biomass magazine -july 2009

INSIDE: OREGON COMPANY TO MAKE ENERGY-DENSE BIOBUTANOL

July 2009

www.BiomassMagazine.com

Metagenomics, Microbes and Methyl Halides A Symbiotic Relationship Involving Yeast and a Bacterium Could be the Key to Flexibility in Biorefi ning

NOW YOU CAN CONVERT FORESTRY RESIDUALS INTO A LIQUID ASSET.

EnvergentTech.com

Finally, there’s a proven, practical technology that converts forestry residuals into pyrolysis oil for generating renewable power and process heat. It’s called Rapid Thermal Processing (RTP™), and it’s been used commercially in other industries since 1989. Today, it offers the forestry industry a more consistent, fl exible and environmentally friendly alternative to directly burning residuals. Visit our website for details. And stop sending valuable assets up in smoke.

WHEEL OF FORTUNE

Do you want to be

a frontrunner in the

cellulosic bioethanol

industry?Then it’s time

we start working

together.

Get the odds in your favorCellulosic bioethanol is key to optimizing the world’s future energy mix.

Novozymes is leading the way in marketing cellulosic ethanol a commercial

reality by 2010. And Novozymes’ Cellic™ products are just what you need

to be a leader in the race to cellulosic bioethanol. So let’s start creating the

future today. Together we can make cellulosic bioethanol a winning solution.

Find out more at www.bioenergy.novozymes.com

Novozymes is the world leader in bioinnovation. Together with customers across a broad array of industries we create tomorrow’s industrial biosolutions, improving our customers’ business and the use of our planet’s resources.

4 BIOMASS MAGAZINE 7|2009

7|2009 BIOMASS MAGAZINE 5

INSIDE JULY 2009 VOLUME 3 ISSUE 7

FEATURES. . . . . . . . . . . . . . . . . . . . .

26 WOODY BIOMASS Balancing Act Can the U.S. count on using woody biomass to produce renewable energy and biofuels and maintain forest lands at the same time? Increased costs and carbon emissions from fossil fuels have some producers turning to woody biomass to generate energy, while some environmentalists worry about the negative impacts of removing biomass from forests. By Lisa Gibson

32 INNOVATION Cutting-Edge Co-Culture University of California-San Francisco researchers believe the discovery of a symbiotic relationship between a cellulose-eating bacterium and brewer’s yeast could be the key to introducing fl exibility into the biorefi nery concept. By Anna Austin

38 BIOBUTANOL Biobutanol: Ethanol’s Energy-Dense Cousin An Oregon company is gearing up to convert biomass into biobutanol, which will be used as a renewable diesel blending agent. The company plans to build several standalone facilities in the Northwest U.S. that will use locally procured feedstocks.By Anna Austin

CONTRIBUTIONS. . . . . . . . . . . . . . . . . . . . .

44 EQUIPMENT Boralex Chips Away at Energy ChallengesA Maine-based company ensures its wood residue supply by contracting with area loggers and land-clearing companies, and helping its suppliers to purchase the equipment they need to keep biomass fl owing steadily. By Larry Trojak

48 FUEL Black Liquor Gasifi cation Can Help Sustain Forests, Generate Ultra-Clean BiofuelsA byproduct of the kraft pulp production process, black liquor could be an excellent gasifi cation feedstock for syngas production. By Richard LeBlanc

BIOBUTANOL | PAGE 38

DEPARTMENTS. . . . . . . . . . . . . . . . . . . . .

06 Editor’s NoteFuel for ThoughtBy Rona Johnson

07 Advertiser Index 09 CITIES Corner

Biomass Defi nition DebatedBy Tim Portz

11 Industry Events

12 Business Briefs

14 Industry News

53 EERC UpdateBiomass as a Medicine for RecoveryBy Bruce Folkedahl & Chris Zygarlicke

54 Marketplace


Fuel for Thought

iven adequate space, we could have produced a cat-alog-sized magazine full of articles about this month’s theme “Commercializing Biomass-Based Fuels: Cellu-losic Ethanol Renewable Diesel, Bio-Oil and More.” It was diffi cult to choose which of the many technologies

to cover but we opted for biobutanol and methyl halides because we haven’t done many stories on them.

What frustrates me in these stories is that although most of the technologies used to make second-generation biofuels work— the tricky part is commercialization. However, when I read an ar-ticle such as the column by the Energy & Environmental Research Center, which appears on page 53, and I am reassured that sec-ond-generation biofuels will happen, and perhaps sooner than we think. With all the attention and money currently directed at renew-able energy and biofuels, economically viable technologies should be on the horizon.

It’s hard to envision what life will be like when these new biomass-based fuels become avail-able, which brings me to a discussion I had with a person who was freaking out about the possibility of having to choose among several kinds of fuels. She was worried that customers would acciden-tally fi ll their gas tanks with the wrong fuel. I thought back to the days when we switched from leaded to unleaded gasoline. I was working at a convenience store at the time, and it wasn’t uncommon for people to try to fi ll their unleaded-fuel-only vehicles with leaded gasoline, though I believe, the pump nozzle for the leaded gas pump was larger than the tank opening on the unleaded vehicle.

I am not worried about using the wrong fuel. People make these types of decisions every day. We already choose ink for our printers from among several different types of ink, and although bat-teries come in all shapes and sizes, we manage to fi gure out which ones go where. I think it’s just knowing what kind of a vehicle we have and then learning which fuel is appropriate. It’s probably just a simple matter of the vehicle manufacturer attaching a sticker to the gas cap that indicates which kind of fuel we need. Or, if there is no gas cap, fi nding the plug-in.

What concerns me is that if we are closing the commercialization gap, issues such as getting the fuel to the consumer need to be addressed. In fact, in the latest issue of EERC’s publication “The Edge” there is an article titled “EERC Foundation receives patent application approval for on-demand hydrogen-fueling system.” Researchers and engineers at the EERC fi rmly endorse using hydrogen for transportation fuels and certainly want to make sure that when hydrogen’s time comes, it will be easily accessible to the driving public.

For those of you who don’t have enough to worry about already, this is some fuel for thought.

G

Rona JohnsonEditor

[email protected]

editor’sNOTE


advertiserINDEX

2009 Atlantic BioEnergy Conference 24

2010 International BIOMASS 56Conference & Expo

2010 International Fuel 8Ethanol Workshop & Expo

Agra Industries 18

Biodiesel Magazine 10

Christianson & Associates PLLP 36

Continental Biomass Industries 4

Duratech Industries International Inc. 47

Energy & Environmental Research Center 55

Eisenmann Corporation 30

Envergent Technologies 2

Ethanol-Jobs.com 25 & 51

Ethanol Producer Magazine 43

Factory Sales and Engineering inc. 28

Gas Technology Institute 52

GEA Barr Rosin inc. 31

Geomembrane Techologies Inc. 46

Harris Group Inc. 41

Hurst Boiler & Welding Co. Inc. 50

Indeck Power Equipment Co. 17

Laidig Systems Inc. 40

Larox Corp. 42

Novozymes 3

Pacifi c Ag Solutions 16

Percival Scientifi c Inc. 37

R.C. Costello & Assoc. Inc. 19

Roskamp Champion/CPM 29

The Teaford Co. Inc. 34

West Salem Machinery 35

EDITORIAL

EDITOR Rona Johnson [email protected]

ASSOCIATE EDITORSAnna Austin [email protected] Gibson [email protected]

COPY EDITOR Jan Tellmann [email protected]

E-MEDIA COORDINATORMegan Skauge [email protected]

ART

ART DIRECTOR Jaci Satterlund [email protected]

GRAPHIC DESIGNERSElizabeth Slavens [email protected] Melquist [email protected] Sitter [email protected]

PUBLISHING & SALES

PUBLISHER & CEO Mike Bryan [email protected]

VICE PRESIDENT OF MEDIA & EVENTS Joe Bryan [email protected]

VICE PRESIDENT OF CONTENT AND COMMUNICATIONSTom Bryan [email protected]

SALES DIRECTOR Matthew Spoor [email protected]

SALES MANAGER, MEDIA & EVENTSHoward Brockhouse [email protected]

ACCOUNT MANAGERSClay Moore [email protected] Hanson [email protected] Shereck [email protected] Steen [email protected] Brown [email protected]

ADVERTISING COORDINATOR Marla DeFoe [email protected]

SUBSCRIPTION MANAGER Jessica Beaudry [email protected]

SUBSCRIBER ACQUISITON MANAGER Jason Smith [email protected]

ADMINISTRATIVE ASSISTANT, SALES Christie Anderson [email protected]

Subscriptions Subscriptions to Bio-mass Magazine are $24.95 per year in the U.S; $39.95 in Canada and Mexico; and $49.95 outside North America. Subscriptions can be com-pleted online at www.BiomassMaga-zine.com or subscribe over the phone at (701) 746-8385.

Back Issues & Reprints Select back issues are available for $3.95 each, plus shipping. Article reprints are also available for a fee. For more informa-tion, contact us at (701) 746-8385 or [email protected].

Advertising Biomass Magazine pro-vides a specifi c topic delivered to a highly targeted audience. We are committed to editorial excellence and high-quality print production. To fi nd out more about Biomass Magazine advertising opportunities, please con-tact us at (701) 746-8385 or [email protected].

Letters to the Editor We welcome let-ters to the editor. Send to Biomass Magazine Letters to the Editor, 308 2nd Ave. N., Suite 304, Grand Forks, ND 58203 or e-mail to [email protected]. Please include your name, address and phone num-ber. Letters may be edited for clarity and/or space.

Cert no. SCS-COC-00648


CITIESc o r n e r

n May 21, the House Energy com-mittee passed the American Clean Energy and Security Act out of committee by a vote of 33-25. The

925-page draft addresses nearly all aspects of the future of our country’s energy picture including greenhouse gases, renewable energy generation and energy effi ciency measures. In section 610 in a segment titled “Federal Renewable Electricity Standard,” policymakers have defi ned eligible bio-mass streams for renewable electricity generation. The defi nition was the source of great debate.

Two biomass streams that attract consid-erable attention and argument are the biomass harvested from federal forests and municipal solid waste (MSW). The intensity of the debate makes sense as these represent some of the larg-est sources of potential biomass. There are more than 190 million acres of federal forest, and the U.S. generated more than 250 million tons of MSW in 2006.

Federal forests have long been protected with good reason, but a recent proliferation of pine beetles has changed the landscape of that debate and millions of acres of national forests have been turned into giant tinder boxes. Ac-cording to an article in the Colorado Independent, Colorado alone has more than 2 million acres of forest that have been decimated by the pine beetle and towns such as Vail and Frisco are looking to their now grey hills as a potential source of re-newable power. Clearly, the British thermal units (Btus) from these infested trees will be released

at some point. The question is, will those Btus be captured or will they be released during potentially devastating forest fi res? In a nod to this eventu-ality, the committee amended the bill to allow biomass re-sources from national forests “that are removed to reduce hazardous fuels, to reduce or contain disease or insect infes-tation, or to restore ecosystem health” to qualify.

It is less clear where the committee stands on MSW. While MSW is excluded from offi cial biomass classifi cation with the phrase “but not municipal solid waste,” there is language earlier in the bill that suggests that advanced technologies to produce energy from MSW would be allowed under a “Qualifi ed Waste to Energy” provision. The language in this section aims to steer the in-dustry away from straight incineration and favors gasifi cation or pyrolysis.

Either of these streams could fi nd them-selves outside of the defi nition of biomass once again, but the biomass portions of HR 2454 ap-pear to be the product of thoroughly argued poli-cymaking.

Tim Portz is a business developer with BBI In-ternational’s Community Initiative to Improve Energy Sustainability. Reach him at [email protected] or (651) 398-9154.

OBiomass Defi nition Debated

Tim Portzbusiness developer, BBI International

industry eventsBioPower Generation USA

July 8-9, 2009Hyatt Regency McCormick PlaceChicagoThis event offers an integrated solution of brand positioning, business de-velopment and networking opportunities. Sessions will cover the potential for large-scale biopower generation, policy and legislation, fi nance and investment, wood-based biomass production, alternative biomass feed-stocks, biopower supply chains, conversion technologies and improving plant effi ciencies.+44 (0)207 099 0600www2.greenpowerconferences.co.uk/v8-12/Prospectus/Index.php?sEventCode=BG0906US

Biomass ‘09 : Power, Fuels and Chemicals Workshop

July 14-15, 2009Alerus CenterGrand Forks, North DakotaAttendees of the workshop will hear presentations on new technology developments, discover opportunities for economic production of power, transportation fuels and chemical feedstocks, develop economic opportu-nities and learn how to become part of this growing industry. More than 300 participants from 175 organizations are expected to attend. Discussion topics will include trends and opportunities in utilizing biomass; biomass feedstocks and agriculture; second- and third-generation renewable fuels; and biomass for heat and electricity. (701) 777-5000 www.undeerc.org/biomass09

2009 Farm to Fuel Summit

July 29-31 Rosen Shingle CreekOrlandoThe summit is a gathering place for stakeholders to advance the develop-ment of Florida’s bioenergy and promote the production, distribution and use of renewable fuels. This year, international, national and local speak-ers will discuss issues of research, production and distribution of biofuels and bioenergy, and the role of agriculture and forestry in a reduced carbon economy.(850) 488-0646 www.fl oridafarmtofuel.com/summit_2009.htm

International Conference on Woody Biomass Utilization

August 4-5, 2009Mississippi State UniversityStarkville, MississippiThis conference will feature information on the utilization of woody biomass and emerging technologies and processes that can boost the economy through the creation of jobs and markets. The conference will focus on worldwide successes, challenges in local and world markets and environ-mental benefi ts. The slate of international speakers, including researchers, material and equipment suppliers, manufacturers, and end-users, will dis-cuss woody biomass utilization.(608) 231-1361 www.forestprod.org/confbiomass09.html

Midwest Algae Commercialization Workshop

August 18, 2009Fredrikson & Byron P.A.MinneapolisWorkshop attendees will learn about commercial opportunities related to algae, and network with others in the industry. Speakers will include pro-ducers, scientists, investors, potential customers and policymakers. Dis-cussions will focus on the issues surrounding the commercial viability of algae production in the Midwest, current government and private initiatives, evolving technologies, processing concepts, life-cycle analysis and ven-ture and project fi nance trends. Opportunities to learn about the intellectual property issues of algae production, application and commercialization will be offered.(612) 492-7864 [email protected]

Atlantic BIOenergy Conference

September 21-23, 2009 Delta BeausejourMoncton, New BrunswickThe Atlantic BIOenergy Conference, hosted by BBI Biofuels Canada, will focus on growth and sustainability and renewable energy opportunities in Atlantic Canada. Dynamic sessions and discussions on biomass-based en-ergy generation, anaerobic digestion, waste management technologies and government incentives will be offered. Expect lively debates, action-orient-ed discussions and world-class presentations on the latest developments, applications and technologies in the bioenergy fi elds. (888) 501-0224 (North America) (519) 576-4500 (International) www.atlanticbioenergy.ca

BTLtec: Biomass to Liquids

September 24-25, 2009Graz, AustriaThe fourth annual BTLtec will feature a panel of experts to share the latest biomass-to-liquids technology developments, project updates, government policies and feedstock issues, and will explore the latest thermochemical pathways for converting waste streams to liquids. Attendees will be able to network with biofuel project operators and developers, biorefi nery execu-tives, gasifi cation technology developers, biodiesel executives and feed-stock developers from around the world. +65 63469145 www.cmtevents.com/aboutevent.aspx?ev=090939&

Biomass & WtE: Waste to Energy

October 28-29, 2009Shanghai, ChinaBiomass & WtE attendees will have the opportunity to network with bio-mass, biodiesel, ethanol and cellulosic ethanol producers; local, municipal and provincial government representatives; enzyme and catalyst providers; and other industry experts. The conference will focus on emerging technol-ogies, upcoming projects around the world and feedstock issues. Program highlights will include power generation from agricultural biomass, energy recovery from municipal solid waste and biotechnologies converting bio-mass to fuels and chemicals.+65 63469145 www.cmtevents.com/aboutevent.aspx?ev=091035&



business BRIEFS

Renewable energy provider opens US headquarters

MWM of America Inc., formerly known as Deutz Power Systems, announced its expansion and commitment in the U.S. market with the opening of its new U.S. headquarters in Atlanta, Ga. The company provides renewable energy solutions for a va-riety of industries through the development of highly effi cient, environmentally friendly industrial engines. These engines con-vert both natural gas and biogas into electricity, which is sold to the power grid to assist utilities in providing reliable energy to homes and workplaces. “The excitement about using a renew-able energy to better our environment is at an all-time high, but we’ve been doing it since before it was cool,” said MWM CEO Ron Ford. BIO

OriginOil partners with Desmet BallestraAlgal oil extraction company OriginOil Inc. has partnered

with Belgium-based oil and fats technology developer Desmet Ballestra to create a more cost-effi cient algae oil extraction sys-tem. OriginOil CEO and President Riggs Eckelberry announced the partnership at the National Algae Association’s fi fth quarter-ly meeting, where he discussed potential gains from OriginOil’s technology breakthrough. His presentation is on the company’s Web site at www.OriginOil.com. Eckelberry said that like most algae oil extraction systems on the market, the Desmet systems are quite expensive, but in early studies when implemented with OriginOil’s system, the companies estimated that energy effi -ciency gains may reach 90 percent in certain confi gurations. BIO

Sanimax launches new Web siteSanimax launched a completely revised and updated Web

site featuring a new look, more in-depth content and user-friend-ly structure. It also incorporates Sanimax’s recent rebranding as North America’s leading bio-return company.

Visitors to www.sanimax.com will fi nd more extensive in-formation on Sanimax’s offerings, which range from collection and maintenance services for the food industry to agriculture and animal nutrition products, hides and leathers, and renewable fuels made from biobased feedstocks. Content has been rewritten and reorganized to focus on the customer. The site now includes full listings for hundreds of products, as well as a facility locator pow-ered by cutting-edge Google technology that pinpoints Sanimax’s 24 locations using maps and satellite photos. BIO

Laidig hosts open house in MishawakaApproximately 250 people toured the manufacturing fa-

cilities of Laidig Systems Inc. in Mishawaka, Ind., during an open house May 4-6. The focus of the event was a new blast-cleaning and powder-coat painting system for large steel com-ponents. As one of the largest such systems in the U.S., it is designed for components up to 80 feet in length. During the dedication ceremony held at the plant in May, the company’s founder, Jon Laidig, presented the company with a painting de-picting four generations of the Laidig family—Jon; Jon’s son, Wyn, who is now company president; Wyn’s son, Daniel, who joined the company three years ago and works as an engineer; and Daniel’s young son, Gabriel. “The portrait illustrates the continuity of the company and our dedication to remain in business strongly for many years to come,” said Senior Vice President Roger Laidig. BIO

Wanzek jumps 168 points on Top 400 Contractors list

For the second year, Wanzek Construction Inc. has held a position on Engineering News-Record magazine’s list of the Top 400 Contractors in the U.S. The list ranks the 400 largest gen-eral contractors according to the previous year’s revenue. In 2008, Wanzek appeared on the list for the fi rst time, holding position No. 345. This year, the company took a 168 point jump into posi-tion No. 177, after doubling revenues to more than $400 million. In 2008, Wanzek’s national portfolio of heavy/civil and industrial construction projects included, most notably, the installation of approximately 1,000 megawatts of wind energy generation capac-ity. Wanzek, a MasTec company, specializes in heavy and industrial projects for the market sectors of power, renewable energy, indus-trial process, heavy/civil and wind energy construction. For more information, visit www.Wanzek.com. BIO

Mascoma executive presented prestigious award Mascoma Corp. announced that Michael Ladisch, chief

technology offi cer, was presented with the Charles D. Scott Award on May 6 at the 31st Symposium on Biotechnology for Fuels and Chemicals in San Francisco. The award is administered by the Society for Industrial Microbiology and recognizes contributions to the biotechnol-ogy fuels and chemicals fi eld as a whole, particularly innovation in fundamental and applied biotechnology, insight into biopro-cessing fundamentals, or commitment to facilitate commercialization of products

from renewable resources. In addition to his role at Mascoma, Ladisch is director of the Laboratory of Renewable Resources Engineering and distinguished professor of agricultural and biological engineering with a joint appointment in biomedical engineering at Purdue University and courtesy appointment in food science. BIO

Ladisch


business BRIEFS

Fredrikson & Byron expand energy groupFredrikson & Byron announced the expansion of the fi rm’s

energy group with the addition of two attorneys, Todd Guer-rero and Alan Mitchell, who are particularly ex-perienced in regulatory matters involving trans-mission and generation. Guerrero and Mitchell will broaden the group’s existing capabilities to help clients build the next generation of ener-gy infrastructure. Guer-

rero acts as lead state outside regulatory counsel to fi ve regional utilities on the Big Stone II project, a 500 MW, $1.6 billion su-percritical pulverized coal plant and associated transmission lines. He is actively involved in the renewable fuels industry, advising clients on corporate, regulatory and related matters. Mitchell is lead outside counsel to Minnesota Transmission Owners, an or-ganization of utilities with generating facilities and transmission lines in Minnesota. He has extensive experience in environmen-tal and energy-related matters. For more than 25 years, Alan was an assistant attorney general representing the Minnesota Pollu-tion Control Agency and the Minnesota Environmental Quality Board in various matters involving rulemaking, permitting, and enforcement. BIO

Advanta, Arcadia to develop salt-tolerant sorghumAdvanta, the world’s largest sorghum seed research and

marketing company, has reached a research and commercial development agreement with Arcadia BioSciences for the de-velopment of salt-tolerant sorghum. Under terms of the agree-ment, Advanta receives exclusive global rights to Arcadia’s salt-tolerance technology, which builds on the agreement the two companies struck in January for the development of nitrogen use effi cient sorghum. Arcadia’s salt-tolerance technology al-lows plants to produce normal yields and grain quality under salty water and soil conditions. This expands the range of lands available for crop production and reduces requirements for fresh water. The expected result will be high-yielding crops with a lower impact on the environment and an ability to grow on land currently not suitable for productive farming. BIO

PerkinElmer appoints Friel board chairmanPerkinElmer Inc. announced that its board of directors

has appointed the company’s President and CEO, Robert Friel, to the additional role of chairman of the board. The announcement comes in conjunction with the company’s an-nual shareholders meeting held in April. Friel’s appointment is part of PerkinElmer’s 2007 leadership succession plan de-signed to support the company’s growth strategy and provide strong leadership continuity. Friel succeeds Gregory Summe, chairman since 1999, who didn’t stand for re-election. Friel joined PerkinElmer in 1999 as chief fi nancial offi cer and was appointed vice chairman and president of the company’s Life and Analytical Sciences business in 2006. In 2007, he was ap-pointed president and chief operating offi cer. He succeeded Summe as CEO in 2008. BIO Guerrero

PEA to supply pellets to power company Perth, Australia-based biomass pellet producer Plantation

Energy Australia reported it has struck a $70 million, three-year agreement with a Belgium-based power company to sup-ply densifi ed biomass fuel pellets for electricity generation. PEA said the deal with Electrabel NV is the fi rst of its kind in Australia. The pellets, made from noncommercial plantation forest residues, will be shipped initially from Albany, Australia, where PEA has a pellet manufacturing facility. The company said it plans to increase its fuel pellet output to 1.65 million tons of pellets by 2012. BIO

Codexis announces appointments Codexis Inc. announced the appointment of David Anton,

Ph.D. as senior vice president, research and development, with responsibility for research and development activities for both the company’s bio-industrials and pharmaceuticals businesses. Anton was previously vice president, research and development for Codexis bio-industrials. He joined Codexis in 2008 after a 25-year career at DuPont. The company also announced that John Grate, Ph.D., previously senior vice president, technology and innovation, and chief technology offi cer, has assumed the newly created position of senior vice president, science and innovation and chief science offi cer. BIO

Mitchell

Higman joins Ze-gen Scientifi c Advisory BoardZe-gen Inc. welcomed Christopher Higman to the com-

pany’s Scientifi c Advisory Board. The board focuses on over-seeing and driving the technical development of Ze-gen’s ad-vanced gasifi cation technology and offers scientifi c guidance on the company’s technical direction. Higman’s fi rst contact with gasifi cation was commissioning a producer gas plant in South Africa in 1968. He joined Lurgi in 1975, where he spent the next 27 years mostly involved with gasifi cation and related tech-nologies. Before taking up a corporate management position at Lurgi in 1997, he was head of gas technology. He is currently an independent consultant specializing in gasifi cation and related technologies. BIO


industry NEWS

Dynamotive, BlueLeaf release biochar test results Canadian companies, Dynamotive Energy Systems Corp., a

Vancouver, British Columbia-based biomass-to-fuel company, and BlueLeaf Inc., a private, applied environmental research company, have released the results of a year-long test applying Dynamotive’s CQuest Biochar in commercial farming test plots. The tests revealed an overall increase in crop yield from 6 percent to 17 percent in plots where biochar was applied versus the control plots

The fi eld trial using Dynamotive’s biochar, which is produced through fast pyrolysis of hardwood waste material, was performed as a preliminary evaluation of the use of biochar in commercial farming operations in Canada, as well as in relation to local climate and soil conditions. The test plots were located on a farm in eastern Quebec.

Objectives of the experiment included determining the infl u-ence of biochar on certain basic physicochemical and biological soil and plant parameters, the ability of biochar to retain certain nutri-ents and moisture in the soil, the infl uence of biochar on soil mi-crobial communities and crop and biomass yields, the infl uence of biochar on greenhouse gas emissions from the soil, and to evaluate a method to handle and apply biochar to the soil.

According to the report, the biochar was packed at the Dyna-motive production facility in 45-gallon (200-liter) steel drums, each containing approximately 121 pounds (55 kilograms) of product, and shipped by truck to the farm trial site. The product used in the trial was produced in 2007 and kept in storage by the producer until shipment to the trial site in 2008.

The targeted application rate for the biochar was 2.5 tons per acre. A signifi cant concern during the spreading of this material was loss due to biochar’s fi ne particle size, according to the report. Al-though some biochar was lost at various stages of handling, losses

while it was being spread on the fi elds were the highest. Although wind velocity was low at the time of spreading, loss rates were visually estimated to be signifi cant, totaling approximately 30 per-cent. Assuming this rate of loss, the actual application of biochar for this trial would be 1.75 tons per acre. “It appears therefore es-sential from this experience to fi nd methods to reduce such losses,” the report said.

Crop and plant yields were measured using three different methods, including plant density at harvest, individual plant analy-sis and yield at harvest using harvester machine calculations. In certain planting methods, plant density increased up to 41 percent. The overall average was a 24 percent plant density increase with biochar use.

Test results are available at http://dynamotive.com.c9.previewyoursite.com/wp-content/themes/dynamotive/pdf/BlueLeaf_Biochar_Field_Trial_2008.pdf.

In the U.S., Dynamotive is supporting several different research efforts including a study by the USDA Agricultural Research Service to quantify the effects of amending soils with CQuest Biochar on crop productivity, soil quality, carbon sequestration and water qual-ity. Initial fi ndings from that study are expected to be available later this year.

The company recently reported that it had secured a supply of 220,000 tons per year of sawdust from Southeast timber producer Springhill Land and Timber for a proposed bio-oil plant in southern Arkansas (for more information see “Dynamotive secures feedstock supply for planned bio-oil plant” at http://www.biomassmagazine.com/article.jsp?article_id=2642).

—Anna Austin

These photos, left to right, show a fi eld before and after Biochar has been applied, a spreader being fi lled with Biochar and Biochar being incorporated into the soil.

PH

OTO

S: B

LUE

LEA

F IN

C.


Rentech to build renewable diesel, green power plant Rentech Inc. recently unveiled plans to build a plant in Rialto,

Calif., for the production of synthetic fuels such as renewable diesel and electric power from waste biomass feedstocks.

Rentech CEO and President Hunt Ramsbottom gave an over-view of the project during a conference call in mid-May, and pro-vided details of what has been accomplished to date as well as a timeline of progress for the future.

“The Rialto project is a result of the integration of Rentech’s process with a biomass gasifi cation technology provided by Silva-Gas Corp.,” Ramsbottom said. “Silva’s process works best with the types of urban waste feedstocks that we plan to use.” Rentech has secured a long-term licensing agreement with SilvaGas for the Ri-alto project, and a commitment for additional licenses for other potential waste-to-energy projects.

“The key to this integration—this is a very important point—is that we have developed the conditioning and clean-up technologies that are required to integrate biomass gasifi cation with synthetic fuels technology,” Ramsbottom said. “This has been a signifi cant barrier to entry into the renewable synthetic fuels market.”

Since biomass gasifi cation technologies are not widely avail-able on a commercial scale, as a fi rst step in developing the project Rentech compiled a list of potential gasifi cation technologies to examine which ones could meet the company’s syngas require-ments, according to Ramsbottom. “Over the past two years, our technological and engineering professionals have evaluated these technologies and determined that only a few gasifi cation processes have the potential to produce high-quality syngas from a range of biomass feedstocks,” he said. “Although the syngas levels they pro-duce can be useful for power or heating applications, it still requires

enhancements to achieve levels acceptable for production of high-quality synthetic fuels. The required technologies to enhance syngas levels are not commercially available.”

This prompted Rentech to spend several months developing its own syngas conditioning and clean-up technologies, which are currently patent-pending, Ramsbottom said.

The Rialto Renewable Energy Center will use urban woody green waste and processed sewage sludge to produce about 25,000 gallons of synthetic fuels per day and export approximately 35 megawatts of electricity, enough to power roughly 30,000 homes in the region.

Rentech has obtained an exclusive option for a site adjacent to the city wastewater treatment plant and EnerTech’s Rialto Regional Biosolids Processing Facility, which will provide treated sewage sludge and biosolids under a long-term supply agreement.

Ramsbottom said due to renewable diesel’s near-zero carbon content, he believes the fuel will be in demand as California looks to meet carbon reduction requirements. He expects Rentech to sell its power under California’s Renewable Portfolio Standard, which requires utilities to increase electricity produced from renewable sources by at least 1 percent per year to 20 percent by 2010.

Ramsbottom said, the company will continue development ac-tivities and complete front-end engineering and design this year, and will pursue major permits in 2010. “In 2011, we will complete detailed engineering, procure equipment and begin construction. In 2012, we will complete construction, commence commissioning and start up,” he said.

—Anna Austin

Gas

ifica

tion

CO2 capture ready

RentechProcess

Jet Fuels

Chemicalsand Waxes

Upgrading

MunicipalWaste

Biomass

Pet Coke

Coal

Rentech-UOP Alliance

Diesel Fuels

RentechSyngas

Conditioningfor Biomass

Hydrocarbons

Multiple Inputs

Multiple Outputs

23 U.S. Patents Issued; 24 U.S. Patents Pending12 Foreign Patents Issued; 30 Foreign Patents Pending

The Rentech Process

industry NEWS


industry NEWS

The Canadian government recently an-nounced it would provide a federal repayable contribution of up to $1.6 million for a $6 million waste-to-energy project in Ontario.

The funds will be distributed through the Agri-Opportunities Program, a $134 million initiative launched in January 2007 and designed to increase market opportuni-ties for the Canadian agriculture industry.

Seacliff Energy Inc. will use the $1.6 million to construct an anaerobic digestion facility which will transform vegetable/food waste from local greenhouses and food pro-cessing plants, as well as cattle and swine ma-nure from local farms, into power that will be sold to the Ontario power grid or used to heat a nearby greenhouses. The digestate will be sold as a natural fertilizer.

In the beginning of 2007, Ontario put

into place its Standard Offer Program, a feed-in tariff that incentivizes the adoption of renewable energy. Regional or national electric utilities are obligated to buy renew-able electricity at above market rates, which are set by the government, to help overcome any cost disadvantages of using renewable energy sources.

Unlike most digester systems current-ly in use in Canada, the project involves a two-stage system that will hold up to 40,000 metric tons of waste. Two-stage digestion systems are complex and typically more expensive than single-stage or continuous batch, but offer considerable advantages such as having more control of the reactions occurring within the system.

A feedstock mix of more than 50 dif-ferent types of materials, including cucum-

bers, corn silage, and cattle and swine ma-nure will be used at Seacliff Energy. The company plans to collect materials from lo-cal food processing plants, fi ve of which are located within 50 kilometers (30 miles) of the facility’s location.

The facility is expected to become op-erational in the fall.

In addition to Seacliff Energy, the Agri-Opportunities Program is providing fi nancial support for an anaerobic digestion project in Ontario. Powerbase Energy Sys-tems Inc., of Carleton Place, Ontario, will receive $480,500 in repayable funding for the development of a facility to manufac-ture anaerobic digestion systems that pro-cess agricultural waste into electrical energy.

—Anna Austin

Canada contributes to anaerobic digestion project


industry NEWS

RISI and BTEC form informational partnershipA new partnership between RISI and

the Biomass Thermal Energy Council will allow BTEC members to contribute to RISI’s Wood Biomass Market Report, a comprehensive source of market informa-tion and wood biomass feedstock pricing in North America.

BTEC, which focuses on advancing the use of biomass for heat and other thermal energy applications, will form an advisory group of its members to help RISI, an infor-mation provider for the global forest prod-ucts industry, determine what kind of issues should be addressed in the report. “We’re not looking to assert any sort of change [in the biomass industry],” said William Perritt, executive editor of the publication. “The purpose of the group is simply to help us

understand what the information needs are in the wood pellet and wood energy sectors. We’re asking this group to tell us what they need; what they’re looking for.”

BTEC’s inclusive membership base was an attractive element for the partnership, as it consists of both wood pellet and wood en-ergy producers, Perritt said. “Inclusiveness is the key thing,” he added. “And they’re in a very positive growth mode right now.”

BTEC members will also get a discount on the publication, which features monthly updates on North America and interna-tional biomass business development and capital investment, government incentives, regulations and policies, feedstock avail-ability and sustainability, along with other factors affecting markets. “We see this as a

good avenue to give responsiveness to the industry,” he said of the partnership. “The more input the better.”

Discussions on pricing and market trends are strictly banned in the group, Per-ritt said, as it violates antitrust laws.

“The partnership may grow in the future, but right now it’s largely centered around this report and what BTEC can contribute to it,” said Kyle Gibeault, BTEC program coordinator. The report grew from another RISI publication, the International Woodfi ber Report, after the company saw an increase in wood biomass interest, Per-ritt said. To subscribe to the Wood Biomass Market Report, visit www.risiinfo.com/woodbiomass.

—Lisa Gibson


industry NEWS

Microbes may be a big player in devel-oping renewable fuels from cellulosic mate-rials, and experiments are being conducted into how they can be used to convert sugars to ethanol and mixed-generation fuels. The topic was discussed at the recent meeting of the American Society for Microbiology.

Manufacturing ethanol from corn com-petes with food crops and has been accused of being responsible for rising food prices, according to the ASM. “The value of us-ing nonfood crops is it will mitigate the sig-nifi cant food-versus-fuel debate,” said Tim Donohue, professor of bacteriology at the University of Wisconsin-Madison, and di-rector of the U.S. DOE’s Great Lakes Bio-energy Research Center.

Researchers are looking at alternative biomass as feedstocks for microorganisms to ferment into ethanol, Donohue said. The most attractive is lignocellulosic biomass—wood residues, municipal paper waste, en-ergy crops, or nonedible parts of corn such as cobs, stalks and stover.

“The same microbial activities used to generate ethanol from starch today can be used to generate ethanol and next-genera-tion fuels from cellulosic feedstocks in the future,” Donohue said.

The challenge is unlocking the sugars from the cellulosic biomass. Martin Keller, DOE Bioenergy Research Center director, and his team at Oak Ridge National Lab-oratory use an adapted method of high-throughput screening to rapidly test pop-lar tree samples for their ability to give up sugars. Some are more likely to release their sugars than others, which Keller says could be because of genetics, environmental fac-tors, or a combination of both. The team is growing poplar saplings in controlled environments to learn more, he said. They chose poplars because they grow quickly and in many different areas, Keller said, add-

ing that his team also is experimenting with switchgrass.

Breaking down cellulosic biomass is an expensive process, but once that is overcome, several companies are ready to move forward with production, according to ASM.

Keller’s team is also studying Anaero-cellum, a bacterium found in a hot spring in Yellowstone. The bacterium grows at 80 degrees Celsius (176 degrees Fahrenheit) and can not only break down the cellulosic biomass to sugars, but it can also ferment it into acetate and ethanol, according to ASM. “This is called consolidated bioprocessing,” Keller said. “This is only one strain that can do this, but none of the strains we have so far is perfect. You still need to optimize the strain. For instance, our strain is producing more acetate than ethanol.”

Besides ethanol and biodiesel, research-ers are also looking at producing hydrogen from renewable resources. Donohue and his lab are working with purple bacteria called Rhodobacter sphaerides that use pho-tosynthesis to produce hydrogen. The hy-drogen can then be converted to electricity using fuel cells the lab is developing. “On a laboratory scale, we can use sunlight and re-newable waste to generate electricity in mi-crobial reactors,” Donohue said. Patents are pending, and he said the team does not have industrial-scale capacity for the project.

The most exciting part of current stud-ies at the DOE energy research centers is the wide variety of disciplines represented by the researchers, Keller said, from molecu-lar experts to chemists and engineers. “This has never existed before, bringing everyone together to target the problems we want to solve,” he said “This will explode even more in the next couple years,” he said.

—Lisa Gibson

Research: Microbes are an option for ethanol, other biofuels


industry NEWS

BC biomass plant would use trees killed by pine beetles

A proposed biomass power plant near Hanceville, British Columbia, will run on trees killed by mountain pine beetles, if the plan is selected as a project for Phase II of BC Hydro’s Bioenergy Call for Power.

Plans for the $260 million 60-megawatt plant in the Cariboo Chilcotin were devel-oped through a partnership between West-ern Biomass Power Corp. and Tsilhqot’in National Government. It is one of many proposals vying for a place in the Bioen-ergy Call for Power, a program to provide British Columbia with clean energy and di-versify rural economies. Phase II includes a two-stream process, the fi rst targeting larger-scale biomass projects and the sec-ond focusing on smaller-scale, community-level biomass energy solutions, according to BC Hydro. Phase I, conducted in 2008, included projects that were immediately viable and resulted in four electricity pur-chase agreements that were fi led with the British Columbia Utilities Commission in February. The program will help the prov-ince reach its goal of becoming electrically self-suffi cient by 2016.

The region has experienced a moun-tain pine beetle infestation and local busi-nessmen responded by establishing West-ern Biomass to utilize the dead wood. Piles of dead wood left behind by forest licens-ees are burned under current practices, re-leasing particulates into the air. “There are literally mountains of these trees,” said Jeff Paquin, manager of business development for the company. “We’re addressing that by using waste wood to create energy. The ob-jective from day one was to do something useful with this otherwise useless wood.” The company was turned over to Run of River Power Inc. in August 2007.

Costs of building the plant and annual operation (estimated at about $55 million) may be less than expected, as service pro-

vider costs are coming down, Paquin said. The facility would create about 167 full-time jobs and another 89 permanent jobs in areas including harvesting, transporting and planning, he said. The plant will work with local traditional saw log licensees to procure the biomass, thereby improving the economics of the industry, he said.

Paquin said the project has several en-vironmental, social and economic benefi ts. It’s an opportunity to create employment in an area that has a high unemployment rate and to attract capital to the region. It also would help drive pride, leadership and self-determination in young First Na-tions people as the region strives for inde-pendence from government funding and toward self-suffi ciency. Environmentally, the project helps clear the dead trees that would otherwise cause problems with soil erosion, habitat and the growth of other plants.

Proposals for both streams of the Bioenergy Call for Power, which must meet certain standards, are to be turned into BC Hydro by fall. The company says it will make its selections early next year. The goal of the larger-scale projects is to acquire 1,000 gigawatt hours of energy, ac-cording to the company. It will also choose at least two community-based projects.

The project proposal is supported by groups such as the Cariboo Regional Dis-trict, the Williams Lake & District Cham-ber of Commerce, First Nations people and the Hanceville City Council.

An in-depth study showed the cur-rent supply of roadside residual and dead trees will last for 25 years, after which Western Biomass will harvest its own crop of trees, to beplanted in about seven years, Paquin said.

—Lisa Gibson


Agrosil Energy to grow commercial-scale miscanthus

Colorado-based Agrosil Energy LLC has begun large-scale growing operations of Miscanthus x giganteus for use in produc-ing heat and power, or liquid biofuels. The energy crop has been used for years in the U.K. and Europe, and Agrosil is in the lead position for commercial production in the U.S., according to Tom Harrington, Agrosil vice president of energy crops.

Harrington has been involved with miscanthus for several years, and Agrosil’s process has been approaching commercializa-tion for about two years, he said. Growing miscanthus involves propagating rhizomes on a smaller scale and transplanting them to large commercial acreage. Because the sterile hybrid produces no seeds, it is grown by planting rhizomes or transplant plugs that have been vegetatively produced.

Farmers in Missouri, Kentucky, Illinois and Kansas, who have production contracts with Agrosil, will receive plants and special-ized equipment to plant a total of 20,000 acres in 2010, he said. Land for planting was chosen based on agronomic data developed in Europe, at the University of Illinois and other universities.

Custom harvesting crews and machines will harvest the cane and then transport it to a central facility for upgrading according to customer requirements, which could include turning it into pellets, condensed bales or cubes. “We can put it in whatever feedstock format conversion facilities require,” Harrington said.

He expected the crops to yield about 15 tons per acre, with the fi rst harvest in the spring of 2012. Long-term contracts for fuel delivery will begin in 2013.

Miscanthus lowers carbon dioxide by sequestering carbon in the rhizomes and by reducing combustion emissions.

—Lisa Gibson

industry NEWS

Miscanthus is grown by planting rhizomes or transplant plugs that have been vegetatively produced.

Miscanthus for biofuels sprouts in Kentucky

Kentucky saw its fi rst biofuel miscanthus planting last week, a 300-acre fi eld in a nursery that will yield rhizomes for 6,000 acres next year.

Midwestern Biofuels is looking for farmers in a 50-mile radius of South Shore, Ky.,—into Ohio and West Virginia—to grow the crop, which the company will pelletize and sell to biofuel produc-ers. Miscanthus can be planted using the same equipment that’s used for tobacco farming, an industry that has shrunk in Kentucky, according to Jeff Lowe, president and co-owner of Midwestern Biofuels. “Who better to plant it than the tobacco farmer?” he said. “They can use whatever equipment they already have and bring [the miscanthus] to our facility.”

Lowe and co-owner Brandon Minix expected the fi rst batch of the waterproof pellets to be ready in June. The project has been funded privately, but discussions with other potential investors are in the works, Lowe said. Midwestern Biofuels was established about nine months ago.

The company will begin producing about 3,000 pellets per month, Lowe said, working up to 6,000 per month by 2010 and exceeding 10,000 by the end of 2010. “It’ll probably be one of the largest biomass producers in the country,” he said. By 2011, the company plans to be operating on 40,000 acres, he added. Mid-western Biofuels will pay the farmers an established rate per acre and buy their yields.

The company also will experiment with growing switchgrass, black locus and willow trees for biomass. Crops were planted on land previously mined for coal, beginning the last week in May, Lowe said. “We’re moving pretty fast.”

Lowe worked in the coal industry for more than 20 years and wanted to develop biomass that can be burned with coal without having to retrofi t producers’ facilities, he said. “When I saw what biomas will mean for the future, I wanted it to be handled like coal,” he said. “It’s been enjoyable coming to the green side.”

Researchers from the University of Kentucky have been in-strumental in the process, Lowe said. At full operation, the project will generate about 200 to 300 jobs, including farmers, truckers and plant operators, he said.

Miscanthus is harvested every year in January, allowing for a freeze. It grows in poor soil, requires almost no fertilizer and is vi-able for at least 20 years. Biofuel from miscanthus has a heat yield of 8,000 Britsh thermal units per pound.

—Lisa Gibson


industry NEWS

Liquid fuels from biomass and coal could reduce petroleum use and carbon dioxide emissions in the U.S. over the next 25 years, ac-cording to a recently released report, but producing the alternative fuels in an environmentally conscious way requires signifi cant re-search, development and commercial demonstration.

“Liquid Transportation Fuels from Coal and Biomass: Techno-logical Status, Costs and Environmental Impacts” looks at reducing the nation’s dependence on foreign oil by transitioning to coal and biomass liquid fuels. The report, the fi rst in a series for the National Academies’ America’s Energy Future project, discussed existing and future technologies, environmental impacts, associated costs and barriers to deployment. The report also estimated potential deploy-ment on three timelines: less than 10 years, from 10 to 25 years and beyond 25 years.

“We suggest that the mixing of biomass and coal be explored,” said David Tilman, professor at the University of Minnesota-St. Paul, and vice chair of the Panel on Alternative Liquid Transporta-tion Fuels. “It can actually be a carbon-neutral or carbon negative fuel.”

The research team made three important fi ndings: an adequate supply of biomass exists—an estimated 550 million tons annually by 2020—without running into direct and indirect land-usage issues; a mixture of coal and biomass, when gasifi ed with carbon capture, is likely to provide more cost-effi cient and greenhouse gas effec-tive fuels; and maximizing carbon capture and sequestration is vital, according to Tilman. Geologic carbon storage is a high priority, he added, as it needs to be proven viable and safe on a commercial-scale before deployment of coal and biomass liquid fuels.

If the 550 million tons were combined with coal at a 60:40 coal-to-biomass energy ratio, 60 billion gallons of gasoline equivalent could be produced each year, about 45 percent of annual gas usage in the country, the report said. An estimated annual supply of 400 million tons of biomass could be produced sustainably with tech-

nologies and practices already available in 2008, the report adds.But transforming the transportation system from petroleum-

based fuels to various domestic sources will take several decades, the report says. In addition, it will be more than a decade before the alternative fuels reach full-market penetration.

Using biomass—specifi cally corn stover, wheat grass, switch-grass, native prairie plants, miscanthus and woody biomass—with coal unites the best of both worlds by providing the environmental benefi ts of biomass and the lower cost of coal, according to the report. Both are abundant in the U.S., making them excellent candi-dates for nonoil-based liquid fuels. The technology is not available in the U.S., but demonstration plants are in operation in Europe. With-out storage of carbon dioxide, life-time greenhouse gas emissions from coal-based fuel are about twice that of oil, but with storage it could be about the same.

If safe and viable geologic carbon dioxide storage is developed at commercial-scale facilities by 2015, the fi rst combination plants could be built in the U.S. by 2020, the report stated. By 2035, the country could produce 2.5 million barrels of gasoline equivalent per day, assuming a 20 percent growth rate in construction, it said.

The research team developed several recommendations from its fi ndings involving collaboration among the U.S. departments of energy and agriculture, researchers and the biofuels industry to iden-tify challenges, market penetration rates, carbon storage issues, con-version technologies, research and development needs, and spatial distribution of biomass in the country.

“The panel strongly felt that we should be trying to achieve a diversifi ed portfolio of technologies,” Tilman said. “If we’re looking at how we can maximize fuel supply that is greenhouse gas friendly, an appropriate mixture [of biomass and coal] is probably the opti-mal mix for the country.”

—Lisa Gibson

US can benefi t from combining coal, biomass fuels

The nation’s dependence on foreign oil could be reduced by transitioning to coal and liquid fuels made from biomass such as switchgrass, according to a report generated by the National Academies’ America’s Energy Future project.


Global Biofuels Wiki makes information gathering easierDisconnected information on biofuels scattered across numer-

ous Web sites and geographical areas can make it diffi cult to fi nd the right source. The Biofuels Center of North Carolina launched a global wiki in April to address the problem.

The Biofuels Wiki is designed to create a one-stop hub for inter-connected information about renewable liquid fuels and establishes a virtual community of biofuels industry experts, agronomists, for-esters, entomologists, researchers, environmentalists, college profes-sors and anyone else interested in the future of biofuels, according to the center. Information on the wiki comes from its members, who will post their knowledge on their topic of interest or expertise, sharing it with all other registered members. Edits and additions to topic pages are done in real-time and the more contributors to the site, the cleaner and better the wiki content will be, according to the center.

The wiki makes it possible to educate members and the public about issues related to large-quantity sustainable production of bio-

fuels all in one place, including feedstock, research, training, logisti-cal solutions, policy, commerce and distribution, among others.

Members can fi nd information via search or through cross links between terms and topics. Registration is required to add or change information.

Unlike traditional, static Web sites, wikis allow ongoing creation and collaboration from their members. The Biofuels Wiki also al-lows for professional networking within the biofuels community, promoting partnerships and providing a window for biofuels com-panies to fi nd employees and interns through a searchable resume database, according to the center. Companies also may use the wiki to explain their technologies and what makes them unique to poten-tial investors.

For more information or to register on the wiki, visit the homepage at www.biofuelswiki.org.

—Lisa Gibson

industry NEWS

Oglethorpe purchases acreage for biomass plantOglethorpe Power Corp. recently purchased a 355-acre site in

Warren County, Ga., for a 100-megawatt biomass electric generating plant. The site is one of fi ve considered last fall as potential sites for two, possibly three, facilities, according to the company.

Each plant will use about 1 million tons of woody biomass—wood from sawmills, forest residue, whole tree chips and chopped pulpwood—per year, according to Greg Jones, Oglethorpe director of public relations. Studies de-termined that nearby forests will be able to provide the necessary biomass supply. “More is already being grown than harvested,” he said. “The bot-tom line is there’s adequate supply.”

Each biomass facility will require a capital investment of $400 million to $500 million, according to the company, which will try to get funding from the rural utilities service, Jones said. The sites must undergo an independent environmental review and evaluation, required by the National Environmental Policy Act. The process will include public meetings at the potential sites. The review at the

Warren County site, and one being considered in Appling County, will occur in the next 18 to 24 months, during which Oglethorpe will work on acquiring the necessary environmental permits.

Each plant will provide about 40 permanent jobs, plus several hundred workers in the construction process, according to the com-

pany. In addition, about 400 to 500 more jobs per plant could be generated to gath-er and transport the biomass.

Construction on the fi rst plant is ex-pected to begin in 2011 and it should be

commercially operational by the summer of 2014, according to the company. The second plant will be op-erational by 2015 and if a third is built, it also will be operational at that time.

The second plant might be in Appling County and Oglethorpe has a third option in Echols County, along with two alternative sites in Washington County, according to Oglethorpe, although no other sites have been purchased yet.

—Lisa Gibson


industry NEWS

Australia-based agriculture technology company Glenvar has developed a direct baling system which it said could benefi t the bio-mass and cellulosic ethanol industries.

The Glenvar Bale Direct System combines a conventional baler and a conventional combine, enabling grain growers to harvest and bale simultaneously. The combine tows the baler using a drawbar attached to the main drive axle. Residue exiting the rear of the com-bine is directed onto a conveyor and then fed into the baler, which is driven by a hydraulic motor powered from an independent hydraulic pump mounted on the combine.

The driver of the baler is able to view the baling operation through the use of a mounted video camera which streams to a screen in the cabin.

Glenvar owner Graham Shields and managers Mike Shields and Kelly Shields have been developing and improving the baling system in Western Australia over the past seven years, according to Alan VanNahmen, product development manager. VanNahmen said he

has been involved in the testing and marketing in the U.S. “Our tests have proven that the combination of a combine with large square baler can improve cellulosic biomass collection and improve mate-rial handling effi ciencies,” he said.

Comparisons have shown an extra 30 percent, up to 300 per-cent, more residue can be collected compared to windrowing and baling as separate operations, according to the company.

The system has been designed to be compatible with a wide range of combines and balers, and is approximately $80,000 per unit.

In collaboration with Glenvar, Strauff Fiber LLC in Dayton, Wash., tested a Glenvar Bale Direct System during the 2008 wheat harvest. To view Strauff Fiber’s video of the Glenvar Bale Direct System in use, go to http://strauff-fi ber.com/ComBaler.aspx.

VanNahmen said Glenvar and its distributor are working to build additional units for other U.S. biomass collection entities.

—Anna Austin

Direct baling system could benefi t biomass industry

A steam generating biomass facility approved for the U.S. DOE Savannah River Site nuclear production plant in South Carolina will be a critical part of operations upon its completion, slated for De-cember 2011.

The DOE tasked Ameresco Federal Solutions Inc. in Knoxville, Tenn., with its largest-ever Energy Savings Performance Contract to construct one of the country’s largest biomass facilities. The $795 million project will replace a deteriorating D Area coal powerhouse and oil-fi red boilers, for a savings of about $34 million a year in energy, operation and maintenance costs, according to DOE. The plant also will reduce greenhouse gas emissions by 100,000 tons per year, a signifi cant contribution toward the goal of reducing energy intensity by 30 percent and water intensity by 16 percent by the end of 2015, according to the DOE.

The plant will run on about 322,000 tons of woody biomass per year, including waste from non-SRS timber companies, pellets and wood debris, according to Julie Petersen, DOE public affairs offi cer. The primary purpose of the facility is steam production, but it will

produce about 20 megawatts of electricity as a byproduct, Petersen said. “Steam is a pretty critical part of our day-to-day operation,” she said. Steam is used at the site to transport waste, reduce the volume of waste, control nuclear ventilation systems and operate turbines, among other functions.

As per the ESPC, Ameresco will fi nance, install and maintain the equipment—a steam cogeneration plant and two steam boilers—in the federal facilities. The government pays no up-front costs, a sav-ings for taxpayers, and the company’s investment is repaid over time by the DOE from the cost savings the project generates, according to the DOE. Ameresco will be repaid during a 15-year debt service payback period. “It’s no more than what we pay to operate the [D Area] facility now,” Petersen said.

The project will create 200 to 250 construction jobs, along with another 20 to maintain day-to-day operations once the facility is op-erational. Construction is scheduled to begin in August.

—Lisa Gibson

Biomass plant will provide steam for SRS operations

Residue exiting the rear of the combine is directed onto a conveyor and fed into the baler.

PH

OTO

: GLE

NVA

R

September 21-23, 2009

Moncton, New BrunswickHosted at the Delta Beauséjour

BBI Biofuels Canada Presents

CALL FOR POSTERS

Gain exposure and network within the Atlantic bioenergy industry. Display how your research could change the bioenergy world.

PARTICIPATE IN THE POSTER SESSIONThe purpose of the Atlantic BIOEnergy Conference poster session is to offer a forum to exhibit and entice agricultural, forestry and associate industries in your research and/or idea for the direction of the industry. Any registered delegate may participate in sharing their vision within the sector.

The abstracts submitted will be on display for the entire conference. Your submission should provide a brief summary of no more than 600 words of the objectives and methods of the research and/or your vision for the future. For detailed poster information please visit the conference website at

www.atlanticbioenergy.ca

Poster and Conference InformationContact: Lara Jack Event Manager [email protected] Ph: (519) 576 - 4500 Toll: (888) 501 - 0224


WOODY BIOMASS

Balancing Act Experts say forest woody biomass could

become a critical component of the conversionto clean energy in the U.S. and can be a sustainable resource, but its extraction concerns conservationists.

By Lisa Gibson


WOODY BIOMASS

s woody biomass and cellulosic materials become acceptable components of renewable energy and biofuels, policymakers, conservationists, energy analysts and biomass industry representatives

have turned their attention to making sure biomass is sus-tainably harvested from the nation’s forests.

Interest in extracting woody biomass—usually the limbs, tops, needles, logging slash and other low-value wood—has increased because of rising fossil fuel costs, concerns about carbon emissions from fossil fuels and the risk of wildfi res. Environmentalists are concerned about tapping into available forest biomass, but offi cials say it can be done in ways that meet the country’s energy needs while maintaining crucial forestlands.

How Much is Available and Where is It?Forestlands make up about one-third of the nation’s to-

tal land area and could supply about 368 million dry tons of biomass annually, according to “Biomass as a feedstock for a bio-energy and bioproducts industry: the techni-cal feasibility of a billion-ton an-nual supply,” a joint study sponsored by the U.S. DOE and USDA. Several factors includ-ing environmentally sensitive areas were taken into consideration when calculating the fi gure, which included forest and agricultural biomass po-tential. To displace 30 percent or more of the nation’s

A


WOODY BIOMASS

petroleum consumption would require 1 billion tons of dry biomass annually, the report says.

In 2008, 2.9 million green tons of biomass was removed from national forests, according to Ed Gee, chair of the USDA Woody Bio-mass Utilization Group. It is possible that more will be used in the future, he said, and more biomass is available on private lands than federal because of timber residue. The USDA alone manages 193 mil-lion acres of forestland, including grasslands, and the Bureau of Land Management manages another 263 million acres.

Nearly 70 percent of the existing biomass feedstock comes from forest products industries, the billion-ton report says. Although 368 million tons are available, estimates of what the workforce is capable of harvesting have not been nailed down, Gee says.

Gee says he believes forest woody biomass could meet America’s renewable energy needs, but the forests need to be sustained for future generations. “It’s very diffi cult to balance that,” Gee says. “Folks need to work together and fi nd common ground.”

The most biomass-dense forests are in the southeast portion of the country. The “Southern Bioenergy Roadmap,” a report by the Southeast Agriculture and Forestry Energy Resources Alliance and the University of Florida, found that 12 southern states—Alabama, Arkansas, Florida, Georgia, Kentucky, Louisiana, Mississippi, North Carolina, Oklahoma, South Carolina, Tennessee and Virginia—con-tain 30 percent of the nation’s bioenergy potential in their agricultural and forestry resources.

In California, about 20 percent of the total 4.5 million bone-dry tons of biomass used annually to fuel the state’s 27 biomass power plants comes from forests, according to John Shelly, woody biomass utilization specialist at the University of California-Berkeley, and For-est Products Society president-elect. Biomass plants produce about 2 percent of California’s power, or 640 megawatts, he said, and forest-based biomass makes up 7 percent of the estimated 50 million tons of

California forest

PH

OTO

: JO

HN

SH

ELL

Y


biomass available in the state per year. “It’s estimated we could prob-ably double that without negative effects on the forests,” he says.

Pennsylvania’s 17 million acres of forestland also have gener-ated interest from the biomass industry, but the current estimate of available low-grade wood for biomass harvest in the state—6 million tons—is overly optimistic and doesn’t adequately consider several ecological, social and practical concerns, according to the Pennsylva-nia Department of Conservation and Natural Resources.

Differences also exist among forests east and west of the Missis-sippi River because of fi re susceptibility relating to weather, density

and insect infestations, Shelly says. Wildfi res are common in the west, where forests are dense and fuel availability for fi res is high. “If you’re going to remove it, a good place to put it is into the biomass sector,” he says.

The primary short-term benefi t of biomass harvest for wildlife in a forest is to create clearings that provide the habitat needed by a variety of species, according to the DCNR report. The long-term benefi t lies in the potential for biomass markets to provide economic incentives to cut low-value wood and promote the regeneration of a new, healthier and more diverse forest, it adds.

“From my point of view, it’s positive because we’re using residue,” Shelly says. It would end up in landfi lls if it wasn’t used, he adds.

The Flip SideHarvesting biomass from forests, if not done properly, can ex-

pose soil to drying and erosion, reduce biodiversity, negatively impact the food supply for benefi cial insects and wood-boring species, reduce organic matter, eliminate habitats and denning sites, and limit fl owers that support declining species of pollinators like bees, bats, butterfl ies and hummingbirds, among other adverse effects.

“It’s detrimental when you overharvest without a careful review of scale and sustainability,” Gee says. It’s imperative that the health of the forest isn’t compromised, he adds.

“To address the supply side and not the conservation side is a weak approach,” says Wayne Jenkins, executive director of Georgia Forest Watch. The conservation group focuses mainly on the 865,000 acres of the Chattahoochee-Oconee forests in Georgia. It is public land and Jenkins says Forest Watch believes public lands in the state should not be harvested. “We believe that material should come off the private lands in Georgia.”

WildEarth Guardians, a conservation group based in the south-western U.S. also focuses on public forests. “When you go in and

WOODY BIOMASS

If you’re transporting DDG as meal, you’re losing profits everyday. Put that money back in your pocket with a CPM pellet mill.Pelleting offers increased energy savings, flowability, dust con-trol and less cleanup. Call for your FREE cost analysis today.

FROM PROBLEMS TO PELLETS TO PROFITS

800-366-2563 | 319-232-8444 | CPMROSKAMP.COM

WATERLOO, IOWA

Harvesting woody biomass from forests in CaliforniaP

HO

TO: J

OH

N S

HE

LLY


WOODY BIOMASS

BOILERworkshop

20092009

Presented by:

In conjunction with:

FREE REGISTRATIONSpace Limited

CALL TODAY!815.477.8777

To register online visit www.eisenmann.com/bbw

July 14 Manchester, NH

July 16 Charlotte, NC

Ensure a successful project from feedstock procurement through emissions compliance.

ATTEND: • intensive 1 day course

LEARN: • how to capitalize on biomass boiler

and CHP systems • late breaking industry information

RECEIVE VALUABLE CASE STUDIES: • biomass fired steam generation • project financing and incentives • regulatory impact on feedstock

remove woody biomass, there are impacts on the forest,” says Bryan Bird, Wild Places program director. “Standing forests are very important in combating climate change,” he says. “It’s important to be diligent in under-standing the role forests play in sequester-ing carbon.” Besides cleaning the air, forests provide clean water and habitats for wildlife.

Concerns particularly associated with the extraction of forest woody biomass in-clude the mechanical equipment used, the amount left to help regenerate the forests and the greenhouse gas emissions associated with removing and transporting the woody biomass, Bird says.

“From the forest to the gate is the is-sue,” Gee says, recognizing the problems that arise during transportation, especially if the forest is a long distance from the plant. But to address other environmental con-cerns he says, “We are going to operate by the laws,” citing the National Environmental Policy Act and the Endangered Species Act. “It makes sense that scale and sustainability is in everyone’s best interest.”

Bird says he believes biomass extrac-tion is not necessary for a forest to thrive, even in the case of insect infestations and wildfi res because they are naturally occur-ring processes and forests have survived for millenniums without human intervention. “Naturally functioning forests do not waste material,” he says.

Shelly says it’s not waste, but a resource. “Wood is just an amazing storehouse for re-sources.”

Biomass harvesting is a complex issue and Jenkins says Georgia Forest Watch does not oppose it altogether, but looks at it on a case-by-case basis. “We would have to look at it forest by forest,” he says. “What might be appropriate in one place might not be ap-propriate in another place.”

“The only place where I would see a potential benefi t is in community interface,” Bird says. For example, it can be good if it helps protect a community from a spreading fi re. He added that logging slash in private forests harvested for timber does increase the fi re hazard and removing it reduces fuel thinning, but he questions the need to log on

public forestlands in the fi rst place.Current laws make it much easier to

acquire woody biomass from private forests than federal, presenting another problem, Gee says. With legislation pushing toward the utilization of private forest biomass, those forests will be depleted much faster. Private forestlands come under the review of state foresters’ offi ces, whereas federal forestlands are under review of federal laws and NEPA. “As such, any harvesting of woody biomass products can be reviewed by the public and therefore repealed by the public,” he says.

In addition, the defi nition of biomass in the Energy Independence & Security Act of 2007 excludes forest woody biomass from federal and native forests from counting to-ward the 36 billion-gallon renewable fuels standard if it’s used to produce biofuels. The White House recently announced that $786.5 million from the economic stimulus bill will be used to fund pilot biofuel refi neries and research into creating more effi cient fuels, but President Barack Obama’s strategy still doesn’t include biomass from federal forests or from natural private forests.

Bird is adamant that biomass should not come from public forestlands. “The public forestlands in this nation are not the place to look for biomass energy,” he says. “They have much higher values than that.”

Developing a Forest Management Plan

A 100-megawatt biomass power plant scheduled to go on line in 2013 in Gaines-ville, Fla., will run on 1 million tons of woody biomass annually. The majority of the wood will be residue from timber operations with-in about a 75-mile radius, but some will be other woody waste such as storm debris.

Gainesville Regional Utilities will pur-chase and own all the output of the facility, operated by Gainesville Renewable Energy Center LLC, an American Renewables proj-ect company. GRU also is in discussions with some water management districts working to restore long leaf pine trees by removing low-value wood in populated areas. In-depth studies have shown there is an adequate sup-ply of forest biomass for the plant to oper-


WOODY BIOMASS

ate, while sustaining the forests, according to GRU. Using biomass from nearby forests will help with transportation costs and emis-sions, according to Josh Levine, director of project development for American Renew-ables. Money spent on fuel will stay in the region, another benefi t, he adds.

To promote good forest management, the companies assembled a technical com-mittee to study the issues related to forest biomass and developed an incentive pro-gram for biomass suppliers, says Joe Wolf, GRU forester.

“It’s the fi rst of its kind in the nation,” Wolf says. The program provides a fi nancial incentive—50 cents to $1 more per ton—for suppliers who go above and beyond to practice good forest management by joining a third party sustainable forestry program, such as the Forest Stewardship Council, and abiding by the group’s standards. The stricter the program standards, the more the sup-plier will earn.

The company will continue research into how biomass harvesting impacts the forests, Wolf says, but believes it will help foresters in the state achieve their objec-tives, such as removing fuel thinning from the state’s clogged forests. “We have wild-fi res burning out of control because of poor management,” he says.

For the most part, the plant has the support of conservation groups that have weighed in, Levine says, adding that some have concerns and conditions. “I can’t think of a single group that fl at-out opposes it,” he says.

The biomass energy potential in Florida is great and will play a signifi cant role in the state’s conversion to clean energy, Levine says. “And in the long run, we do believe that biomass power will lower the region’s elec-tricity rates.”

States Step Up Several states and the Forest Steward-

ship Council have developed guidelines re-garding the harvest of woody biomass from forests.

Guidelines established through a variety of state agencies in Minnesota, Pennsylvania,

Wisconsin, Maine and Missouri all address issues with dead wood, wildlife and biodi-versity, water quality and riparian zones, soil productivity and silviculture, according to the Forest Guild’s January 2009 report, “An Assessment of Biomass Harvesting Guide-lines.” Minnesota, Missouri, Pennsylvania and Wisconsin also address disturbances like insects, fi re or disease. Guidelines can differ depending on what type of forestland is be-ing considered for biomass harvest.

Defi nitions of biomass usually are simi-lar, but can differ between states and as the timber market fl uctuates. For example, Maine guidelines defi ne biomass as all organic ma-terial, but go on to identify “energy wood,” woody material used in a bioenergy facility, and “energy fi ber,” a subcategory of energy wood that excludes wood suitable for saw timber. Some harvests remove only woody biomass, while others combine the harvest of saw timber or other products.

The main sections of the FSC guide-lines that address biomass harvesting include habitat, dead wood and retention. They al-low a variety of practices to be used, as long as the management objectives and FSC stan-dards are not compromised.

Other states also have developed and implemented guidelines as the nation moves toward conversion to clean energy and inde-pendence from foreign oil. Woody biomass is a component of that conversion, Shelly says. “Theoretically, wood has about 20 mil-lion British thermal units per bone-dry ton locked up in it,” he emphasizes, adding that effi ciency rates with current woody biomass technologies range from 30 percent to 70 percent. “More research needs to be done, but we’ll get there,” he says. “It’s about meet-ing the demands of the world and woody biomass is a big part of that picture. The tree is really one of our few naturally renewable resources. It’s an amazing resource for now and the future.” BIO

Lisa Gibson is a Biomass Magazine as-sociate editor. Reach her at [email protected] or (701) 738-4952.


INNOVATION

Cutting-Edge Co-Culture

University of California-San Francisco researchers have genetically engineered a brewer’s yeast and co-cultured it with a cellulose-eating bacterium. The symbiotic relationship of the two microbes has created a novel process to convert biomass into methyl halides.

By Anna Austin


INNOVATION


he phrase “one man’s trash is another man’s treasure” couldn’t possibly ring truer that it does in the biomass industry. In some

cases, its application extends beyond un-wanted lamps or old bottles. In one in-stance, it can be applied to a bacterium discovered in a garbage dump in France in the early 1980s.

According to Christopher Voigt, a University of California-San Francisco pharmaceutical chemistry associate pro-fessor, the bacteria was briefl y considered for cellulosic ethanol production but was discarded because it was low yielding and produced too much acetate.

Today, the bacterium has been given a second chance. Voigt and his research team have utilized the bacteria Actinotalea fermentans in a co-culture along with geneti-cally engineered yeast in a research project designed to discover a way to introduce fl exibility into biorefi ning.

A Unique SymbiosisOnly a few papers about the bacte-

rium have ever been produced based on research that was conducted in the early 1980s, according to Voigt. “It was actually misclassifi ed for 25 years,” he says. “Noth-ing was really known about it, but it’s a very unique organism in the sense that when it

was reclassifi ed, there weren’t many rela-tives out there.”

Voigt says it was studied years ago as a biomass conversion organism, but was ruled out because it was capable of only producing a small amount of ethanol, and it accumulated acetate that inhibited the bacteria from thriving.

The enzymes genetically engineered into the yeast are the result of synthetic metagenomics, which Voigt explains is the identifi cation and selection of specifi c DNA. “The ability to print DNA has ex-ploded within the past couple of years,” he says. “When we were fi rst looking for the enzymes to do the process, we could

INNOVATION

T

Voigt, left, and research team member Dehua Zhao

PH

OTO

: MA

JED

PH

OTO

.CO

M 2

009


go into a sequence database and print out every enzyme in there that looked like it might be what we needed.”

From his perspective, it has progressed into an easier task. “I send an e-mail with the desired DNA sequence in it, and nine days to a month later—they can send back the genes,” he says. “In the plasmid, we want a complete clone. Today, there are a number of companies who do this. Bio-technology research has been accelerating tremendously.”

The biomass conversion process is relatively simple. After the bacterium eats the feedstock, the yeast is able to transform the acetate byproduct into methyl halides.

Therefore, the bacterium is dependent on the yeast for carbon and energy, and the yeast is dependent on the bacteria to me-tabolize toxic waste products. As a result of this unique symbiosis, the UCSF team has been able to effi ciently convert multi-ple biomass feedstocks into methyl halides, which are typically used as agricultural fu-migants and are precursor molecules that can be catalytically converted to chemicals and fuels such as gasoline, alcohols and soil fumigants.

New to Biotechnology“Methyl halides are produced by na-

ture in small quantities,” Voigt says. Marine

algae, fungi and halophytic plants, which thrive in salty soil, all naturally produce methyl halides.

“I don’t think there has been a real ap-preciation that biology makes methyl ha-lides,” Voigt says. “There was quite a bit of work done in atmospheric chemistry, re-garding the natural production of methyl chloride by rice—which is a major ozone depleter. People have tried to fi nd the gene that is producing it and knock it out to cre-ate an environmentally friendly strain of rice, but it hadn’t crossed into biotechnol-ogy. People are often surprised that methyl halides are so prevalent in nature.”

The idea is new to the fi eld of bio-

INNOVATION

Biomass Conversion Process

SOURCE: CHRISTOPHER VOIGT

‘Although theoretical yields are suffi cient for the whole process to be economical, they must still be improved. It’s just a matter of going in and monkeying with the pathways.’

Christopher Voigt, University of California-San Francisco pharmaceutical chemistry associate professor


technology, in that nobody has tried to overproduce it as a useful molecule, al-though methyl halides are well known in petrochemicals as a precursor for a num-ber of different chemicals.

“The conversion of methyl halides into the other chemicals has been around since the 1970s,” Voigt says. “It’s pretty trivial and scalable, but what has not been tested yet is whether it is economical in large-scale quantities. It’s been studied in the context of natural gas to liquid fuel conversion as an alternative to the Fischer-Tropsch process, and the catalysts (zeolite) have been used most prevalently in the petrochemical industry. There have been facilities that use methanol as an interme-diate to gasoline for natural gas, and the same process can be used for methyl ha-lides.”

In the UCFS process, the methyl ha-lides are converted into a vapor or gas. “Since it comes off in this form, it’s quite easy to collect,” Voigt says. “So that’s a huge advantage of this—that you are able to collect the product as fermentation is occurring and you don’t have to do any distillation afterward.”

Flexible and Effi cient The researchers believe the signifi -

cance of their work is two-fold. First, never before have a yeast and a bacterium been combined in fermentation to pro-duce fuel from biomass. Second, although methyl halides have been explored as in-termediates in the conversion of natural

gas to gasoline, they’ve been completely overlooked as a potential building block for biomass.

How might this impact the ethanol and biomass industries? “A characteristic of the current industry is that if you build

INNOVATION

Principal investigator Voigt, center, is shown with research team members, left to right, Daniel Widmaier, Travis Bayer, Ethan Mirsky and Karsten Temme in the Voigt Lab at the University of California, San Francisco Mission Bay Campus. Not pictured is Daniel Santi.

PH

OTO

: MA

JED

PH

OTO

.CO

M 2

009


INNOVATION

a corn-to-ethanol plant, corn is your only feedstock and ethanol is your only prod-uct,” Voigt says. “You can’t switch on a dime. We have approached the feedstock and the product issue separately. The feed-stock we did was based on the bacterium, which has the ability to eat a wide range of material. By picking the right building block chemical, it can then be converted into many different chemicals or fuels like gasoline.” This would allow fl exibility for the industry so producers wouldn’t be locked into only two commodities such as sugar and ethanol. “It would allow you to switch your feedstock and your product based on market pricing,” he says. “It’s something that is done in petrochemicals, but it hasn’t been integrated into biorefi n-ing yet.” The yeast/bacterium combina-tion would allow a producer to utilize the current best-priced feedstock.

Voigt says his research team has suc-cessfully converted sugarcane bagasse, corn stover, switchgrass and poplar into methyl halides, all without any pretreat-ment. “In the case of switchgrass, we use material sent to us by the U.S. Department of Agriculture as-is—it is sort of chopped so the blades are 10 to 15 millimeters.” Wood chips are dumped into a household blender to break them down before pro-cessing.

The fact that the biomass feedstock doesn’t need to be pretreated indicates that the UCFS process may prove to be quite economical. On top of that, the bacterium’s optimum growth occurs at 30 degrees Celsius (86 degrees Fahrenheit) so a signifi cant energy savings may also be realized. “You don’t have to heat up the bioreactor like you would with other cel-lulosic organisms that require very high temperatures,” Voigt says.

The Future of the Pairing

So what’s the next step to advance the process? “From a scientifi c perspective, we need to improve our conversion rates,” Voigt says. “It’s about 40-fold slower than sugar-to-ethanol, and we need to get to that point through engineering the yeasts.

Once we do that, the fermentation aspects become economical.”

Voigt says the team will work to show that the two processes—the fermentation process and the chemical catalysis—can couple to each other in a scalable way that would be required to demonstrate feasibil-ity. The group has started a company called Biomex Inc. to do that. Biomex will help with the commercialization process as the UCFS team’s work progresses.

In the meantime, Voigt says the pro-cess of successfully identifying molecules that will be most valuable as intermediates would benefi t from more communication between the biotechnology and petro-chemical industries. “It’s an issue, because it is a molecule that the petroleum industry appreciates for its conversion into longer-chain molecules,” Voigt says.

As always the common goal of all new fuel and chemical technologies is to achieve greater yields. “Although theoretical yields are suffi cient for the whole process to be economical, they must still be improved,” Voigt says. “It’s just a matter of going in and monkeying with the pathways.”

Voigt and his team wrote a paper titled “Synthesis of Methyl Halides from Bio-mass Using Engineered Microbes,” that was published online April 20 in the Journal of the American Chemical Society. BIO

Anna Austin is a Biomass Magazine as-sociate editor. Reach her at [email protected] or (701) 738-4968.


BIOBUTANOL


BIOBUTANOL

Salem, Ore.-based Diesel Brewing is working to implement a unique business model for the gasifi cation of waste biomass into biobutanol and other valuable energy products.

By Anna Austin

Biobutanol: Ethanol’s Energy-Dense Cousin


iobutanol has an energy density only 10 percent to 20 per-cent lower than gasoline, and its energy content is higher than ethanol, according to the U.S. DOE Alternative Fuels and Advanced Vehicles Data Center. It’s compatible with

the current gasoline distribution infrastructure and would not require new or modifi ed pipelines, blending facilities, storage tanks or retail station pumps. Biobutanol can be effi ciently blended with ethanol to improve the blending of ethanol with gasoline, and can also be pro-duced using existing ethanol production facilities with relatively minor modifi cations.

Under current U.S. EPA regulations, biobutanol can be blended as an oxygenate with gasoline in concentrations up to 11.5 percent by volume.

While possessing these attractive qualities, like many other renew-able fuels, the commercial-scale production of biobutanol has been hampered by challenges. Production costs have typically amounted to nearly double those of ethanol, since traditional fermentation process-es have proven too ineffi cient to make biobutanol in large amounts.

By virtue of innovation in process technologies, however, more players are entering the game. With a slightly different approach than others, Salem, Ore.-based Diesel Brewing is moving full-steam ahead with plans to build multiple stand-alone biobutanol production facili-ties in the Northwest U.S.

Tweaking TechnologiesDon’t let the name throw you off—Diesel Brewing doesn’t man-

ufacture or plan to manufacture diesel fuel. Rather, the company will produce biobutanol for use within local fuel markets as a renewable diesel blending agent.

Uniquely, Diesel Brewing will use a gasifi cation process that con-verts biomass into a synthesis gas that is cleaned, fed into a catalytic reactor, and purifi ed to generate biobutanol, ethanol and methanol.

The individual alcohol components and the ash from the post-com-bustion process are then separated and stored.

The plan to focus on biobutanol was developed as a result of thorough investigation and comparative analyses, according to Diesel Brewing CEO Mark Stapleton.

“We originally looked at a variety of fuels such as cellulosic alco-hols and synthetic diesel,” he says. “We were drawn to biobutanol after several months of investigating various existing technologies.”

Stapleton says other fuels the company looked at simply were not providing satisfactory percentage yields. “There were too many other products as a result of that process, so we were looking for

BIOBUTANOL

Butanol Versus Ethanol

Butanol’s characteristics make it an enhanced fuel ad-ditive for cold and hot climates without sacrifi cing power or fuel effi ciency. Some of the properties that make bu-tanol superior to ethanol are:

It burns cleaner resulting in fewer harmful particu-lates, including less nitrogen oxide, hydrogen and car-bon monoxide emissions.

It is substantially less corrosive, meaning that butanol can be transported utilizing existing fuel pipelines, while ethanol must be transported via rail, barge or truck.

It has a higher energy content, octane value and fl ashpoint rating, tolerates moisture better, and is less evaporative than ethanol.

SOURCE: DIESEL BREWING

B


an alternative where we could get higher yields for our primary product—which is going to be biobutanol,” he says.

By changing the conversion chemistry, the company could produce other fuels such as biodiesel and dimethyl ether (propane) or an-hydrous ammonia for the production of fertil-izer. “For now, we’ll focus on the production of biobutanol,” Stapleton says.

He could not disclose the company’s pre-liminary yield estimates, but Stapleton says they

will soon be validated at Diesel Brewing’s fi rst pilot plant, construc-tion of which is slated to begin in September. “It will be a small plant, located right here in our backyard, that’ll process roughly a ton of biomass per day,” he says. “It’s due to be commissioned in December, and we’re on track for that.”

Using the prototype, Diesel Brewing will develop baseline data on feedstocks, synthesis gas production, emissions composition and relative thermal effi ciencies—employing a technology that consists of multiple previously existing platforms that have been redesigned and integrated. “We’re not purchasing any machines,” says Diesel Brew-ing Chief Operations Offi cer Kevin Caldwell. “Rather, we’re buying many different parts from different people.”

Unitel Technologies Inc., an engineering company based in Chi-cago, Ill., has designed the basic system for Diesel Brewing. “We used other people’s platforms that are already in the public arena, and basi-cally had Unitel redesign them,” Caldwell says. “For instance, the gas-ifi er itself, to do the thermal conversion, is a designed working system that sits at the University of Utah in Salt Lake City, but they use it for an application that’s a little bit different,” he explains. “We took that public domain gasifi er, gave it to Unitel and told them what we wanted it to do, and then they redesigned it for us. [The technology

is] the result of the collaboration of many bright people and their work over the past 50 years, refi ned one more time to fi t our specifi c feedstock.”

Caldwell says the same is true for the development of the com-pany’s synthesis gas cleanup, which was developed through the selec-tion and redesign of existing systems in order to suit the company’s catalyst.

Pressure vessel and refractory specialist CH Murphy Clark-Ull-man Inc., based in Portland, Ore., will work with Diesel Brewing for the fabrication and installation of multiple specialized pressurized ves-sels.

All design engineering and technology rights will be held by Pa-cifi c BioPower, an associated company to Diesel Brewing.

Community Sustainability Aside from the distinctive advantages that biobutanol has when

compared to other fuels, Stapleton says the real thrust that adds to what Diesel Brewing has planned is its focus on small-sized biorefi n-eries. “Most of the biorefi neries across the world are very large in na-ture,” he points out. “Every day they consume 500 to 1,000 plus tons of biomass. We’re unique because we’re focusing on a much smaller amount of biomass so we won’t over-consume.”

Stapleton expects a typical facility to process 120 to 125 tons of biomass per day. “We can go to a fairly small, rural community and not have such a huge impact on the biomass availability—consuming more than is there—and be forced to ship biomass from other plac-es,” he said.

Although the feedstock processing capability of Diesel Brew-ing’s technology is relatively fl exible, Caldwell says the company will utilize a narrowed group of materials. “It won’t be a biomass recycling center,” he says. “We’ve pretty much relegated ourselves to agricul-ture waste and woody biomass. There are a couple of reasons for

www.harrisgroup.com1.800.488.7410 Ext. 4422

Harris Group Inc.Engineering for Optimum Performance®

New Facilities• Full-service Engineering• Program Management• Technology Assessments• Feasibility Studies• Financial Due Diligence• Start-up Assistance

Existing Facilities• Plant Optimization• Performance Assessments• Control Systems Integration

Integrating all components for new and existing facilities

Engineering your success in convertingbiomass to fuels and chemicals

BIOBUTANOL

Mark StapletonCEO,Diesel Brewing


BIOBUTANOL

that. Everything has a little bit different chemi-cal make-up, and by narrowing that just a little bit, it gives us a narrower range of chemistry that we have to deal with in the gasifi er and the catalyst unit.”

Oregon currently has an estimated 9.8 mil-lion bone-dry tons of woody biomass resourc-es and 1.5 million bone-dry tons of agricultural residues available for energy use each year. The state also has many renewable energy incen-tives, such as a business tax credit of 50 percent of eligible project costs (up to $10 million in credits) for facilities that use renewable energy resources and plants that manufacture equipment used for renewable energy projects.

In addition to fuel, electricity will be generated at the site of Diesel Brewing’s biobutanol plants. “We’ll have our own internal electrical needs, so we’ll use what we need and sell the balance of it,” Caldwell says. Out of the estimated 5 megawatts (MW) generated, Diesel Brewing facilities will require 1 to 1.5 MW.

“Oregon’s a unique state in that we can either wheel it to the grid as a small producer under the PURPA (Public Utility Regulatory Policies Act) or, if we have a neighbor or a local co-op or public util-ity district, we can actually execute private power contracts,” Caldwell says. “Our preference will be to sell it to a local co-op to distribute it locally, but there are a lot of options in Oregon for what we can do with the balance of the electricity.”

Under state regulations, Oregon utilities must meet a percent-age of their retail electricity loads with renewable resources. For the three largest utilities—Portland General Electric, Pacifi c Power and Eugene Water and Electric Board—the targets are 5 percent in 2011 and 25 percent by 2025. For the other utilities in the state, the targets are 5 percent or 10 percent by 2025, depending on the size of the utility. If any of these utilities builds or signs a new contract with a coal-fi red plant, the targets for the large utilities apply.

A Map of the FutureDiesel Brewing intends to roll out its plans quickly. After the

start-up of its pilot facility in December, work will begin on a 10-ton per day production unit in Boardman, Ore., which will demon-strate production yields, fuel ratios, gas cleanup procedures, and will allow the company to further fi ne-tune and balance the processes. Completion of that project is slated for October 2010. Based on the fi ndings of the two preliminary test plants, a commercial-scale plant that would use at least 100 dry tons of biomass per day will be con-structed; more will be built across the state when all the kinks are worked out.

“The bottom line is we’re not transporting biomass into our communities and transporting liquid fuels out,” Stapleton says. “Our whole business philosophy is to establish small, rural plants near where we get our feedstock, and then produce and consume the bio-fuels within that same community.” BIO

Anna Austin is a Biomass Magazine associate editor. Reach her at

Kevin Caldwell chief operations offi cer, Diesel Brewing


CONTRIBUTION

EQUIPMENT By Larry Trojak

Boralex Chips Away at Energy ChallengesMaine company employs creative business practices and a fl eet of chippers to ensure a steady stream of feedstock is supplied to their plants.

The claims and statements made in this article belong exclusively to the author(s) and do not necessarily refl ect the views of Biomass Magazine or its advertisers. All questions pertaining to this article should be directed to the author(s).

The recent drastic spike in oil prices sent more than a few states scrambling,

both fi nancially and in efforts to ensure their residents’ energy needs were met. For many, it was—and continues to be—a tremendous challenge. However, for Maine, it was a time when past efforts to encourage the de-velopment of a comprehensive biomass program paid off, and

in a big way. One of the biggest players in that effort, Boralex LP, operates a half-dozen biomass plants in the Northeast, fi ve of which are in Maine and, at peak performance, can generate 240 megawatts per hour (MW/hr) of electricity. Equally impressive is the way the company ensures a steady stream of feedstock material to their plants; drawing upon a combination of creative business practices and solid per-

formance from an ever-growing fl eet of chippers to recycle better than 2 million tons of wood resi-due each year.

Seeing the Forest for the Power

Founded in the early 1990s, Boralex is part of the Quebec-based Cascade Group, and one of the northeast’s key producers of energy from wood residue. Feedstock materials include for-

est-based products such as bark, tree tops and branches, as well as recycled wood waste such as ca-ble drums, pallets, recycled wood, railroad ties and tree stumps. Ac-cording to Eric Dumond, the company’s procurement supervi-sor, Boralex, under the guidance of its founder, Bernard Lemaire, has an uncanny knack for recog-nizing value when it’s not real ap-parent.



“The state of Maine built a large number of biomass plants during the oil shortages of the late ’70s and early ’80s,” Du-mond says. “They all had power contracts, but when the industry fell victim to deregulation and prices dropped, the contracts were bought out and the biomass plants essentially went idle. In the early ’90s, Boralex came along and did what it’s been shown to do best—see energy opportuni-ties and capitalize upon them.”

Today, Boralex owns and operates hydroelectric plants, biomass facilities, cogeneration plants and wind farms through-out the Northeast U.S., Quebec, Canada, and France, resulting in a companywide production capac-ity of better than 350 MW/hr.

Supplying the Suppliers

In Maine, the overwhelm-ing bulk of the power generated by Boralex is through those fi ve biomass plants, and ensuring a steady stream of material to feed them is an ongoing effort. While the company contracts with area loggers and land-clearing com-panies to purchase and stockpile the forest-derived material upon which it relies, Dumond says they still take steps to avoid interrup-tions to that fl ow. One of the ways they’ve done so is through a unique series of arrangements with many of their suppliers.

“Essentially, what it comes down to is this: we identify an area that needs logging, and, if there is no contractor in that area, or no one capable of handling ad-ditional work, we fi nd someone, either through our own contacts or, more often, through Nortrax, our equipment supplier.” Du-mond says. “If necessary, we will

purchase a piece of equipment—anything from a chip trailer, to an excavator, to a chipper itself—and the contractor will pay it off in dollars per ton across our scales. So, for example, we might buy a Morbark 50/48 chipper, and sign a fi ve-year, low-interest agree-ment with a contractor based on a 40,000- to 50,000-ton-per-year volume. He supplies the trucks, chip trailer any other support equipment, goes to work, and for every ton that he delivers across our scales on a daily basis, we take a percentage off for payment on the machine. At the end of fi ve years he owns the machine out-right, we’ve gained an additional supplier, and we got the added volume we needed.”

Dumond adds that, during Maine’s “mud season,” which consists of four to eight weeks where work is near impossible due to snow melt and inaccessi-bility of the areas, the company waives payment.

“This entire approach has done a couple things for us,” he says. “First, it has ensured the consistency of our deliveries; we can look out several months and know that the plants will have the fuel they need. More importantly, however, we’ve gone from see-ing those contractors as suppliers to viewing them as partners and that’s been important for all par-ties concerned.”

Going for the ChipsTo a large degree, the nature

of the material Boralex demands for its feedstock dictates the type of equipment used to process it. Because most of that material is hardwood, chippers have gener-ally been the preferred equipment and of those, Dumond says Mor-bark has been the manufacturer

of choice in the overwhelming majority of cases: nearly 40 units in the past fi ve years.

“Everyone has their pref-erences, so we really leave the choice of equipment to the supplier himself,” he says. “But because of the reputation Mor-bark has in this area—both for production and reliability—that’s the brand most often chosen. We have everything out there from a Hurricane 18 Brush Chipper to their newest chipper, the Model 40/36. Again, we will provide whatever they’d like, but there’s no denying we welcome a Mor-bark choice. The level of support

we get from Bud Iverson and the folks at Nortrax and the excellent parts availability from Morbark it-self are outstanding—and critical to our operation. Without those two things, you risk the potential of having an expensive piece of iron sitting in the woods costing you money instead of making you some.”

To illustrate that point, Du-mond cites several units from a European manufacturer that have been tried in the past. “We were assured that support would be solid and parts would be avail-able at a moment’s notice,” he says. “Well, we had an equipment

Pictured are, left, Boralex Procurement Supervisor Dumond and Terry Theriault, owner of Theriault Tree Harvesting. Both men’s companies have benefi tted from the equipment purchase arrangement Boralex has with many of its fuel suppliers.

PH

OTO

: BO

RA

LEX


failure in the fi eld and quickly found that nei-ther has been true. So we’ve made our dissat-isfaction known and will stay away from that manufacturer in the future. It’s just not worth the headaches—or the lost production.”

Expanding HorizonsIn addition to the arsenal of chippers,

Boralex also has a couple of Morbark’s hori-zontal grinders—a Model 4600 and a track-mounted Model 3800—at work in the forests of Maine. While each type of equipment has

its benefi ts and advantages, Dumond believes that in Maine the ideal scenario would be one in which both are used.

“There is a huge variety of tree species here, making the upper slopes with their hard woods ideal for a chipper, while the lower slopes, which are mixed with both hard and soft woods, are better suited for a horizontal grinder,” Dumond says. “Up to this point, chippers have really ruled the day, mostly because wood chips offer a better [British thermal unit] value. But we have a couple of

horizontals out there and they are doing a great job for us. Plus, having a track-mounted grinder allows us to work deeper into mud season which will be a real plus for us.”

Controlling Growth In what seems to be the true Maine spirit,

most of Boralex’s suppliers are small logging fi rms, committed more to doing a good job than they are to quickly expanding and getting rich overnight. Dumond says Boralex works hard to ensure any one supplier doesn’t over-extend himself with regard to growth.

“We are certainly open to a company wanting to take on more business,” he says.


Feedstock material for Boralex’s biomass plants includes forest-based products such as bark, tree tops and branches (shown here) as well as cable drums, pallets, recycled wood, railroad ties and tree stumps.

PH

OTO

: BO

RA

LEX


“A good example of that is Terry Theriault, owner of Theriault Tree Harvesting out of Stratton, Maine. He is a logger who works on both private wooded lots and industrial forest lands for large land owners. He purchased a chipper on his own about a year ago, but was comfortable taking on more capacity. So he asked to go through our program and recently took delivery of a new Morbark 50/48 Whole Tree Chipper. They are an outstanding com-pany and we have no doubt they will manage the added business just fi ne.”

Such is not always the case, however. Bo-ralex is continually monitoring situations to determine the best course of action. For ex-ample, if they are at a point where they know they need more material, should they seek out

a new contractor or ask one of their existing ones to ramp up? “There are a lot of variables to consider,” Dumond says. “If we are look-ing at an existing supplier, we have to ask: ‘Is he maxed out?’ If he is, we certainly don’t want to throw another piece of equipment at him to bog him down even further. We always want our suppliers to be effi cient.”

In the past, he adds, they’ve had suppliers who were doing really well with one machine but, with the addition of a second unit, actually lost production across the board.

“We never want that—we always want to ensure a steady stream of material to the plants. And we feel that the programs we have in place, coupled with our reliance upon reputa-ble, well-supported equipment manufacturers, will serve us well as we continue to contribute to the growth of biomass in the area.” BIO

Larry Trojak is president and owner of Trojak Communications. Reach him at [email protected].


1-888-406-5449www.duratech.info/biomass

Maximum Power, Minimum Effort.

The 9564 Horizontal Grinder is the fastest, most efficient way to reduce biomass resources into usable materials for the processing and production of low-emissions fuel products. This massive machine, with its 40 x 60.5 inch feed opening and a CAT C27 950hp diesel engine, can grind nearly anything from entire trees to heavy green waste, wood pallets and large stumps. Equipped with an enclosed engine compartment that produces the lowest decibel reading in its class and the only self-cleaning air intake system on the market, the 9564 is a heavy duty “green” machine.

9564 Industrial Horizontal Grinder

Flexible retail financing available. Contact your local dealer.

A dual truck-tipping operation off-loads wood chips which will fuel the boilers at Boralex’s Livermore Falls, Maine, plant.

PH

OTO

: BO

RA

LEX


CONTRIBUTION

FUEL By Richard J. LeBlanc

Black Liquor Gasification Can Help Sustain Forests, Generate Ultra-Clean BiofuelsGasifi cation system process offers feedstock fl exibility and it can produce a variety of green fuels.

The claims and statements made in this article belong exclusively to the author(s) and do not necessarily refl ect the views of Biomass Magazine or its advertisers. All questions pertaining to this article should be directed to the author(s).

Globally, renew-able automotive fuels are increas-ingly promoted

with the help of tax credits, certifi cates systems and leg-islated mandatory use. The primary goals are increased supply security and reduced net emissions of greenhouse gases (GHGs). A vastly in-creased production and use of biofuels is not, however, un-

problematic. To en-sure the long-term viability of biofuels, their production and use must meet some fundamental requirements:

The raw ma-terial production must have a high sustainable land use effi ciency to enable a high production

volume on the lim-ited land area avail-able; use minimal resource for cultiva-tion; give low direct and indirect GHG emissions from cul-tivation; and prefer-ably not use prime agricultural land to minimize competi-tion with food pro-duction.

The conversion effi -ciency of the raw material to the biofuel must be high.

The engine effi ciency when using the fuel must be high.

The cost of the biofuel must be competitive.

Only when these crite-ria are met will it be possible to produce truly meaningful volumes of biofuels that will have a large positive impact on

Richard LeBlancCEO Chemrec



our supply security and GHG emissions and without other severe negative effects.

Black liquor gasifi cation is a well-developed cellulosic biofuels technology that shows outstanding results when eval-uated against these criteria.

The TechnologyGasifi cation has long been

used to convert coal, oil and natural gas into syngas con-taining the building blocks of valuable fuels and chemicals. Black liquor is a byproduct of the kraft pulp production process and also an excellent gasifi cation feedstock for syn-gas production. Black liquor consists of dissolved wood substance, mostly lignin, and spent pulping chemicals. It is traditionally burned by mills in a Tomlinson-type recovery boiler to produce steam to drive the pulp mill processes and to recover the spent pulp-ing chemicals. A gasifi cation-based biofuels unit added to an existing pulp mill includes mostly well-proven technol-ogy extensively used in the petrochemicals industry. The building blocks are:

An oxygen plantA black liquor gasifi er

and gas cooler/steam genera-tor

A plant for removing carbon dioxide and hydrogen sulfi de from the raw syngas

A fuel synthesis plant where liquid fuel is synthe-sized from the syngas

A distillation plant where the fuel produced is pu-rifi ed to meet product specifi -cations.

The patented Chemrec process, when added to a kraft pulp mill, converts black liquor, a mill byproduct, into syngas, the building block of renewable fuels and biochemicals. The gas cooler removes particulate matter and cools the gas before the next stage removes carbon dioxide and hydrogen sulfi de from the raw gas. Other processes in an integrated biorefi nery use established technologies already proven in the petrochemicals industry.

SOURCE: CHEMREC

SOURCE: AB VOLVO BIOFUELS STUDY


ents of the biomass can be utilized. The result is very high land-use ef-ficiency both in terms of amount of fuel possible to produce per acre and year and in terms of being able to use marginal land and low-input production methods, all important for sustainable biofuels production. These are aspects that become even more important when the hot issue of GHG release from indirect land-use change is taken into consider-ation.

High Efficiency, Low Emissions

Not only does the process have high energy feedstock flex-ibility, it can also produce a variety of green fuels, including dimethyl ether (DME), methanol, ethanol, synthetic diesel, synthetic gasoline and biogas.

Biofuels from a black liquor gasification process excel in terms of well-to-wheel carbon dioxide emission reduction and energy ef-ficiency. This was confirmed by an extensive European study per-formed by the research institutes of the auto and refinery industries and the Joint Research Centre of the European Commission. The study included many different feed-stocks, conversion processes and fuel products. Synthetic diesel and DME from forest harvest residues over the black liquor gasification route both showed among the high-est well-to-wheel greenhouse gas reduction and energy efficiency.

The total available black liquor volume in the U.S. is with the con-version efficiency of this process, equivalent to approximately 5 bil-lion gallons per year as ethanol. The renewable fuels standard calls for 16 billion gallons of cellulosic biofuels by 2022 so this route can give a significant contribution to meeting this target.

Producing and Using Biomass Efficiently

The concept also includes a conven-tional biomass boiler to make up the en-ergy deficit that otherwise would result from the export of energy-rich biofuel from the pulp mill. In essence, a feed-stock swap is made—the ideal gasification feedstock black liquor is withdrawn from the pulp mill and replaced by any kind of low-grade biomass. The boiler fuel could

be forestry or industrial wood waste, ag-ricultural waste such as corn stover or wheat straw, purpose-grown biomass such as switchgrass or willow or even the organic fraction of municipal waste.

When using purpose-grown biomass, the only quality requirement is that the biomass burns well in a boiler. This means that the selection of what to grow can be based solely on productivity, production cost and the environmental impact of the cultivation. Also, all parts and constitu-



Transforming the Pulpand Paper Industry

U.S. pulp and paper companies today are meeting fierce competi-tion from low-cost producers over-seas and from alternative solutions in both packaging and printed me-dia. Mill operators and their inves-tors now have a viable option for breathing new life into the industry by transforming mills into biorefin-eries that use this fuels-from-the-forest process.

This transformation completely alters a pulp mill’s competitive posi-tion by adding 30 percent to 50 per-cent of profitable revenue with the typical 25 percent to 40 percent in-ternal rate of return. It also makes needed reinvestment possible by re-placing aged recovery boilers with high-maintenance costs and low performance. In many cases, the fuels plant investment can also be used to provide additional recovery capacity allowing for higher pulp production.

Mills producing as little as 500 tons of black liquor solids per day are viable as fuels-from-the-forest biorefineries using this method. Most mills are considerably larger. At the minimum capacity size, such a biorefinery mill would produce upwards of 8 million gallons a year of green motor fuel calculated as gasoline equivalents.

At a mill investing in second-generation biofuels technology, jobs are not only preserved, but ad-ditional jobs are created, primarily for the extraction of biomass from the forest as well as to operate and maintain the biofuels plant. Other economic and public opinion bene-fits are considerable as well, such as possible tax benefits and air emis-sions reductions.

Typically, a capital investment for a biorefinery project that uses fuels from the forest is $200 million to $400 million, depending on plant

size and the costs to interconnect to the mill. While investment scenarios can vary, a common one is collaboration of fund-ing from the technology provider, the mill itself, investors, and state and fed-eral grants. The black liquor gasification industry is actively pursuing federal and state grants and loan guarantees to ramp up this technology as quickly as possible to large-scale commercial capacity.

As a source of ultra-clean, renewable motor fuels, the black liquor biomass gas-

ification route that transforms pulp and paper mills into biorefineries is standing up to critical scrutiny as a viable and prac-tical way of producing alternative, renew-able energy, while making good use of the land and being gentle to the environ-ment. BIO

Richard J. LeBlanc is CEO of Chemrec AB and its North American subsidiary, Chem-rec USA. Reach him at [email protected].


Powered by:

things are heating up in chicago!

THE INTERNATIONAL CONFERENCE ON THERMOCHEMICAL CONVERSION SCIENCE

111111111111111111116–18888888888888 septtttttttttttteeeeeeeeeeeeeeeeeeeeeeemmmmmmmmmmbbbbbbbbbbbbbbbeeeeeeeeeeeeeeeeeeerrrrrrrrrrrrrrr 22222222222222222222222000000000000000000000000000000000000009999999999999999999999sherrrrrrrrrraatonn ccccccccccchihihihihihihhihihhhicacacacacacacacaaaaacaacaacaaagogogogogogogogogoggogoo h hhh hh hh h h h h hhhhhototototootototottototottttttteeleeeeeeeeeeeel & &&&& tt ttowowwwwwwowowowowwwwowowwwowowwwowwwoowo ererererrereerssssssssss

www.gastechnology.org/tcbiomass2009

ENERGYU.S. DEPARTMENT OF

IEA Bioenergy

join us at the only global

scientific forum on

thermochemical biomass

conversion science—

Three days of peer-reviewed scientific

sessions on gasification; pyrolysis; and

pretreating and upgrading


EERCUPDATE

The U.S. economy is in need of recovery, and bio-mass may be part of the remedy. The government is pouring millions into biomass as a result of the American Recovery and Reinvestment Act of 2009. The stimulus dollars are intended to supercharge new ways to convert biomass into electricity, heat, fuels and other consumable products. The Energy & Environmental Research Center has been advancing the same goals for the past 10 years, investing in biomass research and development and also in the next essential step: getting the technology out of the laboratory and into the commercial marketplace.

Through the EERC’s Centers for Renewable Ener-gy and Biomass Utilization, several biomass technologies are being advanced that coincide with the ARRA’s goals. For all of these EERC technologies, federal dollars are being matched with private industry dollars to increase the utilization of biomass in the emerging renewable energy industry. The goal is to reduce carbon emissions and stimulate economies, especially in rural agricultural areas, by using domestic biomass as an energy resource. A few of the topics to be carried out this year include:

Developing economical technologies for refining domestic biomass to clean renewable fuels, including ethanol, biodiesel, butanol, higher alcohols, Fischer-Tropsch distillates or 100 percent renewable diesel, jet fuels, and hydrocarbon fuels such as renewable gasoline: This is the most exciting area of biomass tech-nology development. Pilot-scale and small commercial plants for biofuels that use cellulosic biomass or other nonfood-grade feedstocks are being designed or built, with two to four years to either make it or break it. Many of us have heard for more than three decades that bio-fuels are only fi ve years away. Current activities by many, including the EERC, are narrowing in on that fi ve-year window.

Producing hydrogen from biomass and ethanol using advanced gasification and reforming technolo-gies: Although hydrogen seems to have been left out of ARRA, the EERC and others think it has to become a player in the development of the new high-effi ciency power systems of the future. Biomass provides a key sustainable renewable feedstock from which hydrogen can be produced.

Developing distributed biomass power systems in the less than 20-megawatt range: Both conventional biomass stoker or fl uidized-bed power systems and ad-vanced biomass gasifi cation systems are components of EERC project development. Every biomass type is unique because of different plant species, natural and artifi cial soil constituents, geography, and climate; there-fore, conventional biomass power systems often still re-quire research. Gasifi cation technologies for ultraclean

syngas production are still in the infant stages and will require more vigorous testing.

Integrating biomass with fossil fuels in large-scale utility systems: Utilities have tried bio-mass before—with little success. The reason is that the cost for implementing cofi ring strategies is expensive and risky. New legisla-tion and incentives are inevitable, and the cofi ring climate is chang-ing; therefore, conventional cofi r-ing strategies will require research and testing to optimize effi ciency and costs, ongoing activities at the EERC.

Processing biomass feed-stocks for use in integrated biore-fi neries and conventional and ad-vanced integrated power systems is an unheralded step in producing economical feedstocks for bioen-ergy and biofuels. Before biomass is converted, it has to be transported and processed via shredding, chop-ping, pulverizing, pelletizing, torrefying, or hydrolyzing. The EERC is working on fast pyrolysis as a means to circumvent the plethora of methods to transport and process biomass.

The jury is still out on whether biorefi neries for cel-lulosic biomass feedstocks will produce economical bio-fuels and bioenergy, but not for long. Two decades from now, the U.S. hopes to have replaced 30 percent of its liquid fuels with biofuels. That’s a short time relative to the fi rst uses of gasoline in the late 1800s. With respect to research, the timeline shrinks dramatically, since we are defi nitely in the midst of a two- to four-year window where technologies and economics are being proved. The EERC sees great successes from research projects already ongoing. ARRA funding for biomass research can only help to magnify the success of other biofuels and bioenergy efforts. Whether we reach 30 percent or not, there appears to be momentum toward replacing a signifi cant portion of our energy resource base with bio-mass. BIO

Bruce Folkedahl is a senior research manager, and Chris Zygarlicke is a deputy associate director for research at the EERC. They can be reached at [email protected], (701) 777-5243, and [email protected], (701) 777-5123.

Biomass as a Medicine for Recovery

Chris Zygarlickedeputy associate director, EERC

Bruce Folkedahlsenior research manager, EERC


ADI’s waste-to-energy systemsproduce renewable energy to offset electrical and natural gas expenses.

www.adisystemsinc.comADI Systems Inc. 1.800.561.2831 [email protected]

Water reuse/reclamation

Biogas recovery, scrubbing and utilization systems

Eliminate surcharges and meet stringent effluent limits

The Source for Waste-to-Energy Systems

MARKETPLACEBIOMASS MAGAZINE

biomass magazine -july 2009

Documents

biomass magazine

biomass fl

renewable energy

energydense biobutanol

cellulosic bioethanol

woody biomass balancing

forestry residuals

oregon company