cloning gfp into mammalian cells - science and...

Cloning GFP Into Mammalian Cells

Studiepraktik 2016

Molecular Biology and Molecular Medicine

Aarhus University

Studiepraktik 2016, Aarhus University

1

PREFACE

This manual is developed to ”Studiepraktikken for Molekylærbiologi og Molekylær Medicin” at

Aarhus University. The manual contains four sections: background, laboratory protocol,

theoretical exercise and appendix.

The scientific level of this manual is to students at their 3rd year of high school with theory and

practical laboratory exercises inspired from university courses. The manual is written in

English to illustrate the literature at the university.

During your three days we will guide you through the material to give you a better and deeper

understanding of the theory behind the practical exercise.

A special thanks to the authors for contributing to this protocol: Maiken Østervemb Aagaard,

Rikke Mouridsen, Tobias Holm Bønnelykke, Steffan Noe Christensen, Emil Gregersen, Michael

Solgaard Jensen, Michael Nguyen and Charlotte Harmsen.

Kind regards

The Instructor Team of 2016

Lotte Stagsted, PhD student. Mol. Bio.

Louise Dalskov, Stud. Cand. Scient. Mol. Bio.

Diani Poulsen, Stud. BSc. Mol. Med.

Ida Møller, Stud. BSc. Mol. Med.

Matias Høgh, Stud. BSc. Mol. Med.

Line Hansen, Stud. BSc. Mol. Bio.


2

TABLE OF CONTENT

PREFACE ...........................................................................................................................................................................1

LABORATORY SAFETY INSTRUCTIONS ...............................................................................................................3

THEORY AND BACKGROUND ...................................................................................................................................4

INTRODUCTION ........................................................................................................................................................5

LABORATORY PROTOCOL .........................................................................................................................................8

Day 1 ..............................................................................................................................................................................9

Day 2 ........................................................................................................................................................................... 13

Day 3 ........................................................................................................................................................................... 16

THEORETICAL EXERCISE ....................................................................................................................................... 20

GENERAL QUESTIONS – THE CENTRAL DOGMA .......................................................................................... 25

APPENDIX ..................................................................................................................................................................... 28


3

LABORATORY SAFETY INSTRUCTIONS

GOOD LABORATORY BEHAVIOR

Bags and extra clothes are not allowed in the laboratory

Papers, pencils etc. are only allowed in the defined areas on the

table.

Do not touch your face, especially your eyes, nose and mouth with

your gloves

Eating, smoking etc. are prohibited in the laboratory

Only wear lab coats with a classification mark. The lab coat should always be worn and

buttoned up at all times in the laboratory and hallways. Not on the toilet!

Wash your hands often during the day and always before you leave the laboratory

Use gloves at all times. If anything is spilt on your gloves – change them

Remember to wash your tables with ethanol before and after using it

Walk in the laboratory. No running is allowed!

Behave yourselves responsibly. No shooting pipet tips, water and other things

SEPARATION OF WASTE

No chemicals or solutions can be poured back to the stock solution. Additional material

is waste

Hazard waste (H-waste) like pipet tips, one time pipets etc. is for the transparent

buckets

Biological waste (anything been in contact with live materials, like cells) is for the

yellow buckets.

POINTERS FOR MICROBIOLOGICAL WORK

Write name and group number on agar plates, eppendorf tubes etc.

Take one eppendorf tube at a time and never touch the opening. Flick the material

before using it.

Always use the lid in the centrifuge.


4

SECTION 1

THEORY AND BACKGROUND


5

INTRODUCTION

During your three days at Aarhus University you are going to conduct an experiment in order

to make human cells emit green fluorescent light. To do this we use the gene of Green

Fluorescent Protein (GFP) isolated from jellyfish. A schematic overview of the experiment is

seen on Figure 1. We have prepared the gene for you, consisting of a double stranded piece of

DNA. You will also receive a flask of living mammalian cells.

LIGATION

In order to transfer the gene into the cells, you have to convert the gene into a circularized

form of DNA, a so-called plasmid. Plasmids are more easily taken up by cells, than linear pieces

of DNA. Furthermore, the gene do not have to be inserted into the genome of the host, but will

function as an individual small genome. For preparing the plasmid, you will receive an open

plasmid, the expression plasmid. You have to ligate the GFP gene into the open plasmid to

recreate a complete circle. For ligation, an enzyme called T4 ligase, is used. The outcome is a

closed plasmid containing the GFP gene.

Figure 1: Schematic overview of your three days experiment in the laboratory.


6

TRANSFORMATION

In the next step we want to sort and amplify our newly prepared GFP plasmid. Our reaction

mixture from above contains different outcomes from the ligation; both unclosed and closed

circles of DNA, some with or without the insert. To find the plasmids with the GFP insert, you

will transform all plasmids from the sample into E. coli bacteria cells. The E. coli cells will be

treated in a way, so they might take up plasmids, and once taken up, the cells will treat the new

plasmid as it was their own genome, thus passing on copies of the plasmid to future daughter

cells. This means that one single E. coli cell, which has taken up the GFP plasmid, will give rise

to a whole colony of bacteria cells all expressing the plasmid harbouring our GFP gene. To get a

sufficient amount of plasmid, the E. coli cells will produce lots of the GFP containing plasmid.

SELECTION

To select the single E. coli cell which have absorbed the GFP plasmid, we seed the cells from

above on media plates, called agar plates. After one night of culturing, the cells will grow to

small colonies if the plasmid is absorbed. Our GFP plasmid contains, together with GFP, a gene

for resistance towards the antibiotic kanamycin. Hereby, E. coli cells, which have absorbed our

plasmid, are also resistant to kanamycin. Cells, which have not absorbed any plasmid, will die

in the presence of kanamycin. So to sort out the cells, we grow them on plates containing

kanamycin.

PLASMID CONTROL

E. coli colonies surviving on the plates have the resistance gene, but we have to test whether

they also contain the GFP gene. A plasmid closed without GFP insert still has resistance

towards kanamycin. You will use the Polymerase Chain Reaction(PCR) procedure, where DNA

can be amplified. We test the GFP-gene size with gel electrophoresis.

PLASMID PURIFICATION

The next step, we will perform for you, since we have no time for it together. The colonies

positive for GFP will be transferred to a flask with media to grow. When a sufficient number of

cells are reached, they are harvested and lysed (broken open) and the plasmids are purified.

TRANSFECTION

Now you have the plasmid containing the GFP gene and you are ready to transfer it into

mammalian cells. You will use calcium phosphate transfection, a transfection method based on


7

forming a calcium phosphate-DNA precipitate, which facilitates the binding of the DNA to the

cell surface. DNA then enters the cell by endocytosis. This means that the cell membrane, which

covers the cell, will fold around the DNA and drag it into the cell.

VISUALIZATION

After transfection, the cells are allowed to grow for two days. After one day you will change

their media in order for them to maintain healthy. On the second day the GFP protein have

been expressed in appropriate amounts to be visualized under UV light. You can therefore see

your cells glowing in a green light if you look in a fluorescence microscope.

The procedure above takes six days of work, and since you only have three, we will divide the

experiment in two parts. Therefore, on day one you will begin by ligating the GFP gene into an

open plasmid as explained. At the same day, you will receive an already made GFP plasmid,

which you will transfect into mammalian cells. On your last day, you will hopefully have an E.

coli colony expressing plasmid containing GFP, and mammalian cells green from GFP protein.


8

SECTION 2

LABORATORY PROTOCOL


9

Day 1

Plasmid production: Ligation of the GFP gene into an expression plasmid

You are going to ligate GFP into an already cut open expression plasmid. By ligation the GFP

becomes a covalent part of the plasmid, which at the same time is circularized. It is only the

circular form that can replicate inside cells.

The GFP and the plasmid have both been cut with the restriction enzymes SalI and NotI, which

recognize specific DNA sequences. This means that the gene and the plasmid have ends

matching each other. A map and sequence of the plasmid with GFP (called pEGFP-N1) is found

in the appendix.

Materials

The purified restricted GFP-gene

5 x T4 Ligase buffer

T4 DNA Ligase

Water

Restricted expression plasmid

Protocol

1. Prepare the following ligation mixtures for your restricted GFP (amounts in µL):

Sample A B

Water 20 7

5 x T4 Ligase buffer 0 4

Restricted GFP 0 6

Restricted plasmid 0 2

2. Add 1 μL T4 Ligase to B. The ligase is handed out by the instructors.


10

3. Incubate the ligation mixtures at room temperature for 1.5 hours. The instructors will

store the samples overnight in the freezer. Remember names on the eppendorf tubes.

Questions:

- What is a promoter?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What is a vector?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What is a ligase and how does it work?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What is a restriction enzyme?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Why are two different restriction enzyme used?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What is special about the restriction sites?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________


11

Cell Transfection: The GFP plasmid is transfected into mammalian cells

To get the new GFP plasmid into the mammalian cells, the plasmid is mixed directly with a

concentrated solution of CaCl2. This mixture is then added drop wise to a phosphate buffer to

form a fine precipitate. Making air bubbles in the phosphate buffer, while adding the DNA-CaCl2

solution, helps to ensure that the precipitate that forms is as fine as possible. This is important

because clumped DNA will not adhere to or enter the cell as efficiently. This solution is then

added drop wise to the cells.

The cells used in this experiment are a line of immortalized human cells. They grow on an

active surface on the bottom of a plastic bottle. Be careful not to disturb the cells. They have to

stay attached to the bottom of the bottle in order to remain healthy.

Materials

Human embryonic kidney cells (HEK293)

2.5M CaCl2

GFP – Plasmid

HEPES buffer

Protocol

1. Add 17 µl 2.5M CaCl2 to your tube containing 150 µl DNA. Mix by gently taking the liquid

up and down with your pipet. Avoid air bubbles.

2. Add the 167 µl DNA-CaCl2-solution slowly one drop at a time to the tube containing 167

µl 2x HEPES buffer. While you do this, you continuously make bubbles in the solution

with a larger pipet.

3. Leave the mixture for 5 min at room temperature.

4. Add the mixture to your cells one drop at a time.

5. Leave the cells to grow in the incubator overnight.


12

Questions:

- Why do we use a stable cell line and not “primary” cells?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What is the difference between transfection and transformation?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Describe and draw the transfection method used:

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________


13

Day 2

Plasmid production: Transformation of E. coli cells with ligation mixes

The plasmids carrying the insert (GFP) are to be transferred into E. coli in order to be sorted

and replicated. This process is called transformation. The E. coli cells have been treated in such

a manner that they are able to take up DNA. The cells are incubated with DNA plasmids and

will after heat shock at 42°C for 20 sec., take up the plasmids having accumulated on the cell

surface. The transformed cells are plated on agar plates containing a selective antibiotic (here

kanamycin). E. coli cells that have received intact plasmids will then be able to divide and grow

into colonies on the agar plates, because the plasmids carry the gene for antibiotic resistance.

Note that the antibiotic resistance does not give any information about whether the cells also

have received the GFP gene.

Materials

LB-medium

2 LB-agar plates containing kanamycin

2 Eppendorf tubes with E. coli cells.

The ligation mixtures from yesterday

Plastic Drigalsky spatulas for plating the bacteria

42°C heat block

Protocol

1. Mark the eppendorf tubes with the competent E. coli cells and the agar plates with name

and group number. Keep the cells on ice at all times.

2. Transfer 10 µL of each ligation mixture (A and B) into separate tubes with E. coli. Use a

pipet tip and gently stir around.

3. Incubate the transformation tubes on ice for 30 min.

4. Heat-shock the cells in a 42°C heat block for 20 sec. and immediately thereafter incubate

on ice for at least 2 min.

5. Add 950 µL LB-medium to each of the two transformation tubes.

6. Incubate at 37°C for 1 hour in a shaking incubator.

7. Mix the transformation mixture by gently pipetting up and down to ensure the cells are

equally distributed in the mix.


14

8. Plate 200 µL of each transformation mixture on each of two LB-agar plates marked A

and B.

9. The agar plates are incubated (bottom up!) in a 37°C incubator overnight.

Questions:

- What does the agar plate contain?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What does it mean that the E. coli cells are competent?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What is the purpose of the shaking incubator?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Why isn’t there any antibiotic in the LB-media?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Why are the cells placed at 37°C for one hour?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- How does the transformation works?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Why are the agar plates placed with the bottom up?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Why are the cells spread out on agar plates?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What is the function of Kanamycin?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________


15

Cell transfection: Maintenance of cells

Today the cells have to have their old media taken away, get washed and receive new media.

The media contains among others the nutrients the cells need to grow.

Materials

Waste tube

PBS wash buffer

Media

Protocol

1. Remove the old media from the cells by transferring it to a waste tube.

2. Wash the cells with 2 mL wash buffer (PBS). Be careful not to disturb the cells. Add the

buffer, let it flow around and empty the flask again by transferring the buffer to the

waste tube.

3. Add 3.5 mL of new media to each culture flask.

Questions:

- Why do the cells need new media?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Did the media change color from yesterday?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- If yes, why did the media change color?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What is the purpose of PBS?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________


16

Day 3

Plasmid production: Check colonies for inserted GFP by colony PCR

Today you are going to find out whether any of your E. coli colonies contain the GFP insert. You

will be doing this by colony-PCR using a primer set, where one primer anneals upstream

(before) of the GFP gene and one anneals inside the gene itself. A PCR product of the right size

tells you that the insert is most probably GFP and that it is oriented correctly in the plasmid.

Materials

PCR master mix

10 x Taq buffer

50 mM MgCl2

Forward primer + reverse primer

10 mM dNTP

dH2O

PCR tubes

1 % agarose gel (incl. GelRed)

Gel apparatus

Power supply

5 x DNA loading buffer (Pulls the dye and DNA down in the wells)

100 bp DNA size marker (see appendix for the size of each band in the marker)

Taq DNA polymerase

Positive control (Pos)

Negative control (Neg)

Protocol

1. Number 5 PCR tubes (1-5).

2. Add 1 μL Taq DNA polymerase to the master mix. The polymerase is handed out by the

instructors. From now on, work on ice!

3. Add 10 µL master mix to each of the PCR tubes.

4. Mark the 3 colonies you want to test on the bottom of the plate with a pen.


17

5. Pick the colonies with a small pipette tip (those for Pipetman P20) by dipping the

pipette tip into a colony and then dipping it in one of the PCR tubes and stir a bit around,

so the cells get into the liquid. Close the lids on the PCR tubes.

6. Add 4 µl of the positive control to a PCR tube.

7. Add 2 µl of the negative control to a PCR tube.

8. The 5 PCR tubes are placed in the PCR machine (remember team numbers!) and the

PCR is started.

9. The PCR cycle program is:

1. Initial denaturation of template DNA: 2 min at 95°C

2. Amplification cycles (repeated 25 times):

30 sec. at 95°C (melting)

30 sec. at 60°C (annealing)

1 min. at 72°C (elongation)

10. After ended PCR, add 2 µL 5x DNA loading buffer to each PCR tube and to the size

marker. Pipette up and down very gently to mix the PCR product and the load buffer.

Avoid air bubbles!

11. Load the agarose gel with 10 µl of each sample. Write down where you load the

samples. (See appendix for how to load a gel).

12. Run electrophoresis at 150 V until the blue dye is around 2.5 cm from the bottom of the

gel.

Visualize the agarose gel on a UV box and photograph your gel. Write sample numbers

on your photography.

Questions:

- Do you have colonies on the agar plates?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Do your samples contain the insert?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________


18

- What does dNTPs mean?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Why do we have both a forward and a reverse primer?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What does the positive control contain? What does the negative control contain?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What is PCR?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- How does the polymerase work?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- How are the bands separated during gel electrophoresis?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Normally, you add SDS, when you make gel electrophoresis of proteins. SDS denatures

proteins and gives them a negative charge. Why don’t we need SDS, when we run the

DNA on the agarose gel?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Why do we add the loading dye?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- How are the bands visualized?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- Why are there two different colored bands?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________


19

Cell transfection: GFP-glowing cells

Today you will see whether the transfection has worked.

Materials

Fluorescence microscope

Protocol

1. Look at your cells in a fluorescence microscope.

Questions:

- Do your cells contain the GFP plasmid?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- How efficient was your transfection?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- How can you optimize the transfection process?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What is transfection used for other than making cells green?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

- What do you think would happen if the cells where kept in the same culture flask?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________


20

SECTION 3

THEORETICAL EXERCISE


21

1. EcoRI has the cleavage site: 5' G*AATTC 3' (* indicates the cleavage). Where would

EcoRI cleave the following sequence: 3' GGTCTTAAGCGG 5'? What does the cleavage

product look like? Tip: Write the complement DNA string.

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

2. How often would there be a restriction site for a specific restriction enzyme that

recognizes a sequence of four bases? It is presumed that all nucleotides are distributed

evenly.

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

3. Make a forward and reverse primer that are able to amplify the following genomic

sequence by PCR. The primers must have a length of 10 base pairs.

5 ’CGCGATGGCTCACTAGCTGGCGCGGCTAGCATCGAGCGCGGACGAGG 3'

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

4. Calculate the size of your colony PCR product. Use the appendix.

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________


22

5. Figure 2 shows an agarose gel with a proposed pattern of your product from your

colony PCR. It is shown with 3 different colonies loaded in the wells 1-3. What can be

concluded about the different colonies used when looking at the bands in the gel?

Explain the different pattern seen.

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

Figure 2: The DNA marker has the size from 1000 bp to 100 bp. There are 100 bp

between each band.


23

6. What restriction enzyme(s) would you choose to cut the GFP-gene out?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

7. What band(s) would you see on the gel if you cut the vectors (see below) with the

following restriction enzymes: Xba, EcoRI, HindIII, NotI, Xba+NotI or BamHI+EcoRI?

What vector would you use to insert the GFP-gene from question 6? What enzyme(s)

would you choose to test if the GFP-gene is inserted correctly and how would the band

pattern look like?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________


24


25

SECTION 4

GENERAL QUESTIONS – THE CENTRAL DOGMA


26

1. The animal cell consists of different organelles. Fill out the empty boxes using the names

below. Write the function of these organelles.

- Cell membrane

- Vesicle

- Nucleus

- Endoplasmatic Reticulum

- DNA

- Cytoplasma

- Golgi apparatus

- Mitochondrion

2. Animal and plant cells are not alike. Describe the differences.

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

3. DNA consists of four different bases. What are their names and how are they paired?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________


27

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

4. The figure below shows “The Central Dogma”. Describe the different steps in this

process.

______________________________________

______________________________________

______________________________________

______________________________________

______________________________________

______________________________________

______________________________________

______________________________________

______________________________________

5. What are the difference(s) between RNA and DNA?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

6. Where do the transcription and translation processes take place in eukaryotes and

prokaryotes?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

7. What do proteins consist of and how are they built?

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________

_____________________________________________________________________________________________________


28

SECTION 5

APPENDIX


29

VECTOR OUTLINE OF pEGFP-N1

The expression plasmid with GFP insert.


30

THE SEQUENCE OF pEGFP-N1

1 tagttattaa tagtaatcaa ttacggggtc attagttcat agcccatata tggagttccg

61 cgttacataa cttacggtaa atggcccgcc tggctgaccg cccaacgacc cccgcccatt

121 gacgtcaata atgacgtatg ttcccatagt aacgccaata gggactttcc attgacgtca

181 atgggtggag tatttacggt aaactgccca cttggcagta catcaagtgt atcatatgcc

241 aagtacgccc cctattgacg tcaatgacgg taaatggccc gcctggcatt atgcccagta

301 catgacctta tgggactttc ctacttggca gtacatctac gtattagtca tcgctattac

361 catggtgatg cggttttggc agtacatcaa tgggcgtgga tagcggtttg actcacgggg

421 atttccaagt ctccacccca ttgacgtcaa tgggagtttg ttttggcacc aaaatcaacg

481 ggactttcca aaatgtcgta acaactccgc cccattgacg caaatgggcg gtaggcgtgt

541 acggtgggag gtctatataa gcagagctgg tttagtgaac cgtcagatcc gctagcgcta

601 ccggactcag atctcgagct caagcttcga attctgcagt cgacggtacc gcgggcccgg

661 gatccaccgg tcgccaccat ggtgagcaag ggcgaggagc tgttcaccgg ggtggtgccc

721 atcctggtcg agctggacgg cgacgtaaac ggccacaagt tcagcgtgtc cggcgagggc

781 gagggcgatg ccacctacgg caagctgacc ctgaagttca tctgcaccac cggcaagctg

841 cccgtgccct ggcccaccct cgtgaccacc ctgacctacg gcgtgcagtg cttcagccgc

901 taccccgacc acatgaagca gcacgacttc ttcaagtccg ccatgcccga aggctacgtc

961 caggagcgca ccatcttctt caaggacgac ggcaactaca agacccgcgc cgaggtgaag

1021 ttcgagggcg acaccctggt gaaccgcatc gagctgaagg gcatcgactt caaggaggac

1081 ggcaacatcc tggggcacaa gctggagtac aactacaaca gccacaacgt ctatatcatg

1141 gccgacaagc agaagaacgg catcaaggtg aacttcaaga tccgccacaa catcgaggac

1201 ggcagcgtgc agctcgccga ccactaccag cagaacaccc ccatcggcga cggccccgtg

1261 ctgctgcccg acaaccacta cctgagcacc cagtccgccc tgagcaaaga ccccaacgag

1321 aagcgcgatc acatggtcct gctggagttc gtgaccgccg ccgggatcac tctcggcatg

1381 gacgagctgt acaagtaaag cggccgcgac tctagatcat aatcagccat accacatttg

1441 tagaggtttt acttgcttta aaaaacctcc cacacctccc cctgaacctg aaacataaaa

1501 tgaatgcaat tgttgttgtt aacttgttta ttgcagctta taatggttac aaataaagca

1561 atagcatcac aaatttcaca aataaagcat ttttttcact gcattctagt tgtggtttgt

1621 ccaaactcat caatgtatct taaggcgtaa attgtaagcg ttaatatttt gttaaaattc

1681 gcgttaaatt tttgttaaat cagctcattt tttaaccaat aggccgaaat cggcaaaatc

1741 ccttataaat caaaagaata gaccgagata gggttgagtg ttgttccagt ttggaacaag

1801 agtccactat taaagaacgt ggactccaac gtcaaagggc gaaaaaccgt ctatcagggc

1861 gatggcccac tacgtgaacc atcaccctaa tcaagttttt tggggtcgag gtgccgtaaa

1921 gcactaaatc ggaaccctaa agggagcccc cgatttagag cttgacgggg aaagccggcg

1981 aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg gcgctagggc gctggcaagt

2041 gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc ttaatgcgcc gctacagggc

2101 gcgtcaggtg gcacttttcg gggaaatgtg cgcggaaccc ctatttgttt atttttctaa

2161 atacattcaa atatgtatcc gctcatgaga caataaccct gataaatgct tcaataatat

2221 tgaaaaagga agagtcctga ggcggaaaga accagctgtg gaatgtgtgt cagttagggt

2281 gtggaaagtc cccaggctcc ccagcaggca gaagtatgca aagcatgcat ctcaattagt


31

2341 cagcaaccag gtgtggaaag tccccaggct ccccagcagg cagaagtatg caaagcatgc

2401 atctcaatta gtcagcaacc atagtcccgc ccctaactcc gcccatcccg cccctaactc

2461 cgcccagttc cgcccattct ccgccccatg gctgactaat tttttttatt tatgcagagg

2521 ccgaggccgc ctcggcctct gagctattcc agaagtagtg aggaggcttt tttggaggcc

2581 taggcttttg caaagatcga tcaagagaca ggatgaggat cgtttcgcat gattgaacaa

2641 gatggattgc acgcaggttc tccggccgct tgggtggaga ggctattcgg ctatgactgg

2701 gcacaacaga caatcggctg ctctgatgcc gccgtgttcc ggctgtcagc gcaggggcgc

2761 ccggttcttt ttgtcaagac cgacctgtcc ggtgccctga atgaactgca agacgaggca

2821 gcgcggctat cgtggctggc cacgacgggc gttccttgcg cagctgtgct cgacgttgtc

2881 actgaagcgg gaagggactg gctgctattg ggcgaagtgc cggggcagga tctcctgtca

2941 tctcaccttg ctcctgccga gaaagtatcc atcatggctg atgcaatgcg gcggctgcat

3001 acgcttgatc cggctacctg cccattcgac caccaagcga aacatcgcat cgagcgagca

3061 cgtactcgga tggaagccgg tcttgtcgat caggatgatc tggacgaaga gcatcagggg

3121 ctcgcgccag ccgaactgtt cgccaggctc aaggcgagca tgcccgacgg cgaggatctc

3181 gtcgtgaccc atggcgatgc ctgcttgccg aatatcatgg tggaaaatgg ccgcttttct

3241 ggattcatcg actgtggccg gctgggtgtg gcggaccgct atcaggacat agcgttggct

3301 acccgtgata ttgctgaaga gcttggcggc gaatgggctg accgcttcct cgtgctttac

3361 ggtatcgccg ctcccgattc gcagcgcatc gccttctatc gccttcttga cgagttcttc

3421 tgagcgggac tctggggttc gaaatgaccg accaagcgac gcccaacctg ccatcacgag

3481 atttcgattc caccgccgcc ttctatgaaa ggttgggctt cggaatcgtt ttccgggacg

3541 ccggctggat gatcctccag cgcggggatc tcatgctgga gttcttcgcc caccctaggg

3601 ggaggctaac tgaaacacgg aaggagacaa taccggaagg aacccgcgct atgacggcaa

3661 taaaaagaca gaataaaacg cacggtgttg ggtcgtttgt tcataaacgc ggggttcggt

3721 cccagggctg gcactctgtc gataccccac cgagacccca ttggggccaa tacgcccgcg

3781 tttcttcctt ttccccaccc caccccccaa gttcgggtga aggcccaggg ctcgcagcca

3841 acgtcggggc ggcaggccct gccatagcct caggttactc atatatactt tagattgatt

3901 taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat aatctcatga

3961 ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta gaaaagatca

4021 aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac

4081 caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt tttccgaagg

4141 taactggctt cagcagagcg cagataccaa atactgtcct tctagtgtag ccgtagttag

4201 gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta atcctgttac

4261 cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca agacgatagt

4321 taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag cccagcttgg

4381 agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa agcgccacgc

4441 ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga acaggagagc

4501 gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc

4561 acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa

4621 acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt gctcacatgt

4681 tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccatg cat


32

Underlined sequences are the sequences where the primers bind

Bold sequence is the GFP insert

Italic and red sequences indicate where the restriction enzymes cleave


33

100 bp DNA SIZE MARKER

bp


34

HOW TO LOAD AN AGAROSE GEL

The picture below shows a gel, which is ready to be loaded. There are 15 wells, which means it

can be used for 15 samples including a DNA size marker. Power will be added so that there will

be a flow of negative charges towards the end of the gel, the positive pole. DNA is negatively

charged.

The two pictures below show you how to hold your hands while loading the gel. It is important

to have very steady hands to avoid you piercing the gel with the pipette or adding your sample

in a wrong well.

Hold the pipette with one hand and use the other hand as support. This will make your hands

more steady.


35

The picture below shows how to add a sample to a well. It is important not to touch the bottom

of the well with the pipette tip. Add the sample very slowly by not pushing the pipette too hard.

cloning gfp into mammalian cells - science and...

Documents