INFECTION AND IMMUNITY,0019-9567/00/$04.0010

Oct. 2000, p. 5663–5667 Vol. 68, No. 10

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Campylobacter fetus sap Inversion Occurs in the Absence of RecA FunctionKEVIN C. RAY,1 ZHENG-CHAO TU,1 ROSEMARY GROGONO-THOMAS,2 DIANE G. NEWELL,3

STUART A. THOMPSON,4 AND MARTIN J. BLASER1*

Vanderbilt University School of Medicine and VA Medical Center, Nashville, Tennessee1; Department of Biochemistryand Molecular Biology, Medical College of Georgia, Augusta, Georgia4; and Department of Farm Animal

and Equine Medicine and Surgery, Royal Veterinary College, Potters Bar, Hertfordshire,2 andVeterinary Laboratories Agency (Weybridge), New Haw, Surrey,3 United Kingdom

Received 3 April 2000/Returned for modification 27 May 2000/Accepted 4 July 2000

Phase variation of Campylobacter fetus surface layer proteins (SLPs) occurs by inversion of a 6.2-kb DNAsegment containing the unique sap promoter, permitting expression of a single SLP-encoding gene. Previouswork has shown that the C. fetus sap inversion system is RecA dependent. When we challenged a pregnant ewewith a recA mutant of wild-type C. fetus (strain 97-211) that expressed the 97-kDa SLP, 15 of the 16 ovine-passaged isolates expressed the 97-kDa protein. However, one strain (97-209) expressed a 127-kDa SLP, sug-gesting that chromosomal rearrangement may have occurred to enable SLP switching. Lack of RecA functionin strains 97-211 and 97-209 was confirmed by their sensitivity to the DNA-damaging agent methyl methane-sulfonate. Southern hybridization and PCR of these strains indicated that the aphA insertion into recA wasstably present. However, Southern hybridizations demonstrated that in strain 97-209 inversion had occurredin the sap locus. PCR data confirmed inversion of the 6.2-kb DNA element and indicated that in these recAmutants the sap inversion frequency is reduced by 2 to 3 log10 units compared to that in the wild type. Thus,although the major sap inversion pathway in C. fetus is RecA dependent, alternative lower-frequency, RecA-independent inversion mechanisms exist.

Campylobacter fetus causes infertility and spontaneous abor-tions in ungulates, as well as intestinal and systemic diseases inboth normal and immunocompromised humans (1). C. fetussurface layer proteins (SLPs) form a protective capsule for theorganism (41) that is critical for virulence (27). C. fetus cellscan express any of eight or nine SLPs that range in mass from97 to 149 kDa (36). Each SLP is encoded by a promoterlesssapA homolog (10), and SLP phase variation occurs by inver-sion of a 6.2-kb DNA segment, which contains a single out-ward-facing sapA promoter (8). The sapA (2) and sapA2 (12)homologs, expressing 97- and 127-kDa SLPs, respectively,flank the 6.2-kb invertible region in wild-type strain 23D. Theinvertible region contains an operon of four genes (sapCDEF),in which SapD, -E, and-F constitute a type I secretion systemnecessary for the extracellular transport of SLPs, while thefunction of SapC is unknown (35).

RecA is a highly conserved bacterial protein that facilitatesDNA rearrangement via homologous recombination (30). Inother bacterial species, including Salmonella species, Bordetellapertussis (24), and Escherichia coli (39), DNA inversion leadingto phase variation has been shown to be RecA independent(6, 20, 23, 26, 29, 31). In contrast, in studies using the definedC. fetus mutant strain 23D:AC200 in which a chloramphenicol(cat) resistance cassette without a functional promoter wasinserted into sapA, no inversion events could be detected afterrecA was interrupted (9). Complementation by recA in transrestored inversion, thus suggesting that recA function was re-quired (11), which is consistent with the long (approximately625-bp) 59 conserved regions of DNA identity in each of thesap homologs.

However, following recent experimental infection of sheepwith a C. fetus recA mutant, one strain (97-209) was recovered

in which the molecular mass of the expressed SLP had shifted(19). The aim of the present study was to investigate thisobserved shift in SLP expression. Two mechanisms were con-sidered: reversion of the recA mutation in 97-209 or occurrenceof a DNA rearrangement in the absence of RecA function. Wedemonstrated that the recA mutation had been maintained instrain 97-209 during in vivo passage but that sap rearrangementhad occurred. We found that although RecA function is criticalfor high-frequency inversion, RecA-independent sap inversioncan occur at a lower frequency.

MATERIALS AND METHODS

Bacterial strains and culture conditions. The C. fetus strains used in this studyare listed in Table 1. In prior studies (19), a pregnant ewe was challenged withrecA mutant 97-211, which expresses a 97-kDa SLP. Although all of the isolatesrecovered from the animal were expected to express a 97-kDa SLP, as observedin 97-210, one (97-209) expressed a 127-kDa SLP. All C. fetus cells were grownon brucella agar containing polymyxin B sulfate (7,000 U/ml), vancomycin(10 mg/ml), nalidixic acid (15 mg/ml), trimethoprim lactate (10 mg/ml), and, whenrequired, kanamycin (30 mg/ml). Strains were cultured at 37°C under microaero-bic conditions. All isolates were kanamycin resistant, reflecting the presence ofaphA in recA, and Southern hybridization studies indicated that all shared thesame genetic background.

Immunoblot assay. Whole-cell preparations of strains 23D, 23B, 97-209, and97-211 were prepared as described previously (32). Protein concentrations weredetermined by bicinchoninic acid assay (Pierce, Rockford, Ill.), and 1 mg ofprotein was assayed by electrophoresis on a sodium dodecyl sulfate–7% poly-acrylamide gel. S-layer proteins were detected with polyclonal rabbit serum(1:10,000 dilution) raised against the C. fetus type A 97-kDa SLP, as describedpreviously (28), using goat anti-rabbit immunoglobulin G–alkaline phosphatase(Boehringer Mannheim, Indianapolis, Ind.) (1:2,000 dilution) as the secondaryantibody. These antibodies recognize C. fetus SLPs of all molecular masses (28,38). Strains 97-211s and 97-209s also were assayed by immunoblotting to deter-mine whether any change in SLP phenotype had occurred.

Serum susceptibility assay. Cells of selected C. fetus strains were harvestedfrom brucella agar plates after 48 h and resuspended in saline (pH 7.0) with1 mM calcium chloride, as described previously (5). Bacterial suspensions werediluted 10-fold from 1021 to 1027, and the 1024 to 1027 dilutions were incubatedin the presence of 10% normal human serum (NHS) or heat-inactivated NHS at37°C in an atmosphere with 5% CO2 for 60 min. Triplicate samples were theninoculated on blood agar plates, and colonies were counted after 72 h as de-scribed previously (10).

* Corresponding author. Mailing address: Department of Medicine,New York University Medical Center, 550 First Ave., New York, NY10016. Phone: (212) 263-6394. Fax: (212) 263-7700. E-mail: martin.blaser@med.nyu.edu.

5663

on Decem

ber 15, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

Sensitivity to MMS. Bacterial cells were harvested after 48 h of growth andresuspended in 3 ml of brucella broth. The cell suspension then was diluted10-fold, and 1 ml was incubated either in brucella broth with 0.05% methylmethanesulfonate (MMS) or in broth alone for 60 min 37°C with gentle shaking.Serial 1024 to 1027 dilutions of the cell suspensions were inoculated in triplicateonto blood agar plates. Cells were sampled both before and after exposure toMMS. Plates were incubated at 37°C for 72 h under microaerobic conditions, andthen colonies were counted to determine sensitivity to MMS. Colonies of strains97-211 and 97-209 that survived MMS incubation were recultured and againexposed to MMS, and survival frequencies were determined as described above.

Southern-hybridization. C. fetus chromosomal DNA was prepared using theWizard Genomic DNA Purification Kit (Promega, Madison, Wis.), digested witheither NdeI or PstI, electrophoresed on a 0.7% agarose gel, and transferred to anylon membrane (MSI, Westborough, Mass.)(12,13). The hybridization probesused were PCR products specific for recA (primers B9088 and B9089) (Table 2),the sapA 59 conserved region (primers B9343 and AN1199), sapF (primers A7308and 7315), and the gel-purified aphA fragment from pILL600 Smal digestion(25). Probes were labeled using the Renaissance chemiluminescent nonradioac-tive kit (NEN Research Products, Boston, Mass.).

PCR. To determine whether aphA remained present in recA (11), chromo-somal DNAs from selected strains were amplified with recA primers BA1916 andBA1917, which flank the original aphA insertion site (Table 2). To detect inver-sion of the C. fetus invertible region, chromosomal DNAs from selected strainswere amplified using primer sapApromF2 (forward-facing promoter primer) witheither sapAR (reverse-facing sapA-specific primer) or sapA2R (reverse-facingsapA2-specific primer) (Table 2). To determine the frequency of inversion of theinvertible region, 10-fold (100 to 1027) dilutions of C. fetus chromosomal DNAwere amplified with sapAR and either sapApromF2 or sapFF (forward-facingsapF primer). Primers from the recA/eno region downstream of the aphA inser-tion site were used in a parallel control PCR.

RESULTSSLP expression of C. fetus cells. We first sought to confirm

that the C. fetus strain (97-209) recovered from the pregnantewe was indeed expressing a different SLP than the challenge

strain, 97-211. Immunoblotting of this strain indicates the ex-pression of a 127-kDa SLP, not the 97-kDa SLP of wild-typestrain 23D or of strain 97-211, which was inoculated into theewe (Fig. 1A). Although for 23D there was a minor 127-kDaband, for strains 97-209 and 97-211, only single SLP bandswere present, consistent with their presumed recA phenotype(11). The strains surviving incubation with MMS (97-211s and97-209s; see below) showed the same SLP expression as thestrains from which they were derived. To confirm that the SLPswere present on the cell surface, the C. fetus cells were testedfor serum resistance by incubation with NHS or with heat-inactivated NHS to control for nonspecific killing. As expected,the control wild-type strain 23D was serum resistant (,1.0log10 unit killing) whereas S2 strain 23B was highly sensitive(Fig. 1B). Challenge strain 97-211 and the two strains recov-ered from the ewe all were serum resistant, confirming SLPexpression on their cell surface (3).

Susceptibility of cells to MMS. Previous studies have shownthat wild-type C. fetus cells survive treatment with the mu-tagenizing agent MMS, whereas recA strains are highly sensi-tive (11). Our studies confirmed that recA strain 97-211 wassubstantially more sensitive to MMS than was wild-type strain23D (Fig. 1C). Strain 97-209, which changed to expression of a127-kDa SLP (Fig. 1A) also was highly sensitive to MMS,consistent with a RecA phenotype. For both strains 97-211 and97-209, several colonies survived a 60-min incubation withMMS. A representative colony from each (97-211s and 97-209s, respectively) was picked and reincubated with MMS todetermine whether there had been selection for MMS resis-tance or whether their presence merely reflected the limits ofthe assay system. These MMS survivors were as susceptible toMMS as were their parental strains (Fig. 1C), indicating noselection for MMS resistance. These results indicate that dur-ing the ovine passage, there had been no change from theoriginal RecA phenotype (11).

recA genotype of C. fetus strains. To assess the recA genotypeof the ewe isolates, both Southern hybridizations and PCRanalyses were used. Southern hybridization using both recAand aphA probes indicated that aphA was stably integratedwithin recA in both the strain used to challenge the ewes(97-211) and the strains recovered (97-209 and 97-210), re-gardless of their SLP phenotype (Fig. 2). PCR using recA

TABLE 1. C. fetus strains used in this study

StrainrecAgeno-type

Dominant SLPexpression

(kDa)Description

23D 1 97 Wild type23B 1 Spontaneous mutant of 23D97-209 2 127 recA::aphA, recovered from ewe placenta97-210 2 97 recA::aphA, recovered from ewe vagina97-211 2 97 recA::aphA, inoculated into pregnant ewe97-209s 2 127 MMS survivor97-211s 2 97 MMS survivor

TABLE 2. PCR Primers used in this study

Name Gene ordesignation Directiona Location

in geneGenbank

accession no. Sequence (5' 3 3')b

B9088 recA F 561–581 AF020677 GCGTACCAAAAGGAAGAATAGB9089 recA R 1410–1390 AF020677 TCTACTGCACCGCTCATTATGA7308 sapF F 4752–4772 AF027405 GCTAGTATGTATGAAAATTTAA7315 sapF R 5320–5300 AF027405 AAGCTAAGATCCATATTTTCAB9341 sapA C terminus F 2014–2033 J05577 AGCTTATTACAGTGAAACTAB9342 sapA C terminus R 2775–2758 J05577 GATCTAGCGTACCTGAAAB9339 sapA2 C terminus F 2889–2909 S76860 GATGATGCATTAACAATAATAB9340 sapA2 C terminus R 3211–3194 S76860 GCAGTGTCTGGAGTAACGB9337 promF2 F 644–626 S44580 CGATAGTATTTTTGCAAATB9338 promR2 R 141–158 S44580 TATGCAATACATCTTCATB9343 sapAcon3 F 645–665 S44580 ATAGTAAGGTAAGCAATCCGTAN1199 sapAcon4 R 590–569 J05577 AGGTAGACGCGTAAGTCGACGTCTCACTCTTCAAAGCATCAATCB6816 sapFF F 5907–5927 AF027405 ACTATTAGAAATTTAGAAAGAA9237 sapA2R R 3767–3747 S76860 AGCTACTGTGATTGTATTAGCA9238 sapAR R 2783–2763 J05577 AAGTTTAAGATCTAGCGTACCBA3517 sapApromF2 F 596–621 S44580 TATAAAAAATTATGTTATAATTCGCGC9294 recAF F 1204–1228 AF020677 CAGCAAAGAAGGAGAGATAATAGATC9295 enoR R 2007–1983 AF020677 CTTTTTTAATGTTTGATATACTTCG

a F, forward; R, reverse.b Restriction digestion sites are underlined. The sequences are as follows: MluI, ACGCGT; SalI, GTCGAC.

5664 RAY ET AL. INFECT. IMMUN.

on Decem

ber 15, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

primers B9088 and B9089 (Table 2) showed a 2.0-kb product inwild-type strain 23D and 3.4-kb products in strains 97-210,97-209, and 97-211, confirming the presence of aphA withinrecA (data not shown). In total, both the phenotypic and ge-

notypic data indicate that in strain 97-209, the change in SLPphenotype occurred in a recA background.

Southern hybridization analyses provide evidence for sapinversion in recA strain 97-209. We next sought to determinethe mechanism for the change in SLP phenotype in recA strain97-209. To accomplish this, we performed a series of Southernhybridizations using strain 97-209 and relevant controls to de-termine whether the changed phenotype could be explained bysap locus inversion. In Southern hybridizations of PstI-digestedchromosomal DNA, if inversion of the 6.2-kb invertible regionhad occurred such that sapA2 now was downstream of theunique sap promoter and able to express the 127-kDa SLP,with use of a probe to the sapA 59 conserved region, the loss of4.8- and 5.7-kb hybridizing fragments and the gain of 6.9- and3.5-kb fragments would be expected. The C. fetus strains ex-pressing a 97-kDa SLP (23D, 97-210, and 97-211) showed the5.7- and 4.8-kb bands, as expected, but these were absent in97-209 and a new band at 3.5 kb was seen (data not shown).When an NdeI digestion of chromosomal DNA was done andthe same sapA probe was used, a shift from a 1.2- to a 1.5-kbhybridizing band was expected in strain 97-209 but not in theother strains, and this was clearly observed (data not shown).Since use of the sapA probe is associated with multiple bands,hybridization of PstI-digested chromosomal DNA also wasdone using a probe to sapF, which is present in a single copywithin the invertible DNA fragment. Rearrangement permit-ting expression of the sapA2 product would be expected toproduce a shift from a 4.8- to a 3.5-kb sapF-hybridizing frag-ment (Fig. 3A), and this was observed for strain 97-209 but not

FIG. 1. Phenotypic characterization of C. fetus recA strains. (A) Identifica-tion of SLPs in whole-cell preparations of C. fetus strains by immunobloting withpolyclonal rabbit serum against C. fetus SLPs. Lanes: a, 23D (wild type); b,97-211; c, 97-209; d, 97-211s (strain surviving incubation with MMS); e, 97-209s(strain surviving MMS); f, 23B (spontaneous S2strain). A 97-kDa SLP is presentin lanes a, b, and d. A major 127-kDa SLP is present in lanes c and e. Immu-noblotting indicates that strain 97-209 has changed to expression of a 127-kDaSLP, and only a single SLP predominated for each strain. Immunoblotting ofstrains 97-211s and 97-209s indicates that SLP expression was not affected byexposure to MMS. (B) Susceptibility of C. fetus strains 23D (S1), 23B (S2),97-211, 97-210, and 97-209 to NHS. Strains 97-211, 97-210, and 97-209 werehighly resistant to serum killing, consistent with the expression of SLPs on theircell surfaces. (C) Sensitivity of C. fetus to MMS, using strains 23D (recA1),97-211 (recA), 97-211s (97-211 survivor of MMS incubation), and 97-209s (97-209survivor of initial MMS incubation). Results represent log10 killing after incu-bation of C. fetus cells at 37°C for 60 min in the presence of 0.05% MMS. Foreach strain, the mean (6 standard deviation) log10 kill is shown for triplicatedeterminations. Strains 97-211 and 97-209 are highly sensitive to MMS, indicat-ing a lack of RecA function. For each of the assays of strains 97-211 and 97-209,several colonies were observed after incubation with MMS. These survivors(97-211s and 97-209s) showed the same phenotype (SLP expression and suscep-tibility to MMS) as their parental strains.

FIG. 2. Analysis of the recA mutation in C. fetus strains by Southern hybrid-ization of PstI-digested chromosomal DNA. The probes used are specific for recA(left panel) and aphA (right panel), and the strains examined are 23D (wild type),97-211, 97-210, and 97-209. The sizes (in kilobases) of hybridizing fragments areindicated at left. The results show that the aphA cassette is stably present withinrecA in strains 97-211, 97-210, and 97-209.

FIG. 3. Analysis of the sap invertible region in C. fetus strains by Southernhybridization of PstI-digested DNA. (A) Postulated restriction maps of strains23D (97-kDa SLP) and 97-209 (127-kDa SLP). Arrows indicate direction oftranscription, and diagonal bars indicate 59 conserved region of sap homologs.PstI sites (P) are shown, and brackets indicate expected products when using asapF probe (black bar). (B) Southern hybridization of PstI-digested chromo-somal DNAs from C. fetus strains 23D (97 kDa), 97-209 (127 kDa), 97-210 (97kDa), and 97-211 (97 kDa) using the sapF probe.

VOL. 68, 2000 C. FETUS sap INVERSION IN ABSENCE OF RecA FUNCTION 5665

on Decem

ber 15, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

for the control strains (Fig. 3B). Therefore, these studies indi-cated that the change in SLP expression in strain 97-209 wasdue to inversion of the 6.2-kb invertible region, which placedsapA2 downstream of the unique sap promoter.

PCR confirmation of inversion of the sap invertible regionand estimation of its frequency. Since inversion of the 6.2-kbinvertible region is believed to occur spontaneously in wild-type strains, we sought to test this phenomenon in strain 23D.Using primer sapApromF2, which is a forward-facing sapFprimer in the region of the unique sap promoter, and reverseprimers specific to either sapA or sapA2, we were able to obtainPCR products, indicating that routine culture of 23D resultedin a mixture of cells with the invertible region in either orien-tation (data not shown). Using these same primers for the recAstrains 97-211 and 97-209 also showed that both products werepresent, confirming that populations of cells with the 6.2-kb in-vertible region in either orientation were present in both strains.

To estimate the frequency of inversion, these PCRs wererepeated using serial dilutions of template DNA. A controlPCR for a chromosomal locus (recA/eno), which does not re-arrange, also was used (Fig. 4). For each strain studied, wecould detect the recA/eno product in 1026 dilutions of thechromosomal DNA template. For wild-type strain 23D, thefrequency of inversion was approximately 1021, comparing theresults of the two competing sapApromF2-based PCRs (Fig.4). In contrast, for recA strains 97-211 and 97-209, the frequen-cies were about 1023 and 1024 respectively, with the number ofpositive dilutions reflecting the strain’s phenotype (expressionof a 97-kDa protein favors the reaction with the sapAR primer,whereas expression of the 127-kDa protein favors the reactionwith the sapA2R primer) (Fig. 4). These results indicate thatmutation of recA substantially diminished but did not eliminatethe sap invertible-region inversion.

DISCUSSION

In this study, we confirmed that C. fetus strain 97-209, re-covered from an experimentally infected ewe, expressed a 127-kDa SLP rather than the 97-kDa SLP expressed in the chal-lenge strain (19). That strain 97-209 was serum resistant (4) isindicative of the surface localization of this protein (18). These

results demonstrate that the shift in SLP expression that hadoccurred in vivo was not to produce a strain lacking SLP en-capsulation (15, 16) but rather to an S1 variant expressing analternative SLP.

Studies of susceptibility to MMS demonstrated that the vari-ant strain 97-209 maintained the RecA phenotype, and bothSouthern hybridizations and PCR analyses showed that theoriginal recA genotype of the challenge strain (97-211) re-mained in 97-209. Further, the few survivors of incubation withMMS showed a fully susceptible phenotype, which indicatesthat rather than selecting for MMS resistance, they representthe chance survivors at the limit of assay efficacy, rather thanreversion to wild-type RecA function.

Given that RecA previously has been demonstrated to benecessary for SLP switching, how then did C. fetus change itsphenotype from expression of a 97-kDa SLP to expression of a127-kDa SLP? Again, both Southern hybridization and PCRanalyses are consistent in indicating that DNA inversion, in-volving the 6.2-kb invertible region had occurred in strain97-209. DNA inversion involving the sap invertible region isknown to occur spontaneously, and in C. fetus mutant strain23D:ACA2K101 (sapA::cat sapA2::aphA) it was estimated tooccur at a frequency of 1024 to 1023 (9). This rate of inversionrecently has been confirmed in both PCR analyses and studiesof (phenotypic) shifts in antibiotic resistance for that strain(Z.-C. Tu et al., unpublished data). For wild-type strain 23D,our PCR dilution results indicate that the frequency of inver-sion is about 1021 (Fig. 4), which is approximately 100- to1,000-fold greater than the previously published result (11).Both results have been confirmed in multiple experiments.One explanation for this 2- to 3-log10-unit difference in inver-sion rate between wild-type strain 23D and mutant strain 23D:ACA2K101 is that in the latter strain, antibiotic resistancecassettes (cat and aphA in sapA and sapA2, respectively) wereinserted in the sapA 59 conserved regions. Their presence atthat location might interfere with the inversion process, espe-cially since it substantially disrupts the DNA homology thatwould be required for RecA-requiring recombination events.For E. coli, the frequency of homologous recombination de-pends in part on the length of the homologous sequence (7, 18,

FIG. 4. Quantitative PCR of C. fetus DNA inversion. Reciprocal 10-fold dilutions (100 to 1027) of chromosomal DNAs from strains 23D (wild type, 97-kDa SLP),97-211 (97-kDa SLP, recA), and 97-209 (127-kDa SLP, recA) were amplified with sapApromF2 (forward-facing sap promoter primer) and either sapAR (reverse-facingsapA-specific primer) or sapA2R (reverse-facing sapA2-specific primer). The same samples also were amplified using primers recAF and enoR to control for DNAtemplate dilutions. The lanes indicate dilutions from 100 to 1027. For strain 23D, PCR products were observed at about 1 dilution further for primers sapApromF2and sapAR, consistent with the dominant expression of the 97-kDa sapA product. For strain 97-211, primers sapApromF and sapAR yielded products about 3 dilutionsfurther than did primers sapApromF2 and sapA2R, also consistent with its expression of a 97-kDa SLP. For strain 97-209, there was about a 4-log-unit difference butwith more dilutions for sapApromF2 and sapA2R, consistent with its expression of the 127-kDa sapA2 product.

5666 RAY ET AL. INFECT. IMMUN.

on Decem

ber 15, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

22, 33, 34, 40). Thus, our present studies of strain 23D (Fig. 4)provide analysis of spontaneous in vitro inversion frequency ina strain with wild-type rather than mutated sapA homologs.

Our results further indicate that sap inversion continues tooccur in the recA strains, but at a frequency also about 2 to 3log10 units lower than for the wild-type strain (Fig. 4). Thus,while RecA function is critical for high-frequency (1021 to1022) inversion, there is a residual recA-independent inversionmechanism that operates at lower frequency. In other bacteria,recA-independent (site-specific) inversion is well recognized(14, 21). That at least two independent pathways can lead toinversion of the sap invertible region is an indication of thefunctional significance of SLP antigenic variation for C. fetus.These results suggest that the ability to change SLP expressionis a critical in vivo function for C. fetus (36). Thus, the recoveryof strain 97-209 during the course of experimental ovine infec-tion (19) could reflect strong in vivo selection for the sponta-neous variant.

The residual recA-independent inversion mechanism couldreflect general (homologous) recombination using other path-ways, analogous to the recBCD and recEF pathways of E. coli(14, 21, 37), for example. Alternatively, the inversion couldreflect a site-specific mechanism involving a unique enzymaticactivity. Studies to examine these possibilities are under way.

ACKNOWLEDGMENTS

This work was supported by grants R01 Al 24145 and R29-Al43548from the National Institutes of Health, by the Medical Research Ser-vice of the Department of Veterans Affairs, and by the WellcomeTrust.

REFERENCES

1. Blaser, M. J. 1998. Campylobacter fetus:emerging infection and model systemfor bacterial pathogenesis at mucosal surfaces. Clin. Infect. Dis. 27:256–258.

2. Blaser, M. J., and E. C. Gotschlich. 1990. Surface array protein of Campy-lobacter fetus:cloning and gene structure. J. Biol. Chem. 265:14529–14535.

3. Blaser, M. J., and Z. Pei. 1993. Pathogenesis of Campylobacter fetus infec-tions. Critical role of high molecular weight S-layer proteins in virulence.J. Infect. Dis. 167:372–377.

4. Blaser, M. J., P. A. Smith, J. E. Repine, and K. A. Joiner. 1988. Pathogenesisof Campylobacter fetus infections. Failure to bind C3b explains serum andphagocytosis resistance. J. Clin. Invest. 81:1434–1444.

5. Blaser, M. J., P. F. Smith, and P. A. Kohler. 1985. Susceptibility of Campy-lobacter isolates to the bactericidal activity in human serum. J. Infect. Dis.151:227–235.

6. Borst, P., and D. R. Greaves. 1987. Programmed gene rearrangements al-tering gene expression. Science 235:658–667.

7. Deng, C., and M. R. Capecchi. 1992. Reexamination of gene targeting fre-quency as a function of the extent of homology between the targeting vectorand the target locus. Mol. Cell. Biol. 12:3365–3371.

8. Dworkin, J., and M. J. Blaser. 1997. Molecular mechanisms of Campy-lobacter fetus surface layer protein expression. Mol. Microbiol. 26:433–440.

9. Dworkin, J., and M. J. Blaser. 1997. Nested DNA inversion as a paradigm ofprogrammed gene rearrangement. Proc. Natl. Acad. Sci. USA 94:985–990.

10. Dworkin, J., and M. J. Blaser. 1996. Generation of Campylobacter fetusS-layer protein diversity utilizes a single promoter on an invertible DNAsegment. Mol. Microbiol. 19:1241–1253.

11. Dworkin, J., O. L. Shedd, and M. J. Blaser. 1997. Nested DNA inversion ofCampylobacter fetus S-layer genes is recA dependent. J. Bacteriol. 179:7523–7529.

12. Dworkin, J., M. K. R. Tummuru, and M. J. Blaser. 1995. The lipopolysac-charide-binding domain of the Campylobacter fetus S-layer protein resideswithin the conserved N terminus of a family of silent and divergent ho-mologs. J. Bacteriol. 177:1734–1741.

13. Dworkin, J., M. K. R. Tummuru, and M. J. Blaser. 1995. Segmental con-servation of sapA sequences in type B Campylobacter fetus cells. J. Biol.Chem. 270:15093–15101.

14. Dybvig, K. 1993. DNA rearrangements and phenotypic switching in pro-karyotes. Mol. Microbiol. 10:465–471.

15. Fogg, G. C., L. Yang, E. Wang, and M. J. Blaser. 1990. Surface-array proteinsof Campylobacter fetus block lectin-mediated binding to type A lipopolysac-charide. Infect. Immun. 89:464–469.

16. Fujimoto, S., A. Takade, K. Amako, and M. J. Blaser. 1991. Correlationbetween molecular size of surface-array protein and both morphology andantigenicity in the Campylobacter fetus S-layer. Infect. Immun. 59:2017–2022.

17. Fujita, M., T. Moriya, S. Fujimoto, N. Hara, and K. Amako. 1997. A deletionin the sapA homologue cluster is responsible for the loss of the S-layer inCampylobacter fetus strain TK. Arch. Microbiol. 167:196–201.

18. Fujitani, Y., and I. Kobayashi. 1999. Effect of DNA sequence divergence onhomologous recombination as analyzed by a random-walk model. Genetics153:1973–1988.

19. Grogono-Thomas, R., J. Dworkin, M. J. Blaser, and D. G. Newell. 2000. Therole of the surface-layer proteins of Campylobacter fetus subspecies fetus inovine abortion. Infect. Immun. 68:1687–1691.

20. Hatfull, G. F., and N. D. F. Grindly. 1988. Resolvases and DNA-invertases:a family of enzymes active in site-specific recombination, p. 358–396. In R.Kucherlapati and G. R. Smith (ed.), Genetic recombination. American So-ciety for Microbiology, Washington, D.C.

21. Henderson, I. R., P. Owen, and J. P. Nataro. 1999. Molecular switches—theON and OFF of bacterial phase variation. Mol. Microbiol. 33:919–932.

22. Jinks-Robertson, S., M. Michelitch, and S. Ramcharan. 1993. Substratelength requirements for efficient mitotic recombination in Saccharomycescerevisiae. Mol. Cell. Biol. 13:3937–3950.

23. Johnson, R. C., M. F. Bruist, and M. I. Simon. 1986. Host protein require-ments for in vitro site-specific DNA inversion. Cell 46:531–539.

24. Kirillov, M., I. L. Shumakov, E. V. Nechaeva, L. N. Siniashina, and G. I.Karataev. 1993. Nucleotide sequence and properties of an inverted repeatingelement of a Bordetella pertussis chromosome. Genetika 29:1267–1277.

25. Labigne-Roussel, A., P. Courcoux, and L. Tompkins. 1988. Gene disruptionand replacement as a feasible approach for mutagenesis of Campylobacterjejuni. J. Bacteriol. 170:1704–1708.

26. Mertens, G., A. Hoffman, H. Blocker, R. Frank, and R. Kahmann. 1984.Gin-mediated site-specific recombination in bacteriophage Mu DNA: over-production and inversion in vitro. EMBO J. 3:2415–2421.

27. Pei, Z., and M. J. Blaser. 1990. Pathogenesis of Campylobacter fetus infec-tions. Role of surface array proteins in virulence in a mouse model. J. Clin.Invest. 85:1036–1043.

28. Pei, Z., R. T. Ellison, R. V. Lewis, and M. J. Blaser. 1988. Purification andcharacterization of a family of high molecular weight surface-array proteinsfrom Campylobacter fetus. J. Biol. Chem. 263:6416–6420.

29. Robertson, B. D., and T. F. Meyer. 1992. Genetic variation in pathogenicbacteria. Trends Genet. 8:422–452.

30. Roca, A. I., and M. M. Cox. 1990. The RecA protein: structure and function.Crit. Rev. Biochem. Mol. Biol. 25:415–430.

31. Sadowski, P. 1986. Site-specific recombinases: changing partners and doingthe twist. J. Bacteriol. 165:341–347.

32. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed., p. 18.41–18.42. Cold Spring Harbor LaboratoryPress, Plainview, N.Y.

33. Shen, P., and H. V. Huang. 1986. Homologous recombination in Escherichiacoli: dependence on substrate length and homology. Genetics 112:441–457.

34. Singer, B. S., L. Gold, P. Gauss, and D. H. Doherty. 1982. Determination ofthe amount of homology required for recombination in bacteriophage TG4.Cell 31:25–33.

35. Thompson, S. A., O. L. Shedd, K. C. Ray, M. H. Beins, J. P. Jorgensen, andM. J. Blaser. 1998. Campylobacter fetus surface layer proteins are transportedby a type I secretion system. J. Bacteriol. 180:6450–6458.

36. Thompson, S. A., and M. J. Blaser. 2000. Pathogenesis of Campylobacterfetus infections, p. 321–347. In I. Nachamkin and M. J. Blaser (ed.), Campy-lobacter, 2nd ed. ASM Press, Washington, D.C.

37. van de Putte, P., and N. Goosen. 1992. DNA inversions in phages andbacteria. Trends Genet. 8:457–462.

38. Wang, E., M. M. Garcia, M. S. Blake, Z. Pei, and M. J. Blaser. 1993. Shiftin S-layer protein expression responsible for antigenic variation in Campy-lobacter fetus. J. Bacteriol. 175:4979–4984.

39. Wanner, B. L., M. R. Wilmes, and E. Hunter. 1988. Molecular cloning of thewild-type phoM operon in Escherichia coli K-12. J. Bacteriol. 170:279–288.

40. Watt, V. M., C. J. Ingles, M. S. Urdea, and W. J. Rutter. 1985. Homologyrequirements for recombination in Escherichia coli. Proc. Natl. Acad. Sci.USA 82:4768–4772.

41. Yang, L., Z. Pei, S. Fujimoto, and M. J. Blaser. 1992. Reattachment of sur-face array proteins to Campylobacter fetus cells. J. Bacteriol. 174:1258–1267.

Editor: W. A. Petri, Jr.

VOL. 68, 2000 C. FETUS sap INVERSION IN ABSENCE OF RecA FUNCTION 5667

on Decem

ber 15, 2020 by guesthttp://iai.asm

.org/D

ownloaded from