control of mammalian translation by mrna … 2006 rna...control of mammalian translation by mrna...

doi:10.1261/rna.2309906 2006 12: 851-861; originally published online Mar 15, 2006; RNA

Jeremy R. Babendure, Jennie L. Babendure, Jian-Hua Ding and Roger Y. Tsien

Control of mammalian translation by mRNA structure near caps

References

http://www.rnajournal.org/cgi/content/full/12/5/851#References

This article cites 34 articles, 13 of which can be accessed free at:

IOA Freely available online through the RNA Open Access option.

serviceEmail alerting

click heretop right corner of the article or Receive free email alerts when new articles cite this article - sign up in the box at the

Notes

http://www.rnajournal.org/subscriptions/ go to: RNATo subscribe to

© 2006 RNA Society

on May 9, 2006 www.rnajournal.orgDownloaded from

http://www.rnajournal.org/cgi/content/full/12/5/851#References

http://www.rnajournal.org/cgi/alerts/ctalert?alertType=citedby&addAlert=cited_by&saveAlert=no&cited_by_criteria_resid=rna;12/5/851&return_type=article&return_url=http%3A%2F%2Fwww.rnajournal.org%2Fcgi%2Freprint%2F12%2F5%2F851.pdf

http://www.rnajournal.org/subscriptions/

http://www.rnajournal.org

Control of mammalian translation by mRNA

structure near caps

JEREMY R. BABENDURE,1,2 JENNIE L. BABENDURE,3 JIAN-HUA DING,4 and ROGER Y. TSIEN1,2,5

1Department of Pharmacology, 2Biomedical Sciences Program, 3Department of Biological Sciences, 4Department of Cellular and MolecularMedicine, and 5Howard Hughes Medical Institute, University of California, San Diego, La Jolla, California 92093-0647, USA

ABSTRACT

The scanning model of RNA translation proposes that highly stable secondary structures within mRNAs can inhibit translation,while structures of lower thermal stability also affect translation if close enough to the 59 methyl G cap. However, onlyfragmentary information is available about the dependence of translation efficiency in live mammalian cells on the thermo-dynamic stability, location, and GC content of RNA structures in the 59-untranslated region. We devised a two-color fluo-rescence assay for translation efficiency in single live cells and compared a wide range of hairpins with predicted thermalstabilities ranging from "10 to "50 kcal/mol and 59 G cap-to-hairpin distances of 1–46 bases. Translation efficiency decreasedabruptly as hairpin stabilities increased from DG = "25 to "35 kcal/mol. Shifting a hairpin as little as nine bases relative to the59 cap could modulate translation more than 50-fold. Increasing GC content diminished translation efficiency when predictedthermal stability and cap-to-hairpin distances were held constant. We additionally found naturally occurring 59-untranslatedregions affected translation differently in live cells compared with translation in in vitro lysates. Our study will assist scientists indesigning experiments that deliberately modulate mammalian translation with designed 59 UTRs.

Keywords: translation; hairpin; structure; RNA; fluorescence; thermal stability

INTRODUCTION

RNA not only serves as templates for protein synthesis, butalso catalyzes biochemical reactions and forms supramo-lecular complexes (Gesteland 1999; Sonenberg 2000; Brantl2002). RNA has also been found to participate in generegulation in prokaryotes and eukaryotes. In prokaryotes,riboswitches regulate bacterial metabolism by transcrip-tionally or translationally controlling genes involved in vitamin,amino acid, and purine metabolism (Nudler and Mironov2004). Furthermore, small noncoding RNAs can regulategene expression in bacteria (Brantl 2002). In eukaryotes, siRNAsand micro RNAs can regulate expression of genes throughchromosomal silencing and post-transcription repressionmechanisms (Westhof and Filipowicz 2005).Translation initiation is a discrete step in eukaryotic gene

regulation (McCarthy 1998; Sonenberg 2000; Gebauer andHentze 2004). Secondary structural features of the mRNA59-untranslated region (UTR) are important to this regu-lation by affecting ribosomal recruitment and positioning

at a favorable initiation codon (Gingras et al. 1999). Themajor rate-limiting step of translation initiation is deter-mined by the binding of the 43S pre-initiation complex(composed of the 40S ribosomal complex, initiation factorseIF3, eIF1, eIF1A, eIF5, and eIF2-GTP-met-tRNA) to mRNAvia the eIF4 initiation factor complex (eIF4E, eIF4A, eIF4G,and eIF4B) (Sonenberg and Dever 2003; Gebauer andHentze 2004). The 59 methyl G cap is initially recognizedby initiation factor eIF4E. Under favorable translation con-ditions, eIF4G serves as a scaffold bridging the ribosometo the mRNA cap by binding eIF4E, eIF4A, and eIF3. Ini-tiation factor eIF4A exhibits RNA helicase activity and isthought to assist the eIF4F complex in unwinding mRNAsecondary structure, creating a binding site for the 43Sinitiation complex (Pestova et al. 2001; Takyar et al. 2005).The 43S complex then scans along the mRNA until itreaches a favorable initiation codon (Kozak 1991b).Ribosomal scanning through structural barriers is known

to be an important regulatory step, since several RNAstructures located in the 59 UTRs of mammalian mRNAtranscripts were shown to affect translation efficiency (Kozak1991b; Gebauer and Hentze 2004). Kozak first found that59 UTR noncoding regions of the a- and b-globin mRNAsimpact their translation efficiency (Kozak 1994). Severalgroups demonstrated that the 59 UTR of the ferritin

A23099 Babendure et al. ARTICLE RA

Reprint requests to: Roger Y. Tsien, Department of Pharmacology,Biomedical Sciences Program, Department of Cellular and MolecularMedicine, University of California, San Diego, La Jolla, California 92093-0647, USA; e-mail: [email protected]; fax: (858) 534-5270.Article published online ahead of print. Article and publication date are

at http://www.rnajournal.org/cgi/doi/10.1261/rna.2309906.

RNA (2006), 12:851–861. Published by Cold Spring Harbor Laboratory Press. Copyright " 2006 RNA Society. 851

JOBNAME: RNA 12#5 2006 PAGE: 1 OUTPUT: Friday April 7 22:36:44 2006

csh/RNA/111792/RNA23099



receptor mRNA and the 39 UTR of the ferritin mRNA eachcontain iron regulatory elements (IRE) which recruit IREbinding proteins to control cellular iron metabolism(Hentze et al. 1987; Rouault et al. 1988; Goossen andHentze 1992; Eisenstein 2000). Werstuck and Green (1998)further showed that they could control translation byinserting small RNA aptamer motifs into the 59 UTRof mRNAs to repress protein production upon ligandaddition. Jiang and Lucy (2001) demonstrated the signif-icance of regulation by 59 UTRs when they showed thattranslation of the bovine growth hormone receptor canvary over an 80-fold range depending on the 59 UTR splicevariant.Despite continuing efforts to investigate the role of

RNA structure in mRNA translation, gaps remain in ourunderstanding of how predicted DG and 59-UTR cap-to-structure distance in cellular mRNAs control translationefficiency in live cells. Most of our current knowledgecomes from Kozak’s studies demonstrating the scanningmodel of mRNA translation (Kozak 1992). Specifically,various hairpins were inserted into the 59 UTR of reporterconstructs to demonstrate that such mRNA hairpinsaffected translation efficiency. These initial studies in Cos7 cells found that hairpins with predicted thermal stabilityof "30 kcal/mol had no effect on translation, while hairpinsof "50 kcal/mol reduced translation by 85%–95% (Kozak1986). Kozak further showed that stem—loop cap-to-hairpindistance plays a role in translation efficiency (Kozak 1989).In these in vitro studies, structures of "30 kcal/mol re-duced translation initiation when situated 12 bases fromthe cap; however, when cap-to-hairpin distance was in-creased to 52 bases, there was no translation inhibition(Kozak 1989). Taken together, Kozak found that trans-lation efficiency is sensitive to structures proximal to theG cap and can efficiently scan through RNA structuresfurther downstream if thermal stability is low to moderate.However, it remains unclear whether hairpin distance fromthe cap affects translation in live cells, whether the de-pendence on hairpin stability is graded or abrupt, andwhether GC content has an effect independent of overallstability.The current study expands upon the above classic work

to investigate in more detail how RNA structures in the59 UTR of mRNA affect translation efficiency in live mam-malian cells. We created a reporter vector to allow ratiometricanalysis of translation efficiency in intact cells and thor-oughly characterize the translation efficiency of a dynamicrange of predicted hairpin thermal stabilities and distancesfrom the 59 G cap. In some cases, we found that a shift ofonly nine bases affects translation efficiency more than 50-fold. In addition, we found that stem GC content affectstranslation efficiency independent of predicted thermal sta-bility and 59 cap distance. Finally, we found that our livecell studies of translation efficiency of a- and b-globin 59UTRs are opposite of the in vitro lysate trends observed by

Kozak. These differences show that live cells experiments tocharacterize 59-UTR translation efficiency are critical forunderstanding how cis-acting mRNA elements regulatetranslation in intact cells.

RESULTS

Translation reporter system

To investigate the effects that 59-UTR structure had onmRNA transition, we constructed a translation reportervector allowing facile manipulation of 59-UTR sequencesupstream of a GFP reporter protein. We cloned originalenzyme sites encompassing a putative transcriptional startsite. Using 59-RACE assays, we determined RNA transcriptsinitiated primarily at base 837 of pcDNA3. This site wasreverified with additional hairpin constructs using RNaseprotection and 59-RACE procedures. We normalized forexperimental variability by adding an RFP protein on thesame vector. Transfection of this vector (GR1) into Cos 7cells resulted in green and red emissions. A general map ofvector GR1 is shown in Figure 1A.We next cloned a variety of RNA structures testing for

thermal stability, cap-to-structure distance, and GC con-tent. Although we could conceive of hundreds of structuresto test, we started with hairpins due to their structuralsimplicity. We designed seven hairpin structures with pre-dicted stabilities between "10 and "50 kcal/mol (Fig. 1B).Each hairpin was placed at distances between 1 and 16bases from the cap, subsequently described as positions +1,+4, +7, +10, +13, and +16 (Fig. 1C). We tested effects ofextended distance with hairpins "30 kcal/mol and greater,by repositioning cloning sites 30 bases downstream, posi-tions +31 and +46. In addition, we tested GC contenteffects by designing four hairpins that maintained a pre-dicted thermal stability near "30 kcal/mol and a +4position. Insert lengths were maintained using CAA motifsas spacers, since these motifs are presumed to have nosecondary structure (Hanson et al. 2003). We finally clonedcontrol constructs composed entirely of CAA motifs fornormalization to ‘‘structure-less RNAs’’.Predicted hairpin thermal stabilities (Mathews et al.

1999) were experimentally verified by measuring meltingcurves of transcribed RNAs. Empirical values showed thesame trends as predicted, however, with a narrower rangeof DG values (Table 1). Supplemental Figure S1 (at http://www.tsienlab.ucsd.edu) summarizes all insert sequencesused in this study.

Hairpin thermal stability and 59-UTR distanceinfluence translation efficiency

We evaluated how the hairpin library constructs affectedtranslation efficiency by measuring the ratios of GFP to

Babendure et al.

852 RNA, Vol. 12, No. 5


csh/RNA/111792/RNA23099



RFP with fluorescence microscopy. Figure 2A shows experi-mental translational efficiencies as a function of predictedthermal stability for all seven hairpin sets ("10 to"50 kcal/mol)with positions +1 to +46, a total of 50 constructs. Boththermal stability and cap-to-hairpin distance parametersaffected translational efficiency, especially when the pre-dicted hairpin stability was between "25 and "35 kcal/mol.Within this narrow "10 kcal/mol range, the dependence oftranslation on hairpin position was especially pronounced

when hairpin structures were placed between +1 and +13.For example, in the "25 kcal/mol hairpin set, comparedwith a hairpin placed at +1, hairpins at +4 or +10 gave11- or 50-fold higher translational efficiency. In addition, weobserved a 9.6-fold difference between the +1 and +7positions in the "30 kcal/mol hairpin set. Hairpins withpredicted stabilities below "25 kcal/mol showed a slightdistance dependence. Only when hairpins were placed at +1did we observe inhibition effects. Translation efficiency was

FIGURE 1. Placement of hairpin inserts in two color fluorescence vector. (A) Map showing placement of RFP and EGFP with respective CMVpromoters. SacI and BamHI restriction sites encompass transcriptional start site for EGFP. The arrow indicates the relative location of thetranscription start site. (B) Sample folding of the "10, "25, and "50 kcal/mol hairpin structures. A total of seven hairpins were utilized including"10, "20, "25, "30, "35, "40, and "50. (C) Example of the "30 kcal/mol hairpin placed at positions +1, +7, and +13. An insert length of 70nucleotides was maintained with CAA repeats. Different hairpins were placed at positions +1, +4, +7, +10, +13, +16, +31, and +46. A completelisting of hairpins inserted into vectors GR1 and GR2 is shown in Supplemental Figure S1. Thermal stability predictions and hairpin structureswere drawn with RNAstructure 3.7 (Mathews et al. 1999).

TABLE 1. DG Verification

Hairpin Predicted DG kcal/mol DH kcal/mol DS cal/Kmol DG kcal/mol

Hairpins "10 to "50, K30 and K50a

HP10 "10.5 "108.0 6 5.1 "275.6 6 14.8 "22.5 6 0.5HP20 "20.5 "127.6 6 5.6 "325.3 6 16.7 "26.9 6 0.8HP25 "25.7 "134.7 6 5.4 "341.9 6 15.2 "28.7 6 0.7HP30 "30.3 "141.9 6 3.8 "357.8 6 10.9 "31.0 6 0.4HP35 "34.5 "156.2 6 10.7 "393.9 6 32.4 "34.1 6 0.6HP40 "39.4 "163.8 6 0.5 "413.8 6 1.5 "35.4 6 1.0HP50 "50.2 "213.2 6 3.0 "543.4 6 8.2 "44.7 6 0.4K30 "25.6 "125.9 6 1.9 "320.5 6 5.4 "26.5 6 0.3K50 "38.6 "193.9 6 5.8 "492.9 6 15.5 "41.0 6 0.9

GC content varientsb

GC52 "31.2 "152.1 6 0.2 "401.5 6 0.4 "27.6 6 0.1GC62 "31.1 "153.7 6 3.7 "402.7 6 10.1 "28.8 6 0.6GC78 "30.5 "131.0 6 32.8 "329.9 6 89.0 "28.7 6 5.2GC92 "31.0 "123.9 6 0.9 "305.9 6 1.3 "29.0 6 0.5

aMeasurements taken in 10 mM sodium phosphate, 10 mM sodium chloride (pH 7.4). Thermodynamic parameters calculated based onabsorbance measurements from 40°C to 108°C.bMeasurements taken in 10 mM sodium phosphate, 2 mM sodium chloride (pH 7.4). Thermodynamic parameters calculated based onabsorbance measurements from 40°C to 108°C. Standard deviations represent the average of two independent experiments.

Translational control by mRNA structure near caps

www.rnajournal.org 853


csh/RNA/111792/RNA23099



consistently inhibited with hairpins above "35 kcal/mol. Inaddition, distance effects were minimized. We did notobserve an enhanced efficiency at +31 and +46. In fact,hairpins placed at extended distances translated less effi-ciently compared with structures at +16. This result differsfrom previous in vitro studies showing that a hairpinplaced at +52 was beneficial for translation efficiency(Kozak 1989).Quantitative RT–PCR cycle number results for GFP and

RFP are displayed above each sample. There were no ap-parent trends in RNA stability providing verification thatdifferences in constructs were due to translational effi-ciency. GFP to RFP transcript ratios remained consistent

between samples, showing that the observed variations intranslation could not be explained by variations in tran-script abundance (Fig. 2A, top margin). This result alsoruled out involvement of RNA silencing, since all but the"50 kcal/mol hairpins were below the 21-bp thresholdneeded to activate RNA silencing (Westhof and Filipowicz2005), and translation was already minimal at "40 kcal/mol.We additionally verified that the observed trends were notdue to the reporter protein itself, its 39-UTR sequence, ornuclear export artifacts with RG1 vectors, by swapping theGFP reporter for an RFP and incorporating an IRES-drivenGFP on the same transcript (Supplemental Fig. S2 andProtocol S5). We conclude that hairpin thermal stabilityand hairpin position dramatically and directly affect trans-lation efficiency.Figure 2B shows the results of increasing hairpin thermal

stability by averaging all hairpin positions for each set.Between the stabilities of "10 and "25 kcal/mol, translationefficiencies remained consistent. As stabilities increasedfrom"25 to"40 kcal/mol, we observed a dramatic inhibitionof translation, a 40-fold drop over a narrow "15 kcal/molrange. Inhibition effects stabilized with a further increase toa thermal stability of "50 kcal/mol. These data suggest anarrow thermodynamic range, where RNA thermal stabilitydramatically affects translation efficiency. Figure 2C depictsthe effect of hairpin position averaged over hairpin stabil-ities up to "35 kcal/mol. Translation efficiency increaseslinearly with hairpin position to +10, then drops slightly atgreater distances.

GC content affects translation efficiency

In addition to thermal stability and distance effects, we foundtranslation efficiency was dependent upon RNA-hairpinGC stem content. We designed these hairpin constructswith different degrees of GC content while maintaininga position at +4 and thermal stability of "30 kcal/mol,empirically verified with absorbance measurements (Table 1).Although the insert length was maintained with CAArepeats, there was a 4-bp difference in hairpins with 52%and 92% GC content. As shown in Figure 3, as GC stemcontent was increased, translation efficiency decreased over18-fold between stems with 52% and 92% GC content.Quantitative RT PCR (Fig. 3, top margin) and RG con-struct controls (Supplemental Figure S2 and Protocol S5)verified that observed trends were not due to the RNAabundance, the reporter protein itself, 39-UTR sequence, ornuclear export artifacts. We conclude that RNA stem GCcontent affects translation efficiency.

FACS analysis of hairpin effects ontranslation efficiency

To examine distance and GC content differences at thesingle cell level with good statistics, we performed FACSanalysis of the "25 kcal/mol hairpin set at positions +1 to

FIGURE 2. Distance and thermal stability affect translation effi-ciency. (A) Each hairpin set is shown with increasing thermalstabilities ("10 to "50 kcal/mol) from left to right. Bars labeled (1–16) refer to hairpins placed at positions +1, +4, +7, +10, +13, and +16from left to right for the "10, "20, and "25 kcal/mol hairpins. Barslabeled (1–46) refer to hairpins placed at positions +1, +4, +7, +10,+13, +16, +31, and +46 from left to right for the "30, "35, "40, and"50 kcal/mol hairpins. All values were normalized to their respectivecontrol CAA value. Error bars represent the standard error of themean for 50 fields. Illustrated at top is quantitative RT–PCR data foreach construct. Values represent the average of two Ct values for GFP(O) and RFP (+). (B) Average thermal stability effect on translationefficiency. Positions +1 to +16 for hairpins with predicted thermalstabilities between "10 and "25 kcal/mol and positions +1 to +46 forhairpins with predicted thermal stabilities between"30 and"50 kcal/molwere averaged. (C) Average distance effect on translation efficiency. Eachposition for hairpins with predicted thermal stabilities between "10 and"35 kcal/mol was averaged. Error bars are the standard error of the meanfor B and C.

Babendure et al.

854 RNA, Vol. 12, No. 5


csh/RNA/111792/RNA23099



+16 (Fig. 4A). Data curves for hairpins at +10 and +16were not included for simplicity; however, they showsimilar curves at +7 and +13 positions, respectively. In addi-tion, we evaluated population studies for hairpin constructswith GC contents between 52% and 92% (Fig. 4B). In bothcases, FACS analysis confirmed microscopy data, since themean translation efficiency increased as cap-to-hairpindistance was extended and GC stem content percentagewas reduced. The populations remained unimodal in eachcase, verifying that differences were due to changes in theentire population as opposed to different quantities offinite values in a multimodal population.

Trends were similar with various cell types

To verify these trends were not cell-type specific, wecompared translational efficiencies in primary mouse embry-onic fibroblasts (MEFs) and Chinese hamster ovary cells(CHO). In both cases, we observed similar trends as Cos 7cells with respect to thermal stability, hairpin position, andGC content (Supplemental Figs. S3 and S4).We did, however, observe differences with each cell type

analyzed. CHO cells (Supplemental Fig. S3) had a lowerrange of average ratios with respect to control constructs,values up to 2.5. Average thermal stability trends weresimilar to Cos7 cells, however, the "10 kcal/mol appearedto translate noticeably more relative to the "20 kcal/molhairpin than with Cos7 cells. Average distance trends weresimilar to Cos7 cells to a +10 position. Ratio averages slightlydipped at +13, then increased again at +16. GC stemefficiencies differed only with the 62% and 78% stemcontent translating at similar levels.MEF cells (Supplemental Fig. S4) had slightly different

trends than Cos7 and CHO cell lines. RNA structureappeared to have minimal effects on thermal stability, sinceaverage levels between the "10 and "50 kcal/mol set onlydiffered eightfold. The "10 kcal/mol hairpin set translated

noticeably less than the "20 kcal/mol set. Furthermore, weobserved distance effects up to the "50 kcal/mol hairpin(opposed to "35 kcal/mol with Cos7 and CHO cells lines).In addition, translation appeared to reach a peak at +13,with a local minimum at +10. Despite these small differ-ences, the general effects of RNA hairpin thermal stability,cap-to-hairpin distance, and GC content on translationappear to be similar across three mammalian cell lines.

Translation efficiency with natural 59 UTRs

We next wanted to determine how the translation effi-ciencies of our designed hairpins compared with natural59 UTRs. Full-length 59 UTRs were cloned by addinga restriction site as the second and third codons of GFP(vector GR3). We initially tested a- and b-globin 59 UTRspreviously evaluated in vitro; both predicted to havea hairpin in their 59 UTR (Kozak 1994). For furthercomparison, we tested an optimized globin 59 UTR nameda ext (Kozak 1994). We found the a-globin 59 UTR had thegreatest translation efficiency followed by the b globin, thena ext, in ratios of 2.4:1.4:1, respectively (Fig. 5). This was asurprisingly opposite trend to that reported in vitro (Kozak1994). Quantitative RT–PCR controls confirmed that trends

FIGURE 4. FACS analysis compares translation efficiencies ina population. (A) Cap-to-hairpin distance affects translation efficiencyin a population. Data curves for positions +10 and +16 were notincluded, however, show similar curves as +7 and +13, respectively.(B) Stem GC content affects translation efficiency in a population.

FIGURE 3. GC stem content affects translation efficiency in Cos7cells. The percent stem GC content increases from left to right. Errorbars represent the standard error of the mean for 50 fields. All valueswere normalized to their respective control CAA value. Illustrated attop is quantitative PCR data for each construct. Values represent theaverage of two Ct values for GFP (O) and RFP (+).




csh/RNA/111792/RNA23099



were not due to mRNA stability. Instead, we found thea-globin mRNA was slightly less abundant in cells than theb-globin and a-ext mRNAs, so the translation efficiency ofthe a-globin 59 UTR must be yet higher than the raw ratiosalone. Efficiency values for the globin 59 UTRs were muchgreater than the designed hairpin set. This is most likelydue to weaker hairpins with predicted thermal stabilities of"8.4, "8.3, and "2 kcal/mol shifted 5, 7, and 34 bases fromthe cap for a globin, b globin, and a ext, respectively.Our present results differ from Kozak (1994) in trans-

lated protein (GFP and RFP vs. preCAT), assay method(ratiometric fluorescence measurements vs. 35S incorpora-tion), and environment (in vitro translation vs. intactmammalian cells). To decide which factors mattered, wefirst measured translation in an in vitro system similar toKozak’s. We designed construct AgeI_Qc3c with an AgeIsite just upstream of the first ATG of GFP. We then cloneda T7–59 UTR with BamHI and AgeI sites (Suplemental Fig.S1). By 35S incorporation, we found ratios for the a , b, anda ext globins of 1:1.5:2 (Fig. 5B), almost identical to thosereported previously (Kozak 1994). We also measured thefluorescence intensities of in vitro-translated fluorescentproteins (Fig. 5C). We found the same trends as with 35S,but less difference between a , b , and a ext globin 59 UTRswith ratios of 1:1.4:1.6, respectively. Presumably, a fluores-cence signal reflects properly translated and folded GFP,while the 35S experiment measures the incorporation of radio-active methionine into the protein regardless of secondarystructure. Nevertheless, all methods agree on the rankorder, a < b < a in vitro, in contrast to a > b > a extin live cells.We additionally tested other natural 59 UTRs similar in

length, structure, and thermal stability to our hairpin sets.Figure 6 shows translation efficiencies of two naturalmRNA transcripts adjacent to the "10 and "20 kcal/mol

hairpin sets. The transcript coding for human fibroblastgrowth factor 5 (FGF-5) was predicted to form a stem–loopstructure with a predicted stability of "9.1 kcal/mol anda +2 position. As predicted from the hairpin sets, FGF-59stranslation efficiency was between that of the "10 kcal/molhairpin from positions +1 to +4. The transcript coding forhuman B-cell lymphoma 3 (BCL-3) was predicted to forma hairpin structure with an internal bulge, a predictedstability of "18.9 kcal/mol at position +3. As with FGF-5,BCL-39s translation efficiency correlated with the designedhairpins sets with an efficiency level between that of the"20 kcal/mol hairpin from positions +1 to +4. We con-clude that our designed hairpin sets should help predicttranslation efficiencies of natural 59 UTRs with reasonablysimilar hairpin structures.

DISCUSSION

The goal of this study was to investigate the effects ofhairpin distance, thermal stability, and GC content onmRNA translation efficiency in live cells and determine thecorrelation to natural hairpin structures. To our knowl-edge, this is the first study that systematically examinesa wide range of both hairpin thermal stabilities and hairpinpositions. In addition, this is the first report to show thatGC content affects protein-translation efficiency indepen-dent of hairpin thermal stability and hairpin position.In regard to hairpin thermal stability, we find that in live

cells, increasing predicted mRNA thermal stability leads toa decrease in translation, which agrees with previous studies(Kozak 1986). We find the steepest falloff in translationefficiency occurs when hairpin-predicted stabilities increasefrom DG = "25 to "35 kcal/mol. This range differs slightlyfrom previously reported values in live cells, which sawthat a "30 kcal/mol hairpin translated efficiently, while

FIGURE 5. Translation through natural 59 UTRs differs in live cellsvs. in vitro lysates. (A) Translation in live cells through a, b, or a extglobin 59 UTRs was measured by fluorescence microscopy. Error barsrepresent the standard error of the mean for 40 fields. All values werenormalized to their respective control CAA value. Illustrated at top isquantitative PCR data for each live cell construct. Values represent theaverage of two Ct values for GFP (O) and RFP (+). In vitro translationefficiency through a, b, or a ext globin was detected by either (B)radioactive 35S exposed to a PhosphorImaging screen, or (C)fluorescence intensity. Error bars represent the standard deviation ofthree independent experiments. Values were normalized to a globin.

FIGURE 6. Translation efficiency with natural 59 UTRs. Translationefficiencies of fibroblast growth factor 5 (FGF-5) and B cell lymphoma3 (BCL-3) are compared with translation efficiencies from the "10and "20 kcal/mol hairpin sets (Fig. 2). Bars labeled (1–16) refer tohairpins placed at positions +1, +4, +7, +10, +13, and +16 from leftto right for the "10 and "20 kcal/mol hairpins. Error bars representthe standard error of the mean for 20 fields. Shown to the right arepredicted structures drawn with RNAstructure 3.7 (Mathews et al.1999) for FGF-5 and BCL-3.

Babendure et al.

856 RNA, Vol. 12, No. 5


csh/RNA/111792/RNA23099



a "50 kcal/mol hairpin inhibited translation (Kozak 1986).These predicted thermal stabilities, however, were basedupon an algorithm published in the early 1970s (Tinocoet al. 1973). Current algorithms calculate that these "30 and"50 kcal/mol hairpins actually have thermal stabilities of"25.6 and "38.6 kcal/mol, respectively, showing Kozak’svalues to be consistent with our results (Mathews et al.1999). Our experimentally determined Tms verify thesepredicted values as well (Table 1).Our study also examines the significance of hairpin

position on mRNA translation in live cells. Similar to invitro studies, we confirm in live cells that mRNA structureis inhibitory when proximal to the 59-mRNA cap (Kozak1989). Previous in vitro studies found a +12 positioninhibitory, while extending distances to +52 released thisinhibition (Kozak 1989). In agreement with these findings,we find in live cells that RNA structures with positions +4or less are inhibitory, perhaps perturbing mRNA recogni-tion and binding of preinitiation complex initiation factors.In contrast to Kozak’s studies, we find positions +7 to +13bases actually enhance translation, provided that hairpinstabilities lie within the "25 to "40 kcal/mol range. Thisdistance may promote favorable initiation complex forma-tion to assist in ribosome binding and melting of mRNAstructure. In further contrast to previous studies, we findthat hairpins at +31 and +46 did not relieve hairpininhibition, with exception of the weaker "30 kcal/molhairpin at +31. In summary, we find that in live cells,mRNA cap-to-hairpin distances have the greatest controlover translation when situated within the first 16 bases ofthe mRNA transcript.An interesting finding was when translation efficiencies

reached a basal minimum as hairpins approached predictedthermal stabilities of "50 kcal/mol, even when hairpinswere situated at +1. We were surprised to find that anytranslation occurred under such inhibitory conditions. Wepostulate that under extremely inhibitory conditions, ribo-somal shunting over or skipping over hairpin barriers mayoccur.Although it is well known that GC content can affect

translation initiation (Kozak 1991a), the discovery that stemGC content had a dramatic effect on mammalian translationefficiency independent of predicted thermal stability andhairpin position was quite unexpected. We observed an18-fold difference between stemswith 52%and 92% stemGCcontent.We later discovered a similar effect occurred in yeastwith hairpins placed in the vicinity of the translation startcodon (Vega Laso et al. 1993). It appears local stability perbase has an effect on translation efficiency, since compact,thermal stable hairpins composed of GC bonds are harder tomelt than hairpins composed of weaker AU bonds. With thisinformation in mind, predicting the efficiency of translationbecomes more complex. Perhaps hairpins with predictedthermal stabilities stronger than "50 kcal/mol may still beefficiently translated as long as stem GC content is relatively

low. Consequently, less stable structures with high stem GCcontent may inhibit translation more than stable structureswith low GC content. The simplest explanation is that thescanning ribosome does not melt the entire hairpin ina concerted event, but rather tries to bulldoze through theobstacle in a progressive, relatively local unzippering. HighGCcontent confers high stability per base pair, perhaps exceedingthe force (free energy per unit distance) available to thetranslation machinery.Many natural mRNAs coding for regulatory proteins use

59-UTR composition as a mechanism for gene regulation.As a result, many of these transcripts have structured59 UTRs with high GC content (between 70% and 90%)(Kozak 1991a). These transcripts code for transcriptionfactors and DNA-binding proteins such as human NF-kB,mouse jun-D, and human GATA-1; ligand receptors suchas human n-acetylcholine, human b2 adrenergic, andhuman insulin; and transcripts involved in signal trans-duction and growth control such as human bcl-3, humanTGF-b1, and human PDGF (Kozak 1991a). Hershey andMiyamoto hypothesized that a cell can regulate gene ex-pression by having different initiation potentials, or theability to overcome structural barriers (Sonenberg 2000).When the initiation potential is low, highly structuredmRNAs are poorly translated; however, when the potentialis high, these mRNAs are allowed to translate efficiently(Sonenberg 2000). They believe the availability of initiationfactor eIF4E can determine whether the initiation potentialis high or low and is regulated by mechanisms includingeIF2 phosphorylation and inhibitory actions of 4E-BP oneIF4E (Sonenberg 2000). As a result, cancer cells shift theinitiation potential by overexpressing initiation factors suchas eIF4E, allowing efficient translation through oncogenictranscripts including a cyclin D-1, c-Myc, FGF-2, andVEGF (de Benedetti and Harris 1999; Sonenberg 2000).Finally, we compared translation efficiencies in live cells

and in vitro lysates with a, b, and a ext globin 59 UTRs(Kozak 1994). Interestingly, we found the opposite trendsin translation efficiencies in live cells to those found invitro. The a-globin mRNA translated the best in live cellsand the worst in the in vitro lysates. We postulate these dif-ferences may be due to protein factors found in live cells notpresent in the lysates, or because coupled transcription—translation in live cells may follow different rules fromtranslation divorced from transcription in vitro.A comparable amount of in vitro and in vivo studies in

yeast have also been dedicated to studying the effects ofRNA structure, position, and thermal stability on mRNAtranslation (Vega Laso et al. 1993; Koloteva et al. 1997;McCarthy 1998). Consistent with these studies, we findRNA structures with stable secondary structures generallyinhibit RNA translation with little regard for 59-UTRposition. Furthermore, we also find that less stable RNAstructures can inhibit RNA translation when placed ina favorable position. However, in yeast, this position effect




csh/RNA/111792/RNA23099



is dependent upon the RNA structure’s proximity to thetranslation start site, not the 59 G cap. Potentially highereukaryotes are more sensitive to the initial interactionbetween the mRNA cap and the ribosome, whereas lowereukaryotes are more sensitive to ribosomal scanning (VegaLaso et al. 1993).A study by Mattick estimates that 98% of the human

genome is made up of nonprotein-coding RNA sequence.He hypothesizes that higher eukaryotes use this excess ofnoncoding RNA to regulate cellular processes (Mattick2003, 2004). Our findings may lend support to Mattick’stheory showing the effects of RNA structure on proteintranslation. In 1994, Kozak postulated that structure in 59UTR of mRNAs could act as regulatory sequences toenhance translation by allowing proteins to bind and shiftstructure downstream (Kozak 1994). Functioning in a sim-ilar capacity, noncoding RNAs could also bind thesestructures and release thermodynamic constraints, allowingfor translation enhancement. This underscores the signif-icant effect that a noncoding sequence of mRNA couldhave on gene expression.In addition to controlling natural processes in the cell,

these mechanisms we have used to modulate mRNAtranslation will also be useful in the design of artificialsystems for controlling transgene expression in eukaryoticcells. In bacteria, a method has recently been described tocontrol gene expression using small noncoding RNAs tomodulate secondary structure at the Shine-Dalgarno site(Isaacs et al. 2004; Davidson and Ellington 2005). Bayerand Smolke (2005) recently modulated trans-binding RNAsto control reporter protein expression in yeast.Our results suggest that a similar strategy of controlling

gene expression through modulation of RNA secondarystructure in cis may also be possible in mammalian cells.Figure 7 depicts a potential design in which a hairpin with

moderate thermal stability (between "25 and "35 kcal/mol)is placed near the cap in the 59 UTR of a reporter transcript.Upon strand hybridization, cap proximal structures wouldbe shifted downstream, releasing cap proximal bases,allowing translation initiation to occur. Our studies in-dicate that as much as a 50-fold difference exists between"25 kcal/mol hairpin structures placed 1 base and 10 basesfrom the cap. In theory, these differences could beharnessed with this system. Such a strategy could be useful,for example, in rendering expression of a reporter gene ortherapeutic transgene, dependent on the presence of spe-cific endogenous mRNAs or possibly organic compounds.

MATERIALS AND METHODS

Materials

Enzymes T4 PNK, T4 DNA ligase, and T7 RNA polymerase werepurchased from New England Biolabs; Pfu Turbo and Lipofect-amine 2000 were from Invitrogen; Taq DNA Polymerase was fromPromega; Fugene 6 was from Roche; DNA Oligos were from AlleleBiotechnology and Integrated DNA Technology; DNA and RNAisolation kits were from QIAGEN; 59RACE reagents, RNA Sure-script, and Rabbit Reticulate Lysates were from Ambion.

Vector construction

Vector Qc3c was created from an EGFP-containing PCDNA3vector to contain unique restriction sites on both sides of theputative transcriptional start site. A Quickchange with primers Aand B removed the SacI site downstream from the SP6 promoter,while a Quickchange with primers C and D removed SacI andBamHI sites in the cloning region. An original SacI site remained10 bases upstream of the putative transcriptional start site. ABamHI site was next introduced nine bases downstream of theputative transcriptional start site by PCR with primers E and F.

A: 59-CACCTAAATGCTAGACCTCGCTGATCAGCCTB: 59-AGGCTGATCAGCGAGGTCTAGCATTTAGGTGC: 59-GCTTGGTACCGAGCTGCGATCCGAATTCGCCACCD: 59-GGTGGCGAATTCGGATCGCAGCTCGGTACCAAGCE: 59-TGGGTTCTCTAGTTAGCF: 59-GGATCCACTGGCTTATCGAAATT

Vector GR1 was created by cloning a dimeric redfluorescent protein (RFP) derivative (Campbell et al. 2002) ormCherry (Shaner et al. 2004) into Qc3c, thus creating a plasmidexpressing both green and red proteins, each driven by separateCMV promoters. To maintain original SacI and BamHI sites, anintermediate vector Qc4c was cloned removing SacI and BamHIsites from Qc3c with cassette insertion of annealed oligos G andH. RFP or mCherry was amplified with primers I and J and clonedinto vector Qc4c using EcoRI and XbaI sites. Finally, the entiregene encompassing CMV, coding sequence, and BGH poly(A) tailwas amplified with primers K and L and inserted into vector Qc3cwith MfeI sites.

G: 59-GTCTGGTAACTAGAGAACCCACH: 59-GATCGTGGGTTCTCTAGTTAGCCAGACAGCT

FIGURE 7. General strategy for mRNA modulation. In the lowreporter expression state, an RNA structural blockade inhibits theribosomal pre-initiation complex (PIC) from binding. As a result, theribosome never reaches the translation start site for the reporterprotein. Upon binding RNA (presumably endogenous mRNA), thestructural blockade is altered, potentially by shifting hybridized RNAstructures downframe. This shift leads to PIC binding, allowing theribosome to reach the translation start-site translating reporter protein.

Babendure et al.

858 RNA, Vol. 12, No. 5


csh/RNA/111792/RNA23099



I: 59-CGGAATTCGCCACCATGGTGAGCAAGGGCGAJ: 59-GGCTCTAGATTACTTGTACAGCTCGTCK: 59-GTCGTAGAACACGTAGTGCGCGAGCAAAATL: 59-GGCACTCAATTGGCCGAAATCCCCAAAAT

Vector GR2 was created by inserting annealed oligos M and Ninto vector GR1, shifting original SacI and BamHI restriction sites30 bases downstream.

M: 59-GTCTGGCTAACTAGGCGCAACAACAACAACAACAACAACAAGAGCTCCAACAACCCTGCGGTCCACCCTACGGCCTGG

N: 59-GATCCCAGGCCGTAGGGTGGACCGCAGGGTTGTTGGAGCTCTTGTTGTTGTTGTTGTTGTTGTTGCGCCTAGTTAGCCAGACAGCT

Vector GR3 was created by PCR amplification of an originalAgeI restriction site after the first ATG of the GFP-coding framewith primers O and P. This fragment was then inserted into vectorQc3c with BamHI and XbaI restriction sites. RFP was added inusing MfeI restriction sites as described above.

O: 59-GATCCGAATTCGCCACCATGACCGTTGTGAGCAAGGGCGAGGAGC

P: 59-CATTTAGGTGACACTA

Determining the transcription start site

Construct HP1 was created by ligating annealed oligos Q and Rinto the GR1 vector. A total of 4 mg of HP1 plasmid wastransfected with Fugene 6 into a 70% confluent 10-cm dish ofCos7 cells for 24 h. RNA was then isolated using RNAeasy kit, anda rapid amplification of cDNA ends (RACE) procedure adaptedfrom Ambion identified 59-RNA ends. Isolated RNA was initiallytreated with Calf Intestinal Phosphatase (CIP) and Tobacco AcidPyrophosphatase (TAP) to remove 59 phosphates from degradednucleic acids and 59 G caps from full-length RNAs, respectively.The 59-RACE adaptor S was next ligated to full-length mRNAtranscripts with T4 RNA ligase. M-MLV Reverse Transcriptasenext produced cDNAs. Nested PCR with outer primers T and Uand inner primers V and W amplified cDNA products with addedPstI and XbaI restriction sites. Finally, amplified products werecloned into a puc18 vector and sequenced.

Q: 59-CTCTGGCTAACTAGGCCGGTTCGGTGGCCGAGCTTCGGCCACCTATCGGCCAG

R: 59-GATCCTGGCCGATAGGTGGCCGAAGCTCGGCCACCGAACCGGCCTAGTTAGCCAGAGAGCT

S: 59-GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA

T: 59-CCGGAATTCGATGTTGCCGTCCTCCTTGAU: 59-GCTGATGGCGATGAATGAACACTGV: 59-GAACTGCAGGAACACTGCGTTTGCTGGCTTTGATGW: 59-CGCTCTAGAGTTGCCGTCGTCCTTGAAGAAGAT

Hairpin library construction

Each set of oligos was gel purified, phosphorylated with T4 PNK,and annealed before ligating into CIPed GR1, GR2, or GR3 vectordigested with SacI and BamHI or GR3 digested with SacI and

AgeI. Oligos ligated into vectors had the general sequence of oligosIA and IB for GR1, IC and ID for GR2, and IE and IF for GR3. Acomplete listing of inserts is shown in Supplemental Figure S1.

IA: 59-CTCTGGCTAACTAGGC—insert 55/70 bases—GIB: 39-TCGAGAGACCGATTGATCCG—insert 55/70 bases—CCTAG

IC: 59 C—insert 63 bases—GID: 39-TCGAG—insert 63 bases—CCTAGIE: 59-CTCTGGCTAACTAGGC—59-UTR insert—ATGAIF: 39-TCGAGAGACCGATTGATCCG—59-UTR insert—TACTGGCC

Tm measurements

RNA was transcribed with T7 RNA polymerase and double-stranded DNA oligos containing a T7 promoter site 59 of thehairpin sequence. RNA products were PAGE purified and addedto a concentration of 0.105 mg/mL in 10 mM Sodium Phosphatebuffer (pH 7.4) with either 2 or 10 mM NaCl. Absorbance at 260was measured on a Beckman DU640 Spectrophotometer from25°C to 108°C. Thermodynamic parameters DH, DS, and DHwere calculated using Meltwin 3.5.

Cell culture

Cos 7 cells were maintained in DMEM containing 4.5 g/L glucosesupplemented with 10% FBS and 1% penicillin/streptomycin. Oneday prior to transfection, cells were seeded into 12-well plates orimaging dishes. The next day, cells were transfected with 750 ng ofDNA and 4 mL of lipofectamine 2000 reagent. Twenty-four hourslater, cells were analyzed by fluorescence microscopy or FACSanalysis.

Fluorescence microscopy

Cells in imaging dishes were washed once with HBSS and left in2 mLs of the same medium. Images were acquired using a ZeissAxiovert with a 40X NA 1.3 objective. GFP was analyzed using505 nm dichroic, 480/30 nm excitation, and 525/25 nm emissionfilters. RFP was analyzed using 560 nm dichroic, 540/55 nmexcitation, 595/50 nm emission filters. Data was analyzed withMetafluor Software. Average green to red ratios were computedafter subtracting a background region from the green and redimages. Ratios for at least 20 fields were averaged and normalizedto the ‘‘structureless’’ constructs HPO, HPO2, or HPO_GR2.

FACS analysis

Cells on each 12-well dish were washed once with DPBS andreleased with 100 mL of trypsin solution. Cells were further dilutedwith 400 mL of HBSS. FACS analysis was performed on a BDFACSVantage DiVA. GFP was excited with a 488-nm laser andemission collected using a 510/21-nm emission filter. MCherrywas excited at 565 nm and analyzed with a 615/40-nm emissionfilter. A total of 10,000 events were collected for each construct.Events greater than two standard deviations from the average GFPand mCherry emission of background Cos7 cells were furtheranalyzed. The GFP to mCherry ratio was computed after back-ground subtraction. Each data point represents the number ofevents that occurred within ratio bins of 0.04. An optimized




csh/RNA/111792/RNA23099



mCherry aided in FACS analysis with its enhanced quantum yieldand red-shifted emission (Shaner et al. 2004). Its fluorescenceintensity remained consistent in all populations.

Quantitative RT—PCR analysis

RNA from each 12-well dish was isolated using QIAGEN’sRNAeasy kit. CDNA was synthesized using Ambion’s M-MLVReverse Transcriptase with random decamer primers. Primers GFand GR and Taqman primer GT detected GFP transcripts, whileprimers RF and RR and Taqman RT detected RFP transcripts.Real time PCR analysis was performed on an Applied BiosystemsABI Prism 7700 Sequence Detection System equipped withsoftware version 1.6.3.

GF: 59-AGCAAAGACCCCAACGAGAAGR: 59-TTACTTGTACAGCTCGTCCATGCCGGT: 59-CGCGATCACATGGTCCTGCTGGRF: 59-CCACCAGGCCCTGAAGCTRR: 59-GGCTTCTTGGCCATGTAGATGRT: 59-AAGGACGGCGGCCACTACCTGGT

In vitro transcription/translation

Double-stranded DNA oligos were ligated into AgeI-modifiedQc3c vector with the general sequence of oligos IJ and IK. A totalof 1 mg of vector linearized with BamHI and XbaI restriction siteswas added to a Surescript Transcription kit reaction to yield 59 G-capped mRNA transcripts. A total of 360 mg of PAGE-purifiedRNA was then added to each 25 mL of Rabbit Reticulate lysatereaction with or without 35S, and allowed to translate for 2 h at30°C. Protein quantities were determined by fluorescence spectros-copy or incorporation of 35S. Fluorescence measurements weretaken on a Spex Fluorolog, diluting the translation mix 1:60, andexciting GFP at 470 and reading emission from 480 to 560. Back-ground fluorescence was subtracted from each sample. Sampleswith incorporated 35S were run on SDS-PAGE and exposed toa PhosphorImaging screen for 3 d. Counts were measured on aSTORM 860.

IJ: 59-GATCCAATACGACTCACTATAG—59-UTR insert—ATGAIK: 59-GTTATGCTGAGTGATATC—59-UTR insert—TACTGGCC

ACKNOWLEDGMENTS

We thank Drs. Stephen Adams, Ben Giepmans, SimpsonJoseph, Michael Lin, Amy Pasquinelli, Yitzhak Tor, Jiwu Wang,Nicholas Webster, Mike Whitney, and Charles Zuker for theirhelpful thoughts and suggestions with the manuscript; PaulSteinbach for help with fluorescence imaging; Coyt Jackson, BrentMartin, and Qing Xiong for help with the FACS analysis; and NickGreco for help with Tm measurements. This work was supportedby HHMI, NIH GM72033, NIH 27177, and DOE DE-FG03-01ER63276 NS27177, and the UCSD Pharmacology Training Grant.

SUPPLEMENTAL MATERIAL

Supplemental material can be found at http://www.tsienlab.ucsd.edu.

Received December 2, 2005; accepted January 27, 2006.

REFERENCES

Bayer, T.S. and Smolke, C.D. 2005. Programmable ligand-controlledriboregulators of eukaryotic gene expression. Nat. Biotechnol. 23:337–343.

Brantl, S. 2002. Antisense-RNA regulation and RNA interference.Biochim. Biophys. Acta 1575: 15–25.

Campbell, R.E., Tour, O., Palmer, A.E., Steinbach, P.A., Baird, G.S.,Zacharias, D.A., and Tsien, R.Y. 2002. A monomeric red fluores-cent protein. Proc. Natl. Acad. Sci. 99: 7877–7882.

Davidson, E.A. and Ellington, A.D. 2005. Engineering regulatoryRNAs. Trends Biotechnol. 23: 109–112.

de Benedetti, A. and Harris, A.L. 1999. eIF4E expression in tumors: Itspossible role in progression of malignancies. Int. J. Biochem. CellBiol. 31: 59–72.

Eisenstein, R.S. 2000. Iron regulatory proteins and the molecularcontrol of mammalian iron metabolism. Annu. Rev. Nutr. 20: 627–662.

Gebauer, F. and Hentze, M.W. 2004. Molecular mechanisms oftranslational control. Nat. Rev. Mol. Cell Biol. 5: 827–835.

Gesteland, R.F., Cech, T.R., and Atkins, J.F. 1999. The RNA world:The nature of modern RNA suggests a prebiotic RNA. Cold SpringHarbor Laboratory Press, New York.

Gingras, A.C., Raught, B., and Sonenberg, N. 1999. eIF4 initiationfactors: Effectors of mRNA recruitment to ribosomes and regu-lators of translation. Annu. Rev. Biochem. 68: 913–963.

Goossen, B. and Hentze, M.W. 1992. Position is the critical deter-minant for function of iron-responsive elements as translationalregulators. Mol. Cell. Biol. 12: 1959–1966.

Hanson, S., Berthelot, K., Fink, B., McCarthy, J.E., and Suess, B. 2003.Tetracycline-aptamer-mediated translational regulation in yeast.Mol. Microbiol. 49: 1627–1637.

Hentze, M.W., Caughman, S.W., Rouault, T.A., Barriocanal, J.G.,Dancis, A., Harford, J.B., and Klausner, R.D. 1987. Identificationof the iron-responsive element for the translational regulation ofhuman ferritin mRNA. Science 238: 1570–1573.

Isaacs, F.J., Dwyer, D.J., Ding, C., Pervouchine, D.D., Cantor, C.R.,and Collins, J.J. 2004. Engineered riboregulators enable post-transcriptional control of gene expression. Nat. Biotechnol. 22:841–847.

Jiang, H. and Lucy, M.C. 2001. Variants of the 59-untranslated regionof the bovine growth hormone receptor mRNA: Isolation, expres-sion and effects on translational efficiency. Gene 265: 45–53.

Koloteva, N., Muller, P.P., and McCarthy, J.E. 1997. The positiondependence of translational regulation via RNA-RNA and RNA-protein interactions in the 59-untranslated region of eukaryoticmRNA is a function of the thermodynamic competence of 40 Sribosomes in translational initiation. J. Biol. Chem. 272: 16531–16539.

Kozak, M. 1986. Influences of mRNA secondary structure on initia-tion by eukaryotic ribosomes. Proc. Natl. Acad. Sci. 83: 2850–2854.

———. 1989. Circumstances and mechanisms of inhibition oftranslation by secondary structure in eucaryotic mRNAs. Mol.Cell. Biol. 9: 5134–5142.

———. 1991a. An analysis of vertebrate mRNA sequences: Intima-tions of translational control. J. Cell Biol. 115: 887–903.

———. 1991b. Structural features in eukaryotic mRNAs that mod-ulate the initiation of translation. J. Biol. Chem. 266: 19867–19870.

———. 1992. Regulation of translation in eukaryotic systems. Annu.Rev. Cell Biol. 8: 197–225.

———. 1994. Features in the 59 non-coding sequences of rabbit a andb-globin mRNAs that affect translational efficiency. J. Mol. Biol.235: 95–110.

Mathews, D.H., Sabina, J., Zuker, M., and Turner, D.H. 1999.Expanded sequence dependence of thermodynamic parametersimproves prediction of RNA secondary structure. J. Mol. Biol. 288:911–940.

Mattick, J.S. 2003. Challenging the dogma: The hidden layer of non-protein-coding RNAs in complex organisms. Bioessays 25: 930–939.

———. 2004. RNA regulation: A new genetics? Nat. Rev. Genet. 5:316–323.

Babendure et al.

860 RNA, Vol. 12, No. 5


csh/RNA/111792/RNA23099



McCarthy, J.E. 1998. Posttranscriptional control of gene expression inyeast. Microbiol. Mol. Biol. Rev. 62: 1492–1553.

Nudler, E. and Mironov, A.S. 2004. The riboswitch control of bacterialmetabolism. Trends Biochem. Sci. 29: 11–17.

Pestova, T.V., Kolupaeva, V.G., Lomakin, I.B., Pilipenko, E.V.,Shatsky, I.N., Agol, V.I., and Hellen, C.U. 2001. Molecularmechanisms of translation initiation in eukaryotes. Proc. Natl.Acad. Sci. 98: 7029–7036.

Rouault, T.A., Hentze, M.W., Caughman, S.W., Harford, J.B., andKlausner, R.D. 1988. Binding of a cytosolic protein to the iron-responsive element of human ferritin messenger RNA. Science 241:1207–1210.

Shaner, N.C., Campbell, R.E., Steinbach, P.A., Giepmans, B.N.,Palmer, A.E., and Tsien, R.Y. 2004. Improved monomeric red,orange and yellow fluorescent proteins derived from Discosomasp. red fluorescent protein. Nat. Biotechnol. 22: 1567–1572.

Sonenberg, N. and Dever, T.E. 2003. Eukaryotic translationinitiation factors and regulators. Curr. Opin. Struct. Biol. 13:56–63.

Sonenberg, N., Hershey, J.W.B., and Mathews, M.B. 2000. Trans-lational control of gene expression,Cold Spring Harbor LaboratoryPress, Cold Spring Harbor, New York.

Takyar, S., Hickerson, R.P., and Noller, H.F. 2005. mRNA helicaseactivity of the ribosome. Cell 120: 49–58.

Tinoco Jr., I., Borer, P.N., Dengler, B., Levin, M.D., Uhlenbeck, O.C.,Crothers, D.M., and Bralla, J. 1973. Improved estimation ofsecondary structure in ribonucleic acids. Nat. New Biol. 246:40–41.

Vega Laso, M.R., Zhu, D., Sagliocco, F., Brown, A.J., Tuite, M.F., andMcCarthy, J.E. 1993. Inhibition of translational initiation in theyeast Saccharomyces cerevisiae as a function of the stability andposition of hairpin structures in the mRNA leader. J. Biol. Chem.268: 6453–6462.

Werstuck, G. and Green, M.R. 1998. Controlling gene expression inliving cells through small molecule-RNA interactions. Science 282:296–298.

Westhof, E. and Filipowicz, W. 2005. From RNAi to epigenomes:How RNA rules the world. Chembiochem 6: 441–443.




csh/RNA/111792/RNA23099



control of mammalian translation by mrna … 2006 rna...control of mammalian translation by mrna...

Documents