bioactivity of plants secondary metabolites...

BIOACTIVITY OF PLANTS SECONDARY METABOLITES

Estrogenic, cytotoxic and anabolic effects on estrogen

target organs of an extract of Erythrina excelsa and

Ecdysterone

A thesis presented to:

The Institute of Cardiovascular Research and Sports Medicine

Department of Molecular and Cellular Sports Medicine

German Sport University Cologne

In partial fulfillment of the requirements for the degree

PhD in Natural Sciences

by:

Sadrine Tchoukouegno Ngueu

From Bamenyam, Cameroon

Members of the jury:

- Prof. Dr. Patrick Diel (First referee)

- Prof. Dr. Günter Vollmer (Second referee)

- Prof. Dr. Wilhelm Schänzer

- Dr. Frank Hülsemann

Date of defence: 05.09.2013

Gedruckt mit Unterstützung des Deutschen Akademischen Austauschdienstes (DAAD)

Versicherung gem. § 7 Abs. 2 Nr. 4

Hierdurch versichere ich:

Ich habe diese Arbeit selbständig und nur unter Benutzung der angegebenen

Quellen und technischen Hilfen angefertigt; sie hat noch keiner anderen Stelle zur

Prüfung vorgelegen. Wörtlich übernommene Textstellen, auch Einzelsätze oder Teile

davon, sind als Zitate kenntlich gemacht worden.

……………………………………


Erklärung gem. § 7 Abs. 2 Nr. 5

Hierdurch erkläre ich, dass ich die Leitlinien guter wissenschaftlicher Praxis der

DeutschenSporthochschule Köln in der aktuellen Fassung eingehalten habe.

……………………………………


I dedicate this work to:

God almighty and to Jesus Christ my Lord and

Savior in whom I trust.

My lovely husband Olivier Ndiapi for his

endless support through happy and difficult

times. These 4 years away from each other

were challenging but your support was always

an encouragement to me.

Acknowledgements

M.Sc. Sadrine Tchoukouegno Ngueu vi

Acknowledgements

I would not have completed this work without the help and support of several

persons. Foremost, special thanks go to my supervisor Prof.Dr. Patrick Diel who did

not only give me his support throughout the completion of my thesis work, but also

supported me with the DAAD scholarship application procedure. I extend my thanks

to Prof. Guenter Vollmer for his helpful pieces of advice regarding my work and who,

during these years, wrote letters of recommandation that helped extend my

scholarship. I am also grateful to Prof. Dr. Maria Paar who guided me through my first

chromatographic separation.

I thank the German academic service exchange (DAAD) for granting me the

scholarship.

I had the opportunity to work in a team composed of persons from different

horizons and experiences which was very helpful not only for my academic

advancement, but also contributed to build certain traits of my character. I think of my

colleagues Jonas Hengevoß, Xiao Juan Hu, Sephanie Mosler, Felix Kluxen, Nora

Zoth, Almut Molzberger, Carmen Weigt, Tina Blei, Dennis Mueller, and Martina

Velders. I specially thank Felix Kluxen not only for the helpful tips in the lab, but also

for his availability and patience towards me during my first days in Germany.

My gratitude also goes to our technical assistant crew composed of Anika

Voß, Ute Laudenbach-Leschowski, Ghilav Mojgan, and Bianca Collins who were

always available to assist me in the pratical aspects of laboratory work. Special

thanks go to Ute Laudenbach for her support in all aspects of animal experiments.

I would also like to acknowledge the support of my former Master degree

supervisor, Prof. Njamen Dieudonne, during my scholarship application process and

during my PhD thesis work.

Acknowledgements

M.Sc. Sadrine Tchoukouegno Ngueu vii

Special thanks to Maria Halabalaki (School of pharmacy, University of Athens)

for her support in my work and for granting me the opportunity to carry out an

internship in the pharmacognosy laboratory of the University of Athens.

I will not forget Job Tchoumtchoua who has been more than a friend to me.

Thank you for the long discussions over the phone and for introducing and

supervising me in your lab in Athens.

I thank Raoul Kempkes of the Biochemistry department for his technical

support in the use of the flow cytometer.

Finally, I thank my family for their continuous support in the course of my

education. I think also of my late parents and my late elder brother who took me as

he his own child and guided me throughout my studies.

Zusammenfassung

M.Sc. Sadrine Tchoukouegno Ngueu viii

Zusammenfassung

Heilpflanzen dienen als primäre Gesundheitsversorgung in den meisten

asiatischen und afrikanischen Ländern. In westlich geprägten Ländern in denen

hauptsächlich auf naturwissenschaftlichen Grundsätzen basierende Medizin

praktiziert wird, werden Stoffe aus pflanzlicher Herkunft entweder direkt als

Kräuterformulierungen oder als Ergänzung zu bestehenden Therapien verwendet.

Daneben können Pflanzen mit aktiven Wirkstoffen auch Teil der Ernährung sein. Es

besteht die allgemeine Überzeugung, dass pflanzliche Heilmittel aufgrund ihres

natürlichen Ursprungs sicher sind. Daher werden sie oft im Rahmen

selbsttherapeutischer Maßnahmen verwendet und sind in Deutschland auch nicht

rezeptpflichtig. Diese Arbeit beschäftigt sich mit der Bioaktivität, Wirkungen aber auch

potentiellen Nebenwirkungen derartiger pflanzlicher Heilmittel. Hierbei stehen

Extrakte aus Erythrina excelsa sowie die Substanz Ecdysterone im Mittelpunkt des

Interesses. Erythrina excelsa ist eine Pflanze die in der kamerunischen traditionellen

Medizin zur Behandlung von Wechseljahrsbeschwerden und gynäkologische

Tumoren Anwendung findet. Ob Erythrina excelsa allerdings wirklich

pharmakologisch aktive Substanzen enthält, die derartige Wirkungen erzielen

können, wurde bisher noch nicht untersucht. Ecdysterone (Ecdy) ist ein Inhaltsstoff

von verschiedenen Pflanzen, die in der chinesischen, ayurvedischen und russischen

traditionellen Medizin zur Behandlung unterschiedlichster Beschwerden verwendet

werden. Für Ecdy konnte eine anabole Wirkung in vitro und in vivo gezeigt werden.

Obwohl die zugrunde liegenden Mechanismen noch nicht aufgeklärt sind, wird es

intensiv als Nahrungsergänzungsmittel zur Steigerung des Muskelaufbaus beworben

und auch von Bodybuildern verwendet. Ein Missbrauch zum Doping in anderen

Sportarten wird befürchtet. Die Ziele dieser Arbeit waren zum einen die Bioaktivität

von Extrakten von Erythrina excelsa, die in Bezug zur traditionellen Anwendung in

der Naturmedizin stehen, sowie die biologisch aktiven Inhaltsstoffe in den Extrakten

näher zu charakterisieren. Zum anderen sollten die Mechanismen der anabolen

Wirkung von Ecdysterone untersucht werden.

Zusammenfassung

M.Sc. Sadrine Tchoukouegno Ngueu ix

Mittels Yeast Estrogen Screen (YES), uterotrophen Assay und des MTT-Assay

konnte gezeigt werden, dass ein Äthanolextrakt von E. excelsa östrogene/anti-

östrogene und zytotoxische Effekte aufweist. Eine dreitägige subkutane

Verabreichung des Extraktes in einer Dosis von 50 mg/kg KG/Tag an

ovariektomierten Wistar Ratten führte zu signifikanten östrogenen Wirkungen auf

morphometrische Parameter der Gebärmutter (Feuchtgewicht und epithelialen

Höhen) und auf die Expression von Östrogen-abhängigen Genen in der Gebärmutter

(C3 und Clusterin) und in der Leber (CaBP9K und IGFBP-1). Bei einer Dosis von 100

mg/kg KG/Tag zeigte der Extrakt unerwartet auf die beschriebenen biologischen

Endpunkte eine anti-östrogene Wirkung. Eine fünftägige Behandlung von

Estrogenrezeptor (ER) -positiven MCF-7 Brustkrebszellen mit dem Extrakt führte zu

einem biphasischen Profil: Bei niedrigen Konzentrationen kam es zu einem leichten

Anstieg der Zellviabilität, bei höheren Konzentrationen dagegen zu einer Induktion

von Zelltod. Dagegen wurde bei der Behandlung von ER negativen HT-29 Zellen

Zytotoxizität bei allen getesteten Konzentrationen beobachtet. Um die Wirkstoffe des

Extraktes näher zu charakterisieren, wurde eine Vakuum Flüssigchromatographie

Fraktionierung durchgeführt. Biologisch aktive Fraktionen wurden mittels des YES

Assays identifiziert und die biologische Wirkung dieser Fraktion auf Proliferation und

Apotose von MCF-7-Brustkrebs-Zellen mittels Durchflusszytometrie,

Genexpressionsanalyse und Immunhistochemie untersucht. Die Dichloromethan-

Methanol (50:50 v/v) Fraktion (F4), die in Bezug auf östrogene und zytotoxische

Wirkung die aktivste Fraktion war, zeigte eine nicht-monotone Konzentrations-

Wirkungs-Kurve auf den Zellzyklus, die Proliferation und Apoptose von MCF-7

Brustkrebszellen. Bei niedrigen Konzentrationen und in Abwesenheit von E2, förderte

F4 Östrogenrezenptor- abhängig die Proliferation von MCF-7 Zellen (Hochregulation

von Cyclin D1 und Herunterregulation des Bax/Bcl-2-mRNA Verhältnisses).

Interessanterweise wirkte F4 in den gleichen Konzentrationen bei Anwesenheit von

E2, als Antagonist und verhinderte ein E2-induziertes Zellwachstum. Bei höheren

Konzentrationen modulierte F4 den Zellzyklus zugunsten einer gesteigerten

Apoptose (Erhöhung des Caspase-gespaltenen Zytokeratin 18, Hochregulation des

Bax/Bcl-2 Verhältnisses und Herunterregulation von Cyclin-D1-mRNA). In

Zusammenarbeit mit der Arbeitsgruppe von Dr. Halabalaki von der Abteilung für

Pharmakognosie und Naturstoffchemie der Universität von Athen wurde eine weitere

Zusammenfassung

M.Sc. Sadrine Tchoukouegno Ngueu x

Charakterisierung des Extraktes mittels LC-HRMS und LC-HRMS/MS Analyse

durchgeführt um die im Extrakt enthaltenen Isoflavonoide zu identifizieren. Diese

Analyse zeigte, dass Pyran- und Prenyl-Isoflavonoidderivate die charakteristischen

chemischen Stoffe des Extrakts sind was auch die beobachtete Kombination der

biologischen Eigenschaften des Extraktes erklären könnte.

Im zweiten Teil dieser Arbeit wurden die anabolen Wirkmechanismen von

Ecdysterone, Erythrina excelsa Extrakt und Genistein in differenzierten C2C12

Myoblasten, einem Zellkulturmodell für Skelettmuskelhypertrophie untersucht. Als

untersuchter biologischer Endpunkt diente die Zunahme des Durchmessers von

C2C12 Myotuben. Für die nähere Charakterisierung der involvierten molekularen

Mechanismen wurden Studien mit Vergleichssubstanzen wie

Androgenrezeptoragonisten (DHT), Androgenrezeptorantagonisten (Flutamid),

anabol wirkende Peptidhormone (IGF-1) und verschiedene Östrogenrezeptor

bindende Substanzen mit agonistischen (E2), antagonistischen sowie ER alpha und

ER beta selektiven Bindungseigenschaften verwendet. Mit diesem Modell konnten

die wachstumsfördernden Wirkungen von IGF1, DHT, E2, Ecdy und des

Phytoestrogens Genistein auf die Skelettmuskulatur bestätigt werden. Co-

Behandlung von Myotuben mit Ecdy und ZK führte zu einer Hemmung der Ecdy-

induzierten Hypertrophie. Darüber hinaus führte auch eine Co-Behandlung von

Myotuben mit E2 oder Ecdy und dem selektiven ER beta Antagonisten zu einer

Antagonisierung der hypertrophen Wirkung von beiden Substanzen, was ein Zeichen

von ERβ-abhängigem Effekt ist.

Zusammenfassend zeigen die Befunde dieser Arbeit einerseits, dass der

Extrakt von Erythrina excelsa biologische Effekte aufweist, die in engem

Zusammenhang zu seiner traditionellen Verwendung stehen. Sie weisen auch darauf

hin, dass diese Pflanze eine Quelle pharmakologisch aktiver Stoffe ist, die von

potentiellem Interesse für weitere Untersuchungen sind. Darüber hinaus zeigen die

Ergebnisse dieser Arbeit, dass Stoffe mit ER beta Bindungseigenschaften das

Skelettmuskelwachstum fördern. Diese Erkenntnis ist von Interesse für die

Behandlung von atropischen Erkrankungen des Skelettmuskels wie z. B der

altersbedingten Abnahme der Muskelmasse (Sarkopenie). Allerdings kann dieser

Zusammenfassung

M.Sc. Sadrine Tchoukouegno Ngueu xi

Effekt auch zum Zwecke des Dopings missbraucht werden. Daher sind diese

Befunde auch für die Ausgestaltung von Anti-Doping-Bestimmungen von Bedeutung.

Summary

M.Sc. Sadrine Tchoukouegno Ngueu xii

Summary

Medicinal plants serve as primary health care in most Asian and African

countries. In developed countries where allopathic medicine is the most practiced

form of medicine, chemicals of plant origin are increasingly consumed either as

herbal formulations, diet, or complement to existing therapies in order to prevent or

treat diseases. There is a general belief that because of their natural origin, herbal

remedies are safe. Therefore they are commonly used in self therapeutic measures

and are not prescribed in Germany. This work deals with the bioactivity and potential

side effects of such herbal remedies. Namely the extract from Erythrina excelsa and

the pure compound Ecdysterone were the focus of our attention. Erythrina excelsa is

a plant used in the Cameroonian traditional medicine to alleviate menopausal

symptoms and to treat female gynecological tumors. However, no test for biological

activities evidencing these health benefit claims has been made so far. Ecdysterone

(Ecdy) is the principal constituent of several plants used in the Chinese, Ayurvedic,

and Russian traditional medicines to treat various ailments. Ecdy has been shown to

exert anabolic properties in vitro and in vivo. Although the mechanisms underlying

these effects are not yet elucidated, it is advertised as a food supplement to increase

muscle mass and physical performance and is used by bodybuilders. A misuse for

doping purpose in sports is suspected. The aims of this thesis were on the one hand

to investigate the biological activities likely to explain the traditional use of Erythrina

excelsa and to characterize its biologically active ingredients. On the other hand, this

work also aims at examining the mechanisms underlying the anabolic effect of

ecdysterone

Using the yeast estrogen screen, the uterotrophic assay, and the MTT assay,

we showed that an ethanol extract of E. excelsa exhibits estrogenic/anti-estrogenic

and cytotoxic effects. A three-day subcutaneous administration of the extract at a

dose of 50 mg/kg BW/day to ovariectomized Wistar rats produced significant

estrogenic effects on uterine morphometric parameters (wet weight and epithelial

height) and on the gene expression of estrogen responsive genes in the uterus (C3

Summary

M.Sc. Sadrine Tchoukouegno Ngueu xiii

and Clusterin) and in the liver (CaBP9K and IGFBP-1). Unexpectedly, at a dose of

100 mg/kg BW/day the extract significantly decreased the same parameters below

the control level indicating anti-estrogenic effects. The extract exhibited a biphasic

profile on the growth of ER positive MCF-7 cells with a slight increase of cell viability

at low concentrations and induction of cell death at higher concentrations. But on ER

negative HT-29, cytotoxicity was observed at all concentrations tested. To get more

insights into the active principles of the extract, a bioactivity-guided fractionation was

performed and the bioactive fractions were identified by means of both YES and XTT

assays. The effect of the most active fraction [Dichloromethane-Methanol (50:50, v/v)

(F4)] on the proliferation and apoptosis of MCF-7 breast cancer cell line was

assessed by flow cytometry, gene expression analysis and immunohistochemistry.

F4 exhibited a non-monotonic concentration-response effect on the proliferation and

apoptosis of MCF-7 breast cells. At low concentrations and in the absence of E2, F4

promoted cell cycle progression through ER signaling and modulated gene

expression in favor of cell survival (upregulation of cyclin D1 and and downregulation

of the Bax/Bcl-2 ratio mRNA). Interestingly, when E2 was present, F4 at the same

concentrations acted as an antagonist and prevented E2-induced cell growth. At

higher concentrations, F4 modulated the cell cycle in favor of increased apoptotic cell

death (increase of caspase cleaved cytokeratin 18, upregulation of Bax/Bcl-2 ratio

and downregulation of cyclin D1 mRNA). In collaboration with the group of Dr.

Halabalaki from the Department of Pharmacognosy and Natural Products Chemistry

of the Unviversity of Athens, a LC-HRMS and LC-HRMS/MS analysis was performed

to identify the isoflavonoids contained in the extract. This analysis showed that pyran

and prenyl derivatives of isoflavonoids are the most characteristic chemical groups of

the extract and may explain the observed biological activities.

In the second part of this work, the mechanisms of the anabolic effect of

ecdysterone, Erythrina excelsa extract and other plant secondary metabolites such

as genistein were studied in a cell culture model of differentiated C2C12 myoblasts.

This test system is a well established model to study the ability of anabolic

substances to induce skeletal muscle hypertrophy as measured by the increase in

the diameter of myotubes. Several comparative substances such as androgen

receptor agonist (DHT) and antagonist (flutamide), anabolic peptide hormone (IGF-1),

Summary

M.Sc. Sadrine Tchoukouegno Ngueu xiv

and different estrogen receptor binding compounds with agonistic (E2), antagonistic

(ZK), and ERα and ERβ selective binding properties were used for the

characterization of the involved molecular mechanisms. With this model, we

confirmed the skeletal muscle growth-promoting effects of IGF1, DHT, E2, Ecdy, and

the phytoestrogen genistein. Co-treatment of myotubes with ZK and Ecdy led to an

inhibition of Ecdy-induced hypertrophy. In addition, a co-treatment of myotubes with

E2 or Ecdy and the selective ERβ antagonist prevented both substances to induce

myotube hypertrophy, what unequivocally shows an ERβ-mediated effect.

In general, the results of this work show that the extract of Erythrina excelsa

has biological activities that are in close agreement with its reported traditional use to

manage menopausal complaints and to treat female gynecological tumors. They also

highlight the fact that this plant is a source of substances of potential interest for

further pharmacological investigations. In addition, our findings also show that

substances with ERβ binding affinity promote skeletal muscle growth and may

provide new insights into therapeutic strategies for the treatment of skeletal muscle

atrophic conditions such as the age-related decline in muscle mass (sarcopenia).

However, this effect may be misused for doping purpose and is therefore also of

importance for Anti-doping regulation.

Table of contents

M.Sc. Sadrine Tchoukouegno Ngueu xv

Table of contents

Acknowledgements ................................................................................................................. vi

Zusammenfassung ................................................................................................................. viii

Summary .................................................................................................................................. xii

Table of contents ..................................................................................................................... xv

List of figures .......................................................................................................................... xix

List of Tables ........................................................................................................................ xxiii

List of abbreviations ............................................................................................................ xxiv

CHAPTER 1: INTRODUCTION ................................................................................................. 1

1.1 Description of the research problem ............................................................................... 2

1.2 Aims and objectives of the thesis .................................................................................... 4

CHAPTER 2: LITTERATURE REVIEW .................................................................................... 6

Section 2.1: Estrogens ............................................................................................................ 7

2.1.1 Synthesis and endogenous sources ............................................................................ 7

2.1.2 Transport and metabolism ............................................................................................. 8

2.1.3 Mechanism of action ....................................................................................................... 9

2.1.3.1 Structure of estrogen receptors ......................................................................................... 9

2.1.3.2 Tissue distribution.............................................................................................................. 11

2.1.3.3 Mechanism of estrogen action (Figure 5) ...................................................................... 12

2.1.3.3.1 Genomic actions ......................................................................................................... 12

2.1.3.3.2 Non-genomic actions ................................................................................................. 14

2.1.4 Estrogens and health.................................................................................................... 15

2.1.4.1 Estrogens and hormone-dependent cancers ................................................................ 15

2.1.4.5 Estrogen and skeletal muscle .......................................................................................... 17

Table of contents

M.Sc. Sadrine Tchoukouegno Ngueu xvi

Section 2.2: Phytoestrogens ................................................................................................. 19

2.2.1 Definition and sources ................................................................................................. 19

2.2.2 Absorption and metabolism ........................................................................................ 20

2.2.3 Mode and mechanisms of action ................................................................................ 21

2.2.4 Phytoestrogens and health .......................................................................................... 22

2.2.4.1 Phytoestrogens and the reproductive health ................................................................. 22

2.2.4.2 Phytoestrogens and gynecological cancers .................................................................. 22

2.2.4.3 Phytoestrogens and menopausal symptoms ................................................................ 24

Section 2.3: Erythrina excelsa Baker ................................................................................... 26

2.3.1 Taxonomy ...................................................................................................................... 26

2.3.2 Description and geographical distribution ................................................................ 27

2.3.3 Active constituents of plants of the genus Erythrina ............................................... 27

2.3.4 Traditional uses of Erythrina excelsa Baker .............................................................. 27

Section 2.4: Ecdysterone ...................................................................................................... 29

2.4.1 Origin and sources ....................................................................................................... 29

2.4.2 Biological effects .......................................................................................................... 30

Section 2.5: Marker genes used ........................................................................................... 33

2.5.1 Complement component 3 (C3) ................................................................................... 33

2.5.2 Clusterin ......................................................................................................................... 33

2.5.3 Insulin-like growth factor binding protein 1 (IGFBP-1)............................................. 33

2.5.5 Cyclin D1 (CCND1) ........................................................................................................ 34

2.5.6 Bax .................................................................................................................................. 34

2.5.7 Bcl-2 ................................................................................................................................ 35

CHAPTER 3: MATERIAL AND METHODS ............................................................................ 36

3.1 Material .............................................................................................................................. 37

3.1.1 Substances ............................................................................................................................ 37

3.1.2 Chemicals, consumables and lab equipments ................................................................. 39

Table of contents

M.Sc. Sadrine Tchoukouegno Ngueu xvii

3.1.3 Test organisms ...................................................................................................................... 44

3.2 Methods ............................................................................................................................. 45

3.2.1 Preparation of cell culture media and buffers ................................................................... 45

3.2.3 LC-HRMS and LC-HRMS/MS analysis ............................................................................. 49

3.2.4 Vacuum liquid chromatography (VLC)............................................................................... 50

3.2.5 HPLC ...................................................................................................................................... 50

3.2.6 Yeast estrogen screen ......................................................................................................... 51

3.2.7 MTT/XTT assays ................................................................................................................... 54

3.2.8 Myotubes diameter assay .................................................................................................... 54

3.2.9 Western blot ........................................................................................................................... 56

3.2.10 Uterotrophic assay.............................................................................................................. 57

3.2.11 Histological analysis of tissues ......................................................................................... 58

3.2.12 Gene expression analysis ................................................................................................. 60

3.2.13 Cell cycle analysis .............................................................................................................. 63

3.2.14 Immunocytochemistry ........................................................................................................ 65

3.2.15 Statistical analysis .............................................................................................................. 66

CHAPTER 4: RESULTS .......................................................................................................... 67

4.1 Biological activities and chemical characterization of Erythrina excelsa ................ 68

4.1.1 Estrogenic and Cytotoxic properties of E.excela whole extract ............................ 68

4.1.1.1 Yeast estrogen screen ...................................................................................................... 68

4.1.1.2 Uterotrophic assay ............................................................................................................ 70

4.1.1.2.1 Effect of E. excelsa whole extract on the uterus ................................................... 70

4.1.1.2.2 Effect of E. excelsa whole extract on the vagina ................................................... 72

4.1.1.2.3 Effect of E. excelsa whole extract on the liver IGFBP-1 and CaBP9k mRNA

expression .................................................................................................................................... 73

4.1.1.3 MTT assay .......................................................................................................................... 74

4.1.2 Effect of a phytoestrogenic fraction of E. excelsa on the growth of the human

breast cancer line MCF-7. ...................................................................................................... 75

Table of contents

M.Sc. Sadrine Tchoukouegno Ngueu xviii

4.1.2.1 Yeast estrogen screen ...................................................................................................... 75

4.1.2.2 XTT ...................................................................................................................................... 76

4.1.2.3 HPLC fingerprints of F4 and E. excelsa whole extract ................................................ 78

4.1.2.4 Effect of F4 on MCF-7 cell cycle distribution ................................................................. 78

4.1.2.4.1 Antagonisation with ZK .............................................................................................. 80

4.1.2.4.2 Cotreatment with E2 .................................................................................................. 81

4.1.2.5 M30 staining ....................................................................................................................... 83

4.1.2.6 Effect of F4 on the mRNA expression of CCND1, Bax and Bcl-2 in MCF-7 cells ... 83

4.1.3 Chemical characterisation of E. excelsa extract ....................................................... 84

4.2 Effects of estrogens and chemicals of plant origin on skeletal muscle growth ...... 92

4.2.1 E2, genistein, and Ecdysone induce hypertrophy of C2C12 murine skeletal muscle

cells ................................................................................................................................................... 92

4.2.2 Role of ER and AR on ecdysone induced myotube hypertrophy .................................. 92

4.2.3 Role of ERα and ERβ in skeletal muscle growth ............................................................. 93

CHAPTER 5: DISCUSSION .................................................................................................... 98

5.1 Biological activities of Erythrina excelsa ...................................................................... 99

5.1.1 Estrogenic/anti-estrogenic and cytotoxic properties of E. excelsa ................................ 99

5.1.2 Effect of a phytoestrogenic faction of E. excelsa on the growth of the human breast

cancer line MCF-7. ....................................................................................................................... 103

5.2 Effect of estrogens and chemicals of plant origin on C2C12 murine skeletal muscle

cells growth. ...........................................................................................................................105

CHAPTER 6: CONCLUSION AND PERSPECTIVES ...........................................................108

Bibliography ...........................................................................................................................111

Publications and presentations ...........................................................................................141

Curriculum vitae ....................................................................................................................142

List of figures

M.Sc. Sadrine Tchoukouegno Ngueu xix

List of figures

Figure 1: Source of drugs (Adapted from (Cragg and Newman, 2013)). .................................... 3

Figure 2: Biosynthesis of estrogens in ovaries (Campbell reproductive biology July 2012:

http://kcampbell.bio.umb.edu). SCC=P450scc= cholesterol side-chain cleavage enzyme; 3β-

HSD= 3β-hydroxysteroid dehydrogenase. The conversion of androstenedione to testosterone

is mediated by the enzyme 17β- hydroxysteroid dehydrogenase (17β-HSD). ........................... 8

Figure 3: (A) Modular structure of nuclear receptors (Adapted from (Nilsson et al., 2001) and

(B) protein sequence homology of the two ERs (Adapted from (Shao and Brown, 2004);

percentages of homology are from Faulds et al. (2012). .............................................................. 10

Figure 4: ERs distribution in male and female organs (Nilsson and Gustafsson, 2011) ......... 11

Figure 5: Molecular pathways of ERs actions (Heldring et al., 2007). TF= transcription factor;

SM= second messenger. ................................................................................................................... 14

Figure 6: Mechanisms of estrogens-induced cancer .................................................................... 17

Figure 7: Major classes of phytoestrogens ..................................................................................... 20

Figure 8: Overview of possible actions of phytoestrogens in relation to cancer (adapted from

(Mense et al., 2008)). ......................................................................................................................... 24

Figure 9: Erythrina Excelsa (April 2011 in Kumba-Cameroon by Stephane Zingue) ............... 26

Figure 10: 20-hydroxyecdysone (20 HE) or Ecdysterone ............................................................ 29

Figure 11: Pathways of Ecdysterone-induced protein synthesis in skeletal muscle (Gorelick-

Feldman et al., 2010). 20HE: 20-hydroxyescdysone; PIP2: phosphatidylinositol-4,5-

diphosphate; PLC: phospholipase C; IP3: Inositol-1,4,5-triphosphate; IP3R: IP3 receptor; SR:

sarcoplasmic reticulum. ..................................................................................................................... 31

Figure 12: Estrogen-inducible expression in yeast (Routledge and Sumpter, 1996). .............. 52

Figure13: Cell culture procedure for cell cycle analysis. .............................................................. 64

Figure 14: Effect of E. excelsa whole extract as compared to genistein and E2 on the

expression of β-galactosidase in yeast cells. The graph depicts the concentration of 17β-

estradiol, genistein, ZK and E. excelsa ethanolic extract plotted against the CAUs of the

medium after 3 days of incubation (A) estrogenicity; (B) antagonism of E. excelsa with ZK

and (C) anti-estrogenicity. ................................................................................................................. 69

Figure 15: (A) Uterine wet weight (mg/kg BW) and (B) uterine epithelial height (µm) after 3-

day subcutaneous treatment of ovariectomized Wistar rats with either E. excelsa ethanolic

List of figures

M.Sc. Sadrine Tchoukouegno Ngueu xx

extract (50 and 100 mg/kg BW/day) or E2 (4 µg/kg/BW/day). (C) 100X Microphotographs of

uterine tissue following a Hematoxylin-Eosin (HE) staining. Mean values ± S.D. are given for

n = 6 animals per dose group ** p≤ 0.01;*p≤0.05, significantly different from the control group

(Ovex), Kruskal-Wallis H-test followed by Mann–Whitney U-test. .............................................. 71

Figure 16: (A) Relative mRNA expression of C3 and (B) clusterin (normalized to the mRNA

amount of 1A and compared to the vehicle control group) in the uterus of ovariectomized

Wistar rats treated subcutaneously for 3 consecutive days with 50 and 100 mg/kg BW/day E.

excelsa ethanolic extract and 4 µg/kg/BW/day E2. * P≤0.05 significantly different from the

control group (Ovex), Kruskal-Wallis H-test followed by Mann-Withney U-test. ....................... 72

Figure 17: (A) Vaginal epithelial height (µm) after 3-day subcutaneous treatment of

ovariectomized Wistar rats with either E. excelsa ethanolic extract (50 and 100 mg/kg

BW/day) or E2 (4 µg/kg/BW/day). (B) 100X Microphotographs of vagina tissue following a

Hematoxylin-Eosin (HE) staining. Mean values ± S.D. are given for n = 6 animals per dose

group ** p≤ 0.01;*p≤0.05, significantly different from the control group (Ovex), Kruskal-Wallis

H-test followed by Mann–Whitney U-test. ....................................................................................... 73

Figure 18: Relative mRNA expression of (A) IGFBP-1 and (B) CaBP9k (normalized to the

mRNA amount of 1A and compared to the vehicle control group) in the liver of

ovariectomized Wistar rats after 3-day subcutaneous administration of 50 and 100 mg/kg

BW/day E. excelsa ethanolic extract and 4 µg/kg/BW/day E2. *P≤0.05, Kruskal-Wallis H-test

followed by Mann-Withney U-test. ................................................................................................... 74

Figure 19: Effects of E. excelsa whole extract on the growth of (A) MCF-7 and (B) HT-29

cells. Results present the average and standard deviation of n≥3 independent experiments

performed in 6 replicates for each concentration. ......................................................................... 75

Figure 20: Effect of fractions of E. excelsa on the expression of β-galactosidase in yeast

cells. (A) VLC fractions, (B) active fractions compared to the whole extract. The graphs depict

the concentration of test chemicals plotted against the CAUs of the medium after 3 days of

incubation. ............................................................................................................................................ 76

Figure 21: (A) Effect of estrogenic fractions of E. excelsa ethanol extract on MCF-7 cell„s

viability. (B) F4 compared to the whole extract. MCF-7 cells were incubated for 72 h with

increasing concentrations of fractions or whole extract and the cell viability examined by

XTT.* (p≤0.05) and *** (p<0.001) vs. control analyzed by Kruskal Wallis H-test followed by

Mann Whitney U-test. ......................................................................................................................... 77

Figure 22: HPLC chromatograms of E. excelsa whole extract and F4 fraction ........................ 78

Figure 23: Effects of F4 on the cycle distribution of MCF-7 cells. MCF-7 cells were incubated

for 48 h with increasing concentrations of F4 and the cell cycle distribution assessed by flow

cytometry. (A) Representative Histogramms and (B) mean of n≥ 3 independent experiments.

a (p≤0.05), b (p<0.01), c (p<0.001) vs. control analyzed by Kruskal Wallis H-test followed by


Figure 24: Role of ER in F4-mediated effects on the cycle distribution of MCF-cells. MCF-7

cells were cotreated for 48 h with F4 and the pure anti-estrogen ZK and the cell cycle

List of figures

M.Sc. Sadrine Tchoukouegno Ngueu xxi

analyzed by flow cytometry. * (p≤0.05), ** (p<0.01), *** (p<0.001) vs. Control; + (p≤0.05), ++

(p<0.01), +++ (p<0.001) vs. single treatment analyzed by Kruskal Wallis H-test followed by


Figure 25: Effect of the cotreatment with E2 and lower (A) and higher (B) concentrations of

F4 on the cycle distribution of MCF-7 cells. MCF-7 cells were treated for 48h with various

concentrations of F4 together with 0.1 nM E2 and the cell cycle distribution analyzed by flow

cytometry. * (p≤0.05), ** (p<0.01), *** (p<0.001) vs. Control; + (p≤0.05), ++ (p<0.01), +++

(p<0.001) vs. single treatment analyzed by Kruskal Wallis H-test followed by Mann Whitney

U-test. ................................................................................................................................................... 82

Figure 26: Effect of F4 on caspase-cleaved cytokeratin 18 in MCF-7 cells. MCF-cells were

exposed for 6h to either ZK (10-6

M) or increasing concentrations of F4 and the protein

expression of caspase-cleaved cytokeratin 18 measured by indirect immunofluorescence

using the M30 CytoDEATH antibody as described in material and methods. (A)

Representative fluorescence microscopy images (100 X magnitude), (B) quantitative analysis

of M30 positive cells. .......................................................................................................................... 83

Figure 27: Effects of F4 on the mRNA expression of Bax (A), Bcl-2 (B), Bax/Bcl-2 ratio (C),

and Cyclin D1 (D) in MCF-7 cells. MCF-7 cells were treated for 48h with the tests chemicals

and the expression level of target genes assessed by real-time RT-PCR. ** (p<0.01)

analyzed by Kruskal-Wallis H-test followed by Mann Whitney U-test. ....................................... 84

Figure 28: Base Peak chromatogram of Erythrina excelsa ethanol extract and Extracted Ion

Chromatograms (XICs) of representative isoflavonoids detected............................................... 85

Figure 29: HRMS/MS spectrum of compound 1. ........................................................................... 87








Figure 37: Effect of E2, PEs, and the phytoecdysteroid ecdysone on C2C12 myotubes

hypertrophy. 4-6 days old myotubes incubated for 48 h with test chemicals were fixed and

photographied by glutaraldehyde induced autofluorescence. Depicted are mean of n≥2

independent experiments. * p≤0.05 vs. Control by Kruskal Wallis H-test and Mann Withney

U-test. ................................................................................................................................................... 92

Figure 38: Role of AR (A) and ER (B) on ecdysterone induced C2C12 myotubes hypertrophy.

4-6 days old myotubes incubated for 48 h with test chemicals were fixed and photographied

List of figures

M.Sc. Sadrine Tchoukouegno Ngueu xxii

by glutaraldehyde induced autofluorescence. Represented are mean± SD of n=2

independent experiments. * p≤0.05 vs. Control, + p≤0.05 vs. Single treated Kruskal Wallis H-

test and Mann Withney U-test. ......................................................................................................... 93

Figure 39: Effect of ER subtype selective agonists on C2C12 myotubes hypertrophy. 4-6

days old myotubes incubated for 48 h with test chemicals were fixed and photographied by

glutaraldehyde induced autofluorescence. Depicted are mean of n=3 independent

experiments. ........................................................................................................................................ 94




experiments. * p≤0.05 vs. Control, + p≤0.05 vs. Single treated Kruskal Wallis H-test and

Mann Withney U-test. ......................................................................................................................... 95

Figure 41: Ecdysterone induced myotube hypertrophy is ERβ-mediated. 4-6 days old

myotubes incubated for 48 h with test chemicals were fixed and photographied by

glutaraldehyde induced autofluorescence. * p≤0.05 vs. Control Kruskal Wallis H-test and

Mann Withney U-test. ......................................................................................................................... 96

Figure 42: ERα mRNA expression (A) and ERβ protein expression (B) in C2C12 myotubes.97

Figure 43: Transactivation studies with ERα agonist (16α-LE2) and ERβ agonist (8β-VE2) in

comparison to E2 (Hillisch et al., 2004) ......................................................................................... 107

List of tables

M.Sc. Sadrine Tchoukouegno Ngueu xxiii

List of Tables

Table 1: List of chemicals .................................................................................................................. 39

Table 2: List of antibodies ................................................................................................................ 42

Table 3: Consumables and equipement. ........................................................................................ 42

Table 4: Yeast culture medium components .................................................................................. 45

Table 5: C2C12, HT-29 and MCF-7 cells growth media ............................................................... 46

Table 6: VLC fractions. ..................................................................................................................... 50

Table 7: Experimental groups myotube diameter assay. ............................................................. 56

Table 8: Groups treatment uterotrophic assay ............................................................................... 58

Table 9: Primer Sequences ............................................................................................................... 61

Table 10: PCR reaction mix. ............................................................................................................. 62

Table 11: PCR cycling conditions. .................................................................................................. 62

Table 12: Experimental groups for the cell cycle analysis. .......................................................... 63

Table 13: Yeast assay results with E. excelsa whole extract. ..................................................... 69

Table 14: Yeast assay results with VLC fractions. ........................................................................ 76

Table 15: Representative Isoflavonoids of Erythrina excelsa ethanol extract using LC-PDA-

ESI (+)-LTQ-Orbitrap platform. ......................................................................................................... 86

List of abbreviations

M.Sc. Sadrine Tchoukouegno Ngueu xxiv


ACN Acetonitrile

AF-1 Activation function 1

AF-2 Activation function 2

ALPHA ERα-selective agonist (16α-LE2)

AP-1 Activator protein 1

ApoJ Apolipoprotein J

AR Androgen receptor

ATCC American Type Culture Collection

BAX BCL-2 associated protein X

BCL-2 B-cell lymphoma 2

DBD DNA-binding domain

BETA ERβ-selective Agonist (8β-VE2)

BSA Bovine serum albumin

BW Body weight

CAM Complementary and alternative medicine

CAU Corrected absorbance units

C3 Complement component 3

CaBP9k Vitamin D dependent calcium binding protein 9kDa

cAMP Cylic adenosine monophosphate

CCND1 Cyclin D1

CDNA complementary desoxyribonucleic acid

CID Collision-induced dissociation

CPRG Chlorophenol red-β-D-galactopyranoside

DAD Diode-array detector

DAPI 4',6-diamidino-2-phenylindole

DCM Dichloromethane

ddH2O Double distilled water

DEPC Diethyl pyrocarbonate

DHT Dihydrotestosterone

DM Differentiation medium

DMEM Dubelcco's modified eagle medium

DMSO dimethylsulfoxide

DNA Desoxyribonucleic acid

dNTPs Deoxynucleotide triphosphates

E1 Estrone

E2 17β)-estra-1,3,5(10)-triene-3,17-diol, 17β-estradiol

E3 16α-Hydroxy-17β-estradiol, Estriol

Ecdy 20-Hydroxyecdysone, Ecdysterone

http://www.google.de/url?sa=t&rct=j&q=cprg&source=web&cd=3&cad=rja&ved=0CEAQFjAC&url=http%3A%2F%2Fwww.roche-applied-science.com%2Fproddata%2Fgpip%2F3_7_3_3_4_1.html&ei=_LgnUdPkB8ThtQbyy4D4AQ&usg=AFQjCNHtHb19L1aJ5CFfmb3Hi6v8wAs2zA


M.Sc. Sadrine Tchoukouegno Ngueu xxv

EDL Extensor digotorum longus

EDTA Ethylenediaminetetraacetic acid

EGF Epidermal growth factor

EICCAM European information centre for alternative and complementary medicine

ER Estrogen receptor

ERE Estrogen responsive elements

ERα Estrogen receptor alpha

ERβ Estrogen receptor beta

ESI Electrospray ionization

EtOH Ethanol

EU European Union

FACS Fluorescence activated cell sorting

FBS Foetal bovine sserum

Fe2(S04)3 Iron(III) sulfate hydrate, ferric sulfate hydrate

FMD Flow mediated vasodilatation

FSH Follicle-stimulating hormone

GnRH gonadotropin releasing hormone

GPCR G protein-coupled receptor

HCl Hydrogen chloride

HDL high density lipoprotein

hERα Human ERα

HPLC High performance liquid chromatography

IGF1 Insulin-like growth factor 1

IGFBP-1 Insulin-like growth factor binding protein 1

IGF-II Insulin-like growth factor II

ISO Isoflavones

KH2PO4 Potassium dihydrogen phosphate

KOH Potassium hydroxide

LBD ligand binding domain

LC-HRMS Liquid chromatography-high resolution mass spectrometry

LDL Low density lipoprotein

LH Luteinizing Hormone

MAPK mitogen-activated protein kinase

MCF-7 Michigan Cancer Foundation - 7

MeOH Methanol

MgCl2 Magnesium chloride

MgSO4 Magnesium sulfate

mRNA Messenger ribonucleic acid

MS Mass spectrometry

MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide)

MW Molecular weight

Na2HPO4 *2H2O Disodium phosphate dihydrate

NaCl Sodium chloride

http://www.sigmaaldrich.com/catalog/product/sial/f1135?lang=en&region=GR


M.Sc. Sadrine Tchoukouegno Ngueu xxvi

NaH2PO4* H2O Disodium phosphate hydrate

NaOH Sodium hydroxide

NF-κB Nuclear factor-kappa B

(NH4)2S04 Ammonium sulfate

NTD N-terminal domin

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PE Phytoestrogen

PI Propidium iodide

PI3k Phosphatidylinositide 3-kinase

PKA Protein kinase A

PKC Protein kinase c

PM Proliferation medium

PMSF Phenylmethylsulfonyl fluoride

Rb Retinoblastoma protein

RCT Randomized controlled trial

RNA Ribonucleic acid

RPMI Roswell Park Memorial Institute medium

RT-qPCR Real time quantitative polymerase chain reaction

SCC Side-chain cleavage

SDS sodium dodecyl sulfate

SERMS Selective estrogen recptor modulators

SGP-2 Sulphated glycoprotein 2

SHBG Sex-hormone binding globulin

SR Sarcoplasmic reticulum

SP-1 Specificity protein 1

TBS Tris buffered saline

TGF-α Transforming growth factor alpha

TM Traditional medicine

TRIS Tris (hydroxymethyl) aminoethane

TRPM-2 Testosterone-repressed protein message 2

VLC Vacumm liquid chromatography

WHO World health organization

XTT 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide

YES yeast estrogen screen

YES yeast estrogen screen

Introduction

M.Sc. Sadrine Tchoukouegno Ngueu 1

CHAPTER 1: INTRODUCTION

Introduction


1.1 Description of the research problem

Most African and Asian countries have a long history of use of traditional

medicine (TM) for health care. A World Health Organization (WHO) report shows that

40-80% of the population in these countries rely on TM for primary health care

(WHO, 2008). Traditional medicine is defined by the WHO as “diverse health

practices, approaches, knowledge and beliefs incorporating plant, animal, and/or

mineral based medicines, spiritual therapies, manual techniques and exercises

applied singularly or in combination to maintain well-being, as well as to treat,

diagnose or prevent illness“. In developed countries, TM is referred to as

complementary and alternative medicine (CAM), non-conventional or parallel

medicines. The use of TM/CAM has increased worldwide over the last decades.

Surveys done in recent decades show that 20% of the EU-citizens have a clear

preference for CAM healthcare, another 20% are regular users of CAM and more

than 100 million citizens in the EU make use of CAM (EICCAM, 2009). The

increasing use of TM/CAM raises some challenging issues concerning evidences on

their quality, safety, and efficiency. The strategy of the WHO is to integrate TM/CAM

into national health care systems. For this to occur, sufficient knowledge should be

available on their efficiency or effectiveness and safety allowing the identification of

safest and most effective therapies. TM also plays an important role in guiding drug

discovery and development. Recent studies (Newman and Cragg, 2010; Cragg and

Newman, 2013) analyzed the sources of new drugs over the period 01/1981-12/2010

and reported that only 36% of 1073 new chemical compounds considered were

devoid of natural inspiration as represented in Figure 1.

Introduction


Figure 1: Source of drugs (Adapted from (Cragg and Newman, 2013)).

N: unmodified natural product; ND: Modified natural product; S: synthetic compound with no

natural product conception; S*, S*/NM: Synthetic compound with a natural product

pharmacophore, N/M indicating competitive inhibition; S/NM: synthetic compound showing

competitive inhibition of the natural product substrate.

Herbal medicine is one of the most used form of alternative therapy and is

used either to prevent or to treat a wide range of health conditions (menopausal

symtoms, fatigue, cardiovascular diseases, diabetes, cancer, mental disorder…).

Erythrina excelsa Baker (Fabaceae/Leguminoseae) extract and Ecdysterone

containing plants extracts such as Rhaponticum carthamoides, Achyranthes bidenta,

and Trianthema portulacastrum are examples of herbal preparations that are used in

several tradiotional medicine systems. E. excelsa is a plant belonging to the genus

Erythrina that is known for its traditional use by several communities to treat a wide

range of ailments (reviewed in Majinda et al., 2005). E. excelsa stem bark is reported

to have been used by some village communities in the SouthWest region of

Cameroon to alleviate menopausal complaints and to treat growths (uterine fibroids

and ovarian cysts being the most frequent) in the female genital tract. Uterine fibroids

are begnin growths that develop from the muscle tissue of the uterus. Normally they

are not harmful but may under certain circumstances negatively affect fertility

Introduction


outcomes (Pritts et al., 2009). It is recognized that 4-25 % of white women over 30

years old are carriers of uterine fibroids, while this frequency increases to 50% in

African women (Lefebvre, 1993). This shows that the use of this medicinal plant may

include a population of both pre- and postmenopausal women. Like most herbal

preparations used in the traditional medicine, testing for biological activity evidencing

these health benefit claims has not been performed. Ecdysterone (Ecdy) also known

as ecdisten, ecdysone, isoinokosterone, 20-hydroxyecdysone or β-ecdysterone

belongs to the class of ecdysteroids that are steroids mainly found in Arthropods but

that are also present in large amounts in certain plants including spinach (Spinacia

oleracea). In vitro and in vivo studies have reported anabolic effects of Ecdy

(Chermnykh et al., 1988; Gorelick-Feldman et al., 2008; Gorelick-Feldman et al.,

2010). However, despite these findings, the mechanisms by which Ecdy may exert

this effect are not yet elucided. As a consequence of this lack of evidence, Ecdy is

not subjected to regulation and is incorporated in many commercially available

supplements for body-builders and sportsmen and may be misused for doping

purpose.

1.2 Aims and objectives of the thesis

The aims and associated objectives of this thesis are :

Aim 1: To evaluate the biological activities of E. excelsa in relation to its traditionally

reported use for the management of menopausal complaints and for the treatment of

female gynecological tumors.

To evaluate the estrogenic activity of an ethanol extract of E.excelsa;

To investigate the cytotoxic effect of E.excelsa ethanol extract.

Introduction


Aim 2: To get more insights into the “active principles” of E. excelsa

To get a fraction containing the secondary metabolites accounting for the

biological activities of interest (estrogenic and cytotoxic effects);

To evaluate the effect of this fraction on the growth of MCF-7 breast cancer

cell line;

To identify the main chemical components of the extract.

Aim 3: To elucidate the mechanisms by which the phytoecdysteroid Ecdysterone

affect mammalian skeletal muscle homeostasis.

To evaluate the ability of Ecdysterone and other chamicals of plant origin to

induce skeletal muscle hypertrophy;

To characterize the mechanisms invoved in the anabolic activity of

Ecdysterone.

Literature review


CHAPTER 2: LITTERATURE REVIEW

Literature review


Section 2.1: Estrogens

There are three major naturally occurring estrogens (structures see below) in

women. 17β-estradiol (E2) is the most potent and main estrogen found in

premenopausal and non-pregnant women. After menopause estrone (E1) is

predominant. Estriol (E3) is known as the pregnancy hormone.

2.1.1 Synthesis and endogenous sources

In premenopausal women, the ovaries are the primary site of production and

source of circulating E2. The steroidogenic cells of the ovary are the granulosa cells

that are the cellular compartment surrounding the oocyte and the theca cells that

reside in the ovarian stroma (Havelock et al., 2004). The biosynthesis of estrogens in

the ovaries is under the influence of the hypothalamic-pituitary axis and consists of

the production of androgens from cholesterol in theca cells, followed by their

conversion to estrogens in granulosa cells (Figure 2). The primary source of estrogen

in postmenopausal women is from the conversion of androstenedione to estrone in

adipose tissue. The placenta is the major source of estrogens during pregnancy.

Literature review


Figure 2: Biosynthesis of estrogens in ovaries (Campbell reproductive biology July 2012:

http://kcampbell.bio.umb.edu). SCC=P450scc= cholesterol side-chain cleavage enzyme; 3β-

HSD= 3β-hydroxysteroid dehydrogenase. The conversion of androstenedione to testosterone

is mediated by the enzyme 17β- hydroxysteroid dehydrogenase (17β-HSD).

2.1.2 Transport and metabolism

In the circulation, most of the estrogen is reversibly bound to and transported

by the sex hormone-binding globulin (SHBG). SHBG is a protein mainly secreted by

the liver and it influences the action of the steroids in target tissue by regulating their

bioavailability. Estrogens can also bind to albumin but with less affinity as compared

to SHBG (17alpha-ethinylestradiol, the E2 derivate used for hormonal contraception,

is almost exclusively bound to albumin). A small amount of estrogens circulate bound

to HDL and LDL (Shwaery et al., 1997; Tang et al., 1997).

Estrogens are mainly metabolized in the liver and the gastro-intestinal tract.

They are conjugated in the liver as glucuronides, sulfates and thioether (Fishman et

al., 1960; Tseng et al., 1972). The conjugated forms of estrogens are water soluble

and are readily excreted via different routes (Eriksson and Gustafsson, 1971). The

glucuronide conjugates are more rapidly excreted in urine than the sulfates that have

http://kcampbell.bio.umb.edu/

Literature review


a higher chance to be hydrolyzed in tissues to biologically active estrogens

(Sandberg and Slaunwhite, 1957). The estrogen metabolites that are excreted in the

bile pass into the intestine, are hydrolyzed by intestinal bacteria (Adlercreutz et al.,

1976), and are either reabsorbed into the portal circulation or excreted in the feces.

2.1.3 Mechanism of action

2.1.3.1 Structure of estrogen receptors

The biological effects of estrogens are mediated through two distinct estrogen

receptors (ER) subtypes; ERα and ERβ that are members of the large superfamily of

nuclear receptors. Like all other members of this family, ERs are composed of five

independent but interacting functional domains (A/B-F). These domains are the N-

terminal domain (NTD or A/B), the DNA-binding domain (DBD or C), the hinge or D

domain, the ligand-binding domain (LBD or E), and the F domain (Figure 3).

The NTD or A/B encodes the transcriptional activation function (AF-1) (Kraus

et al., 1995; McInerney and Katzenellenbogen, 1996) that is a region involved in the

interaction with coregulator proteins. It can also be phosphorylated and thus is

important for autonomous ligand-independent activation of transcriptional activity of

the ER (Onate et al., 1998; Webb et al., 1998). This domain also comprises amino

acids that are targets for post-translational modifications by kinases of growth factor

pathways that stimulate the activation function 1 (AF-1) activity (Nilsson and

Gustafsson, 2011)

The DBD contains a zinc finger structure that plays an important role in the

binding of the receptor to specific DNA sequences called estrogen response

elements (ERE) (Beato, 1989; Schwabe et al., 1993).

The D domain contains amino acid sequences that promote nuclear

localization and those that are targets for post-translational modifications that affect

ER activity and degradation (Nilsson and Gustafsson, 2011). It also serves as a

flexible region connecting DBD and LBD (Kumar et al., 2011).

The COOH-terminal or ligand-binding domain (LBD) is involved in ligand

binding, receptor dimerization, and contains the ligand-dependent activation function

2 (AF-2) that mediates the interaction of ERs with coregulator proteins and the

Literature review


transactivation of target gene expression (Giguere et al., 1988; Danielian et al., 1992;

Tsai and O'Malley, 1994; Henttu et al., 1997; Darimont et al., 1998; Feng et al., 1998;

Shiau et al., 1998).

The role of the F-domain in ER activity is not well defined, but some data

suggest that this domain may affect the agonist/antagonist activity of selective ER

modulators (SERMs), ER dimerization, and ER-coregulator interactions (Nilsson and

Gustafsson, 2011).

The two ERs share a quite high degree of sequence homology in their DBD

(96% amino acid identity) and LBD (59% amino acid identity) (Nilsson and

Gustafsson, 2011). However, the NTD of ERβ is shorter than that of ERα with a very

poor sequence homology (Kumar et al., 2011). Moreover, the AF-1 domain of ERα is

very active in the stimulation of reporter-gene expression from a variety of estrogen

response element (ERE)-reporter constructs in different cell lines; while the

transcriptional activity of the AF-1 of ERβ under the same conditions is negligible

(Cowley and Parker, 1999).

Figure 3: (A) Modular structure of nuclear receptors (Adapted from (Nilsson et al., 2001) and

(B) protein sequence homology of the two ERs (Adapted from (Shao and Brown, 2004);

percentages of homology are from Faulds et al. (2012).

H2

N-

-COOH

< 20% 95% 30%

59%

< 20%

A)

B)

Literature review


2.1.3.2 Tissue distribution

The two ER subtypes are expressed in both male and female reproductive and

non-reproductive organs but show some differences in their tissue distribution (Figure

4). In some organs, ERα and ERβ are co-expressed at similar levels, whereas in

other tissues, one or the other subtype predominates (Nilsson and Gustafsson,

2011). ERα is predominantly expressed in the uterus, prostate (stroma), ovary (theca

cells), testes (Leydig cells), epididymis, bone, breast, liver, kidney, white adipose

tissue, and various regions of the brain. ERβ is predominantly expressed in the

intestine, prostate (epithelium), testis, ovary (granulosa cells), bone marrow, salivary

gland, vascular endothelium, lung, bladder and certain regions of the brain (Ascenzi

et al., 2006; Nilsson and Gustafsson, 2010).

Figure 4: ERs distribution in male and female organs (Nilsson and Gustafsson, 2011)

Literature review


2.1.3.3 Mechanism of estrogen action (Figure 5)

Most of the effects of estrogens in target organs are exerted through the action

of ERs on the gene expression (genomic actions), but a number of other effects are

so rapid (within seconds or minutes) that they cannot depend on DNA transcription

and protein synthesis (non-genomic actions).

2.1.3.3.1 Genomic actions

Ligand-dependent mechanism

ERE-dependent pathway

The ERE-dependent pathway is the classic/main mechanism through which

the ERs modulate expression of target genes. In the absence of ligands, ERs are

largely located in the cytosol where they are associated with intracytoplasmic

chaperones such as heat-shock protein 70 and 90 (Smith et al., 1993). The binding of

ligand causes the dissociation of the heat-shock proteins and the migration of the

receptor to the nucleus where it dimerizes to either homodimers (ERα:ERα or

ERβ:ERβ) or heterodimers (ERα:ERβ) and binds to ERE located in the promoter

region of target genes (Nilsson et al., 2001). The binding of the ligand also induces a

conformational change of the LBD that allows the recruitment of transcriptional

cofactors (Rosenfeld and Glass, 2001). Two main categories of transcriptional

cofactors can be distinguished: coactivators that activate target gene transcription,

negative coregulators or corepressors that inhibit gene activation and possibly turn

off activated target genes (Nilsson et al., 2001).

ERE-independent pathway

The fact that around one third of the genes in humans that are regulated by

ERs do not contain ERE-like sequences (O'Lone et al., 2004) has led to the

subsequent discovery of signaling pathways that deviate from the classical model. In

the ERE-independent signaling, ligand-bound ERs interact with other transcription

factor complexes like fos/jun (AP-1-responsive elements) (Kushner et al., 2000) and

SP-1 (GC-rich SP-I motifs) (Porter et al., 1997; Saville et al., 2000) that are already

bound to their specific sites on DNA and influence the transcription of target genes

whose promoters do not harbor EREs. The actions of ERs at SP-1 or AP-1 binding

Literature review


sites (also called “tethering”) depend on the ligand, the cell type and the receptor

subtype involved.

Ligand-independent mechanism

In the absence of ligand, other signaling pathways can influence ER

transcriptional activity either by directly targeting the receptor (through

phosphorylation) or by regulating the activity of receptor coregulators. These

signaling pathways include:

- Regulators of the general cellular phosphorylation state such as protein

kinases A (PKA) (Aronica and Katzenellenbogen, 1993; Ince et al., 1994) and

C (PKC) (Migliaccio et al., 1993; Lahooti et al., 1998);

- Peptides Growth factors such as epidermal growth factor (EGF) (Ignar-

Trowbridge et al., 1992; Bunone et al., 1996), insulin-like growth factor (IGF-

1), and transforming growth factor alpha (TGF-α) (Ignar-Trowbridge et al.,

1996);

- Neurotransmitters (dopamine) (Power et al., 1991; Smith et al., 1993);

- Cell cycle regulators such as cyclin D1 (Neuman et al., 1997; Prall et al., 1998)

and cyclin A (Trowbridge et al., 1997);

- NF-κB (Chu et al., 2004; Mahmoodzadeh et al., 2009).

Literature review


2.1.3.3.2 Non-genomic actions

Apart from intracellular cellular ERs, membrane-associated ERs have been

described and are thought to rapidly alter cellular physiology by activating G-protein

coupled receptor (GPCR)-associated pathways. These non-genomic effects include:

i) regulation of intracellular calcium homeostasis and mitogen-activated protein

kinase (MAPK) pathway in different cell lines (Chen et al., 1999; Improta-Brears et

al., 1999); ii) stimulation of adenylate cyclase activity and cyclic adenosine

monophosphate (cAMP) production (Aronica et al., 1994); and iii) activation of the

phosphoinositol 3-kinase (PI3k) signaling pathway (Chen et al., 1999; Castoria et al.,

2001; Marino et al., 2002).

Figure 5: Molecular pathways of ERs actions (Heldring et al., 2007). TF= transcription factor;

SM= second messenger.

Literature review


2.1.4 Estrogens and health

Estrogens play an important role in the growth and differentiation of the female

reproductive organs that are also known as its classical targets. They are also

involved in the function of several other tissues and organs including the

cardiovascular and nervous systems, bone, skeletal muscle…

2.1.4.1 Estrogens and hormone-dependent cancers

Estrogens are crucial for the normal growth and development of reproductive

organs.

Ovaries: estrogens have direct and indirect (through the pituitary gland)

stimulatory effects on follicle growth.

Uterus: estrogens increase uterine weight through stimulation of fluid retention

and hyperplasia of the cells of the endometrium, effects that prepare the

uterus for implantation. They also induce the secretion of cervical mucus that

facilitates the penetration of spermatozoa in the uterus.

Mammary tissue: estrogens are required for complete ductal elongation and

branching, and the subsequent development of the lobulo-alveolar end buds

(Brisken and Rajaram, 2006).

Vagina: estrogens stimulate the thickening, the stratification and keratinization

of epithelial cells of the vagina. They also play an important role in the

secretion of mucus that lubricates the vagina.

However, animal studies using rodents have shown that estrogens can induce

and promote mammary (Shull et al., 1997; Cavalieri et al., 2006), endometrial

(Newbold et al., 1990) and other cancers (Kirkman, 1959; Bhat et al., 1993).

Similarly, estrogens have been shown to promote tumor growth and the proliferation

of cancer cells in vivo and in vitro. In humans, parameters such as early menarche,

late menopause, short breastfeeding periods, and low number of pregnancies that

maximize the number of ovulatory cycles and therefore the lifetime exposure to

estrogens are associated with an increased risk of breast-cancer. Estrogens

Literature review


supplementation in postmenopausal women is associated with an increased risk of

breast and endometrial cancers.

Two main mechanisms (Figure 6) are proposed to explain the carcinogenic effect

of natural and synthetic estrogens:

Estrogens affect the rate of cell division and stimulate the proliferation of target

cells via ER-mediated processes. This increased and abnormal cell

proliferation can result in increased DNA damage leading to cancer if not

repaired. It is also proposed that estrogens may act indirectly by enhancing

the replication of cells carrying genetic errors (Nandi et al., 1995; Feigelson

and Henderson, 1996; Dickson and Stancel, 2000; Hahn and Weinberg,

2002).

Specific oxidative metabolites (catechol estrogen metabolites) of estrogens

can react with DNA to cause mutations that may initiate cancer (Cavalieri et

al., 1997; Cavalieri et al., 2000; Chakravarti et al., 2001; Cavalieri et al., 2004;

Li et al., 2004; Zhao et al., 2006).

Literature review


Figure 6: Mechanisms of estrogens-induced cancer

2.1.4.5 Estrogen and skeletal muscle

Estrogens are involved in the regulation of glucose metabolism in several

tissues including skeletal muscles where they increase glucose uptake. Increasing

evidences also show that estrogens modulate skeletal muscle mass and strength.

Aging is associated with a decline in muscle strength and mass known as

sarcopenia. However, there are gender differences in the age and rate at which

Sarcopenia occurs. The prevalence of sarcopenia is higher among women than men

and women exhibit an accelerated loss of muscle mass and strength at an earlier age

(around the time of menopause)(Calmels et al., 1995; Dionne et al., 2000; Lemoine

et al., 2003; Wiik et al., 2003). Imbalance between muscle protein synthesis and

muscle protein breakdown is the major factor leading to sarcopenia (Short and Nair,

2000). Increased oxidative stress and inflammation (Morley et al., 2001) and

menopause-associated decline in hormonal levels (Maltais et al., 2009) have also

been shown to be implicated. Estrogens positively modulate skeletal muscle mass

and strength (Lowe et al., 2010; Pollanen et al., 2011), decrease oxidative stress in

Literature review


muscle (Lowe et al., 2010), and affect myosin function and composition (Kadi et al.,

2002; Moran et al., 2007). A recent study by Enns and Tiidus (Enns and Tiidus, 2010)

suggested a gender and E2-specific influence on membrane and exercise-induced

muscle damage. In the same line, Velders et al (2012) demonstrated that estrogens

were able to regulate skeletal muscle growth and regeneration by stimulating

anabolic pathways, activating satellite cells and modulating immune response.

Both functional ERs isoforms are expressed in human skeletal muscle

(Lemoine et al., 2003; Wiik et al., 2003; Wiik et al., 2009) and despite the recognized

role of estrogens on muscle homeostasis, the mechanisms by which they exert their

effects are not fully understood. Recent studies from our lab show that ERβ is the

major ER isoform mediating estrogens effects on skeletal muscle growth and repair

(Velders et al., 2012; Weigt et al., 2012).

Literature review


Section 2.2: Phytoestrogens

2.2.1 Definition and sources

Phytoestrogens (PEs) are naturally-occurring plant compounds that are

structurally and/or functionally similar to mammalian estrogens and their active

metabolites. They are commonly divided into 4 groups: isoflavones (e.g. genistein,

daidzein, glycitein, and formonetin), lignans (e.g. secoisolariciresinol, matairesinol,

pinoresinol, and lariciresinol), coumestans (e.g. coumestrol), and stilbens (e.g.

resveratrol) as presented in Figure 7. Lignans are found in many fiber-rich foods such

as berries, seeds (particularly flaxseeds), grains, nuts and fruits (Nakamura et al.,

2007; Martin-Millan et al., 2010; Patisaul and Jefferson, 2010). Isoflavones are

components of berries, wine, grains and nuts but are most abundant in soybeans and

other legumes (Kurzer and Xu, 1997). Coumestans are found in many plants but

especially in clover and alfalfa sprouts, and stilbens in grape-containing products,

particularly red wine (Jefferson et al., 2012).

Literature review


2.2.2 Absorption and metabolism

Isoflavones and lignans are the two major classes of PEs in food and are the

most studied and the best characterized with regard to PE metabolism. Genistein and

daidzein, the predominant isoflavones, occur in soy mainly as biologically inactive

glycoside conjugates (genistin and daidzin) (Patisaul and Jefferson, 2010). After oral

ingestion, the glycoside conjugates are either hydrolyzed into their corresponding

aglycones bioactive form (genistein and daidzein) by intestinal glucosidases or

absorbed as conjugates. Genistein and daidzein can also be obtained from the

intestinal hydrolysis of their respective precursor biochanin A and formonetin that are

found in high amounts in red clover (Axelson et al., 1984). The aglycone metabolites

Genistein Daidzein

Enterolactone Enterodiol

Coumestrol

Resveratrol

Isoflavones

Lignans

Coumestans

Stilbens

Figure 7: Major classes of phytoestrogens

Literature review


are further metabolized to more specific metabolites (p-ethylphenol for genistein,

equol or O-desmethylangolensin for daidzein) (Axelson et al., 1984; Bannwart et al.,

1984; Kelly et al., 1993; Joannou et al., 1995). Once in circulation, PE undergo in the

liver several other metabolic pathways including hydroxylation, glucuronidation, and

sulfation (D'Alessandro et al., 2005). Then they are excreted in the urine or in the

bile.

Lignans exist in food as glycosides and are converted to enterolactone and

enterodiol by the gut microflora (D'Alessandro et al., 2005). It is worth to note that the

extent of PE metabolism and therefore the bioavailability of the active metabolites are

highly variable among individuals and are influenced by many factors including the

other components of the diet, gut microflora, use of antimicrobials, intestinal transit

time, and genetic polymorphisms (Setchell et al., 1984; Messina et al., 2006).

2.2.3 Mode and mechanisms of action

Most PEs bind to ERα and ERβ and activate ER-dependent gene transcription

through both ERs. However, unlike E2 that binds with equal affinity to both ERs, they

bind predominantly to ERβ (Kuiper et al., 1997) and may exert both agonistic and

antagonistic effects depending on the cellular context. Therefore, most PEs are

termed as selective estrogen receptor modulators (SERMs). They have been

reported to produce their effects either via direct binding to ER or by acting indirectly

to modulate the concentration of endogenous estrogens. PEs modulate the brain-

pituitary-gonad axis which is the principal endocrine system to regulate mammalian

reproduction. They induce changes in the concentration of circulating steroid

hormones by inhibiting the secretion and activity of gonadotropin releasing hormone

(GnRH) (Bowe et al., 2003; Christoffel et al., 2006; Losa et al., 2011), by increasing

sex hormone binding globulin (SHBG) synthesis (Adlercreutz et al., 1987; Berrino et

al., 2001), and through direct inhibition of some steroidogenic enzymes (Adlercreutz

et al., 1993; Evans et al., 1995; Kao et al., 1998; Brooks and Thompson, 2005) .

PEs may also induce effects that may not be mediated through ERs. For

instance, the isoflavone genistein that is one of the most studied PE inhibited

topoisomerase II (an enzyme involved in replication and transcription of DNA) in NIH

3T3 cells (Okura et al., 1988). Several in vitro studies have also shown that genistein

Literature review


inhibits the activity of tyrosine kinase which is essential for cellular growth and

differentiation (Akiyama et al., 1987; Pagliacci et al., 1994; Dalu et al., 1998).

Mutagenic (Kulling and Metzler, 1997; Mitchell et al., 2000; Misra et al., 2002) and

antioxidant properties (Wei et al., 1993) of PEs have been described. Additionally,

PEs exert non-genomic rapid effects for example through the binding of early

intermediate genes such as jun and fos (Kushner et al., 2000).

2.2.4 Phytoestrogens and health

2.2.4.1 Phytoestrogens and the reproductive health

The effects of PEs on female reproductive health depend on applied dose,

route of exposure, and hormonal or developmental status of the exposed individual:

different tissues have species-specific windows of sensitivity to morphological and

functional disruption (Jefferson et al., 2012). Since Bennetts et al (1946) reported that

sheep that grazed on red clover were infertile due to the estrogenic content in clover,

several others have also reported on the impact of dietary PEs on the reproductive

function in adults. There are limited available literature answering to this question

with regard to the situation in humans but considerable studies have been performed

in rodents. Perinatal PEs exposure in rodents is associated with an altered timing of

puberty onset and estrous cyclicity as well as an abnormal development of the

female reproductive tract (Kouki et al., 2003; Nikaido et al., 2004; Jefferson et al.,

2005; Bateman and Patisaul, 2008; Jefferson et al., 2012).

2.2.4.2 Phytoestrogens and gynecological cancers

Although weaker than natural estrogens, PEs mimic estrogenic effects on the

reproductive organs. This raises some concerns because estrogens are implicated in

the pathology of hormone-dependent cancers. However, epidemiologic studies show

that Asiatic women have a significant lower incidence of hormone-dependent cancers

compared to their age-matched Caucasian women and that this lower risk is

positively correlated to PE consumption (Adlercreutz et al., 1992; Knight and Eden,

1996; Setchell and Cassidy, 1999; Messina and Wood, 2008). This observation has

motivated the scientific community to conduct intensive research that has

unfortunately yielded heterogenic and contradictory results (probably because of the

critical time-window of exposure). The impact of PEs on the incidence and

Literature review


progression of reproductive cancer is controversially discussed and this controversy

is fueled by the fact that apart from binding to ER and mimic estrogen effects, PEs

have a plethora of other effects which are not yet fully understood. Moreover, as

previously mentioned with regard to the impact on reproductive health, studies of our

lab and other have revealed that the time of exposure to PEs is an important

parameter to consider when evaluating breast cancer outcomes (Whitsett and

Lamartiniere, 2006; Lee et al., 2009; Molzberger et al., 2012). Nevertheless, recent

studies report beneficial effects of PE consumption on gynecological cancer risk. In a

3 years randomized controlled trial (RCT), Palacios et al (2010) assessed the effects

of an oral soy isoflavone extract (Phytosoya 70 mg daily dose) on the endometrium

and breast of 395 postmenopausal women and found no increase in endometrial and

breast cancers. Steinberg et al (2011) demonstrated that 403 healthy

postmenopausal women that received a daily isoflavone dose of 80-120 mg for one

year showed no significant difference in endometrial thickness or fibroids. In the

same line, Ollberding et al (2012) found a reduced risk of endometrial cancer

associated with total isoflavone, daidzein or genistein intake after 13.6 years follow

up of 46027 non hysterectomized postmenopausal women. Myung and coworkers

(Myung et al., 2009) also showed a protective effect of soy intake on the risk of

ovarian cancer. The possible actions of phytoestrogens in relation to cancer are

presented on Figure 8.

Literature review


Figure 8: Overview of possible actions of phytoestrogens in relation to cancer (adapted from

(Mense et al., 2008)).

2.2.4.3 Phytoestrogens and menopausal symptoms

Despite intensive investigations on the effects of PE on the vasomotor

symptoms of menopause (mainly hot flushes), it remains unclear whether PEs are

clinically relevant for the management of these disorders. Bolanos and coworkers

(2010) recently performed a systematic review and meta-analysis of 90 randomized

controlled trials (RCT) to determine whether soy intervention either as diet, extract or

concentrate reduces the incidence of hot flashes in climacteric women. They found a

significant tendency in favor of soy ISO but were not able to establish conclusive

results due to the high heterogeneity found in the studies. Following a similar

exercise, Howes et al (2006) concluded that soy supplementation may produce a

slight to modest reduction of the number of daily flushes.

The impact of PEs, particularly ISO, on the cardiovascular health is also

controversially discussed with some studies reporting beneficial effects and others no

Literature review


effect. Hypercholesterolemia is a well-documented and established risk factor for

coronary heart disease and soy proteins but not purified isoflavones have been

shown to lower serum cholesterol levels (Nagata et al., 1998; Dewell et al., 2006).

Several randomized placebo-controlled trials have been performed to

determine the effect of oral ISO supplementation on endothelial function as

measured by flow-mediated dilatation (FMD) in postmenopausal women. In a meta-

analysis of 9 of such trials, Li et al (2010) found that oral ISO supplementation does

not improve endothelial function in postmenopausal women with high baseline FMD

levels but leads to significant improvement in women with low baseline FMD levels.

Bone cell culture and the rat model of postmenopausal osteoporosis have

been extensively used to show that PE can prevent postmenopausal bone loss (Lee

et al., 2004; Hertrampf et al., 2007). Setchell and lydeking-Olsen (2003) compared

data from 17 studies on cultured bone cells, 24 studies of animal model for

postmenopausal osteoporosis, 15 human observational/epidemiological studies, 17

dietary intervention studies and found that diets rich in PE have bone-sparing effects

in the long-term. Yamori et al (2002) came to the same conclusion after an

intervention study performed with immigrants Japanese women in Brazil.

Literature review


Section 2.3: Erythrina excelsa Baker

2.3.1 Taxonomy

Kingdom: Plantae

Phylum: Magnoliophyta

Class: Magnoliopsida

Order: Fabales

Family: Fabaceae, Leguminosae,

Genus: Erythrina

Botanical names: Erythrina bagshawei Baker F., Erythrina seretii De Wild, Erythrina

excelsa Baker

Figure 9: Erythrina Excelsa (April 2011 in Kumba-Cameroon by Stephane Zingue)

Literature review


2.3.2 Description and geographical distribution

The genus Erythrina comprises around 110 species of orange or red flowered

trees, shrubs and herbaceous plants found throughout tropical and semi-topical

regions of the World. These species are distinguished based on their morphology

mainly the color and shapes of the flowers and fruits, and the inflorescence

characteristics (Majinda et al., 2005). E. excelsa is a deciduous medium sized tree of

up to 30m tall that grows very fast and usually flowers when leafless. The

inflorescence of E. excelsa is compact, axillary or terminal. The flowers are bisexual,

papilionaceous with a spathe-like, glabrous or slightly hairy calyx that is splitted at

one side. The corolla is orange-red to scarlet or coral-red. The fruit is a linear-oblong

spirally twisted pod markedly constricted between the orange-red with whitish scar

seeds (up to 10/fruit) (Lemmens, 2008). E. excelsa is mainly found in the Democratic

Republic of Congo, Cameroon, Ivory Coast, Mali, Southern Nigeria, Sudan, and

throughout East Africa except Zanzibar.

2.3.3 Active constituents of plants of the genus Erythrina

Several secondary metabolites have been reported : alkaloids, flavanones,

flavonols, chalcones, cinnamoyl phenols, stilbenoids, isoflavones, isoflavans,

isoflavanones, pterocarpans, isoflav-3-enes, 3-phenoxychromones, coumastans, 3-

phenylcoumarins, lignans, cinnamate esters, simple phenolics, triterpenes,

sesquiterpenes, squalene, C-18 unsaturated hydroxycarboxylic acid, and

octacosanol (Majinda et al., 2005). Previous phytochemical studies reported the

isolation of a long chain ester of ferulic acid (Wandji et al., 1990) and a prenylated

isoflavonoid (Tanee Fomum et al., 1986) from E. excelsa.

2.3.4 Traditional uses of Erythrina excelsa Baker

The wood of E. excelsa is popular in Uganda for making drums, stools,

shields, mortars and carving for the tourist industry. It is also used as fuel wood and

for making charcoal (Lemmens, 2008). As in Uganda, E. excelsa is planted in

Cameroon as an ornamental and roadside tree.

Some village communities in the South West region of Cameroon reported the

use of E. excelsa for the management of menopausal complaints and for the

Literature review


treatment of growths in the female genital tract (ovarian cysts and uterine fibroids).

Others have also reported the use of E. excelsa as an antidote for snakebites (Owuor

and Kisangau, 2006; Lemmens, 2008; Samy et al., 2008) and for arthritis and catarrh

(Jiofack et al., 2010).

Literature review


Section 2.4: Ecdysterone

2.4.1 Origin and sources

Ecdysterone (Ecdy) (Figure 10) belongs to the large family of ecdysteroids that

are polyhydroxylated hormones found in arthropods. Several plant species

synthesize ecdysteroids and there were more than 300 reported phytoecdysteroids in

2008 (Bathori et al., 2008). Some of these ecdysteroids containing plants are

included in the human diet (spinach) and are used in several traditional medicine

systems for the treatment of various ailments. For example:

- Rhaponticum carthamoides is used in the Siberian traditional medicine

in cases of overstrain and common weakness after illness (Petkov et

al., 1984);

- Achyranthes bidentata is used in Chinese traditional medicine for the

treatment of osteoporosis (Zhang et al., 2012);

- Trianthema portulacastrum is used in Ayurvedic traditional medicine as

analgesic, laxative and for the treatment of blood diseases, anemia,

inflammation, and night blindness (Shivhare et al., 2012).

Figure 10: 20-hydroxyecdysone (20 HE) or Ecdysterone

Literature review


2.4.2 Biological effects

In plants, phytoecdysteroids act as protective agents against predatory insects

(Le Bizec et al., 2002). In insects, ecdysteroids exert trophic effects on muscles and

play an important role in metamorphosis (hence the name molting hormone)

(Schwartz and Truman, 1984). This muscle growth stimulatory effect of ecdysteroids

has inspired several research activities to test whether they could produce the same

effect in vertebrates and mammals in particular.

In vitro and in vivo experimental models have shown that Ecdy exhibits

anabolic effect on mammalian skeletal muscles. Ecdy has been demonstrated to

increase protein synthesis in skeletal muscle (Chermnykh et al., 1988) and in other

organs (Otaka et al., 1968; Chaudhary et al., 1969; Otaka et al., 1969; Hikino and

Takemoto, 1972; Syrov and Kurmukov, 1976). Gorelick et al (2008; 2010) using

cultured murine C2C12 myotubes showed that this increased protein synthesis was a

result of direct or indirect stimulation of the PI3K/Akt signaling pathway as indicated

on Figure 11.

Literature review


Figure 11: Pathways of Ecdysterone-induced protein synthesis in skeletal muscle (Gorelick-

Feldman et al., 2010). 20HE: 20-hydroxyescdysone; PIP2: phosphatidylinositol-4,5-

diphosphate; PLC: phospholipase C; IP3: Inositol-1,4,5-triphosphate; IP3R: IP3 receptor; SR:

sarcoplasmic reticulum.

Toth et al (2008) showed that treatment of adult non-castrated male Wistar

rats for 7 consecutive days with 5 mg/kg BW Ecdy leads to an increase of the fiber

size of both soleus and extensor digotorum longus (EDL) muscles. They proposed

that this increase may involve the activation of satellite cells as they found that the

number of nuclei also increased in Ecdy treated animals.

To date, it is not clear whether Ecdy exerts the same effects in humans

although ecdysteroids were reported as being used by athletes in Asian countries

(Bathori et al., 2008) and by Russian Olympic athletes (Le Bizec et al., 2002). Schoch

et al (2006) investigated the effect of 8 weeks Ecdy supplementation on body

composition, markers of catabolism (creatinine, creatine kinase, lactate

deshydrogenase...), and on training adaptation of 45 resistance-trained males and

found no effect on the parameters considered.

Literature review


Conversely to anabolic-androgenic steroids (AAS) that increase muscle mass

mainly through their binding to androgen receptor (AR), no nuclear receptor that is

homologous to the ecdysone nuclear receptor (EcR) found in insects have yet been

described in mammals (Gorelick-Feldman et al., 2010). Ecdysterone has been

characterized as devoid of binding ability to either AR (Bathori et al., 2008; Gorelick-

Feldman et al., 2008), ER (Bathori et al., 2008; Seidlova-Wuttke et al., 2010), or

glucocorticoid receptor (Bathori et al., 2008). Therefore, the mechanisms underlying

the action of Ecdy in mammals are still to be clarified.

Literature review


Section 2.5: Marker genes used

The molecular markers for estrogenicity/cytotoxicity used in this work are

described in the following paragraphs.

2.5.1 Complement component 3 (C3)

The C3 gene encodes for a protein called complement component 3 that plays

a key role in a part of the body´s immune system known as complement system.

Together with other proteins of the complement system, C3 triggers inflammation,

serve as a first line of defense against infection, and acts to bridge the innate and the

adaptive immune system (Carroll and Prodeus, 1998; Barrington et al., 2001). The

C3 gene is constitutively expressed in the liver and its up-regulation in the uterine

endometrium following estrogen administration has been extensively demonstrated

(Diel et al., 2004; Hofer et al., 2009; Kluxen et al., 2012).

2.5.2 Clusterin

Clusterin, also known as testosterone-repressed protein message 2 (TRPM2),

Apolipoprotein J (ApoJ), or sulphated glycoprotein 2 (SGP-2), is a 75-80 kDa

heterodimeric glycoprotein produced by a wide array of tissues and found in most

biological fluids. Based on its distribution and in vitro properties, several physiologic

functions have been proposed and include complement regulation, lipid transport,

sperm maturation, initiation of apoptosis, endocrine secretion, membrane protection,

and promotion of cell interactions (Rosenberg and Silkensen, 1995). Estrogen-

dependent regulation of the clusterin mRNA-expression has been reported in rat

uterus (Diel et al., 2000) and in endometrial estrogen-dependent carcinoma

(Wunsche et al., 1998).

2.5.3 Insulin-like growth factor binding protein 1 (IGFBP-1)

IGFBP-1 mRNA and protein expression have been identified in human liver, in

uterine decidua, and in nonhuman kidney. It is one of the six structurally homologous

proteins that specifically bind and modulate the mitogenic and metabolic actions of

Literature review


insulin-like growth factor (IGF)-I and IGF-II (Lee et al., 1993). It has been shown in

vitro (Diel et al., 1995), in vivo (Geis et al., 2005), and in humans (Isotton et al., 2012)

that estrogens up-regulate IGFBP-1 expression.

2.5.4 Vitamin D dependent calcium binding protein 9kDa (CaBP9K)

CaBP9k or calbindin-9k is a member of a large family of intracellular calcium

binding proteins that have high affinity for calcium (Kim et al., 2012). It plays an

important role in calcium transport and re-asorbtion in many tissues (Wasserman and

Taylor, 1966; Bruns et al., 1988; Balmain, 1991; Krisinger et al., 1994). Diel et al

(1995) identified CaBP9k as an estrogen regulated gene in Fe33 rat hepatoma cells.

The CaPB9k promoter contains several EREs (Lee et al., 2003).

2.5.5 Cyclin D1 (CCND1)

Cyclin D1 together with other members of cyclins family regulate progression

through the cell cycle leading to mammalian cell division. Upon binding to cyclin

dependent kinases Cdk4 and Cdk6, CCND1 phosphorylates the retinoblastoma

protein (Rb) and promotes the transition from G1 to S phase. CCND1 gene is

amplified in 15% of primary ER positive breast cancers and is overexpressed in up to

50% of cases (Tobin and Bergh, 2012). Although there is no classical ERE in the

CCND1 promoter (Liu et al., 2002), estrogens when bound to ER (ERα) are able to

upregulate CCND1 mRNA expression (Liu et al., 2002; Tobin and Bergh, 2012). On

the other hand, CCND1 has been shown to directly interact with the LBD of ER and

to stimulate ER transactivation in a ligand-independent fashion (Zwijsen et al., 1997)

2.5.6 Bax

Bax belongs to the proapoptotic members of the Bcl-2 family of proteins whose

role in the regulation of apoptotic cell death is well characterized. It is a soluble

monomeric protein that is localized in the cytosol or is attached at the periphery of

intracellular membranes in unstimulated cells (mitochondria, endoplasmic reticulum,

and nucleus) (Goping et al., 1998; Danial, 2007). Upon a death stimulus, Bax is

activated and translocates to the outer mitochondrial membrane where it promotes

the release of cytochrome C from the mitochondria. Once released, cytochrome C

Literature review


activates a caspase cascade leading to increased mitochondrial mediated apoptotic

cell death (Adams and Cory, 1998).

2.5.7 Bcl-2

Bcl-2 is the prototype protein of the BCL-2 family and was first discovered as a

proto-oncogene in follicular lymphoma (Tsujimoto et al., 1984). It codes for an

antiapoptotic protein that acts by binding and antagonizing the proapoptotic effectors

Bax and Bak (Carpinelli et al., 2012). Bcl-2 protein is overexpressed in a variety of

solid organ malignancies including breast cancer (Dawson et al., 2010). Estrogens

have been shown to prevent apoptosis of normal and breast tumor cells through the

activation of Bcl-2 gene expression (Somai et al., 2003).

Material and methods


CHAPTER 3: MATERIAL AND METHODS



3.1 Material

3.1.1 Substances

The following substances were used either as test substance or positive

control:

Substances Chemical structure Manufacturer

1. 17β-Estradiol or E2 (Estra-1,3,5(10)-trien-3,16α,17 β-diol)

Sigma-aldrich (Steinheim, Germany)

2. Genistein (Gen) (4´,5,7-Trihydroxyisoflavon)

LC Laboratories (Wolburn, USA)

3. ERα-selective agonist or ALPHA [(16α-LE2), 3,17-dihydroxy-19-nor-17α-pregna-1,3,5 (10)-triene-21,16α-lactone;)]

Bayer HealthCare Pharmaceuticals (Berlin-Germany)

4. ERβ-selective agonist or BETA [(8β-VE2), 8-vinylestra-1,3,5 (10)-triene-3,17ß-diol]




5. ZK 283361 (ERβ antagonist or Anti-BETA)


6. 20-Hydroxyecdysone or Ecdy ( 2β,3β,14α,20β,22,25-Hexahydroxy-7-cholesten-6-one)


7. Cisplatin (cisplatinum, or cis-diamminedichloroplatinum)

Millipore (Darmstadt, Germany)

8. ZK 191703 or ZK (pure antiestrogen )

Bayer HealthCare Pharmaceuticals (Berlin-Germany

9. Dihydrotestosterone (DHT)


10. Flutamide (Flu)


11. LONG®R3 IGF-1, human recombinant analog (IGF-1)




3.1.2 Chemicals, consumables and lab equipments

Table 1: List of chemicals

Chemicals Manufacturer

Yeast growth and assay media components

Adenine Sigma-aldrich (Steinheim, Germany)

CuSO4 _

CPRG Roche diagnostics (Mannheim, Germany)

Fe2(S04)3 Merck (Darmstadt, Germany)

KH2PO4 _

KOH _

L-arginine-HCI Sigma-aldrich (Steinheim, Germany)

L-aspartic acid _

L-glutamic acid _

L-histidine _

L-Ieucine _

L-isoleucine _

L-lysine-HCl _

L-methionine _

L-phenylalanine _

L-serine _

L-threonine _

L-tyrosine _

L-valine _

MgSO4 _

(NH4)2S04 Merck (Darmstadt, Germany)

Pantothemic acid Sigma-aldrich (Steinheim, Germany)

Pryridoxine _

Thiamine _

Inositol _

Biotin _

D-(+)-glucose Merck (Darmstadt, Germany)

Buffers components

Na2HPO4 *2H2O Merck (Darmstadt, Germany)

NaCl _

NaH2PO4* H2O _

NaOH _

Tris _

Triton X 100 Sigma-aldrich (Steinheim, Germany)

Tween 20 Sigma-aldrich (Steinheim, Germany)

Sucrose



Bromophenol blue Merck (Darmstadt, Germany)

Xylene cyanol _

HCl (1M) _

NaOH (1M) _

EDTA Sigma-aldrich (Steinheim, Germany)

Glacial acetic acid Merck (Darmstadt, Germany)

PMSF Sodium deoxycholate

Protein analysis

BSA PAA Laboratories (Pasching, Austria)

Milk powder Reformhaus Bacher (Cologne, Germany)

SDS-loading buffer (Laemmli 1970) BIO-RAD (Munich, Germany)

NuPAGE Novex 4–12% Bis–Tris Midi Gel Invitrogen, life technologies

DC protein assay reagent A BIO-RAD (Munich, Germany)

DC protein assay reagent B _

Precision Plus Protein™Dual color Standards _

Cell culture media components

DMEM Gibco, Invitrogen (Karlsruhe, Germany)

Glutamin _

FBS _

Horse serum _

Human insulin _

PBS cell culture grade _

Penicillin-Steptomycin _

Trypsin-EDTA (0.05%) _

RPMI 1640 _

Sodium bicarbonate _

Sodium pyruvate _

Freezing medium _

PCR reaction components

dNTPs Invitrogen, life technologies (Karlsruhe, Germany)

PCR buffer _

MgCl2 for PCR _

Taq polymerase _

Ampuwa _

Primers _

RNA preparation

TRIzol ®reagent Invitrogen, life technologies (Karlsruhe, Germany)

Chloroform Merck (Darmstadt, Germany)



Isopropanol _

EtOH for molecular biology _

DEPC

Nucleic acids electrophoresis and staining dyes

DAPI Sigma-aldrich (Steinheim, Germany)

Propidium iodide (PI) _

Ethidium bromide _

Sybr Green BIO-RAD (Munich, Germany)

Agarose Biozym (Hess. Oldendorf, Germany)

100 bp DNA ladder Invitrogen, life technologies (Karlsruhe, Germany)

Kits

MTT Roche diagnostics (Mannheim, Germany)

XTT Roche diagnostics (Mannheim, Germany)

QuantiTect® Reverse transcription Qiagen

Other Organic solvents

EtOH for histology

MeOH Merck (Darmstadt, Germany)

MeOH HPLC grade VWR (Leuven,Belgium)

Cyclohexane HPLC grade _

Dichloromethane HPLC grade _

Xylol Quadflieg (Geselkirchen, Germany)

DMSO Merck (Darmstadt, Germany)

Formaldehyd 37% _

Others

Paraffin Sasol wax (Hamburg, Germany)

Corn oil Sigma-aldrich (Steinheim, Germany)

Glutardialdehyde Merck (Darmstadt, Germany)

Activated carbon _

Meliseptol B. Braun (Melsungen, Germany)

Liquid nitrogen Air Liquide (Düsseldorf, Germany)

Eosine VWR (Leuven,Belgium)

Mounting medium (Entellan®) Merck (Darmstadt, Germany)

Mayer Hamalun _

Silicagel (60 Å, 70-230 mesh) Sigma-aldrich (Steinheim, Germany)



Antibodies

Table 2: List of antibodies

Antibody Host Dilution Manufacturer

Primary antibodies

Anti-β-actin(clone AC-74) mouse 1:5000 Sigma-aldrich

Anti-ERβ (H-150) rabbit 1:200 Santa Cruz Biotechnology,

Inc

M30 CytoDEATH mouse 1:10 Roche Applied Science

secondary antibodies

Anti-Mouse Ig, HRP* rabbit 1:2000 Dako

Anti-Rabbit Ig, HRP Swine 1:2000 Dako

Anti-Mouse Ig biotinylated Goat 1:400/1:200 Dako

signal detection reagents

chemoluminescent POD-Substrate (LumiLight Plus)

Roche Diagnostics

FluoroLinkTM Cy3 labelled streptavidin 1:1000

Amersham Biosciences

* Horseradisch peroxidase

Table 3: Consumables and equipement.

Consumables and equipments Manufacturer

42ippsipette tips 1 – 5mL _

Eppendorf Tubes Eppendorf (Essling-Berzdorf, Germany) RT-qPCR plates 96-well plates without border QPCR

Agilent Technologies (Waldbronn, Germany)

Optical Cap Mx3000P/Mx3005P 8 x Strip _

Falcon tubes 15 mL BD Biosciences(Heidelberg, Germany)

Falcon tubes 50 mL BD Biosciences(Heidelberg, Germany)

Gloves Comfort Unigloves (Troisdorf, Germany)

Gloves Nitrile VWR (Leuven,Belgium)

Syringes Injekt solo 2-10 mL B. Braun (Melsungen, Germany)

Sterile syringue filter 0.2 μm VWR (Leuven,Belgium)

Cannulas 0.6 x 30 mm HenrySchein (Melville NY, USA)

Towels facial tissues Flirty H.-Kimberly (Mainz, Germany)

Coverslips Coverslips 50x30 mm VWR (Leuven,Belgium)

Polysine slides _

Embedding cassette Histosette _

pH meter Mettler Toledo (Giessen, Germany)

Cell scraper BD Biosciences(Heidelberg, Germany)

Protran®Nitrocellulose Membranes Whatman Inc (USA)

96-well optically flat bottom plates Nunc (Danemark)

96-well optically round bottom plates BD Biosciences(Heidelberg, Germany)

6-well plates _

Chromatography column NS 14/23 Lenz Laborglas GmbH & Co. kG



(Wertheim, Germany)

Ice Machine, AF 80 Scotsman (Milan, Italy)

Freezer (-20 °C) Liebherr (Bulle, Switzerland)

Freezer (-80 °C) HERAfreeze Heraeus ( Hanau, Germany)

Gel chamber small or medium Biometra (Göttingen, Germany)

Camera and evaluation system for agarose gels MWG-Biotech (Ebersberg, Germany)

Refrigerator Liebherr (Bulle, Switzerland)

Refrigerated Centrifuge Centrifuge 5417 R Eppendorf (Essling-Berzdorf, Germany)

Microwave MS192A LG (Willich, Germany)

PCR GeneAmp PCR system 9600 Applied Biosystems (Foster City, USA)

Pipettes Eppendorf (Essling-Berzdorf, Germany)

RT-qPCR Stratagene Mx3005P Agilent Technologies

Spectrophotometer NanoDrop 1000 Thermo Fisher Scientific (Schwerte, Germany)

Benchtop centrifuge Biofuge 13 Heraeus (Hanau, Germany)

Vortex Genie 2 Scientific Industries (Bohemia NY, USA)

Libra Scaltec SBA52 Denver Instrument (Göttingen, Germany)

Inverted microscope Axiovert 200M Zeiss (Jena, Germany)

Confocal microscope Axiophot KS300 Zeiss (Jena, Germany)

Microscope Camera (3 CCD colr video camera) Sony (Tokio, Japan)

Microscope Camera B / W HAL 100 Zeiss (Jena, Germany)

Microtome Autocut Mod 1140 Reichert-Jung (Vienna, Austria)

Oven T5052 E Heraeus ( Hanau, Germany)

Embedding centre MPS/P2 Slee (Mainz, Germany)

Microplate Reader MWG-Biotech (Ebersberg, germany) XCell4 SureLock™ Midi-Cell electrophoresis system Invitrogen ( Karlsruhe, Germany)

Trans-Blot®Turbo™ Transfert System BIO-RAD (Munich, Germany)

BD FACSCalibur flow cytometer BD Biosciences (USA)

Elisa reader Thermoscientific (Lagenselbord- Germany)

CO2 incubator C 150 Binger GmbH (Tuttligen, Germany)

Waterbath Kottermann (Vienna, Austria)

Ultrospec 2000 (UV/visible spectrophotometer) Pharmacia Biotech

SANYO Incubator MIR 152 SANYO Electric Co.Ltd (Japan)

Microplate shaker VWR (Leuven,Belgium)

Autoclave Systec GmbH (Wettenberg, Germany)

HeraSafe biological safety cabinet Heraeus ( Hanau, Germany)

HPLC system Thermo Finnigan, San Jose, CA

UHPLC system Thermoscientific (Lagenselbord- Germany)

LTQ-Orbitrap Mass Spectrophotometer _

LTQ-Orbitrap Mass Spectrophotometer _ Hypersil Gold column (100 x 2.1 mm id, 3µm particle size) _ Discovery Supelco HS C-18 column (25 x 4.6 mm, 5µm particle size) Sigma-aldrich (Steinheim, Germany)



3.1.3 Test organisms

3.1.3.1 Animals

Juvenile female Wistar rats aged 5 weeks and weighing 101-124 g were

obtained from Janvier (Le Genest St Isle, France). They were maintained under

controlled temperature (20±1°C), humidity (50-80%), and illumination (12h light, 12h

dark) conditions. The rats had free access to standard rat soy free diet (Sniff R10-

Diet, Ssniff GmbH, Soest Germany) and water. All animal handling and experimental

conditions were carried out according to the Institutional Animal Care and Use

Committee guidelines regulated by the German federal law for animal welfare.

3.1.3.2 Yeast strain

Yeast cells (saccharomyces cerevisiae) originated from Glaxo. They are stably

transfected with the human estrogen receptor alpha (hERα) gene, together with

expression plasmids containing estrogen-responsive elements and the lac-Z reporter

gene encoding the enzyme β-galactosidase.

3.1.3.3 Cell lines

MCF-7

MCF-7 cells are immortalized cells from human breast adenocarcinoma that

were isolated in 1970 from a 69 year-old Caucasian woman. They grow as an

adherent monolayer in cell culture flasks and have retained several characteristics

particular to the mammary epithelium. Moreover, estrogens can activate the ER

found in their cytoplasm and they are known as ER positive cell line. MCF-7 cells are

useful for in vitro breast cancer studies and were kindly provided by Bayer

HealthCare Pharmaceuticals (Berlin, Germany).

HT-29

HT-29 cells were isolated in 1964 from a primary adenocarcinoma of a 44

year-old Caucasian woman. They grow as adherent monolayer and are able to

express differentiation features that are characteristic of mature intestinal cells. Apart

from their particular use in glucose metabolism and hormones receptors studies, they



are like all other cancer cell lines used in the area of cancer research. They were also

provided by Bayer HealthCare Pharmaceuticals.

C2C12

The C2C12 cell line is an immortal line of mouse skeletal myoblasts derived

from the thigh muscle of a C3H mouse after a crush injury. C2C12 cells grow as

adherent monolayer and exhibit characteristic features of satellite cells. They are

used to study the process of satellite cells activation, proliferation and differentiation.

Because they are able to differentiate in contractile myotubes producing

characteristic muscle protein, C2C12 are also used to study several aspects of

skeletal muscle function and adaptation. They were purchased from ATCC (American

Type Culture Collection, CRL-1772).

3.2 Methods

3.2.1 Preparation of cell culture media and buffers

Table 4: Yeast culture medium components

Stock solutions Components/concentration

Minimal medium

13.61 g KH2PO4, 1.98 g (NH4)2S04, 4.2 g KOH pellets, 0.2 g MgSO4, 1 ml Fe2(S04)3 solution (40 mg/50 ml H20), 50 mg L-Ieucine, 50 mg L-histidine, 50 mg adenine, 20 mg L-arginine-HCI, 20 mg L-methionine, 30 mg L-tyrosine, 30 mg L-isoleucine, 30 mg L-lysine-HCI, 25 mg L-phenylalanine, 100 mg L-glutamic acid, 150 mg L-valine, and 375 mg L-serine to 1 L double-distilled water pH 7.1.

Vitamin Solution

8 mg thiamine, 8 mg pyridoxine, 8 mg pantothenic acid, 40 mg inositol, and 20 mL biotin solution (2 mg/100 mL H20) to 180 mL doulble-distilled water.

L-aspartic Acid 4 mg/mL

D-( + )-glucose 20% w/v

L-threonine 24 mg/mL

Copper Sulfate 20 mM

*CPRG 10 mg/mL

* Chlorophenol red-β-D-galactopyranoside

The minimal medium and all other stock solutions were sterile filtered through

0.2 μm filter and stored at 4°C in glass bottles. Growth medium was prepared by

mixing 5 mL of glucose solution, 1.25 mL of L-aspartic acid solution, 0.5 mL of

vitamin solution, 0.4 mL of L-threonine solution, 125μL of copper sulfate solution to



45 mL minimal medium solution. Assay medium was prepared by adding 0.5 mL of

CPRG solution to fresh growth medium.

Table 5: C2C12, HT-29 and MCF-7 cells growth media

Cell line Medium composition

C2C12 (Proliferation medium)

420 mL DMEM 50 mL FBS 10 mL glutamin (4nM) 5 mL penicillin/streptomycin (100U/L) 5 mL sodium pyruvate (100mM) 10 mL sodium bicarbonate (7.5%)

HT-29

450 mL DMEM 50 mL FBS 5 mL L-glutamin (4nM) 10 mL penicillin/streptomycin (100U/l)

MCF-7 (Normal growth medium)

450 mL RPMI 50 mL FBS 5 mL L-glutamin (4nM) 10 mL penicillin/streptomycin (100U/l) 1.25 mL human Insulin (4mg/ml)

Charcoal-stripped FBS

In experiments with the aim to assess the impact of E2 or PEs on cell

proliferation, the steroids contained in FBS have to be removed in other to avoid any

interference. To achieve this, activated charcoal was added to FBS (10 mg/mL) and

the mixture shook for 1h at RT. The mixture was afterwards placed at 4 °C overnight

to allow the charcoal to sediment. Then it was centrifuged (3500 rpm, 4 °C) and

sterile filtered through a 0.2 μm syringe filter.

Buffers and solutions

Phosphate-buffered saline (PBS 0.1 M)

Adjust the pH to 7.4

Na2HPO4 *2H2O 14.4 g

NaH2PO4* H2O 2.6 g

NaCl 8766 g

ddH2O 1L



Tris-buffered saline (TBS 0.05 M)

Tris 6.057 g

NaCl 8.76 g

ddH2O 1L

Ajust the pH to 7.6 with 1M HCl

Depending on the purpose of use (antibody dilution, washing steps), both

buffers were sometimes supplemented with 0.1% Tween 20.

TAE (Tris-Acetate-EDTA) buffer

TAE buffer was used in agarose gel electrophoresis for the separation of RNA

and DNA.

For 1 L 50X TAE Stock Solution:

Tris Base (MW=121.1 g/mol) 242 g

Glacial Acetic Acid 57.1 mL

0.5 M EDTA (pH 8.0) 100 mL

ddH2O 1 L

To prepare 1L of 0.5 M EDTA (pH 8.0) solution:

EDTA (MW = 372.24 g/mol) 186.1 g

ddH2O 1 L

Adjust the pH with 10 N NaOH (40 g NaOH in 100 mL ddH2O).

Lysis puffer

This buffer was used for the preparation of proteins from cells. For 100 mL:

Tris (50 mM) 0.605 g

0.25% sodium deoxycholate 0.25g

NaCl (150 mM) 0.8766g

1 mM EDTA 0.0292g



1% Triton X 100 1mL

Adjust the pH to 7.4 with HCl

Diethylpyrocarbonate (DEPC)-treated water.

DEPC-treated water is suitable for dissolving RNA after its extraction from

cells or tissues. To prepare 1L, 1 mL of DEPC was added in 999 mL ddH2O and

placed overnight in a water bath at 37°C. Afterwards the water was autoclaved for 20

min to remove the DEPC.

6X Sucrose loading buffer

For 10 mL solution:

Sucrose (40 % w/v)

Bromophenol blue 0.25 %

Xylene xyanol 0.25 %

DNA Ladder

The DNA ladder is a solution of DNA molecules of different lengths that is

used in agarose gel electrophoresis as a reference to estimate the size of an

unknown double-stranded DNA molecule. The DNA ladder was also used in total

RNA quality control to estimate the location of the 28 S and 18 S ribosomal RNA

bands.

For 1 mL solution:

100 bp DNA ladder 50 μL

6x sucrose loading buffer 166 μL

1x TAE buffer 784 μL



3.2.2 Plant material extraction

The stem bark of E. excelsa was collected in Kumba (in the SouthWest region

of Cameroon) in April 2011. The botanical sample was identified and authenticated at

the Cameroon National Herbarium in Yaounde where a voucher specimen (N° 61487

HNC) is deposited. The samples were air-dried (19-29°C), ground and 1.5 kg of the

powder extracted at room temperature (22 ± 5°C) with ethanol (3× 6 l; 72 h each).

After filtration, the solvent was removed using a rotary evaporator under reduced

pressure.

3.2.3 LC-HRMS and LC-HRMS/MS analysis

An Accela Ultra High-Performance Liquid Chromatography (UHPLC) system

hyphenated to a hybrid LTQ-Orbitrap Discovery Mass Spectrometer was employed

for the extract profiling. The UHPLC system was equipped with an Accela pump, an

Accela autosampler and an Accela PDA detector. Stock solution of 1 mg/mL (MeOH:

H2O, 50/50, v/v) of the crude extract was prepared and 10 μL injected on a Hypersil

Gold column (100 x 2.1 mm i.d., 3 μm particle size). The mobile phase used was

aqueous acetic acid 0.1% (v/v) (solvent A) and acetonitrile (solvent B). The initial

conditions were 98% of solvent A and 2% of solvent B adjusting linearly to 98% B in

28 min. This solvent composition was maintained for 0.9 min (98% B) followed by a

return to the initial conditions (in 0.1 min) and a re-equilibration step (1 min) prior to

the next run. The flow rate was set to 500 μL/min and the wavelengths used for

monitoring the chromatograms were 220, 280, and 365 nm (recording window 200 -

700 nm).

The mass spectrometer was equipped with electrospray ionization (ESI)

source and operated in positive mode. A data dependent triple play method involving

three scan events was developed for the profiling of the extract. This method

consisted of a full scan acquisition, a Selective Ion Mode (SIM) and a MS/MS

acquisition employing the Orbitrap analyzer and was designed so that the major ion

detected in each full scan could be selected, scanned in SIM mode and fragmented,

resulting to highly accurate MS and MS/MS spectra. For all measurements, the mass

tolerance was set at 5 ppm. The ESI source was operated at a sheath gas flow rate

of 50 arb, auxiliary gas flow rate of 10 arb, ion spray voltage of 3.5 kV, capillary



temperature of 300 oC, capillary voltage of 35 V, tube lens of 110 V and collision-

induced dissociation (CID) of 35% (HRMS/MS acquisitions). Xcalibur 2.0.7 software

was used for the pre-and post acquisition of the results.

3.2.4 Vacuum liquid chromatography (VLC)

The column (200x15mm) was packed with 25 g of silica gel. The dry loading

method was applied for sample application. 1g of the crude extract was dissolved in

methanol, the resulting solution adsorbed on 3g of silica and the solvent allowed to

evaporate. The dry adsorbent loaded with the sample was then applied to the column

and eluted using a step gradient of solvent under vacuum. 250 mL fractions were

collected at each polarity step and the column was allowed to run dry after each

fraction collection. The solvent was evaporated to yield five fractions (Table 6) that

were monitored for biological activity.

Table 6: VLC fractions.

Fraction Solvent Weight (mg)

F1 Cyclohexane(100%) 6.7

F2 Cyclohexane - DCM(*) (50:50) 21.9

F3 DCM(100%) 9.8

F4 DCM - MeOH (50:50) 485

F5 MeOH (100%) 24.1

(*) Dichloromethane

3.2.5 HPLC

The HPLC system consisted of a vacuum degasser, a quaternary pump, an

autosampler and a Diode-Array Detector (DAD). A Discovery SUPELCO HS C-18

column (25 × 4.6 mm, 5 μm particle size) was used for separations. A binary mobile

phase consisting of 1% acetic acid (A) and methanol (B) was used. The initial

conditions were 50% A and 50% B. Then a gradient program was applied as follows:

50-98% B and 50-2% A over 60 min, isocratic 98% B and 2% A for 5 min, return to

the initial conditions over 5 min and maintain of these conditions for 10 min prior to

the following injection. The injection volume was set to 20 μL and the flow rate to

1mL/min. DAD conditions: 254, 280, and 365 nm and recording window from 200 to



700 nm. The control of the system as well as data acquisition and analysis were

performed using ChromQuestTM 4.1 software.

3.2.6 Yeast estrogen screen

3.2.6.1 Principle

The yeast estrogen screen (YES) (Figure 12) is a transactivation assay used

to identify compounds that can interact with the human estrogen receptor (here hER-

α). In this system, yeast cells (saccharomyces cerevisiae) are transfected with hERα

gene, together with expression plasmids containing estrogen-responsive elements

and the lac-Z reporter gene encoding the enzyme β-galactosidase. Upon binding an

active ligand, the receptor interacts with transcription factors and other transcriptional

components to modulate gene transcription. This causes expression of the reporter

gene lac-Z and the enzyme produced is secreted into the medium where it

metabolizes a chromogenic substrate, chlorophenolred-β-D-galactopyranoside

(CPRG) which is normally yellow, into a red product that can be measured by

absorbance at 540nm.



Figure 12: Estrogen-inducible expression in yeast (Routledge and Sumpter, 1996).

3.2.6.2 Assay procedure

Yeast cells were stored at -80°C as 10X concentrated stock in growth medium

supplemented with 15% glycerin. At day zero, growth medium was inoculated with

yeast stock and incubated at 28°C till an OD of 1 at 690nm was attained

(approximately 24h). The following day, chemicals serially diluted in DMSO were

transferred (2μL) to 96-well optically flat bottom plates. Each plate contained one row

(12 wells) of blanks (2μL DMSO only) and each assay had a 17β-estradiol standard

curve (10-12-10-8 M). Assay medium was inoculated with the optimal yeast density of

the 24 h culture prepared at day 0 and 200μL was given in each well. The plates

were then sealed with autoclave tape and incubated at 32°C in a naturally ventilated

heating cabinet on an orbital shaker. After 3 days of incubation, color change of the

medium was quantified by absorbance at 540 nm. Yeast growth (turbidity) was

measured at 620 nm.



3.2.6.3 Calculations

Dose–response curves for β-galactosidase activity were obtained using

corrected absorbance units (CAU):

CAU = (AU 540nm) compound − [(AU 620nm) compound − (AU 620nm)

blank]. The best-fitting curve was calculated with SigmaPlot for Windows, version 11

using a four-parameter logistic regression according to the following formula:

Hillslope x) (logEC50101

min -max min

CAU

min = baseline absorbance

max = maximal absorbance

EC50 = concentration of test compound yielding a half-maximal effect

X= given concentration of test compound.

Other parameters such as the relative induction efficiency (RIE) and the

relative potency (RP) of each chemical were calculated as follows:

100 E2 min)-(max

compound min)-(max RIE

100 Compound (EC50)

E2 (EC50)RP



3.2.7 MTT/XTT assays

3.2.7.1 Principle

Both assays are based on the cleavage of yellow tetrazolium salts MTT (3-

(4,5-dimethythiazol-2-yl)-2,5-diphenyl tetrazolium bromide) or XTT (2,3-Bis-(2-

Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide) by mitochondrial

succinate dehydrogenases of metabolic active cells. The colored (dark purple for

MTT and orange for XTT) formazan product is then measured spectrophotometrically

and correlates to cell viability since the reduction of tetrazolium salts can occur only

in metabolically active cells. The difference between the two assays is that the XTT is

performed in the presence of an electron- coupling reagent and the formazan product

formed is water-soluble and does not require a further solubilization step as it is the

case for MTT.

3.2.7.2 Assay procedure

Breast cancer (MCF-7) and colon carcinoma (HT-29) cell lines were used. The

cell culture media were prepared as indicated in Table 5. For the assay, the cells

were washed with phosphate buffered saline (PBS) and detached with 0.05 %

trypsin-EDTA. After centrifugation, the pellet was resuspended in medium, the cells

counted and diluted to give the optimal seeding density (104 cells/well). The cells

were further plated into a 96-well plate, allowed to attach for 24-48 h and incubated

for 3 or 5 days with either cisplatin or the plant extract dissolved in DMSO. Each

concentration was added to the plates in six replicates. The final DMSO

concentration was not more than 0.1%, this concentration being used in the solvent

control wells.

3.2.8 Myotubes diameter assay

C2C12 cells were routinely cultured in a proliferation medium (Table 5). They

were passaged 2 to 3 times/week (at 80% confluence) to avoid confluence that would

cause a depletion of the myoblast population. For the assay, myoblasts in PM were

seeded at a density of 105 cells/well in 6-well plates. Differentiation towards

myotubes was induced on the 3rd day (at confluence) by shifting the proliferation

medium (PM= DMEM+10% foetal bovine serum) to a differentiation medium (DM=



DMEM supplemented with 2-10% horse serum). Myotubes at day 4-6 post-fusion

were incubated for 48 h with the different substances (Table 7). At the end of the

treatment period, cultures were fixed in 2.5% glutardialdehyde and photographed by

glutaraldehyde-induced autofluorescence using an Axiovert 200 M microscope

equipped with a HaL 100 camera. Average diameters of at least 50 myotubes were

measured for each condition at different points separated by 25-50 µm along the

length of the myotube (Stitt et al., 2004) using the Axiovision LE software.



Table 7: Experimental groups myotube diameter assay.

3.2.9 Western blot

3.2.9.1 Protein preparation from C2C12 cells

C2C12 cells were cultured and seeded for this assay as previously mentioned

with the difference that they were allowed to grow to confluence and to differentiate in

normal growth medium. At 10 days old, cells were incubated for 72h in the presence

of either E2 (10-8 M) or vehicle control (DMSO) and the lysate prepared.

Cell culture dishes were placed on ice and the cells washed twice with ice-cold

PBS. Then ice-cold lysis buffer supplemented with protease enzyme inhibitor PMSF

(phenylmethanesulfonylfluoride, dissolved in isopropanol) at final concentration of 1

mM was added directly in the dishes and the cells scraped off using a cold plastic

scraper. The cell suspension was transferred into pre-cooled micro centrifuge tubes

and maintained for 30 min on ice. After 20 min centrifugation at 12000 rpm, the

supernatants were transferred in new tubes and the protein concentration

determined.

3.2.9.2 Determination of protein concentration

The total level of protein in each sample was determined using the BIO-RAD

DC Protein Assay which is based on the Lowry method (Lowry et al., 1951). BSA

(Bovine Serum Albumin) standard protein samples ranging from 0 to 2 mg/mL were



prepared in lysis buffer and the myotubes protein samples diluted up to 1: 5. Then 5

µL of each sample protein was introduced in each well of a microplate reader

followed by 25 µL Reagent A and 200 µL Reagent B. After 15 min of incubation at

room temperature (RT), the absorption at 650 nm was read using a microplate

reader. The protein samples were stored at -80°C till further use.

3.2.9.3 SDS gel electrophoresis

Sample protein (20 μg) were mixed with equal amounts of SDS-loading buffer

and loaded on a NuPAGE Novex 4–12% Bis–Tris Midi Gel. After migration at 90 mA

for 60 min using the XCell4 SureLock™ Midi-Cell electrophoresis system, proteins

were blotted for 30 min at 25V, 1A (Trans-Blot®Turbo™ Transfert System) onto

nitrocellulose membranes (Protran®Nitrocellulose Membranes). The membranes

were blocked for 1h at room temperature with 5% dry milk powder in Tris-buffered

saline with 0.1% Tween 20 (TBS-T). The membranes were incubated overnight at

4°C with either β-actin or ERβ antibody diluted (Table 2) in 1% dry milk powder in

TBS-T. After four times wash with TBS-T for 10 min each, the membranes were

incubated for 1h at RT with the corresponding secondary antibody solution. After

another four times wash (10 min each) in TBS-T, blot signals were visualized by the

chemoluminescent POD-Substrate and the images analyzed using the Image J 1.40g

software.

3.2.10 Uterotrophic assay

Juvenile female Wistar rats aged 6 weeks were ovariectomized. After 14 days

of endogenous estrogens decline, the animals weighing 200-250g were randomly

distributed into treatment and vehicle groups (Table 8) and treated for three

consecutive days with a daily dose. The animals were sacrificed by decapitation 24 h

after the last dose. Uterine and liver wet weights were recorded. Half of the uteri were

kept together with vaginas in 4% formaldehyde for subsequent histological analysis

and the rest of the uteri as well as the livers were snap frozen in liquid nitrogen for

RNA preparation.



Table 8: Groups treatment uterotrophic assay

Groups Dose Number of animal

Control 1 mL/kg BW career (20% DMSO + 80% corn oil)

7

E2 4 μg/kg BW 7

E.excelsa 50 mg/kg BW 6

100 mg/kg BW 6

3.2.11 Histological analysis of tissues

The standard paraffin process that includes fixation, processing, embedding,

sectioning, and staining was used for historical anlaysis of tissues.

3.2.11.1 Fixation

To prevent the degenerative process that takes place when tissues are

deprived from their blood supply, tissues were put in cassettes carrying details for

their identification and kept in a 4% formalin solution right after their preparation.

3.2.11.2 Dehydration and clearing

To allow cutting, tissues have to be infiltrated with paraffin wax that is however

not soluble in water or alcohol but in a solvent called xylene or xylol which is miscible

with both alcohol and paraffin. The water that is contained in tissues was removed by

passing the tissues through increasing concentrations of ethanol (50-100%). Finally,

the alcohol that replaced the water was replaced by xylol. The specimens were

afterwards transferred in molten wax (60°C) in an embedding centre.

3.2.11.3 Embedding

The specimens were removed from their cassettes and placed in wax filled

molds according to the desired orientation (transversal and/or longitudinal). The

cassettes were then placed on top of the molds and the now called “block” allowed to

solidify on a cold surface.



3.2.11.4 Sectioning

Sections of 5-7 μm were cut on a microtome (Mod. 1140/Autocut), flatted on

the surface of warm water and picked up onto polysine microscope slides.

3.3.11.5 Staining

Hematoxylin-eosin (HE) was used as the staining technique. Because staining

solutions used are aqueous, the wax had to be removed and the sections rehydrated.

The sections were first incubated at 60°C for 1h (Hereaus B5042 incubator) and were

afterwards passed in xylene and decreasing concentrations of ethanol as follows:

Xylol 1 15 min

Xylol 2 10 min

Xylol 3 10 min

100% EtOH 1 5 min

100% EtOH 2 5 min

96% EtOH 1 5 min

96% EtOH 2 5 min

70% EtOH 1 5 min

70% EtOH 2 5 min

Distilled water 5 min

The slides were immersed in different solutions as follows:

1. Mayer‟s hemalun 5 min

2. Tape water 5 min

3. Eosin 2 min

4. Distilled water Briefly

5. EtOH 70 % 2-3 min

6. EtOH 96 % 2-3 min

7. EtOH l 100 % 2-3 min

8. Xylol 2-3 min

9. Mounting with coverslips and mounting medium.



3.2.12 Gene expression analysis

3.2.12.1 RNA preparation from cells and tissues

The total cytoplasmic RNA was extracted from cells and tissues using the

standard TRIzol® method according to the manufacturer‟s instructions (Invitrogen,

Life Technologies). For the animal experiment, tissue samples from the same

treatment group were pooled.

3.2.12.2 RNA concentration and quality control

RNA concentration was obtained by measuring the absorbance at 260nm

using a NanoDropTM 1000 spectrophotometer. The purity of the extracted RNA was

estimated by the ratio between absorbance at 260 and 280nm and its integrity

controlled by agarose gel electrophoresis and ethidium bromide staining.

3.2.12.3 Complementray DNA (cDNA) synthesis

Synthesis of cDNA including the removal of genomic DNA was performed

using the QuantiTect® Reverse Transcription Kit of Qiagen according to the provided

instructions. The incubation steps were performed in a GeneAmp PCR system 9600

thermocycler.

3.2.12.4 Primer design

The genomics sequences available at the University of California Santa Cruz

Genome Bioinformatics site (UCSC genome browser) and the Primer3 software

(Whitehead Institute for Biomedical Research, Cambrigde, USA) were used to design

primers (sequences in Table 9). The specificity of the designed primer was checked

using the BLAST program of the NCBI (National Centre for Biotechnology

Information). The design criteria were as follows:

Melting temperature: between 58°C and 60°C

Length: 18-23 bp

Amplicon length: 150-200 bp

G/C content: 40-60%



Table 9: Primer Sequences

Gene name Forward and reverse primers Amplicon size (bp)

Mouse

Cyclophilin (CYC) GGATTCATGTGCCAGGGTGG

212 CACATGCTTGCCATCCAGCC

ERα TGTTTGCTCCTAACTTGCTCCT

222 GGTGGATGTGGTCCTTCTCTT

Rat

1A CGTCACAGCCCATGCATTCG

212 CTGTTCATCCTGTTCCAGCTC

C3 CAGCCCGCAGAGTGCCAGTAGTC

CCATCCTCCTTTCCATCAACTGC

Clusterin CCCTTCTACTTCTGGATGAA

GAACAGTCCACAGACAAGAT

IGFBP-1 GATTAGCTGCCGCTCAACAG

283 TTCCCACTCCATGGGTAGAC

CaBP9k ATCCAAACCAGCTGTCCAAG

181 TGTCGGAGCTCCTTCTTCTG

Human

1A CTATAGTGGAGGCCGGAGCAGCAA

203 GAGGGGCGTTTGGTATTGGGTTATG

BAX AACATGGAGCTGCAGAGGA

GGAGGAAGTCCAATGTCCAG

BCL-2 GGATGCCTTTGTGGAACTGT

GCCTGCAGCTTTGTTTCAT

CCND1 TCGGTGTCCTACTTCAAATGTGT

233 GGGATGGTCTCCTTCATCTTAG

3.2.12.5 Quantitative realtime RT-PCR

Real-time RT-PCR was performed in a MX3005P thermal cycler. The protocol

consisted of a denaturing cycle at 94-95 °C for 4 min followed by 40 cycles of 20 s at



94-95 °C, 20-30 s at 58-60 °C, and 30 s at 72°C. The reaction setup and the cycling

conditions are resumed in Tables 10 and 11.

Table 10: PCR reaction mix.

Components 25 μL reaction 50 μL reaction Final []

Ampuwa 16.425 32.85 _

10X PCR buffer 2.5 5 1X

MgCl2 (50 mM) 1.5 3 3 mM

dNTPs (2.5 mM) 1 2 0.1 mM

Primer mix (10 mM each ) 0.5 1 0.2 mM

Template DNA 0.5 1 _

Taq-polymerase (5U/μL) 0.075 0.15 0.75 U

Sybr green (1X) 2.5 5 0.1X

Table 11: PCR cycling conditions.

Cycle Step Temperature Time Description

1 Segment 1 94-95°C 4 min Initial denaturation

40-45 Segment 2

94-95°C 20s Template denaturation, Primer annealing and Extension 58-60°C 20-30s

72 °C 30s

1 Segment 3

95°C 1 min Flourescnece data collection, dissociation (melting) curve analysis

55°C 30s

95°C 30s

3.2.12.6 Analysis of real time RT-PCR results

Expression levels of the analyzed genes were normalized to the housekeeping

gene (cytochrome C oxidase or 1A) and correlated to the untreated control animal

group using the ΔΔCt method (Pfaffl, 2001). This method assumes that the DNA

amplification efficiency is 100% or equal to 1 and proposes the following formula for

the calculation of the amount of target gene:

Expression level target gene (Fold induction) FI = 2 -∆∆Ct where:

Ct = cycle number at which the fluorescence crosses the threshold (threshold cycle)

ΔCt = Ct target-Ct reference

ΔΔCt = ΔCt target- ΔCt control



3.2.13 Cell cycle analysis

The analysis of cell cycle is based on the ability to stain cellular DNA in a

stoichiometric manner, i.e. the amount of stain is directly proportional to the amount

of DNA within the cell. Because the DNA amount changes between the different

phases during the cell cycle, the measure of DNA content in cells by flow cytometry is

a powerful tool that allows the study of how chemicals affect cell cycle distribution

and progression. For the assay, MCF-7 cells were routinely cultured in the normal

growth medium as indicated in Table 5. To avoid any influence of steroids contained

in the serum, FBS was stripped with 0.5% charcoal and the medium containing

charcoal-treated FBS (assay medium) used for the assay. The cells were plated at a

density of 2x105 cells/well in 6 -well plates and pre-incubated 48 h in assay medium

prior to the treatment. The procedure is represented in Figure 13. All the test

chemicals (see Table 12 for different groups) were dissolved in DMSO and the final

DMSO concentration in each well was not more than 0.1%. The cell cycle distribution

was analyzed using a BD FACSCalibur flow cytometer.

Table 12: Experimental groups for the cell cycle analysis.



Figure13: Cell culture procedure for cell cycle analysis.



3.2.14 Immunocytochemistry

This method was applied for the detection of apoptosis of MCF-7 cells using

the M30 CytoDEATH antibody that recognizes a specific caspase cleavage site

within cytokeratin 18 (Roche, Mannheim Germany). MCF-7 cells were plated in 24-

well plates (5x104 cells/well), pre-incubated for 48 h with charcoal treated-FBS

medium and exposed for 6h to the test chemicals. The following protocol provided by

Roche was used with some modifications:

1. Washing of cells with PBS

2. 30 min fixation at -20°C in ice-cold pure methanol

3. 2 x 5 min wash with washing buffer (PBS+0.1%

Tween 20)

4.

Incubation with 100 µL/well M30 CytoDEATH antibody

(diluted 1/10 in washing buffer containing 1% BSA) at

4°C overnight

5. 2 x 5 min wash with washing buffer

6. Incubation with polyclonal goat anti-mouse Ig,

biotynylated (diluted 1/200 in PBS) for 1h at RT


8. Incubation with streptavidin-cy3 (diluted 1/1000 in

PBS) for 1h at RT


10. Incubation with Dapi (1/1000 in PBS) for 3 min at RT


12. Acquisition of photos using fluorescence microscope

Photos were taken and analyzed with an Axiovert 200 M inverted fluorescence

microscope equipped with an HL 100 camera. At least 1000 cells/treatment groups

were counted and the apoptotic index calculated according to the following formula:

100cellsof number Total

cells positive M30of Number index Apoptotic



3.2.15 Statistical analysis

All data are expressed as mean±SD and were statistically analyzed with SPSS

17.0-21.0 for Windows. Kruskal-Wallis H-test and the Mann–Whitney U-test were

used and significance level set at P < 0.05.

Results


CHAPTER 4: RESULTS

Results


4.1 Biological activities and chemical characterization of Erythrina

excelsa

4.1.1 Estrogenic and Cytotoxic properties of E.excela whole extract 1

4.1.1.1 Yeast estrogen screen

The ability of E. excelsa whole ethanol extract to interact with the human

estrogen receptor alpha was assessed using the yeast transactivation assay. As

shown in Figure 14A, E. excelsa similarly to E2 and genistein dose-dependently

induced lac-Z reporter gene expression. Yeast growth was inhibited by

concentrations of extract above 10 μg/mL (data not shown). The EC50 values as well

as RIEs and RPs are summarized in Table 13. The response of the yeast to E.

excelsa was antagonized by the pure anti-estrogen ZK (Figure 14B). In the anti-

estrogenic activity assay, only ZK was able to produce a full dose-response effect

(Figure 14C).

1 These results are submitted as original research article in planta medica

Results


Figure 14: Effect of E. excelsa whole extract as compared to genistein and E2 on the

expression of β-galactosidase in yeast cells. The graph depicts the concentration of 17β-

estradiol, genistein, ZK and E. excelsa ethanolic extract plotted against the CAUs of the

medium after 3 days of incubation (A) estrogenicity; (B) antagonism of E. excelsa with ZK

and (C) anti-estrogenicity.

Table 13: Yeast assay results with E. excelsa whole extract.

EC50 (μg/mL) EC50 (M) RIE (100%) RP

E2 2.34x10-5 ± 1.76x10-6 8.6x10-11 ± 6.5x10-12 100 100

Genistein 0.2 ± 0.0282 7.4x10-7 ± 1.07x10-7 90.2 1.6x10-2

E. excelsa 1.8 ± 0.2 67.45 1.3x10-3

Results


4.1.1.2 Uterotrophic assay

4.1.1.2.1 Effect of E. excelsa whole extract on the uterus

Uterine wet weight and epithelial height

E. excelsa at a dose of 50 mg/kg BW/day like E2 led to a significant increase

of uterine wet weight and uterine epithelial height but was less potent. At 100 mg/kg

BW/day, a significant decrease of uterine wet weight and a tendency to a decrease of

the uterine epithelial height were observed (Figure 15).

Results


Figure 15: (A) Uterine wet weight (mg/kg BW) and (B) uterine epithelial height (µm) after 3-

day subcutaneous treatment of ovariectomized Wistar rats with either E. excelsa ethanolic

extract (50 and 100 mg/kg BW/day) or E2 (4 µg/kg/BW/day). (C) 100X Microphotographs of

uterine tissue following a Hematoxylin-Eosin (HE) staining. Mean values ± S.D. are given for

n = 6 animals per dose group ** p≤ 0.01;*p≤0.05, significantly different from the control group

(Ovex), Kruskal-Wallis H-test followed by Mann–Whitney U-test.

Uterine C3 and clusterin mRNA expression

As expected, Clusterin mRNA expression was down-regulated and C3 up-

regulated following treatment with E2. In response to the treatment with 50 mg/kg

BW/day of E. excelsa ethanolic extract, the same but less pronounced gene

expression pattern was detected. The 100 mg/kg dose of E. excelsa, unlike the 50

mg dose, caused a significant up-regulation of Clusterin and a down-regulation of

C3 (Figure 16).

Results


Figure 16: (A) Relative mRNA expression of C3 and (B) clusterin (normalized to the

mRNA amount of 1A and compared to the vehicle control group) in the uterus of

ovariectomized Wistar rats treated subcutaneously for 3 consecutive days with 50 and

100 mg/kg BW/day E. excelsa ethanolic extract and 4 µg/kg/BW/day E2. * P≤0.05

significantly different from the control group (Ovex), Kruskal-Wallis H-test followed by

Mann-Withney U-test.

4.1.1.2.2 Effect of E. excelsa whole extract on the vagina

E2 increased the vaginal epithelial height by approximately 5-fold. No

significant effects of E. excelsa could be detected at both doses, but clear tendencies

of either increase or decrease were seen (Figure 17).

Results


Figure 17: (A) Vaginal epithelial height (µm) after 3-day subcutaneous treatment of

ovariectomized Wistar rats with either E. excelsa ethanolic extract (50 and 100 mg/kg

BW/day) or E2 (4 µg/kg/BW/day). (B) 100X Microphotographs of vagina tissue following a

Hematoxylin-Eosin (HE) staining. Mean values ± S.D. are given for n = 6 animals per dose

group ** p≤ 0.01;*p≤0.05, significantly different from the control group (Ovex), Kruskal-Wallis

H-test followed by Mann–Whitney U-test.

4.1.1.2.3 Effect of E. excelsa whole extract on the liver IGFBP-1 and CaBP9k

mRNA expression

The 50 mg/kg dose of E. excelsa similar to E2 significantly increased the

mRNA expression of IGFBP-1 and CaBP9k, whereas the 100 mg/kg dose led to a

significant down regulation of the two genes (Figure 18).

Results


Figure 18: Relative mRNA expression of (A) IGFBP-1 and (B) CaBP9k (normalized to the

mRNA amount of 1A and compared to the vehicle control group) in the liver of

ovariectomized Wistar rats after 3-day subcutaneous administration of 50 and 100 mg/kg

BW/day E. excelsa ethanolic extract and 4 µg/kg/BW/day E2. *P≤0.05, Kruskal-Wallis H-test

followed by Mann-Withney U-test.

4.1.1.3 MTT assay

The effect of E. excelsa whole extract on the growth of breast (MCF-7) and

colon (HT-29) cancer cell lines was investigated using the MTT cytotoxicity/cell

viability assay. A slight and non significant increase of the viability of MCF-7 cells was

caused by lower concentrations of E. excelsa. At higher concentrations however, cell

death was observed. The extract was cytotoxic on HT-29 cells at all tested

concentrations and was less potent than the chemotherapeutic drug cisplatin (Figure

19).

Results


Figure 19: Effects of E. excelsa whole extract on the growth of (A) MCF-7 and (B) HT-29

cells. Results present the average and standard deviation of n≥3 independent experiments

performed in 6 replicates for each concentration.

4.1.2 Effect of a phytoestrogenic fraction of E. excelsa on the growth of the

human breast cancer line MCF-7.

Here, the above mentioned crude ethanol extract was fractionated by vacuum

liquid chromatography and the fractions monitored for both estrogenic (YES) and

cancer growth inhibitory (XTT) properties.

4.1.2.1 Yeast estrogen screen

From the 5 fractions obtained by VLC, F4 and F5 were able to induce the

transactivation of the hERα as depicted on Figure 20. Based on the calculated EC50

values (Table 14) F4 was almost as potent as the whole extract and 13.47 times

more potent than F5.

Results


Figure 20: Effect of fractions of E. excelsa on the expression of β-galactosidase in yeast

cells. (A) VLC fractions, (B) active fractions compared to the whole extract. The graphs

depict the concentration of test chemicals plotted against the CAUs of the medium after 3

days of incubation.

Table 14: Yeast assay results with VLC fractions.

Substance EC 50(μg/ml) RIE (%) RP

E2 5.08 x 10-5

± 4.64 x10-6

100

F1 - -

F2 - -

F3 - -

F4 1.1 ± 0.0174 70.37 4.62 x 10-3

F5 14.8 ± 6.7 35.06 3.43 x 10-3

4.1.2.2 XTT

To test whether the two estrogenic fractions also conserved the cytotoxic

ability exhibited by the whole extract, their effect on MCF-7 cell growth was assessed

using the XTT assay. To minimize the influence of the steroids presents in FBS, the

assay was performed with a medium supplemented with charcoal stripped FBS. As

shown in Figure 21, both fractions at lower concentrations induced a slight but not

significant increase in cell viability. At higher concentrations, F4 induced a

Results


concentration-dependent decrease of cell number but was less cytotoxic than the

whole extract.

Figure 21: (A) Effect of estrogenic fractions of E. excelsa ethanol extract on MCF-7 cell„s

viability. (B) F4 compared to the whole extract. MCF-7 cells were incubated for 72 h with

increasing concentrations of fractions or whole extract and the cell viability examined by

XTT.* (p≤0.05) and *** (p<0.001) vs. control analyzed by Kruskal Wallis H-test followed by

Mann Whitney U-test.

Results


4.1.2.3 HPLC fingerprints of F4 and E. excelsa whole extract

Figure 22: HPLC chromatograms of E. excelsa whole extract and F4 fraction

Based on the results obtained in YES and XTT, F4 was the most potent

fraction with respect to both estrogenicity and cytotoxicity and was chosen for further

analysis.

4.1.2.4 Effect of F4 on MCF-7 cell cycle distribution

As on cell viability, a biphasic effect of F4 on cell cycle distribution was

observed. Similarly to E2, F4 at lower concentrations stimulated the G1/S transition

leading to an increased percentage of cells in S and G2/M phases. At the same time,

a concentration-dependent decrease of the percentage of subG1 population (death

cells) was observed. With higher concentrations of F4, although not significant, a

concentration-dependent increase of the percentage of cells in G0/G1 was observed

followed by a decrease of the percentage of cells in S but not in G2/M phase. Higher

concentrations of F4 also increased the percentage of the subG1 population (Figure

23).

M. Sc. Sad

rine T

cho

uk

ou

egno

Ngu

eu

Page 7

9

Resu

lts

Figure 23: Effects of F4 on the cycle distribution of MCF-7 cells. MCF-7 cells were incubated for 48 h with increasing concentrations of F4 and

the cell cycle distribution assessed by flow cytometry. (A) Representative Histogramms and (B) mean of n≥ 3 independent experiments. a

(p≤0.05), b (p<0.01), c (p<0.001) vs. control analyzed by Kruskal Wallis H-test followed by Mann Whitney U-test.

Results


4.1.2.4.1 Antagonisation with ZK

To elucidate the role of ER in the estrogen-like effects of lower concentrations

of F4, an antagonization experiment with a pure antiestrogen (ZK) was performed.

Treatment with ZK alone led to G1 arrest (indicated by a significant increase of the

percentage of the cells in G1 with a concomitant significant decrease in the

percentage of S and G2/M populations) and to an increase of cell death. ZK

antagonized the effects of E2 as well as F4 on almost all phases of the cell cycle

(Figure 24).

Figure 24: Role of ER in F4-mediated effects on the cycle distribution of MCF-cells. MCF-7

cells were cotreated for 48 h with F4 and the pure anti-estrogen ZK and the cell cycle

analyzed by flow cytometry. * (p≤0.05), ** (p<0.01), *** (p<0.001) vs. Control; + (p≤0.05), ++

(p<0.01), +++ (p<0.001) vs. single treatment analyzed by Kruskal Wallis H-test followed by

Mann Whitney U-test.

Results


4.1.2.4.2 Cotreatment with E2

To test for ER antagonism activity of F4, MCF-7 cells were simultaneously

treated with increasing concentrations of F4 and 10-10 M E2 (Figure 25). Analysis of

the cell cycle following cotreatment with lower concentrations of F4 and 0.1 nM E2

shows some antagonistic patterns on both SubG1 and S phases. In fact single

treatment with F4 at those concentrations or with E2 decreased the percentage of the

subG1 cell population and cotreatment brought this percentage back to control levels.

The same effect was observed on the percentage of S-phase cells with 1 μg/mL F4.

In contrast to subG1 and S, additive effects were observed on Go/G1 and M phases.

Cotreatment with E2 did not rescue the cells from death induced by higher

concentrations of F4 rather, E2 addition led to even more pronounced cell death. On

the other hand E2 addition induced more cells to transit from G1 to S phase.

Results


Figure 25: Effect of the cotreatment with E2 and lower (A) and higher (B) concentrations of

F4 on the cycle distribution of MCF-7 cells. MCF-7 cells were treated for 48h with various

concentrations of F4 together with 0.1 nM E2 and the cell cycle distribution analyzed by flow

cytometry. * (p≤0.05), ** (p<0.01), *** (p<0.001) vs. Control; + (p≤0.05), ++ (p<0.01), +++

(p<0.001) vs. single treatment analyzed by Kruskal Wallis H-test followed by Mann Whitney

U-test.

Results


4.1.2.5 M30 staining

To assess the cell death process sustaining the increase of subG1 population

induced by higher concentrations of F4, the caspase cleaved cytokeratin 18 that is a

marker of early apoptosis was investigated. Figure 26 shows clear tendency of a

concentration-dependent increase of the percentage of M30 positive cells following

treatment with F4.

Figure 26: Effect of F4 on caspase-cleaved cytokeratin 18 in MCF-7 cells. MCF-cells were

exposed for 6h to either ZK (10-6

M) or increasing concentrations of F4 and the protein

expression of caspase-cleaved cytokeratin 18 measured by indirect immunofluorescence

using the M30 CytoDEATH antibody as described in material and methods. (A)

Representative fluorescence microscopy images (100 X magnitude), (B) quantitative analysis

of M30 positive cells.

4.1.2.6 Effect of F4 on the mRNA expression of CCND1, Bax and Bcl-2 in MCF-7

cells

CCND1 mRNA was upregulated following treatment with E2 and 10 μg/mL F4,

and downregulated by ZK and 50 μg/mL of F4. E2 and F4 at low concentration acted

differently on Bax and Bcl-2 expression but both significantly downregulated the

Bax/Bcl-2 ratio. E2 had no effect on Bax and upregulated Bcl-2 whereas F4 had no

effect on Bcl-2 but downregulated Bax. At high concentration, F4 as well as ZK

Results


induced a concomitant upregulation of Bax and downregulation of Bcl-2 leading to an

increased Bax/Bcl-2 ratio (Figure 27).

Figure 27: Effects of F4 on the mRNA expression of Bax (A), Bcl-2 (B), Bax/Bcl-2 ratio (C),

and Cyclin D1 (D) in MCF-7 cells. MCF-7 cells were treated for 48h with the tests chemicals

and the expression level of target genes assessed by real-time RT-PCR. ** (p<0.01)

analyzed by Kruskal-Wallis H-test followed by Mann Whitney U-test.

4.1.3 Chemical characterisation of E. excelsa ethanol extract2

The LC-PDA-ESI (+)-HRMS analysis revealed the rich metabolic content of E.

excelsa. The analytical effort was focused on the identification of the major

compounds of the extract as well as the characterization of chemically representative

secondary metabolites. The applied separation and spectroscopic method was

developed aiming to cover the entire spectrum of polarities, thus giving an inclusive

overview of the chemical nature of the extract (Figure 28, Table 15). UV-Vis spectra,

suggested elemental composition (EC), Ring Double Bond equivalent (RDBeq)

values as well as highly accurate mass measurements were incorporated for the

identification procedure. Additionally, the HRMS/MS spectra found to be critical to the

2 Included in the Research article submitted in Planta Medica

Results


identification procedure supporting the structural information were obtained from the

HRMS analysis in full scan (Figures 29-36).

Figure 28: Base Peak chromatogram of Erythrina excelsa ethanol extract and Extracted Ion

Chromatograms (XICs) of representative isoflavonoids detected.

M. Sc. Sad

rine T

cho

uk

ou

egno

Ngu

eu

Page 8

6

Resu

lts

Table 15: Representative Isoflavonoids of Erythrina excelsa ethanol extract using LC-PDA-ESI (+)-LTQ-Orbitrap platform.

Rt

(min)

[M+H]+ Experimental

m/z

Theoritical

m/z

Δm(mmu/ppm)/

ppm)

RDB λmax

(nm)

Main MS / MS fragment ions (Relative abundance, %) Chemicalclass

(Identification) 1 7.91 C15H11O4 255.0663 255.0652 1.125 / 4.409 10.5 261 255 (100), 237 (18), 227 (43), 211 (4), 199 (85), 137 (43)

Simple isoflavone

(Daidzein)

2 9.53 C15H9O5 269.0435 269.0444 -0.900 / -3.345 11.5 262, 342 Not found Coumestan (coumestrol)

3 11.43 C20H19O6 355.1187 355.1176 1.095 / 3.084 11.5 267 337 (100), 319 (5), 309 (8), 295 (37), 283 (77), 271 (2) Prenyl isoflavonoid

4 12.11 C25H27O7 439.1761 439.1751 0.960 / 2.255 12.5 234, 270 421 (11), 403 (49), 385 (9), 368 (24), 349 (100), 295 (8),

213 (6) Dipyran isoflavonoid

5 14.83 C20H9O5 339.1234 339.1227 0.710 / 2.093 11.5 228, 267 283 (100) Prenyl isoflavonoid

6 16.12 C25H25O6 421.1651 421.1646 0.535 / 1.270 13.5 232, 280 403 (100), 349 (10) Dipyran isoflavonoid

7 16.69 C20H17O5 337.1076 337.1071 0.520 / 1.542 12.5 228, 282 337 (8), 322 (19), 319 (69), 309 (15), 295 (31), 283 (100),

267 (15) Pyran isoflavonoid

8 17.22 C25H27O6 423.1803 423.1802 0.085 / 0.201 12.5 237, 271 405 (42), 367 (100), 351 (3), 349 (39), 295 (2) Pyran prenyl

isoflavonoid

9 18.56 C25H27O5 407.1851 407.1853 -0.180 / -0.443 12 .5 239, 271 351 (100), 295 (10) Diprenyl isoflavonoid

Results


The great majority of the detected secondary metabolites were isoflavonoids.

For instance compound 1 (Rt = 7.91 min) was identified as daidzein based on its

accurately measured pseudomolecular ion [M+H]+ at m/z 255.0663 with an RDBeq.

value of 10.5 (positive mode). HRMS/MS spectra verified its structure through the

characteristic [M+H-CO]+, [M+H-CO-CO]+ and 1,3A+ ions (Figure 29) (Lee et al.,

2005).

Figure 29: HRMS/MS spectrum of compound 1.

Coumestans were also detected. For example, the well-known phytoestrogen

coumestrol (compound 2, Rt = 9.23 min) was identified by its pseudomolecular ion at

m/z 269.0435 and its characteristic UV spectra as well as the RDBeq. value of 12.5

(positive mode) (Antignac et al., 2003).

Except isoflavones and coumestans, several mono- and di-pyran and prenyl

derivatives of isoflavonoids seem to dominate the extract and thus comprising its

most characteristic chemical group. Some representative prenylated and pyran

isoflavonoid derivatives are listed in Table 15. Similarly to the above mentioned

compounds, they were identified from their accurately measured spectrometric data

and additional spectrometric features while fragmentation patterns mostly related to

specific mass losses at their HRMS/MS spectra supported drastically their

Results


identification. In particular, the nominal mass losses of 56 Da (C4H8) characteristic of

prenyl group and 54 Da (C4H6) for pyran ring were widely observed at the HRMS/MS

spectra of compounds 3-9 (Simons et al., 2009). Specifically, at the HRMS/MS

spectra of compounds 3 (Figure 30) (Rt = 11.43 min), 5 (Figure 31) (Rt = 14.83 min)

and 9 (Figure 32) (Rt = 19.56 min), the typical loss of 56 Da (C4H8) is observed

indicating the occurrence of at least one prenyl side chain at the basic skeleton of

these isoflavonoids (Zhang et al., 2008; Simons et al., 2009). Particularly for

compound 9, two successive losses of 56 Da were observed from its

pseudomolecular ion. Based on this observation as well as the suggested molecular

formula and the RDBeq value, diprenylation could be proposed.


Results




In contrast, at the HRMS/MS spectra of compounds 4 (Figure 33) (Rt = 12.11

min), 6 (Figure 34) (Rt = 16.12 min) and 7 (Figure 35) (Rt = 16.69 min), the

characteristic loss of 54 Da is observed indicating the presence of a pyran ring

(Takayama and Nomura, 1995). Moreover, similarly to compound 9, a successive

Results


loss of 54 Da was observed at the HRMS/MS spectra of compound 4 indicating

likewise the presence of two pyran rings on the basic isoflavonoid skeleton.



Results



Finally, compound 8 (Figure 36) exhibited both type of mass losses indicating

probably the concurrent presence of prenyl substitution and pyran ring.


Results


4.2 Effects of estrogens and chemicals of plant origin on skeletal

muscle growth

4.2.1 E2, genistein, and Ecdysone induce hypertrophy of C2C12 murine skeletal

muscle cells

Differentiated C2C12 cells were used as a model to evaluate the effect of

estrogens, PEs and the phytoecdysteroid ecdysterone on skeletal muscle growth. As

shown in Figure 37 all the chemicals except the whole extract and fraction F4 were

able to significantly increase the diameter of C2C12 myotubes.

Figure 37: Effect of E2, PEs, and the phytoecdysteroid ecdysone on C2C12 myotubes


photographied by glutaraldehyde induced autofluorescence. Depicted are mean of n≥2

independent experiments. * p≤0.05 vs. Control by Kruskal Wallis H-test and Mann Withney

U-test.

4.2.2 Role of ER and AR on ecdysone induced myotube hypertrophy

To get more insights on the mode of action of ecdysterone, further

experiments were performed with both AR (Flutamide) and ER (ZK) antagonists. ZK

but not flutamide was able to block to hypertrophic response of C2C12 myotubes to

ecdysterone treatment (Figure 38).

Results


Figure 38: Role of AR (A) and ER (B) on ecdysterone induced C2C12 myotubes


photographied by glutaraldehyde induced autofluorescence. Represented are mean± SD of

n=2 independent experiments. * p≤0.05 vs. Control, + p≤0.05 vs. Single treated Kruskal

Wallis H-test and Mann Withney U-test.

4.2.3 Role of ERα and ERβ in skeletal muscle growth

ERs subtype selective agonists (ALPHA and BETA) were used to specify the

implication of each ER isoform on the hypertrophic response of C2C12 to estrogens

and estrogen-like chemicals. The dose-response effect of both agonists is

represented in Figure 39. The increase of mytobute diameter was positively

correlated with higher concentrations of ALPHA and lower concentrations of BETA.

Results





experiments.

At a concentration where both agonists selectively bind to their specific

receptors, BETA but not ALPHA was able to induce myotube hypertrophy (Figure

40).

M. Sc. Sad

rine T

cho

uk

ou

egno

Ngu

eu

Page 9

5

Resu

lts

Figure 40: Effect of ER subtype selective agonists on C2C12 myotubes hypertrophy. 4-6 days old myotubes incubated for 48 h with test

chemicals were fixed and photographied by glutaraldehyde induced autofluorescence. Depicted are mean of n=3 independent experiments. *

p≤0.05 vs. Control by Kruskal Wallis H- and Mann Withney U-tests.

Results


Moreover, in the presence of an ERβ selective antagonist the hypertrophic response

to E2 and Ecdy was reduced (Figure 41) confirming therefore an ERβ-mediated

effect.

Figure 41: Ecdysterone induced myotube hypertrophy is ERβ-mediated. 4-6 days old

myotubes incubated for 48 h with test chemicals were fixed and photographied by

glutaraldehyde induced autofluorescence. * p≤0.05 vs. Control, + p≤0.05 vs. Single treated

Kruskal Wallis H-test and Mann Withney U-test.

4.2.4 ERα and ERβ expression in C2C12 myotubes

Both ERs are expressed in differentiated C2C12 cells as shown below (Figure

42). Expression of ERα was shown at the mRNA level and ERβ at the protein level.

Results


Figure 42: ERα mRNA expression (A) and ERβ protein expression (B) in C2C12 myotubes.

Discussion


CHAPTER 5: DISCUSSION

Discussion


The aims of this thesis were to evaluate the biological activities that may

explain the use of the extract of E. excelsa to alleviate menopausal symptoms and to

treat female gynecological tumors and to characterize its main chemical constituents;

and to elucidate the mechanisms underlying the anabolic effect of ecdysterone on

mammalian skeletal muscle. The major findings that emerged are:

1. E. excelsa exhibits both estrogenic and antiestrogenic effects on several

estrogens responsive endpoints.

2. A phytoestrogenic fraction of E. excelsa at low and maybe

physiologically relevant concentrations stimulates the growth of MCF-7

breast cancer cell line in an E2-free environment but exerts antagonistic

effects in the presence of E2.

3. Prenyl- and pyran-substituted isoflavonoids are the main constituents

of E. excelsa extract.

4. ERβ is involved in Ecdysterone-mediated skeletal muscle growth.

5.1 Biological activities of Erythrina excelsa

5.1.1 Estrogenic/anti-estrogenic and cytotoxic properties of E. excelsa

Based on the ethnomedical use of E. excelsa to alleviate menopausal

complaints and to treat tumors in the female genital tract, we hypothetized that the

extract may possess estrogenic and cytotoxic properties. The yeast estrogen screen

(YES) and the uterotrophic assay were used as tests for estrogenicity and the MTT

assay as test for cytototoxic effects.

Yeast cells transfected with ERs function as steroid-dependent transcriptional

activators and are therefore a suitable tool used to measure the ability of a substance

to activate the transactivation of the receptor. To assess the functionality of our

assay, the EC50 of E2 was determined and was 86 pM, a value that is comparable to

the median EC50 value of 100 pM in mammalian cells based transcriptional

activation assays (The National Toxicology Program (NTP), 2002). Genistein was

Discussion


used as reference phytoestrogen and its calculated EC50, RP and RIE were in line

with published values (Dhooge et al., 2006). E. excelsa was able to induce a

concentration-dependent transactivation of ER with a RP of 1.3 x 10-3 which is in the

range of other RPs reported for estrogenic plants extracts in the YES (Lee et al.,

2005; Zhang et al., 2005). The dose-dependent transactivation of ER by E. excelsa

was antagonized by a pure anti-estrogen (Figure 14B) demonstrating an ER-

mediated effect. It is worth noting that the calculated potency of the extract was only

12.3 times lower than that of the pure phytoestrogen genistein suggesting the

presence of potent estrogenic secondary metabolites in the extract. This was later

confirmed by LC-HRMS and LC-HRMS/MS analysis which showed that E. excelsa

whole ethanol extract contains isoflavonoids (Figure 28) known to exhibit estrogenic

activity in several test systems.

Because in vitro test systems are usually specific for one mechanism of action

and cannot totally predict what may happen in an organism, we also used the 3-day

uterotrophic assay with adult OVX rats according to the OECD guidelines (Owens

and Ashby, 2002; OECD, 2007) to test the estrogenic activity of E. excelsa. This

assay is an established model for studying the effect of estrogen and estrogen-like

substances on estrogen-responsive tissues. Uterine weight is the major endpoint

measured in the uterotrophic assay as recommended by OECD. However, because

several PEs and endocrine disruptor substances have been shown to exhibit

estrogenic effects not visible on the uterine weight, other endpoints (uterine and

vaginal epithelial heights and uterine and liver gene expression analysis) were also

included in the investigation.

Treatment of OVX rats with E.excelsa led to mixed estrogenic and anti-

estrogenic effects on uterine morphometric parameters (Figure 15).The same profile

was observed at the molecular level on uterine (Figure 16) and liver (Figure 18) gene

expression. Up-regulation of C3 and down-regulation of clusterin are highly sensitive

molecular markers to detect estrogenicity in the uterus (Diel et al., 1995). Analysis of

the uterine expression of these genes in E. excelsa-treated animals indicates a

strong agonistic activity after treatment with the 50 mg/kg dose, whereas treatment

with the 100 mg/kg dose resulted in an expression pattern indicative of anti-

estrogenic activity. The liver that is the central organ in metabolic pathways is also a

non-classical target of estrogen and estrogen-like substances (Geis et al., 2005). The

Discussion


gene expression of IGFBP-1 and CaBP9k in the liver has been shown to be

upregulated following estradiol administration (Diel et al., 1995; Geis et al., 2005; Lee

et al., 2005). Here, like in the uterus, E. excelsa exhibited a pattern of activity

indicative of mixed estrogenic and anti-estrogenic effects. E. excelsa extract contains

ISO that are known to exhibit hormetic dose-responses on many physiological

endpoints. Hormesis is defined as the phenomenon by which chemicals are able to

induce biologically opposite effects at different doses (Siow and Mann, 2010; Vargas

and Burd, 2010). It is defined in toxicology as a dose-response phenomenon that is

characterized by low dose stimulation, high dose inhibition, resulting in either a J-

shaped or an inverted U-shaped dose-response. Both estrogenic and anti-estrogenic

effects of ISO depending on the dose have been reported (Patisaul and Jefferson,

2010; Pilsakova et al., 2010; Zhao and Mu, 2010). Moreover, according to the MS-

based investigation, pyrano as well as prenylated isoflavonoids comprise the main

chemical classes of secondary metabolites of the extract. There are several

published data investigating the role of prenyl chains and pyran rings in the

estrogenicity of isoflavonoids (Halabalaki et al., 2006; Okamoto, 2006; Djiogue et al.,

2010; Simons et al., 2012). Depending on their position on the isoflavonoids skeleton,

these substitutions have been shown to modify the biological activity of the parent

molecule. Djiogue et al (2010) showed that prenylation of genistein at various

positions was associated with either increase or decrease of its estrogenic

activity/potency, and with a modification of its ER selectivity. Okamoto et al (2006)

and Simons et al (2012) on the other hand showed that prenylation at certain

positions of the isoflavone skeleton was associated with anti-estrogenic activity.

Okamoto et al (2006) showed that four structural features among which the presence

of prenyl groups at the 6- and 8-positions of the A-ring of the isoflavone structure are

essential for the anti-estrogenicity of isoflavones. Tanee Fomum et al. (1986) isolated

a 5, 7, 4'-trihydroxy-6, 8-diprenylisoflavone from the stem bark of E. excelsagrown in

Cameroon. We therefore suggest that the diprenyl isoflavonoid identified in the

ethanol extract by LC-MS analysis may correspond to the same compound and may

also account for the anti-estrogenic effect observed.

Although the estrogenic response is predominantly mediated by the same ER

subtype in uterus and vagina, E. excelsa elicited significant estrogenic effects on the

uterus and not on the vagina. This selectivity of action may be explained by different

Discussion


ratio of coactivators to corepressors proteins or by the fact that the extract may

induce a different conformation of the ER in both organs. Some authors have

proposed that phytoestrogens mainly isoflavones due to their mixed agonist

/antagonistic effects on ER targets may be considered as natural selective estrogen

receptor modulators (SERMS). For instance, Mersereau et al (2008) showed that

liquiritigenin, a plant derived phytoestrogen exhibits similar binding affinities for ERα

and ERβ but induces selective transcriptional change of the ERβ only. To explain this

difference in transcriptional regulation, they demonstrated that liquiritigenin only

recruits coactivators to ERβ. Moreover, Shanle and Xu (2011) stated that given the

importance of coactivators in stimulating transcription and their potential role in

stabilizing ligand-bound ER in an active conformation, the estrogenic effects of

potential endocrine disruptors‟ compounds will be highly dependent on the availability

of coactivators which can vary among cell types, thereby contributing to tissue

specific effects.

The effect of E. excelsa on both estrogen-dependent and estrogen-

independent cancer cell lines was investigated using the MTT assay. E. excelsa

induced a slight increase of the viability of the ER positive MCF-7 cells. This effect

that may be correlated to an ERα- mediated cell proliferation since we showed in the

YES that the extract is able to induce the transactivation of ERα. At higher

concentrations, E. excelsa was cytotoxic on MCF-7 cells, a result that is in agreement

with the general knowledge on PEs action. It has been shown that this cytotoxic

effect may be ER-independent as demonstrated here when considering that the

extract was also cytotoxic on HT-29 cells which are ERα-negative (Hartman et al.,

2009; Edvardsson et al., 2011). There are some evidences suggesting that ERα-

negative cells may have different responses to phytoestrogen exposure. Van der

Woude et al (2005) demonstrated that the phytoestrogen quercetin at low

concentrations dose-dependently promoted the growth of the ER-positive MCF-7

cells and inhibited proliferation at high concentrations. They also showed that

quercetin in the same concentration range caused a significant inhibition of the

proliferation of MDA-MB-231 ERα-negative cells. Similarly, genistein was shown to

increase the growth of estrogen-sensitive cells at low concentrations but decreased

cell growth at high concentrations (Seo et al., 2006). On HT-29 cells, genistein has

Discussion


been shown to have no effect on the proliferation at low concentration and to inhibit

cell growth at high concentration (Arai et al., 2000).

In summary our data demonstrated that E. excelsa exhibits several biological

activities (estrogenic, antiestrogenic, and cytotoxic) that may explain its

aforementioned ethnomedical use for women‟s health problems. We also showed

that prenyl- and pyran-substituted isoflavonoids were the main constituents of the

extract and may explain the variety of biological activities observed since prenyl

substitution for example, has been shown to improve interaction with membranes and

proteins enlarging therefore the range of biological activities.

5.1.2 Effect of a phytoestrogenic faction of E. excelsa on the growth of the

human breast cancer line MCF-7.

Breast cancer is the most common cancer in women with about 60-70% of

cases classified as ER positive and dependent on estrogens for growth (Mohibi et al.,

2011). Initial results of this work showed that the whole extract of E. excelsa a part

from its estrogenic effect also inhibit the growth of MCF-7 cells, a wel established in

vitro model for ER (+) breast cancer. With this backgroung, we then aimed this step

of our study to get more insights into the “active principle” of the extract accounting

for these two biological activities. To do this, the ethanol crude extract was

fractionated over silica gel into five fractions that were further screened for biological

activity. We concentrated our field of investigations on fractions exhibiting both

estrogenic and cytotoxic activities. The YES was used as first step screen to select

estrogenic fractions and the XTT assay used to access their effect on the viability of

MCF-7 cells. F4 was almost as potent as the whole extract in respect to the

estrogenic effect but was less cytotoxic suggesting that other non-estrogenic

compounds of the whole extract may also account for its effects. The HPLC profiling

method showed that some major compounds present in the whole extract are either

absent or in low amount in F4 (Figure 22).

To gain more understanding of the mechanisms underlying F4-effect on the

growth of MCF-7 cells, cell cycle analysis was performed following 48h-treatment with

increasing concentrations (1-100 µg/ml). At Lower concentrations, F4 similar to E2

promoted cell cycle progression and inhibited cell death (Figure 23) and this effect

was ER-dependent (Figure 24). Gene expression analysis showed that F4 at low

Discussion


concentration like E2 increased CCND1 level and modulated the Bax/Bcl-2 ratio in

favor of cell survival (Figure 27). Cell cycle progression is a tightly controlled process

controlled by cyclins and cyclin-dependent kinases (CDKs) complexes and the

deregulation of their expression frequently impacts on breast cancer outcome

including response to therapy (Nigg, 1995; Caldon et al., 2006). CyclinD1 along with

its binding CDKs is an essential sensor and activator of cell cycle initiation and

progression (particularly the transition from G1 to S-phase) and is overexpressed in

up to 50% of human invasive breast cancers (Sun et al., 2012). Bcl-2 family members

play an important role in the mediation and regulation of apoptotic signaling pathways

acting to either inhibit (e.g. Bcl-2) or promote cell death (e.g. Bax). The Bax/Bcl-2

ratio has been recognized as a key factor and determines whether a cell will undergo

apoptosis (Leung and Wang, 1999; Gewies, 2003). As CCND1, Bcl-2 overexpression

is common in breast cancer (Oakes et al., 2011). It is well known that estrogens

through several mechanisms among which their stimulating effects on cell cycle

progression and pro-survival Bcl-2 are an important risk factor for breast cancer

development and progression (Sutherland et al., 1995). F4 at low and maybe

physiologically relevant concentrations behaved in the same way. However, the

relevance of this result for the in vivo situation where the mammary gland is

surrounded by other tissues and is under the influence of growth factors and other

hormones is still to be determined. In fact the local estrogen level in the tissue, the

expressed cofactors, and the expression level of ERα and ERβ are important factors

to take into consideration when considering the in vivo situation (Bondesson and

Gustafsson, 2010). For instance PEs have been shown to exhibit antagonistic

properties in the presence of E2 and this ability was also confirmed here as we

showed that F4 at the same concentration range where growth stimulation was

observed, acted as an antagonist in the presence of E2. This antagonistic ability may

be of interest because it is generally believed that treatments that trigger ER

antagonist effects are protective against breast cancer and favorably affect the

course of breast cancer once diagnosed (Bolca et al., 2010).

At higher concentrations, F4 modulated the G1/S transition as confirmed by

decreased CCND1 mRNA level and induced apoptosis sustained by M30 staining

results and increased Bax/ Bcl-2 ratio (Figures 23, 26, and 27). Impairment of

apoptosis is implicated in not only cancer development but also in the therapy

Discussion


(Adams and Cory, 2007). Cancer cells are resistant to apoptosis and it is proposed

that drugs or treatment strategies that can restore the apoptotic signaling pathways

towards normality have the potential to eliminate cancer cells (Wong, 2011). It is

however worth to note that this effect was achieved with relatively high and probably

supraphysiologic concentrations of the extract fraction.

Cotreatment with E2 and higher concentrations of F4 induced more cells to

transit from G1 to S as compared to single F4 treatment. But at the same time an

increase of the percentage of cells in SubG1 was observed. At high concentrations

F4 acted almost the same way as the pure antiestrogen ZK with the difference that

ZK caused cell cycle arrest whereas F4 blocked G1/S transition without preventing

the cells to transit from S to G2/M. (Dalvai and Bystricky, 2010) showed that cells in

the S-phase are more sensitive to antiestrogens-induced apoptosis. Therefore,

cotreatment with E2 by inducing more cells transit from G1 to S also increases their

susceptibility to undergo F4 induced cell death.

Overall these results show that F4 has a biphasic profile on the growth MCF-7

breast cancer cells: low dose stimulation and high dose inhibition through induction of

apoptosis. However, whether this is relevant for breast cancer outcomes is still to be

determined because a direct translation of in vitro results to the in vivo situation would

be oversimplifying and unrealistic. One interesting aspect is that the effects of low

and physiologically relevant concentrations of F4 depended on the presence or

absence of E2. In the presence of E2, F4 could counteract E2-induced stimulation of

cancer cells growth and may therefore be of significance and of interest for

premenopausal women.

5.2 Effect of estrogens and chemicals of plant origin on C2C12

murine skeletal muscle cells growth.

Increasing evidences have emerged over the past decades indicating that

estrogens can regulate skeletal muscle mass (established by a net difference

between muscle protein synthesis rate and muscle protein breakdown). Galluzzo et al

(2009) proposed that estrogens (E2) should be included in the list of skeletal muscle

trophic factors. Skeletal muscle hypertrophy is a dynamic process involving both an

increase in the number of nuclei (due to the stimulation of the proliferation,

Discussion


differentiation and fusion of quiescent satellite cells) as well as an increase in

cytoplasmic volume (due to an increase in protein synthesis or remodeling). Here, we

were interested in the effects of our test chemicals on the increase in cytoplamic

volume. Therefore, to differentiate between effects on myoblast differentiation and

those on the trophic state of existing myofibers, fusion of C2C12 myoblasts towards

myotubes was induced prior to the treatment. E2, genistein and Ecdy induced a

significant increase of myotube diameter compared to untreated myotubes probably

due to a shift of the balance in favor of protein synthesis. The Akt signaling pathway

plays an important role in skeletal muscle hypertrophy. E2 (Stefanetti et al, 2008),

and Ecdy (Gorelick-Feldman et al, 2010) have been shown to increase Akt activity

and its downstream anabolic signaling proteins. Conversely to Ecdy that increase the

protein synthesis in the muscle, E2 and genistein have been shown to rather

decrease protein breakdown in porcine skeletal muscle cells (Mau, 2007).

As previously shown by others (Kahlert et al., 1997; Galluzzo et al., 2009;

Milanesi et al., 2009), the presence of both ER isoforms in C2C12 cells was

confirmed in this study. We also showed for the first time that the Ecdy-induced

hypertrophic response is ER-mediated (Figure 38). ERα and ERβ selective agonists

were used to further elucidate the contribution of each ER subtype on E2 and Ecdy-

induced myotube hypertrophy. 16α-LE2 (ALPHA) and 8β-VE2 (BETA) are subtype-

selective steroidal ER agonists designed on the basis of the available protein

structure information (Hillisch et al., 2004). In a transactivation assay with APHA and

BETA, Hillisch et al (2004) showed that the selectivity of both agonists was lost when

used at higher concentrations (Figure 43). Based on this knowledge, dose-response

effects of each agonist were investigated and the results demonstrated that the

hypertrophic response was ERβ-mediated. Moreover, the use of an ERβ antagonist

allowed us to unequivocally show that E2 and Ecdy-induced hypertrophy is mediated

through ERβ (Figure 41). With respect to E2, these results are in line with previous

findings of our lab which indicate that the anabolic effect of E2 is primordially ERβ-

mediated (Velders et al., 2012; Weigt et al., 2012) but are in contradiction with the

findings of Galluzzo et al (2009) who found that ERα was the principal mediator of E2

effect in skeletal muscle. However, it is worth to note that their experiments were

performed on differentiating myotubes, while we used already differentiated

myotubes. With respect to Ecdy, published data on its ability to bind ERs are

Discussion


conflicting. Gao et al (2008) showed that Ecdy was able to transactivate ERβ in

embryonic kidney stem cells (293T) transfected with ERβ expression vector. Others

(Bathori et al., 2008; Seidlova-Wuttke et al., 2010) however demonstrated that Ecdy

was not able to bind ER.

Figure 43: Transactivation studies with ERα agonist (16α-LE2) and ERβ agonist (8β-VE2) in

comparison to E2 (Hillisch et al., 2004)

In summary, we successfully used a system with differentiated C2C12

myoblasts to demonstrate the skeletal muscle growth promoting effects of E2, the

phytoestrogen genistein, and the phytoecdysteroid ecdysterone. Moreover, we

confirmed the results of previous studies showing that ERβ was the ER isoform

mediating E2 anabolic effects, and showed for the first time that the anabolic effect of

Ecdy is ERβ-mediated.

Conclusion and perspectives


CHAPTER 6: CONCLUSION AND PERSPECTIVES



The aim of the present thesis was to investigate the biological activities and

mechanisms of action of two plant-related chemicals either as an extract or as a pure

compound. The results showed that an ethanol extract of Erythrina excelsa Baker

exhibits estrogenic and cytotoxic effects that are in close agreement with its

traditionally reported use to alleviate menopausal complaints and to treat female

gynaecological tumors. Chemical characterization revealed a rich metabolic content

of the extract and the isolation of the characterized compounds is ongoing with the

aim to investigate their biological activities as single compounds. We also confirmed

the anabolic efficiency of Ecdysterone and showed for the first time that it is ERβ-

mediated, a result that is of interest and may provide new insights not only for

strategies aiming to treat health conditions related to muscle atrophy (sarcopenia,

Duchenne myopathy), but also for doping. Overall, the findings of this thesis show

that although traditional medicine is often regarded with a lot of skepticism, it may

provide helpful basic knowledge for research orientation. In an era marked by

worldwide increase in life expectancy and its associated chronic diseases, the

maintenance of good health and quality of life is a challenging global issue involving

both developed and developing countries. The potential of traditional medicine is

increasingly recognized but a lot of effort is still needed in other to attain an evidence-

based utilization.

With respect to breast cancer risk, one interesting result that emerged from our

investigations confirming previous recommendations is that local estrogens levels is

an important factor to take into consideration when considering phytoestrogens

consumption and breast cancer outcomes. Intensive research has been made over

the last decade to clarify whether phytoestrogens could be an alternative to hormone

replacement therapy (HRT). Unfortunately most of the performed human clinical trials

failed to show clear evidences. To my opinion, strategies combining HRT and

phytoestrogens maybe of more interest in the future.

Limitations and recommendations for further research

The results of this thesis give an overview of the possible biological activity of

E.excelsa but do not provide sufficient understanding to enable specific

recommandations for use. With respect to Ecdysterone, although we clearly show



that its skeletal muscle growth promoting effects are ERβ- mediated, published data

regarding its ER binding ability are conflicting. Future investigations should clarify this

issue.

Bibliography


Bibliography

Adams JM, Cory S (1998). "The Bcl-2 protein family: arbiters of cell survival." Science

281(5381): 1322-6.

Adams JM, Cory S (2007). "The Bcl-2 apoptotic switch in cancer development and

therapy." Oncogene 26(9): 1324-37.

Adlercreutz H, Bannwart C, Wahala K, Makela T, Brunow G, Hase T, Arosemena PJ,

Kellis JT, Jr., Vickery LE (1993). "Inhibition of human aromatase by

mammalian lignans and isoflavonoid phytoestrogens." J Steroid Biochem Mol

Biol 44(2): 147-53.

Adlercreutz H, Hockerstedt K, Bannwart C, Bloigu S, Hamalainen E, Fotsis T, Ollus A

(1987). "Effect of dietary components, including lignans and phytoestrogens,

on enterohepatic circulation and liver metabolism of estrogens and on sex

hormone binding globulin (SHBG)." J Steroid Biochem 27(4-6): 1135-44.

Adlercreutz H, Martin F, Pulkkinen M, Dencker H, Rimer U, Sjoberg NO, Tikkanen MJ

(1976). "Intestinal metabolism of estrogens." J Clin Endocrinol Metab 43(3):

497-505.

Adlercreutz H, Mousavi Y, Hockerstedt K (1992). "Diet and breast cancer." Acta

Oncol 31(2): 175-81.

Akiyama T, Ishida J, Nakagawa S, Ogawara H, Watanabe S, Itoh N, Shibuya M,

Fukami Y (1987). "Genistein, a specific inhibitor of tyrosine-specific protein

kinases." J Biol Chem 262(12): 5592-5.

Antignac JP, Cariou R, Le Bizec B, Cravedi JP, Andre F (2003). "Identification of

phytoestrogens in bovine milk using liquid chromatography/electrospray

tandem mass spectrometry." Rapid Commun Mass Spectrom 17(12): 1256-64.

Bibliography


Arai N, Strom A, Rafter JJ, Gustafsson JA (2000). "Estrogen receptor beta mRNA in

colon cancer cells: growth effects of estrogen and genistein." Biochem

Biophys Res Commun 270(2): 425-31.

Aronica SM, Katzenellenbogen BS (1993). "Stimulation of estrogen receptor-

mediated transcription and alteration in the phosphorylation state of the rat

uterine estrogen receptor by estrogen, cyclic adenosine monophosphate, and

insulin-like growth factor-I." Mol Endocrinol 7(6): 743-52.

Aronica SM, Kraus WL, Katzenellenbogen BS (1994). "Estrogen action via the cAMP

signaling pathway: stimulation of adenylate cyclase and cAMP-regulated gene

transcription." Proc Natl Acad Sci U S A 91(18): 8517-21.

Ascenzi P, Bocedi A, Marino M (2006). "Structure-function relationship of estrogen

receptor alpha and beta: impact on human health." Mol Aspects Med 27(4):

299-402.

Axelson M, Sjovall J, Gustafsson BE, Setchell KD (1984). "Soya--a dietary source of

the non-steroidal oestrogen equol in man and animals." J Endocrinol 102(1):

49-56.

Balmain N (1991). "Calbindin-D9k. A vitamin-D-dependent, calcium-binding protein in

mineralized tissues." Clin Orthop Relat Res(265): 265-76.

Bannwart C, Adlercreutz H, Fotsis T, Wähälä K, Hase T, Brunow G (1984).

"Identification of O-desmethylangolensin, a metabolite of daidzein, and of

matairesinol, one likely plant precursor of the animal lignan enterolactone, in

human urine. ." Finn Chem Lett 4-5: 120–125.

Barrington R, Zhang M, Fischer M, Carroll MC (2001). "The role of complement in

inflammation and adaptive immunity." Immunol Rev 180: 5-15.

Bateman HL, Patisaul HB (2008). "Disrupted female reproductive physiology

following neonatal exposure to phytoestrogens or estrogen specific ligands is

Bibliography


associated with decreased GnRH activation and kisspeptin fiber density in the

hypothalamus." Neurotoxicology 29(6): 988-97.

Bathori M, Toth N, Hunyadi A, Marki A, Zador E (2008). "Phytoecdysteroids and

anabolic-androgenic steroids--structure and effects on humans." Curr Med

Chem 15(1): 75-91.

Beato M (1989). "Gene regulation by steroid hormones." Cell 56(3): 335-44.

Bennetts HW, Underwood EJ, Shier FL (1946). "A specific breeding problem of

sheep on subterranean clover pastures in Western Australia." Br Vet J

102(11): 348-52.

Berrino F, Bellati C, Secreto G, Camerini E, Pala V, Panico S, Allegro G, Kaaks R

(2001). "Reducing bioavailable sex hormones through a comprehensive

change in diet: the diet and androgens (DIANA) randomized trial." Cancer

Epidemiol Biomarkers Prev 10(1): 25-33.

Bhat HK, Hacker HJ, Bannasch P, Thompson EA, Liehr JG (1993). "Localization of

estrogen receptors in interstitial cells of hamster kidney and in estradiol-

induced renal tumors as evidence of the mesenchymal origin of this

neoplasm." Cancer Res 53(22): 5447-51.

Bolanos R, Del Castillo A, Francia J (2010). "Soy isoflavones versus placebo in the

treatment of climacteric vasomotor symptoms: systematic review and meta-

analysis." Menopause 17(3): 660-6.

Bolca S, Urpi-Sarda M, Blondeel P, Roche N, Vanhaecke L, Possemiers S, Al-

Maharik N, Botting N, De Keukeleire D, Bracke M, Heyerick A, Manach C,

Depypere H (2010). "Disposition of soy isoflavones in normal human breast

tissue." Am J Clin Nutr 91(4): 976-84.

Bondesson M, Gustafsson JA (2010). "Does consuming isoflavones reduce or

increase breast cancer risk?" Genome Med 2(12): 90.

Bibliography


Bowe J, Li XF, Sugden D, Katzenellenbogen JA, Katzenellenbogen BS, O'Byrne KT

(2003). "The effects of the phytoestrogen, coumestrol, on gonadotropin-

releasing hormone (GnRH) mRNA expression in GT1-7 GnRH neurones." J

Neuroendocrinol 15(2): 105-8.

Brisken C, Rajaram RD (2006). "Alveolar and lactogenic differentiation." J Mammary

Gland Biol Neoplasia 11(3-4): 239-48.

Brooks JD, Thompson LU (2005). "Mammalian lignans and genistein decrease the

activities of aromatase and 17beta-hydroxysteroid dehydrogenase in MCF-7

cells." J Steroid Biochem Mol Biol 94(5): 461-7.

Bruns ME, Overpeck JG, Smith GC, Hirsch GN, Mills SE, Bruns DE (1988). "Vitamin

D-dependent calcium binding protein in rat uterus: differential effects of

estrogen, tamoxifen, progesterone, and pregnancy on accumulation and

cellular localization." Endocrinology 122(6): 2371-8.

Bunone G, Briand PA, Miksicek RJ, Picard D (1996). "Activation of the unliganded

estrogen receptor by EGF involves the MAP kinase pathway and direct

phosphorylation." Embo J 15(9): 2174-83.

Caldon CE, Daly RJ, Sutherland RL, Musgrove EA (2006). "Cell cycle control in

breast cancer cells." J Cell Biochem 97(2): 261-74.

Calmels P, Vico L, Alexandre C, Minaire P (1995). "Cross-sectional study of muscle

strength and bone mineral density in a population of 106 women between the

ages of 44 and 87 years: relationship with age and menopause." Eur J Appl

Physiol Occup Physiol 70(2): 180-6.

Carpinelli MR, Wise AK, Arhatari BD, Bouillet P, Manji SS, Manning MG, Cooray AA,

Burt RA (2012). "Anti-apoptotic gene Bcl2 is required for stapes development

and hearing." Cell Death Dis 3: e362.

Bibliography


Carroll MC, Prodeus AP (1998). "Linkages of innate and adaptive immunity." Curr

Opin Immunol 10(1): 36-40.

Castoria G, Migliaccio A, Bilancio A, Di Domenico M, de Falco A, Lombardi M,

Fiorentino R, Varricchio L, Barone MV, Auricchio F (2001). "PI3-kinase in

concert with Src promotes the S-phase entry of oestradiol-stimulated MCF-7

cells." Embo J 20(21): 6050-9.

Cavalieri E, Chakravarti D, Guttenplan J, Hart E, Ingle J, Jankowiak R, Muti P, Rogan

E, Russo J, Santen R, Sutter T (2006). "Catechol estrogen quinones as

initiators of breast and other human cancers: implications for biomarkers of

susceptibility and cancer prevention." Biochim Biophys Acta 1766(1): 63-78.

Cavalieri E, Frenkel K, Liehr JG, Rogan E, Roy D (2000). "Estrogens as endogenous

genotoxic agents--DNA adducts and mutations." J Natl Cancer Inst

Monogr(27): 75-93.

Cavalieri E, Rogan E, Chakravarti D (2004). "The role of endogenous catechol

quinones in the initiation of cancer and neurodegenerative diseases." Methods

Enzymol 382: 293-319.

Cavalieri EL, Stack DE, Devanesan PD, Todorovic R, Dwivedy I, Higginbotham S,

Johansson SL, Patil KD, Gross ML, Gooden JK, Ramanathan R, Cerny RL,

Rogan EG (1997). "Molecular origin of cancer: catechol estrogen-3,4-quinones

as endogenous tumor initiators." Proc Natl Acad Sci U S A 94(20): 10937-42.

Chakravarti D, Mailander PC, Li KM, Higginbotham S, Zhang HL, Gross ML, Meza

JL, Cavalieri EL, Rogan EG (2001). "Evidence that a burst of DNA

depurination in SENCAR mouse skin induces error-prone repair and forms

mutations in the H-ras gene." Oncogene 20(55): 7945-53.

Chaudhary KD, Lupien PJ, Hinse C (1969). "Effect of ecdysone on glutamic

decarboxylase in rat brain." Experientia 25(3): 250-1.

Bibliography


Chen Z, Yuhanna IS, Galcheva-Gargova Z, Karas RH, Mendelsohn ME, Shaul PW

(1999). "Estrogen receptor alpha mediates the nongenomic activation of

endothelial nitric oxide synthase by estrogen." J Clin Invest 103(3): 401-6.

Chermnykh NS, Shimanovskii NL, Shutko GV, Syrov VN (1988). "[The action of

methandrostenolone and ecdysterone on the physical endurance of animals

and on protein metabolism in the skeletal muscles]." Farmakol Toksikol 51(6):

57-60.

Christoffel J, Rimoldi G, Wuttke W (2006). "Effects of 8-prenylnaringenin on the

hypothalamo-pituitary-uterine axis in rats after 3-month treatment." J

Endocrinol 188(3): 397-405.

Chu S, Nishi Y, Yanase T, Nawata H, Fuller PJ (2004). "Transrepression of estrogen

receptor beta signaling by nuclear factor-kappab in ovarian granulosa cells."

Mol Endocrinol 18(8): 1919-28.

Cowley SM, Parker MG (1999). "A comparison of transcriptional activation by ER

alpha and ER beta." J Steroid Biochem Mol Biol 69(1-6): 165-75.

Cragg GM, Newman DJ (2013). "Natural products: A continuing source of novel drug

leads." Biochim Biophys Acta.

D'Alessandro TL, Boersma-Maland BJ, Peterson TG, Sfakianos J, Prasain JK, Patel

RP, Darley-Usmar VM, Botting NP, Barnes S (2005). "Metabolism of

phytoestrogen conjugates." Methods Enzymol 400: 316-42.

Dalu A, Haskell JF, Coward L, Lamartiniere CA (1998). "Genistein, a component of

soy, inhibits the expression of the EGF and ErbB2/Neu receptors in the rat

dorsolateral prostate." Prostate 37(1): 36-43.

Dalvai M, Bystricky K (2010). "Cell cycle and anti-estrogen effects synergize to

regulate cell proliferation and ER target gene expression." PLoS One 5(6):

e11011.

Bibliography


Danial NN (2007). "BCL-2 family proteins: critical checkpoints of apoptotic cell death."

Clin Cancer Res 13(24): 7254-63.

Danielian PS, White R, Lees JA, Parker MG (1992). "Identification of a conserved

region required for hormone dependent transcriptional activation by steroid

hormone receptors." Embo J 11(3): 1025-33.

Darimont BD, Wagner RL, Apriletti JW, Stallcup MR, Kushner PJ, Baxter JD,

Fletterick RJ, Yamamoto KR (1998). "Structure and specificity of nuclear

receptor-coactivator interactions." Genes Dev 12(21): 3343-56.

Dawson SJ, Makretsov N, Blows FM, Driver KE, Provenzano E, Le Quesne J,

Baglietto L, Severi G, Giles GG, McLean CA, Callagy G, Green AR, Ellis I,

Gelmon K, Turashvili G, Leung S, Aparicio S, Huntsman D, Caldas C, Pharoah

P (2010). "BCL2 in breast cancer: a favourable prognostic marker across

molecular subtypes and independent of adjuvant therapy received." Br J

Cancer 103(5): 668-75.

Dewell A, Hollenbeck PL, Hollenbeck CB (2006). "Clinical review: a critical evaluation

of the role of soy protein and isoflavone supplementation in the control of

plasma cholesterol concentrations." J Clin Endocrinol Metab 91(3): 772-80.

Dhooge W, Arijs K, D'Haese I, Stuyvaert S, Versonnen B, Janssen C, Verstraete W,

Comhaire F (2006). "Experimental parameters affecting sensitivity and

specificity of a yeast assay for estrogenic compounds: results of an

interlaboratory validation exercise." Anal Bioanal Chem 386(5): 1419-28.

Dickson RB, Stancel GM (2000). "Estrogen receptor-mediated processes in normal

and cancer cells." J Natl Cancer Inst Monogr(27): 135-45.

Diel P, Geis RB, Caldarelli A, Schmidt S, Leschowsky UL, Voss A, Vollmer G (2004).

"The differential ability of the phytoestrogen genistein and of estradiol to

induce uterine weight and proliferation in the rat is associated with a substance

Bibliography


specific modulation of uterine gene expression." Mol Cell Endocrinol 221(1-2):

21-32.

Diel P, Schulz T, Smolnikar K, Strunck E, Vollmer G, Michna H (2000). "Ability of

xeno- and phytoestrogens to modulate expression of estrogen-sensitive genes

in rat uterus: estrogenicity profiles and uterotropic activity." J Steroid Biochem

Mol Biol 73(1-2): 1-10.

Diel P, Walter A, Fritzemeier KH, Hegele-Hartung C, Knauthe R (1995).

"Identification of estrogen regulated genes in Fe33 rat hepatoma cells by

differential display polymerase chain reaction and their hormonal regulation in

rat liver and uterus." J Steroid Biochem Mol Biol 55(3-4): 363-73.

Dionne IJ, Kinaman KA, Poehlman ET (2000). "Sarcopenia and muscle function

during menopause and hormone-replacement therapy." J Nutr Health Aging

4(3): 156-61.

Djiogue S, Njamen D, Halabalaki M, Kretzschmar G, Beyer A, Mbanya JC,

Skaltsounis AL, Vollmer G (2010). "Estrogenic properties of naturally occurring

prenylated isoflavones in U2OS human osteosarcoma cells: Structure-activity

relationships." J Steroid Biochem Mol Biol 120(4-5): 184-91.

Edvardsson K, Strom A, Jonsson P, Gustafsson JA, Williams C (2011). "Estrogen

receptor beta induces antiinflammatory and antitumorigenic networks in colon

cancer cells." Mol Endocrinol 25(6): 969-79.

EICCAM (European Information Center for Complementary and Alternative Medicine)

(2009). http://www.eiccam.eu/portal.html. Accessed April 2013.

Enns DL, Tiidus PM (2010). "The influence of estrogen on skeletal muscle: sex

matters." Sports Med 40(1): 41-58.

Eriksson H, Gustafsson JA (1971). "Excretion of steroid hormones in adults. Steroids

in faeces from adults." Eur J Biochem 18(1): 146-50.

Bibliography


Evans BA, Griffiths K, Morton MS (1995). "Inhibition of 5 alpha-reductase in genital

skin fibroblasts and prostate tissue by dietary lignans and isoflavonoids." J

Endocrinol 147(2): 295-302.

Faulds MH, Zhao C, Dahlman-Wright K, Gustafsson JA (2012). "The diversity of sex

steroid action: regulation of metabolism by estrogen signaling." J Endocrinol

212(1): 3-12.

Feigelson HS, Henderson BE (1996). "Estrogens and breast cancer." Carcinogenesis

17(11): 2279-84.

Feng W, Ribeiro RC, Wagner RL, Nguyen H, Apriletti JW, Fletterick RJ, Baxter JD,

Kushner PJ, West BL (1998). "Hormone-dependent coactivator binding to a

hydrophobic cleft on nuclear receptors." Science 280(5370): 1747-9.

Fishman J, Bradlow HL, Gallagher TF (1960). "Oxidative metabolism of estradiol." J

Biol Chem 235: 3104-7.

Galluzzo P, Rastelli C, Bulzomi P, Acconcia F, Pallottini V, Marino M (2009). "17beta-

Estradiol regulates the first steps of skeletal muscle cell differentiation via ER-

alpha-mediated signals." Am J Physiol Cell Physiol 297(5): C1249-62.

Gao L, Cai G, Shi X (2008). "Beta-ecdysterone induces osteogenic differentiation in

mouse mesenchymal stem cells and relieves osteoporosis." Biol Pharm Bull

31(12): 2245-9.

Geis RB, Diel P, Degen GH, Vollmer G (2005). "Effects of genistein on the

expression of hepatic genes in two rat strains (Sprague-Dawley and Wistar)."

Toxicol Lett 157(1): 21-9.

Gewies M. (2003). "Introduction to Apoptosis." Accessed April 2013 from

http://www.celldeath.de/encyclo/aporev/aporev.htm.

http://www.celldeath.de/encyclo/aporev/aporev.htm

Bibliography


Giguere V, Yang N, Segui P, Evans RM (1988). "Identification of a new class of

steroid hormone receptors." Nature 331(6151): 91-4.

Goping IS, Gross A, Lavoie JN, Nguyen M, Jemmerson R, Roth K, Korsmeyer SJ,

Shore GC (1998). "Regulated targeting of BAX to mitochondria." J Cell Biol

143(1): 207-15.

Gorelick-Feldman J, Cohick W, Raskin I (2010). "Ecdysteroids elicit a rapid Ca2+ flux

leading to Akt activation and increased protein synthesis in skeletal muscle

cells." Steroids 75(10): 632-7.

Gorelick-Feldman J, Maclean D, Ilic N, Poulev A, Lila MA, Cheng D, Raskin I (2008).

"Phytoecdysteroids increase protein synthesis in skeletal muscle cells." J Agric

Food Chem 56(10): 3532-7.

Hahn WC, Weinberg RA (2002). "Rules for making human tumor cells." N Engl J Med

347(20): 1593-603.

Halabalaki M, Alexi X, Aligiannis N, Lambrinidis G, Pratsinis H, Florentin I, Mitakou S,

Mikros E, Skaltsounis AL, Alexis MN (2006). "Estrogenic activity of

isoflavonoids from Onobrychis ebenoides." Planta Med 72(6): 488-93.

Hartman J, Edvardsson K, Lindberg K, Zhao C, Williams C, Strom A, Gustafsson JA

(2009). "Tumor repressive functions of estrogen receptor beta in SW480 colon

cancer cells." Cancer Res 69(15): 6100-6.

Havelock JC, Rainey WE, Carr BR (2004). "Ovarian granulosa cell lines." Mol Cell

Endocrinol 228(1-2): 67-78.

Heldring N, Pike A, Andersson S, Matthews J, Cheng G, Hartman J, Tujague M,

Strom A, Treuter E, Warner M, Gustafsson JA (2007). "Estrogen receptors:

how do they signal and what are their targets." Physiol Rev 87(3): 905-31.

Bibliography


Henttu PM, Kalkhoven E, Parker MG (1997). "AF-2 activity and recruitment of steroid

receptor coactivator 1 to the estrogen receptor depend on a lysine residue

conserved in nuclear receptors." Mol Cell Biol 17(4): 1832-9.

Hertrampf T, Gruca MJ, Seibel J, Laudenbach U, Fritzemeier KH, Diel P (2007). "The

bone-protective effect of the phytoestrogen genistein is mediated via ER

alpha-dependent mechanisms and strongly enhanced by physical activity."

Bone 40(6): 1529-35.

Hikino H, Takemoto T (1972). "Arthropod moulting hormones from Plants,

Achyranthes and Cyathula." Naturwissenschaften 59(3): 91-8.

Hillisch A, Peters O, Kosemund D, Muller G, Walter A, Schneider B, Reddersen G,

Elger W, Fritzemeier KH (2004). "Dissecting physiological roles of estrogen

receptor alpha and beta with potent selective ligands from structure-based

design." Mol Endocrinol 18(7): 1599-609.

Hofer N, Diel P, Wittsiepe J, Wilhelm M, Degen GH (2009). "Dose- and route-

dependent hormonal activity of the metalloestrogen cadmium in the rat

uterus." Toxicol Lett 191(2-3): 123-31.

Howes LG, Howes JB, Knight DC (2006). "Isoflavone therapy for menopausal

flushes: a systematic review and meta-analysis." Maturitas 55(3): 203-11.

Ignar-Trowbridge DM, Nelson KG, Bidwell MC, Curtis SW, Washburn TF, McLachlan

JA, Korach KS (1992). "Coupling of dual signaling pathways: epidermal growth

factor action involves the estrogen receptor." Proc Natl Acad Sci U S A 89(10):

4658-62.

Ignar-Trowbridge DM, Pimentel M, Parker MG, McLachlan JA, Korach KS (1996).

"Peptide growth factor cross-talk with the estrogen receptor requires the A/B

domain and occurs independently of protein kinase C or estradiol."

Endocrinology 137(5): 1735-44.

Bibliography


Improta-Brears T, Whorton AR, Codazzi F, York JD, Meyer T, McDonnell DP (1999).

"Estrogen-induced activation of mitogen-activated protein kinase requires

mobilization of intracellular calcium." Proc Natl Acad Sci U S A 96(8): 4686-91.

Ince BA, Montano MM, Katzenellenbogen BS (1994). "Activation of transcriptionally

inactive human estrogen receptors by cyclic adenosine 3',5'-monophosphate

and ligands including antiestrogens." Mol Endocrinol 8(10): 1397-406.

Isotton AL, Wender MC, Casagrande A, Rollin G, Czepielewski MA (2012). "Effects

of oral and transdermal estrogen on IGF1, IGFBP3, IGFBP1, serum lipids, and

glucose in patients with hypopituitarism during GH treatment: a randomized

study." Eur J Endocrinol 166(2): 207-13.

Jefferson WN, Padilla-Banks E, Newbold RR (2005). "Adverse effects on female

development and reproduction in CD-1 mice following neonatal exposure to

the phytoestrogen genistein at environmentally relevant doses." Biol Reprod

73(4): 798-806.

Jefferson WN, Patisaul HB, Williams CJ (2012). "Reproductive consequences of

developmental phytoestrogen exposure." Reproduction 143(3): 247-60.

Jiofack T, Fokunang C, Guedje N, Kemeuze V, Fongnzossie E, Nkongmeneck BA,

Mapongmetsem PM, Tsabang N (2010). "Ethnobotanical uses of medicinal

plants of two ethnoecological regions of Cameroon " International Journal of

Medicine and Medical Sciences 2(3): 60-79.

Joannou GE, Kelly GE, Reeder AY, Waring M, Nelson C (1995). "A urinary profile

study of dietary phytoestrogens. The identification and mode of metabolism of

new isoflavonoids." J Steroid Biochem Mol Biol 54(3-4): 167-84.

Kadi F, Karlsson C, Larsson B, Eriksson J, Larval M, Billig H, Jonsdottir IH (2002).

"The effects of physical activity and estrogen treatment on rat fast and slow

skeletal muscles following ovariectomy." J Muscle Res Cell Motil 23(4): 335-9.

Bibliography


Kahlert S, Grohe C, Karas RH, Lobbert K, Neyses L, Vetter H (1997). "Effects of

estrogen on skeletal myoblast growth." Biochem Biophys Res Commun

232(2): 373-8.

Kao YC, Zhou C, Sherman M, Laughton CA, Chen S (1998). "Molecular basis of the

inhibition of human aromatase (estrogen synthetase) by flavone and

isoflavone phytoestrogens: A site-directed mutagenesis study." Environ Health

Perspect 106(2): 85-92.

Kelly GE, Nelson C, Waring MA, Joannou GE, Reeder AY (1993). "Metabolites of

dietary (soya) isoflavones in human urine." Clin Chim Acta 223(1-2): 9-22.

Kim SM, Jung EM, An BS, Hwang I, Vo TT, Kim SR, Lee SM, Choi KC, Jeung EB

(2012). "Additional effects of bisphenol A and paraben on the induction of

calbindin-D(9K) and progesterone receptor via an estrogen receptor pathway

in rat pituitary GH3 cells." J Physiol Pharmacol 63(5): 445-55.

Kirkman H (1959). "Estrogen-induced tumors of the kidney. III. Growth characteristics

in the Syrian hamster." Natl Cancer Inst Monogr 1: 1-57.

Kluxen FM, Hofer N, Kretzschmar G, Degen GH, Diel P (2012). "Cadmium modulates

expression of aryl hydrocarbon receptor-associated genes in rat uterus by

interaction with the estrogen receptor." Arch Toxicol 86(4): 591-601.

Knight DC, Eden JA (1996). "A review of the clinical effects of phytoestrogens."

Obstet Gynecol 87(5 Pt 2): 897-904.

Kouki T, Kishitake M, Okamoto M, Oosuka I, Takebe M, Yamanouchi K (2003).

"Effects of neonatal treatment with phytoestrogens, genistein and daidzein, on

sex difference in female rat brain function: estrous cycle and lordosis." Horm

Behav 44(2): 140-5.

Kraus WL, McInerney EM, Katzenellenbogen BS (1995). "Ligand-dependent,

transcriptionally productive association of the amino- and carboxyl-terminal

Bibliography


regions of a steroid hormone nuclear receptor." Proc Natl Acad Sci U S A

92(26): 12314-8.

Krisinger J, Setoyama T, Leung PC (1994). "Expression of calbindin-D9k in the early

pregnant rat uterus: effects of RU 486 and correlation to estrogen receptor

mRNA." Mol Cell Endocrinol 102(1-2): 15-22.

Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, Gustafsson

JA (1997). "Comparison of the ligand binding specificity and transcript tissue

distribution of estrogen receptors alpha and beta." Endocrinology 138(3): 863-

70.

Kulling SE, Metzler M (1997). "Induction of micronuclei, DNA strand breaks and

HPRT mutations in cultured Chinese hamster V79 cells by the phytoestrogen

coumoestrol." Food Chem Toxicol 35(6): 605-13.

Kumar R, Zakharov MN, Khan SH, Miki R, Jang H, Toraldo G, Singh R, Bhasin S,

Jasuja R (2011). "The dynamic structure of the estrogen receptor." J Amino

Acids: 812540.

Kurzer MS, Xu X (1997). "Dietary phytoestrogens." Annu Rev Nutr 17: 353-81.

Kushner PJ, Agard DA, Greene GL, Scanlan TS, Shiau AK, Uht RM, Webb P (2000).

"Estrogen receptor pathways to AP-1." J Steroid Biochem Mol Biol 74(5): 311-

7.

Lahooti H, Thorsen T, Aakvaag A (1998). "Modulation of mouse estrogen receptor

transcription activity by protein kinase C delta." J Mol Endocrinol 20(2): 245-

59.

Le Bizec B, Antignac J, Monteau F, Andre F (2002). "Ecdysteroids: one potential new

anabolic family in breeding animals." Analytica Chimica Acta 473: 89-97.

Bibliography


Lee JS, Kim DH, Liu KH, Oh TK, Lee CH (2005). "Identification of flavonoids using

liquid chromatography with electrospray ionization and ion trap tandem mass

spectrometry with an MS/MS library." Rapid Commun Mass Spectrom 19(23):

3539-48.

Lee KY, Oh GT, Kang JH, Shin SM, Heo BE, Yun YW, Paik SG, Krisinger J, Leung

PC, Jeung EB (2003). "Transcriptional regulation of the mouse calbindin-D9k

gene by the ovarian sex hormone." Mol Cells 16(1): 48-53.

Lee PD, Conover CA, Powell DR (1993). "Regulation and function of insulin-like

growth factor-binding protein-1." Proc Soc Exp Biol Med 204(1): 4-29.

Lee SA, Shu XO, Li H, Yang G, Cai H, Wen W, Ji BT, Gao J, Gao YT, Zheng W

(2009). "Adolescent and adult soy food intake and breast cancer risk: results

from the Shanghai Women's Health Study." Am J Clin Nutr 89(6): 1920-6.

Lee SY, Oh SM, Lee SK, Chung KH (2005). "Antiestrogenic effects of marijuana

smoke condensate and cannabinoid compounds." Arch Pharm Res 28(12):

1365-75.

Lee YB, Lee HJ, Kim KS, Lee JY, Nam SY, Cheon SH, Sohn HS (2004). "Evaluation

of the preventive effect of isoflavone extract on bone loss in ovariectomized

rats." Biosci Biotechnol Biochem 68(5): 1040-5.

Lefebvre Y (1993). Fibromyomes utérins. Encyclopédie médicale chirurgicale. Paris,

France. Editions Techniques.

Lemmens R. (2008). "Erythrina excelsa Baker." Accessed August 2012 from

http://database.prota.org/search.htm.

Lemoine S, Granier P, Tiffoche C, Rannou-Bekono F, Thieulant ML, Delamarche P

(2003). "Estrogen receptor alpha mRNA in human skeletal muscles." Med Sci

Sports Exerc 35(3): 439-43.

http://database.prota.org/search.htm

Bibliography


Leung LK, Wang TT (1999). "Differential effects of chemotherapeutic agents on the

Bcl-2/Bax apoptosis pathway in human breast cancer cell line MCF-7." Breast

Cancer Res Treat 55(1): 73-83.

Li KM, Todorovic R, Devanesan P, Higginbotham S, Kofeler H, Ramanathan R,

Gross ML, Rogan EG, Cavalieri EL (2004). "Metabolism and DNA binding

studies of 4-hydroxyestradiol and estradiol-3,4-quinone in vitro and in female

ACI rat mammary gland in vivo." Carcinogenesis 25(2): 289-97.

Li SH, Liu XX, Bai YY, Wang XJ, Sun K, Chen JZ, Hui RT (2010). "Effect of oral

isoflavone supplementation on vascular endothelial function in

postmenopausal women: a meta-analysis of randomized placebo-controlled

trials." Am J Clin Nutr 91(2): 480-6.

Liu MM, Albanese C, Anderson CM, Hilty K, Webb P, Uht RM, Price RH, Jr., Pestell

RG, Kushner PJ (2002). "Opposing action of estrogen receptors alpha and

beta on cyclin D1 gene expression." J Biol Chem 277(27): 24353-60.

Losa SM, Todd KL, Sullivan AW, Cao J, Mickens JA, Patisaul HB (2011). "Neonatal

exposure to genistein adversely impacts the ontogeny of hypothalamic

kisspeptin signaling pathways and ovarian development in the peripubertal

female rat." Reprod Toxicol 31(3): 280-9.

Lowe DA, Baltgalvis KA, Greising SM (2010). "Mechanisms behind estrogen's

beneficial effect on muscle strength in females." Exerc Sport Sci Rev 38(2):

61-7.

Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951). "Protein measurement with

the Folin phenol reagent." J Biol Chem 193(1): 265-75.

Mahmoodzadeh S, Fritschka S, Dworatzek E, Pham TH, Becher E, Kuehne A,

Davidson MM, Regitz-Zagrosek V (2009). "Nuclear factor-kappaB regulates

estrogen receptor-alpha transcription in the human heart." J Biol Chem

284(37): 24705-14.

Bibliography


Majinda RRT, Wanjala C, Juma BF (2005). "Boiactive non-alkaloidal constituents

from the genus Erythrina." Studies in natural Products Chemistry 32 (Part 12):

821-853.

Maltais ML, Desroches J, Dionne IJ (2009). "Changes in muscle mass and strength

after menopause." J Musculoskelet Neuronal Interact 9(4): 186-97.

Marino M, Acconcia F, Bresciani F, Weisz A, Trentalance A (2002). "Distinct

nongenomic signal transduction pathways controlled by 17beta-estradiol

regulate DNA synthesis and cyclin D(1) gene transcription in HepG2 cells."

Mol Biol Cell 13(10): 3720-9.

Martin-Millan M, Almeida M, Ambrogini E, Han L, Zhao H, Weinstein RS, Jilka RL,

O'Brien CA, Manolagas SC (2010). "The estrogen receptor-alpha in

osteoclasts mediates the protective effects of estrogens on cancellous but not

cortical bone." Mol Endocrinol 24(2): 323-34.

Mau M, (2007). "In vitro-Wachstum und -Differenzierung prciner Skelettmuskelzellen

unter den Einfluss der Isoflavone Genistein und Daidzein". PhD thesis Faculty

of Mathematics and Natural Sciences, Ernst-Moritz-Arndt University,

Greifswald-Germany.

ub-ed.ub.unigreifswald.de/opus/volltexte/2008/466/pdf/Dissertation_Mau_Marcus.pdf

McInerney EM, Katzenellenbogen BS (1996). "Different regions in activation function-

1 of the human estrogen receptor required for antiestrogen- and estradiol-

dependent transcription activation." J Biol Chem 271(39): 24172-8.

Mense SM, Hei TK, Ganju RK, Bhat HK (2008). "Phytoestrogens and breast cancer

prevention: possible mechanisms of action." Environ Health Perspect 116(4):

426-33.

Mersereau JE, Levy N, Staub RE, Baggett S, Zogovic T, Chow S, Ricke WA,

Tagliaferri M, Cohen I, Bjeldanes LF, Leitman DC (2008). "Liquiritigenin is a

Bibliography


plant-derived highly selective estrogen receptor beta agonist." Mol Cell

Endocrinol 283(1-2): 49-57.

Messina M, McCaskill-Stevens W, Lampe JW (2006). "Addressing the soy and breast

cancer relationship: review, commentary, and workshop proceedings." J Natl

Cancer Inst 98(18): 1275-84.

Messina MJ, Wood CE (2008). "Soy isoflavones, estrogen therapy, and breast

cancer risk: analysis and commentary." Nutr J 7: 17.

Migliaccio S, Wetsel WC, Fox WM, Washburn TF, Korach KS (1993). "Endogenous

protein kinase-C activation in osteoblast-like cells modulates responsiveness

to estrogen and estrogen receptor levels." Mol Endocrinol 7(9): 1133-43.

Milanesi L, Vasconsuelo A, de Boland AR, Boland R (2009). "Expression and

subcellular distribution of native estrogen receptor beta in murine C2C12 cells

and skeletal muscle tissue." Steroids 74(6): 489-97.

Misra RR, Hursting SD, Perkins SN, Sathyamoorthy N, Mirsalis JC, Riccio ES,

Crowell JA (2002). "Genotoxicity and carcinogenicity studies of soy

isoflavones." Int J Toxicol 21(4): 277-85.

Mitchell JH, Duthie SJ, Collins AR (2000). "Effects of phytoestrogens on growth and

DNA integrity in human prostate tumor cell lines: PC-3 and LNCaP." Nutr

Cancer 38(2): 223-8.

Mohibi S, Mirza S, Band H, Band V (2011). "Mouse models of estrogen receptor-

positive breast cancer." J Carcinog 10: 35.

Molzberger AF, Vollmer G, Hertrampf T, Moller FJ, Kulling S, Diel P (2012). "In utero

and postnatal exposure to isoflavones results in a reduced responsivity of the

mammary gland towards estradiol." Mol Nutr Food Res 56(3): 399-409.

Bibliography


Moran AL, Nelson SA, Landisch RM, Warren GL, Lowe DA (2007). "Estradiol

replacement reverses ovariectomy-induced muscle contractile and myosin

dysfunction in mature female mice." J Appl Physiol 102(4): 1387-93.

Morley JE, Baumgartner RN, Roubenoff R, Mayer J, Nair KS (2001). "Sarcopenia." J

Lab Clin Med 137(4): 231-43.

Myung SK, Ju W, Choi HJ, Kim SC (2009). "Soy intake and risk of endocrine-related

gynaecological cancer: a meta-analysis." Bjog 116(13): 1697-705.

Nagata C, Takatsuka N, Kurisu Y, Shimizu H (1998). "Decreased serum total

cholesterol concentration is associated with high intake of soy products in

Japanese men and women." J Nutr 128(2): 209-13.

Nakamura T, Imai Y, Matsumoto T, Sato S, Takeuchi K, Igarashi K, Harada Y,

Azuma Y, Krust A, Yamamoto Y, Nishina H, Takeda S, Takayanagi H, Metzger

D, Kanno J, Takaoka K, Martin TJ, Chambon P, Kato S (2007). "Estrogen

prevents bone loss via estrogen receptor alpha and induction of Fas ligand in

osteoclasts." Cell 130(5): 811-23.

Nandi S, Guzman RC, Yang J (1995). "Hormones and mammary carcinogenesis in

mice, rats, and humans: a unifying hypothesis." Proc Natl Acad Sci U S A

92(9): 3650-7.

Neuman E, Ladha MH, Lin N, Upton TM, Miller SJ, DiRenzo J, Pestell RG, Hinds

PW, Dowdy SF, Brown M, Ewen ME (1997). "Cyclin D1 stimulation of estrogen

receptor transcriptional activity independent of cdk4." Mol Cell Biol 17(9):

5338-47.

Newbold RR, Bullock BC, McLachlan JA (1990). "Uterine adenocarcinoma in mice

following developmental treatment with estrogens: a model for hormonal

carcinogenesis." Cancer Res 50(23): 7677-81.

Bibliography


Newman DJ, Cragg GM (2010). "Natural products as sources of new drugs over the

30 years from 1981 to 2010." J Nat Prod 75(3): 311-35.

Nigg EA (1995). "Cyclin-dependent protein kinases: key regulators of the eukaryotic

cell cycle." Bioessays 17(6): 471-80.

Nikaido Y, Yoshizawa K, Danbara N, Tsujita-Kyutoku M, Yuri T, Uehara N, Tsubura A

(2004). "Effects of maternal xenoestrogen exposure on development of the

reproductive tract and mammary gland in female CD-1 mouse offspring."

Reprod Toxicol 18(6): 803-11.

Nilsson S, Gustafsson JA (2010). Estrogen receptors: their actions and functional

roles in health and disease. Nuclear Receptors: Current Concepts and Future

Challenges (C. C. Bunce, M.J, Springer, The Netherlands: 91–141.

Nilsson S, Gustafsson JA (2011). "Estrogen receptors: therapies targeted to receptor

subtypes." Clin Pharmacol Ther 89(1): 44-55.

Nilsson S, Makela S, Treuter E, Tujague M, Thomsen J, Andersson G, Enmark E,

Pettersson K, Warner M, Gustafsson JA (2001). "Mechanisms of estrogen

action." Physiol Rev 81(4): 1535-65.

O'Lone R, Frith MC, Karlsson EK, Hansen U (2004). "Genomic targets of nuclear

estrogen receptors." Mol Endocrinol 18(8): 1859-75.

Oakes SR, Vaillant F, Lim E, Lee L, Breslin K, Feleppa F, Deb S, Ritchie ME, Takano

E, Ward T, Fox SB, Generali D, Smyth GK, Strasser A, Huang DC, Visvader

JE, Lindeman GJ (2011). "Sensitization of BCL-2-expressing breast tumors to

chemotherapy by the BH3 mimetic ABT-737." Proc Natl Acad Sci U S A

109(8): 2766-71.

OECD (2007). "OECD guideline for testing of chemicals. Uterotrophic Bioassay in

Rodents: A short-term screening test for oestrogenic properties." Test

Guidelines 440.

Bibliography


Okamoto Y, Suzuki, A., Ueda, K., Ito C., Itoigawa, M., Furukawa, H., Nishihara, T and

Kojima, N. (2006). "Anti-estrogenic activity of prenylated isoflavone from

Millettia pachycarpa: Implications for pharmacophores and unique

mechanisms." Journal of health Science 52(2): 186-191.

Okura A, Arakawa H, Oka H, Yoshinari T, Monden Y (1988). "Effect of genistein on

topoisomerase activity and on the growth of [Val 12]Ha-ras-transformed NIH

3T3 cells." Biochem Biophys Res Commun 157(1): 183-9.

Ollberding NJ, Lim U, Wilkens LR, Setiawan VW, Shvetsov YB, Henderson BE,

Kolonel LN, Goodman MT (2012). "Legume, soy, tofu, and isoflavone intake

and endometrial cancer risk in postmenopausal women in the multiethnic

cohort study." J Natl Cancer Inst 104(1): 67-76.

Onate SA, Boonyaratanakornkit V, Spencer TE, Tsai SY, Tsai MJ, Edwards DP,

O'Malley BW (1998). "The steroid receptor coactivator-1 contains multiple

receptor interacting and activation domains that cooperatively enhance the

activation function 1 (AF1) and AF2 domains of steroid receptors." J Biol

Chem 273(20): 12101-8.

Otaka T, Okui S, Uchiyama M (1969). "Stimulation of protein synthesis in mouse liver

by ecdysterone." Chem Pharm Bull (Tokyo) 17(1): 75-81.

Otaka T, Uchiyama M, Okui S, Takemoto T, Hikino H (1968). "Stimulatory effect of

insect-metamorphosing steroids from Achyranthes and Cyathula on protein

synthesis in mouse liver." Chem Pharm Bull (Tokyo) 16(12): 2426-9.

Owens JW, Ashby J (2002). "Critical review and evaluation of the uterotrophic

bioassay for the identification of possible estrogen agonists and antagonists: in

support of the validation of the OECD uterotrophic protocols for the laboratory

rodent. Organisation for Economic Co-operation and Development." Crit Rev

Toxicol 32(6): 445-520.

Bibliography


Owuor BO, Kisangau DP (2006). "Kenyan medicinal plants used as antivenin: a

comparison of plant usage." J Ethnobiol Ethnomed 2: 7.

Pfaffl MW (2001). "A new mathematical model for relative quantification in real-time RT-PCR." Nucleic Acids Res 29(9): e45.

Pagliacci MC, Smacchia M, Migliorati G, Grignani F, Riccardi C, Nicoletti I (1994).

"Growth-inhibitory effects of the natural phyto-oestrogen genistein in MCF-7

human breast cancer cells." Eur J Cancer 30A(11): 1675-82.

Palacios S, Pornel B, Vazquez F, Aubert L, Chantre P, Mares P (2010). "Long-term

endometrial and breast safety of a specific, standardized soy extract."

Climacteric 13(4): 368-75.

Patisaul HB, Jefferson W (2010). "The pros and cons of phytoestrogens." Front

Neuroendocrinol 31(4): 400-19.

Petkov V, Roussinov K, Todorov S, Lazarova M, Yonkov D, Draganova S (1984).

"Pharmacological investigations on Rhaponticum carthamoides." Planta Med

50(3): 205-9.

Pilsakova L, Riecansky I, Jagla F (2010). "The physiological actions of isoflavone

phytoestrogens." Physiol Res 59(5): 651-64.

Pollanen E, Sipila S, Alen M, Ronkainen PH, Ankarberg-Lindgren C, Puolakka J,

Suominen H, Hamalainen E, Turpeinen U, Konttinen YT, Kovanen V (2011).

"Differential influence of peripheral and systemic sex steroids on skeletal

muscle quality in pre- and postmenopausal women." Aging Cell 10(4): 650-60.

Porter W, Saville B, Hoivik D, Safe S (1997). "Functional synergy between the

transcription factor Sp1 and the estrogen receptor." Mol Endocrinol 11(11):

1569-80.

Bibliography


Power RF, Mani SK, Codina J, Conneely OM, O'Malley BW (1991). "Dopaminergic

and ligand-independent activation of steroid hormone receptors." Science

254(5038): 1636-9.

Prall OW, Rogan EM, Musgrove EA, Watts CK, Sutherland RL (1998). "c-Myc or

cyclin D1 mimics estrogen effects on cyclin E-Cdk2 activation and cell cycle

reentry." Mol Cell Biol 18(8): 4499-508.

Pritts EA, Parker WH, Olive DL (2009). "Fibroids and infertility: an updated systematic

review of the evidence." Fertil Steril 91(4): 1215-23.

Rosenberg ME, Silkensen J (1995). "Clusterin: physiologic and pathophysiologic

considerations." Int J Biochem Cell Biol 27(7): 633-45.

Rosenfeld MG, Glass CK (2001). "Coregulator codes of transcriptional regulation by

nuclear receptors." J Biol Chem 276(40): 36865-8.

Routledge EJ, Sumpter JP (1996). "Estrogenic activity of surfactants and some of

their degradation products assassed using a recombinant yeast screen "

Environmental Toxicology and Chemistry Vol. 15(No. 3): 241–248.

Samy RP, Thwin MM, Gopalakrishnakone P, Ignacimuthu S (2008). "Ethnobotanical

survey of folk plants for the treatment of snakebites in Southern part of

Tamilnadu, India." J Ethnopharmacol 115(2): 302-12.

Sandberg AA, Slaunwhite WR, Jr. (1957). "Studies on phenolic steroids in human

subjects. II. The metabolic fate and hepato-biliary-enteric circulation of C14-

estrone and C14-estradiol in women." J Clin Invest 36(8): 1266-78.

Saville B, Wormke M, Wang F, Nguyen T, Enmark E, Kuiper G, Gustafsson JA, Safe

S (2000). "Ligand-, cell-, and estrogen receptor subtype (alpha/beta)-

dependent activation at GC-rich (Sp1) promoter elements." J Biol Chem

275(8): 5379-87.

Bibliography


Schoch RD, Willoughby D, Greenwood M (2006). "The regulation and expression of

the creatine transporter: a brief review of creatine supplementation in humans

and animals." J Int Soc Sports Nutr 3: 60-6.

Schwabe JW, Chapman L, Finch JT, Rhodes D (1993). "The crystal structure of the

estrogen receptor DNA-binding domain bound to DNA: how receptors

discriminate between their response elements." Cell 75(3): 567-78.

Schwartz LM, Truman JW (1984). "Hormonal control of muscle atrophy and

degeneration in the moth Antheraea polyphemus." J Exp Biol 111: 13-30.

Seidlova-Wuttke D, Christel D, Kapur P, Nguyen BT, Jarry H, Wuttke W (2010).

"Beta-ecdysone has bone protective but no estrogenic effects in

ovariectomized rats." Phytomedicine 17(11): 884-9.

Seo HS, DeNardo DG, Jacquot Y, Laios I, Vidal DS, Zambrana CR, Leclercq G,

Brown PH (2006). "Stimulatory effect of genistein and apigenin on the growth

of breast cancer cells correlates with their ability to activate ER alpha." Breast

Cancer Res Treat 99(2): 121-34.

Setchell KD, Borriello SP, Hulme P, Kirk DN, Axelson M (1984). "Nonsteroidal

estrogens of dietary origin: possible roles in hormone-dependent disease." Am

J Clin Nutr 40(3): 569-78.

Setchell KD, Cassidy A (1999). "Dietary isoflavones: biological effects and relevance

to human health." J Nutr 129(3): 758S-767S.

Setchell KD, Lydeking-Olsen E (2003). "Dietary phytoestrogens and their effect on

bone: evidence from in vitro and in vivo, human observational, and dietary

intervention studies." Am J Clin Nutr 78(3 Suppl): 593S-609S.

Shanle EK, Xu W (2011). "Endocrine disrupting chemicals targeting estrogen

receptor signaling: identification and mechanisms of action." Chem Res

Toxicol 24(1): 6-19.

Bibliography


Shao W, Brown M (2004). "Advances in estrogen receptor biology: prospects for

improvements in targeted breast cancer therapy." Breast Cancer Res 6(1): 39-

52.

Shiau AK, Barstad D, Loria PM, Cheng L, Kushner PJ, Agard DA, Greene GL (1998).

"The structural basis of estrogen receptor/coactivator recognition and the

antagonism of this interaction by tamoxifen." Cell 95(7): 927-37.

Shivhare MK, Singour PK, Chaurasiya PK, Pawar RS (2012). "Trianthema

portulacastrum Linn. (Bishkhapra)." Pharmacogn Rev 6(12): 132-40.

Short KR, Nair KS (2000). "The effect of age on protein metabolism." Curr Opin Clin

Nutr Metab Care 3(1): 39-44.

Shull JD, Spady TJ, Snyder MC, Johansson SL, Pennington KL (1997). "Ovary-intact,

but not ovariectomized female ACI rats treated with 17beta-estradiol rapidly

develop mammary carcinoma." Carcinogenesis 18(8): 1595-601.

Shwaery GT, Vita JA, Keaney JF, Jr. (1997). "Antioxidant protection of LDL by

physiological concentrations of 17 beta-estradiol. Requirement for estradiol

modification." Circulation 95(6): 1378-85.

Simons R, Gruppen H, Bovee TF, Verbruggen MA, Vincken JP (2012). "Prenylated

isoflavonoids from plants as selective estrogen receptor modulators

(phytoSERMs)." Food Funct 3(8): 810-27.

Simons R, Vincken JP, Bakx EJ, Verbruggen MA, Gruppen H (2009). "A rapid

screening method for prenylated flavonoids with ultra-high-performance liquid

chromatography/electrospray ionisation mass spectrometry in licorice root

extracts." Rapid Commun Mass Spectrom 23(19): 3083-93.

Bibliography


Siow RC, Mann GE (2010). "Dietary isoflavones and vascular protection: activation of

cellular antioxidant defenses by SERMs or hormesis?" Mol Aspects Med

31(6): 468-77.

Smith CL, Conneely OM, O'Malley BW (1993). "Modulation of the ligand-independent

activation of the human estrogen receptor by hormone and antihormone." Proc

Natl Acad Sci U S A 90(13): 6120-4.

Somai S, Chaouat M, Jacob D, Perrot JY, Rostene W, Forgez P, Gompel A (2003).

"Antiestrogens are pro-apoptotic in normal human breast epithelial cells." Int J

Cancer 105(5): 607-12.

Stefanetti AI, Turner MJ, Quick RJ, Russell AP (2008). The effect of estrogen on Akt

signalling and protein synthesis in C2C12 skeletal myotubes. Proceeding of

the Australian Physiological Society. aups.org.au/Proceeding/39/70P/.

Steinberg FM, Murray MJ, Lewis RD, Cramer MA, Amato P, Young RL, Barnes S,

Konzelmann KL, Fischer JG, Ellis KJ, Shypailo RJ, Fraley JK, Smith EO,

Wong WW (2011). "Clinical outcomes of a 2-y soy isoflavone supplementation

in menopausal women." Am J Clin Nutr 93(2): 356-67.

Stitt TN, Drujan D, Clarke BA, Panaro F, Timofeyva Y, Kline WO, Gonzalez M,

Yancopoulos GD, Glass DJ (2004). "The IGF-1/PI3K/Akt pathway prevents

expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO

transcription factors." Mol Cell 14(3): 395-403.

Sun Y, Luo D, Liao DJ (2012). "CyclinD1 protein plays different roles in modulating

chemoresponses in MCF-7 and MDA-MB 231 cells." Journal of carcinogensis

11(12): 18-29.

Sutherland RL, Hamilton JA, Sweeney KJ, Watts CK, Musgrove EA (1995).

"Expression and regulation of cyclin genes in breast cancer." Acta Oncol

34(5): 651-6.

Bibliography


Syrov VN, Kurmukov AG (1976). "[The anabolic properties of turkesterone

phytoecdysone and turkesterone tetraacetate in experiments on male rats]."

Probl Endokrinol (Mosk) 22(3): 107-12.

Takayama M, Nomura T (1995). "Structure of the Diene Originating from a retro-

Diels- Alder Cleavage of the Natural Product Kuwanon G." Rapid Commun

Mass Spectrom 9: 383-386.

Tanee Fomum Z, Ayafor JF, Ifeadike PN, Nkengfack AE, Wandji J (1986). "Erythrina

Studies; Part 3. Isolation of an isoflavone from Erythrina senegalensis and

Erythrina excelsa." Planta Med(4): 341.

Tang M, Abplanalp W, Subbiah MT (1997). "Association of estrogens with human

plasma lipoproteins: studies using estradiol-17beta and its hydrophobic

derivative." J Lab Clin Med 129(4): 447-52.

The National Toxicology Program (NTP) (2002). "Background review document

(BRD) current status of test methods for detecting endocrine disruptors: In

vitro estrogen transcriptional activation assays. National Institute of

Environmental Health Sciences (NIEHS)." NIH Publication. Research Triangle

Park. NC 27709 nº 03-4505.

Tobin NP, Bergh J (2012). "Analysis of Cyclin D1 in Breast Cancer: A Call to Arms."

Curr Breast Cancer Rep 4(3): 171-173.

Toth N, Szabo A, Kacsala P, Heger J, Zador E (2008). "20-Hydroxyecdysone

increases fiber size in a muscle-specific fashion in rat." Phytomedicine 15(9):

691-8.

Trowbridge JM, Rogatsky I, Garabedian MJ (1997). "Regulation of estrogen receptor

transcriptional enhancement by the cyclin A/Cdk2 complex." Proc Natl Acad

Sci U S A 94(19): 10132-7.

Bibliography


Tsai MJ, O'Malley BW (1994). "Molecular mechanisms of action of steroid/thyroid

receptor superfamily members." Annu Rev Biochem 63: 451-86.

Tseng L, Stolee A, Gurpide E (1972). "Quantitative studies on the uptake and

metabolism of estrogens and progesterone by human endometrium."

Endocrinology 90(2): 390-404.

Tsujimoto Y, Finger LR, Yunis J, Nowell PC, Croce CM (1984). "Cloning of the

chromosome breakpoint of neoplastic B cells with the t(14;18) chromosome

translocation." Science 226(4678): 1097-9.

van der Woude H, Ter Veld MG, Jacobs N, van der Saag PT, Murk AJ, Rietjens IM

(2005). "The stimulation of cell proliferation by quercetin is mediated by the

estrogen receptor." Mol Nutr Food Res 49(8): 763-71.

Vargas AJ, Burd R (2010). "Hormesis and synergy: pathways and mechanisms of

quercetin in cancer prevention and management." Nutr Rev 68(7): 418-28.

Velders M, Schleipen B, Fritzemeier KH, Zierau O, Diel P (2012). "Selective estrogen

receptor-beta activation stimulates skeletal muscle growth and regeneration."

Faseb J 26(5): 1909-20.

Wandji J, Nkengfack AE, Fomum ZT, Ubillas R, Killday KB, Tempesta MS (1990). "A

new prenylated isoflavone and long chain esters from two Erythrina species." J

Nat Prod 53(6): 1425-9.

Wasserman RH, Taylor AN (1966). "Vitamin d3-induced calcium-binding protein in

chick intestinal mucosa." Science 152(3723): 791-3.

Webb P, Nguyen P, Shinsako J, Anderson C, Feng W, Nguyen MP, Chen D, Huang

SM, Subramanian S, McKinerney E, Katzenellenbogen BS, Stallcup MR,

Kushner PJ (1998). "Estrogen receptor activation function 1 works by binding

p160 coactivator proteins." Mol Endocrinol 12(10): 1605-18.

Bibliography


Wei H, Wei L, Frenkel K, Bowen R, Barnes S (1993). "Inhibition of tumor promoter-

induced hydrogen peroxide formation in vitro and in vivo by genistein." Nutr

Cancer 20(1): 1-12.

Weigt C, Hertrampf T, Zoth N, Fritzemeier KH, Diel P (2012). "Impact of estradiol, ER

subtype specific agonists and genistein on energy homeostasis in a rat model

of nutrition induced obesity." Mol Cell Endocrinol 351(2): 227-38.

Whitsett TG, Jr., Lamartiniere CA (2006). "Genistein and resveratrol: mammary

cancer chemoprevention and mechanisms of action in the rat." Expert Rev

Anticancer Ther 6(12): 1699-706.

WHO (2008). "Traditional medicine." Fact sheet N°134

Wiik A, Ekman M, Johansson O, Jansson E, Esbjornsson M (2009). "Expression of

both oestrogen receptor alpha and beta in human skeletal muscle tissue."

Histochem Cell Biol 131(2): 181-9.

Wiik A, Glenmark B, Ekman M, Esbjornsson-Liljedahl M, Johansson O, Bodin K,

Enmark E, Jansson E (2003). "Oestrogen receptor beta is expressed in adult

human skeletal muscle both at the mRNA and protein level." Acta Physiol

Scand 179(4): 381-7.

Wong RS (2011). "Apoptosis in cancer: from pathogenesis to treatment." J Exp Clin

Cancer Res 30: 87.

Wunsche W, Tenniswood MP, Schneider MR, Vollmer G (1998). "Estrogenic

regulation of clusterin mRNA in normal and malignant endometrial tissue." Int

J Cancer 76(5): 684-8.

Yamori Y, Moriguchi EH, Teramoto T, Miura A, Fukui Y, Honda KI, Fukui M, Nara Y,

Taira K, Moriguchi Y (2002). "Soybean isoflavones reduce postmenopausal

bone resorption in female Japanese immigrants in Brazil: a ten-week study." J

Am Coll Nutr 21(6): 560-3.

Bibliography


Zhang CZ, Wang SX, Zhang Y, Chen JP, Liang XM (2005). "In vitro estrogenic

activities of Chinese medicinal plants traditionally used for the management of

menopausal symptoms." J Ethnopharmacol 98(3): 295-300.

Zhang R, Hu SJ, Li C, Zhang F, Gan HQ, Mei QB (2012). "Achyranthes bidentata

root extract prevent OVX-induced osteoporosis in rats." J Ethnopharmacol

139(1): 12-8.

Zhang Y, Zhang P, Cheng Y (2008). "Structural characterization of isoprenylated

flavonoids from Kushen by electrospray ionization multistage tandem mass

spectrometry." J Mass Spectrom 43(10): 1421-31.

Zhao E, Mu Q (2010). "Phytoestrogen Biological Actions on Mammalian

Reproductive System and Cancer Growth." Sci Pharm 79(1): 1-20.

Zhao Z, Kosinska W, Khmelnitsky M, Cavalieri EL, Rogan EG, Chakravarti D, Sacks

PG, Guttenplan JB (2006). "Mutagenic activity of 4-hydroxyestradiol, but not 2-

hydroxyestradiol, in BB rat2 embryonic cells, and the mutational spectrum of 4-

hydroxyestradiol." Chem Res Toxicol 19(3): 475-9.

Zwijsen RM, Wientjens E, Klompmaker R, van der Sman J, Bernards R, Michalides

RJ (1997). "CDK-independent activation of estrogen receptor by cyclin D1."

Cell 88(3): 405-15.

Publications and Presentations


Publications and presentations

Tchoukouegno SN, Job Tchoumtchoua, Dieudonné Njamen, Maria Halabalaki, Ute

Laudenbach-Leschowski, Patrick Diel. Estrogenic and cytotoxic properties of the

ethanolic extract of Erythrina excelsa. Original research article submitted in Planta

Medica.

Tchoukouegno SN et al. A phytoestrogen rich-fraction of Erythrina excelsa

modulates cell cycle progression and induces apoptosis of human breast cancer

MCF-7 cell line. Original research article in preparation.

Parr MK, Haupt O, Hengevoss J, Tchoukouegno Ngueu S, Fritzemeier KH, Marion

Picotta, Muhn P, Diel P. Estrogen receptor beta mediated anabolic effects – insights

from mechanistic studies on the phytoecdysteroid ecdysterone. Original research

article in preparation.

Tchoukouegno SN, Dieudonné Njamen, Ute Laudenbach-Leschowski, Patrick Diel.

Estrogenic effects of the ethanolic extract of Erythrina excelsa Baker

(Leguminoseae). Poster presentation at the Bregenz sommer school of

Endocrinology (Austria, July 2011).

Tchoukouegno SN. Estrogenic and cytotoxic properties of Erythrina excelsa Baker

(Fabaceae). Oral presentation at the symposium on bioactive principles of medicinal

plants and diet. (Dresden, October 2012).

Maria Kristina Parr, PhD, Oliver Haupt, Sadrine Tchoukouegno Ngueu, Karl-

Heinrich Fritzemeier, , Peter Muhn, and Patrick Rene Diel. Estrogen Receptor Beta

mediated anabolic effects – Insights from mechanistic studies on the

Phytoecdysteroid Ecdysterone and Selective Ligands. Poster presentation at the

95thannual Meeting and Expo of the Endocrine Society 14-18 June 2013.

https://endo.confex.com/endo/2013endo/webprogram/Paper6126.html




Curriculum Vitae


Curriculum vitae

PERSONAL DETAILS

Name Sadrine Tchoukouegno Ngueu

Family and marital status Married

Date& Place of Birth 20.04.1984 at Bamenyam

Nationality Cameroonian

EDUCATIONAL QUALIFICATIONS

Degree/Diploma Field /

specialty

Institution Marks Yea

r

1. High School Diploma Mathematics

and Natural

Sciences

Lycee de Nkol-

Eton

16.35/20 200

1

2. Bachelor of Science Animal Biology

& Physiology

University of

Yaounde I

200

4

3. Master‟s Degree (without

thesis)

Animal

Physiology

University of

Yaounde I

13.25/20 200

5

4. Master‟s Degree (with

thesis)

Animal

Physiology

University of

Yaounde I

14.37/20 200

7

5. PhD candicate Natural

Sciences

German Sport

University

(Cologne)

from

201

0

AWARDS & SCHOLARSHIP

1. Price of the Best Cameroonian female student at the High School Diploma

exam 2001

2. DAAD Scholarship for PhD Studies in Natural Sciences

INTERSHIPS

Internship at the “Centre Pasteur du Cameroun”

(Biochemistry laboratory)

October-November

2005 (One month)

Internship at the laboratory of Pharmacognosy and

Natural Products Chemistry, Faculty of Pharmacy,

University of Athens, Greece.

February – Mai 2013

(3 months)

TECHNICAL SKILLS

1. Cellular and Molecular Biology: PCR, Western blot, FACS

2. Chromatography: CC, FCPC, HPLC-DAD

3. Scientific softwares: Chromquest, Sigmaplot, SPSS.

LANGUAGES

1. French (Native)

2. English (Very Good)

3. German (Very Good)

Curriculum Vitae


4. Spanish (Basic)

PROFESSIONAL AFFILIATIONS AND MEMBERSHIPS

Member of the Society of Medicinal Plant and Natural Product Research (GA)

Member of ANSA e.v (Alumni Netzwerk Subsahara Afrika)

bioactivity of plants secondary metabolites...

Documents