negative signalsapoptosisgrowth arrest/senescencedifferentiation

GO

M S

G1

G2

Cells Enter The Cell Cycle to Proliferate

Interphase generally lasts at least 12 to 24 hours in mammalian tissue. During this period, the cell is constantly synthesizing RNA, producing protein and growing in size. By studying molecular events in cells, scientists have determined that interphase can be divided into 4 steps:

Gap 0 (G0)Gap 1 (G1)S (synthesis) phaseGap 2 (G2)

In Mitosis (M) growth stops and the cell divides into 2 daughter cells.

5

• Many carcinogens are mutagens.

• Susceptibility to certain carcinogens is dependent on the ability of cellular enzymes to convert them to a mutagenic form.

• Defects in DNA repair increase the probability of cancer.

• Some cancers are inherited (?)

• Malignant tumors contain mutated oncogenes.

• Some tumors have lost or mutated tumor suppressor genes.

Evidence for a Genetic Origin of Cancer

Types of Mutations

**

Normal Activity Abnormal Activity

7

Types of Injuries That Can Result in Mutations

Spontaneous Alterations of and Damage to DNA- Mismatches (replication errors)- Spontaneous alterations in the chemistry of DNA

bases• Deamination of bases• Loss of bases• Oxidative damage to DNA

Environmental Damage to DNA- Physical damage to DNA

• Ionizing radiation (X-rays)• UV radiation (Sun light)

- Chemical damage to DNA• Alkylating agents• Crosslinking agents

Mutations that affect Oncogenes and Tumor Suppressors are Required for Carcinogenesis

Oncogenes Generated by gain-of-function mutation. Encode proteins that promote tumor formation.

Tumor suppressor genesEncode proteins that inhibit tumor formation. Loss of function mutation occurs in tumors

Mutations on these genes provide selective advantage to the cell.

Oncogenes

Tumor suppressors

Cancers are of Clonal Origin

Both alleles of a tumor suppressor gene (TSG) need to be inactivated to initiate the carcinogenesis process

10

Cancer Risk Increases with Age

- The number of cases for any given cancer increase as the individual age increases.

- Mathematical analysis of this data suggests that 5 to 7 mutations are necessary for malignant transformation of a normal cell.

- This suggests that mutations accumulate as we age.

11

Lynch Syndrome: Hereditary Nonpolyposis Colorectal Carcinoma (HNPCC)

When several members of a family are afflicted by a particular type of cancer, it is highly probable that is has a hereditary component.

One classical example is hereditary colon cancer:

- Dominant mode of transmission.

- Founder mutation mimics sporadic case.

- Early age of onset compared to sporadic cancers.

- Multiple primary tumors.

- High Proportion of colorectal cancer. Also develop tumor of the stomach, endometrial, small bowel, bladder, ovary, biliary tract, pancreas, sebaceous skin tumors and gliomas.

12

Henry T. Lynch, M.D.

First identification of an HNPCC family was made by renowned pathologist Aldred Warthin, M.D. in 1985 based on the family of his seamstress who died at an early age of metastatic endometrial carcinoma. Warthin published a description of this family, which he called Family G, in 1913.

In 1962, Henry Lynch, M.D., had a patient who was recovering from delirium tremens. His excessive drinking was caused by his fear of dying of cancer of the colon just like most members of his family. Shortly thereafter, he was diagnosed with adrenal cortical carcinoma. Lynch to compiled the family history of this patient, many of whom were farmers residing in Missouri, Kansas, and Nebraska and reported a personal history of cancer, particularly involving the colon and often with early age of onset. Among the women, CRC was often associated with endometrial and ovarian carcinoma. He referred to this family as Family N.

Although Lynch applied for significant NIH grant support, he was turned down because reviewers did not believe that genetics was the primary cause for cancer in these families. A common suggestion by the reviewers was to search for environmental carcinogens, particularly pesticides and herbicides, given the heavy farming background of many of the families.

In 1993 Fishel and Kolodner (Harvard) and Vogelstein (Johns Hopkins) identified defects in mismatch repair as the cause of HNPCC.

A Brief History of HNPCC

13

Circles denote women; squares denote men; filled symbols denote Lynch syndrome; symbols with a dot denote inferred or verified unaffected mutation carriers; half-filled symbols denote non-Lynch syndrome cancer; plus sign denotes verified mutation; arrow denotes proband of initial subfamily. BST, benign skin tumor; CC, colon cancer; CxC, cervical cancer; D, died; EC, endometrial cancer; H, healthy; KC, kidney cancer; OC, ovarian cancer; PC, prostate cancer; RC, rectal cancer; Sa, sarcoma. Numbers denote age of diagnosis or death.Proband: The family member through whom a family's medical history comes to light.

Pedigree of a Swedish Lynch Syndrome Family

14

DNA Replication Errors

15

The Fidelity of DNA Replication is Significantly Increased by DNA

Mismatch Repair

Mechanisms for Insuring Replicative Fidelity

Mechanism Error frequency1. Base pairing 10-1 to 10-2

2. DNA polymerases 10-5 to 10-6

- base selection- proofreading

3. Accessory proteins 10-7

- single strand binding protein4. Mismatch correction 10-10

"If our strands of DNA were stretched out in a line, the 46 chromosomes making up the human genome would extend more than six feet [close to two metres]. If the ... length of the 100 trillion cells could be stretched out, it would be ... over 113 billion miles [182 billion kilometres]. That is enough material to reach to the sun and back 610 times." [Source: Centre for Integrated Genomics]

16

Common Features of the Excision-Type Repair Pathways

Recognition Step: Altered DNA is recognized and bound by a specific damage recognition protein. First step of the pathway, recruits other components required for the repair reaction.

Excision: The damaged base(s), and in some cases additional nucleotides adjacent to the damage, are excised (removed) from the DNA by exonucleases, resulting in a gapped DNA.

Resynthesis: The gap on the DNA is refilled by a DNA polymerase using the complementary strand as the template.

17

Mutations on mismatch repair genes that are associated with HNPCC and

sporadic cancers

MLH1 PMS2

MSH2 MSH6

Base:Base mispair

MSH2 MSH3

MLH1 MLH3

Insertion/Deletion mispair

H 38%S 15%

H 49%S 85%

H 2%

0%H 9%

H 2%

H: hereditaryS: sporadic

The germline mutation in Lynch’s Family N was identified in the year 2000 as a MSH2 R680X mutation.

18

Mismatch Repair in Mammalian Cells

MutS (Msh2/Msh6) - recognizes mismatch or 1 bp IDLMutS (Msh2/Msh3) - recognizes 2-12 bp IDL

MutL (Mlh1/Pms2) and MutL (Mlh1/Pms1) couple the binding of the mismatch bases to the downstream steps

The correct strand to be removed is discriminated by sensing the replication machinery .

Exonucleases (Exo I and FEN1) degrade the strand containing the incorrect base, generating a gap.

The replication machinery, including the polymerases Pol and Pol fill-in the missing fragment of DNA.

What are the Benefits of Identifying the Genetic Defects in

Cancer

Allows us to provide genetic counseling to patients belonging to afflicted families.

Provides a more accurate diagnosis of the type of cancer.

Suggests more effective therapy, in particular since mutations in certain genes correlate with the sensitivity of some cancers to smart drugs.

Genomic sequences prone to mutation

1) Mononucleotide runs:

2) Di or trinucleotide repeats:

gtacagtttttcatgtcaaaaaaaaagtc

t

3) Direct repeats (short (4-9bp) and distant (>30bp))

cca gta cag cag cagggt cat gtc gtc gtc gtc gtc

caggca

21

Molecular Features of HNPCC

Mutations in mismatch repair genes: MSH2, MLH1, MSH6 and PMS2

Immunohistochemical absence of one or more MMR gene products.

Microsatellite instability (MSI-H): 10%–15% of sporadic tumors have MSI10%–15% of sporadic tumors have MSI

95% of HNPCC tumors have MSI at multiple loci95% of HNPCC tumors have MSI at multiple loci

Electrophoresis:Electrophoresis:

Helicase

RPA

pol delta

PCNA

Possible organization of proteins at the replication fork

Futile repair pathway (structure model)