Angelica keiskei Extract Improves Insulin Resistanceand Hypertriglyceridemia in Rats Fed a High-Fructose Drink

Hiromu OHNOGI,1;2;y Shoko HAYAMI,2 Yoko KUDO,2 Suzu DEGUCHI,2 Shigetoshi MIZUTANI,2

Tatsuji ENOKI,2 Yuko TANIMURA,1 Wataru AOI,1;3 Yuji NAITO,1

Ikunoshin KATO,2 and Toshikazu YOSHIKAWA1

1Department of Molecular Gastroenterology and Hepatology, Kyoto Prefectural University of Medicine,Kamigyo-ku, Kyoto 602-8566, Japan2Takara Bio Inc., 3-4-1 Seta, Otsu, Shiga 520-2193, Japan3Laboratory of Health Science, Kyoto Prefectural University, Sakyo-ku, Kyoto 606-8522, Japan

Received December 2, 2011; Accepted January 11, 2012; Online Publication, May 7, 2012

[doi:10.1271/bbb.110927]

Angelica keiskei is a traditional herb peculiar toJapan and abundantly contains vitamins, dietary fiberand such polyphenols as chalcone. We investigated inthe present study the effect of A. keiskei on insulinresistance and hypertriglyceridemia in fructose-drink-ing rats as a model for the metabolic syndrome. MaleWistar rats were given a 15% fructose solution asdrinking water for 11 weeks. Fructose significantlyincreased the levels of serum insulin and triglyceride(TG) compared with the control level. Treatment withan ethanol extract of A. keiskei (AE) significantlyreduced the levels of blood glucose (�16:5%), seruminsulin (�47:3%), HOMA-R (�56:4%) and TG(�24:2%). A hepatic gene analysis showed that fructosereduced the expression of the genes related to fatty acid�-oxidation and high-density lipoprotein (HDL) pro-duction. Treatment with AE enhanced the expression ofthe acyl-CoA oxidase 1 (ACO1), medium-chain acyl-CoA dehydrogenase (MCAD), ATP-binding membranecassette transporter A1 (ABCA1) and apolipoprotein A1(Apo-A1) genes. These results suggest that AE improvedthe insulin resistance and hypertriglyceridemia of thefructose-drinking rats.

Key words: Angelica keiskei; insulin resistance; hyper-triglyceridemia; fructose-drinking rat

Insulin resistance is a metabolic disorder character-ized by reduced insulin sensitivity in the target tissues,including skeletal muscle, liver and adipose tissue.Insulin resistance is closely associated with type IIdiabetes mellitus (T2DM), dyslipidemia and hyperten-sion. The insulin resistance syndrome, also known as themetabolic syndrome, increases the risk for cardiovascu-lar disease (CVD).1,2) According to the national healthand nutrition survey by Ministry of Health, Labor andWelfare of Japan, 50% of men and 20% of women aged40–74 years are patients with or candidates for themetabolic syndrome. CVD is a major cause of mortality,

accounting for almost 25% of all deaths in Japan. It iswell known that dietary intervention and moderateexercise are effective for preventing or treating insulinresistance. However, these lifestyle modifications arefrequently neglected. Recent studies have shown thatsuch food materials as herbs,3–6) spices,7) vegetables,8)

green tea9) and wine10) improved insulin resistance inanimal models.Angelica keiskei Koidzumi (‘‘Ashitaba’’ in Japanese)

is an edible plant grown along the Pacific Coast ofJapan. This traditional herb was also used as a folkmedicine in the Izu islands for a long time. Fresh leavesof A. keiskei are nowadays widely used for green juiceand health-promoting food in Japan. A. keiskei uniquelycontains chalcones as polyphenols in its leaves, rootsand yellow exudates from the stem. Xanthoangelol (XA)and 4-hydroxyderricin (4HD) are two major prenylatedchalcones in A. keiskei.11) It has also been reported thatabout twenty minor chalcones were isolated fromA. keiskei.12–15) These chalcones have shown anti-tumorpromoting,16) anti-cancer,17,18) anti-bacterial,19) anti-ulcer20) and artery relaxation21) actions. Our previousstudies indicated that XA and 4HD markedly inducedadipogenic differentiation of 3T3-L1 preadipocytes andenhanced glucose uptake in 3T3-L1 adipocytes.22,23) Ithas also been reported that XA and 4HD enhanced theglucose transporter type 4 (GLUT4)-dependent glucoseuptake in skeletal muscle cells.24) Moreover, the chal-cones from A. keiskei have exhibited anti-diabetic, anti-dyslipidemic and anti-hypertensive actions in animalmodels. We have reported that oral administered XAand 4HD prevented hyperglycemia in KK-Ay type IIdiabetic mice.22) Ogawa et al. have reported that XA and4HD also improved hypertension and hyperlipidemia inspontaneously hypertensive rats.25,26) These reportssuggested that A. keiskei could be useful for preventinginsulin resistance and the metabolic syndrome. How-ever, little is known about the effects of chalcones fromA. keiskei on insulin resistance.

y To whom correspondence should be addressed. Tel: +81-77-543-7201; Fax: +81-77-543-7238; E-mail: onogih@takara-bio.co.jpAbbreviations: ABCA1, ATP-binding membrane cassette transporter A1; ACO1, acyl-CoA oxidase 1; AE, ethanol extract of Angelica keiskei;

Apo-A1, apolipoprotein A1; CPT-1, carnitine palmitoyltransferase-1; CVD, cardiovascular disease; ELISA, enzyme-linked immunosorbentassay; FFA, free fatty acid; GLUT4, glucose transporter type 4; HbA1c, hemoglobin A1c; 4HD, 4-hydroxyderricin; HDL, high-density lipoprotein;HOMA-R, homeostasis model assessment insulin resistance; MCAD, medium-chain acyl-CoA dehydrogenase; PPAR, peroxisome proliferator-activated receptor; T2DM, type II diabetes mellitus; TG, triglyceride; TZD, thiazolidinedione; XA, xanthoangelol

Biosci. Biotechnol. Biochem., 76 (5), 928–932, 2012

The excess ingestion of fructose has generallyinduced insulin resistance in humans and rodents.27,28)

Fructose-drinking or -fed rats are used as a model for themetabolic syndrome. We investigate in this study theeffect of an ethanol extract of A. keiskei (AE) containingchalcones on the insulin resistance and hypertriglycer-idemia in fructose-drinking rats.

Materials and Methods

Preparation of AE. A. keiskei was cultivated and harvested in

Kagoshima Prefecture in Japan. Dried leaves and stems (10 kg) were

washed with hot water, and the washed residue was extracted twice

with 90% ethanol (120L) for 2 h. The resulting extract was

concentrated under reduced pressure and dried. Powdered AE

contained XA (7.30 g per kg) and 4HD (3.45 g per kg) which

constituted 97% of the total chalcones.

Animals and experimental design. Male Wistar rats (5 weeks old,

Japan SLC, Shizuoka, Japan) were housed in standard cages (2 rats per

cage) at 23� 2 �C and 55� 10% relative humidity with a 12 h light/

12 h dark cycle (lights on at 06.00 h). After a 1-week acclimatization

period, the rats were assigned to three groups of 8 rats each by body

weight. The Fructose (F) group and Fructose-AE (F-AE) group were

given a 15% fructose solution as drinking water and fed for 11 weeks

with a powdered CE-2 diet (Clea, Tokyo, Japan) with or without 3%

w/w of AE. The Normal (N) group was given tap water and CE-2 for

11 weeks. All the rats were provided with food and water ad libitum.

The body weight, food intake and fluid intake were measured once a

week. This study was carried out in accordance with the guidelines for

animal experiments of our institution, the Japanese Government

Animal Protection and Management Law, and the Japanese Govern-

ment Notification on Feeding and Safekeeping of Animals.

Biological measurements. At the end of the feeding period, blood

samples were collected from the caudal vena cava of anesthetized rats.

Each sample was centrifuged at 1;500 g for 10min at 4 �C, and aliquots

of the serum were stored at �80 �C until being analyzed. The blood

glucose level was measured by a Glucose CII-Test kit (Wako Pure

Chemicals, Osaka, Japan). The serum insulin level was measured by a

rat insulin ELISA kit (Morinaga Institute of Biological Science,

Kanagawa, Japan). The serum triglyceride (TG), free fatty acid (FFA),

total cholesterol and high-density lipoprotein (HDL)-cholesterol levels

were measured with commercial assay kits (Triglyceride E-test, NEFA

C-test, Total Cholesterol E-Test and HDL-Cholesterol E-Test, Wako

Pure Chemicals). Serum adiponectin was measured by an ELISA kit

(Assaypro, Saint Charles, MO, USA). HOMA-R, an index of insulin

resistance, was calculated by using the formula, blood glucose (mmol/

L) � insulin (mU/mL)/22.5. The liver was excised, weighed and

divided into several pieces for storage at �80 �C (for the lipid analysis)

or in an RNAlater solution (Ambion, Austin, TX, USA) (for the gene

expression analysis). Lipids from the liver were extracted by

hexane:isopropanol (3:2) and measured by using the assay kits just

described.

Gene expression analysis. Hepatic mRNA was isolated by RNA Iso

Plus (Takara Bio, Shiga, Japan). Total RNA was subjected to real-time

RT-PCR by using a SYBR PrimeScript RT-PCR kit (perfect real time)

(Takara Bio) according to the manufacturer’s protocol and a Thermal

Cycler Dice real time system (Takara Bio). The following PCR

conditions were applied: 1 cycle of 95 �C for 10 s, 45 cycles of 95 �C

for 5 s and 60 �C for 30 s, this being followed by 1 cycle of 95 �C for

15 s, 60 �C for 30 s and 95 �C for 15 s. �-Actin was used as the internal

control gene. The primer pairs used in the present study are listed

in Table 1.

Statistical analysis. All data are expressed as the mean� SEM. A

one-way analysis of variance (ANOVA) was used to compare means

among the groups. Post hoc analyses were performed by the least

significant difference (LSD) test if the ANOVA data were significant.

StatLight #4 (Yukms, Tokyo, Japan) was applied for the statistical

analysis, p < 0:05 being considered significant.

Results

Body weight, food intake and fluid intakeThere was no significant difference in body weight

among all groups by the end of the experiment(Table 2). The daily food intake by the F group andF-AE group was significantly lower than that by the Ngroup (p < 0:001 and p < 0:001, respectively), whilethe daily fluid intake by the F group and F-AE groupwas significantly higher than that by the N group(p < 0:01 and p < 0:05, respectively). There was noappreciable difference in the food and fluid intakebetween the F group and F-AE group.

Liver weight and liver lipidsThe absolute and relative liver weights of the F group

were significantly higher than those of the N group(p < 0:001 and p < 0:001, respectively). Table 2 shows

Table 1. Primers Used for Real-Time PCR

Gene Forward primer Reverse primer

ACO1 TTCAAGACAAAGCCGTCCAA TGCTCCCCTCAAGAAAGTCC

MCAD ACCGAAGAGTTGGCGTATGG CATTGGCTGCTCCGTCATC

PPAR-� CGGGTCATACTCGCAGGAAA AAGCGTCTTCTCAGCCATGC

CPT-1 GCATCCCAGGCAAAGAGACA CGAGCCCTCATAGAGCCAGA

Apo-A1 TAAAGGTTGTGGCCGAGGAG CGATCAGGGTAGGGTGGTTC

ABCA1 AGGAAACCCAATCCCAAACA CTGCTACACTGGCACGAAGG

LDLR AGCCATTTTCAGTGCCAACC TGCCTCACACCAGTTTACCC

�-Actin TAAGGCCAACCGTGAAAAGA CCAGAGGCATACAGGGACAA

Table 2. Effects of AE on the Body Weight, Food Intake, FluidIntake, Liver Weight and Liver Lipid Contents in Fructose-DrinkingRats

N F F-AE

Body weight (g) 320� 8 332� 7 323� 6

Food intake (g/d) 18:7� 0:2 13:8� 0:3��� 14:5� 0:4���

Fluid intake (mL/d) 23:9� 0:3 27:9� 0:9�� 26:6� 1:1�

Liver weight (g) 10:2� 0:3 12:1� 0:3��� 10:6� 0:3##

Relative liver weight 3:18� 0:03 3:64� 0:03��� 3:30� 0:04�;###

(per body %)

Liver total cholesterol 1:82� 0:05 1:57� 0:06�� 1:69� 0:03

(mg/g of liver)

Liver TG 20:2� 1:0 20:0� 1:1 19:8� 0:8

(mg/g of liver)

The fructose-drinking groups (F and F-AE) were given 15% fructose water

for 11 weeks. The F-AE group was also fed a diet containing 3%w/w AE.

The normal group (N) was fed tap water. The body weight, food intake and

fluid intake were measured once a week. The liver weight and liver lipid

contents were measured after 11 weeks of feeding.

Data are shown as the mean� SEM (n ¼ 8).� p < 0:05, �� p < 0:01, ��� p < 0:001 (vs. the N group)## p < 0:01, ### p < 0:001 (vs. the F group)

Angelica keiskei Extract Improves Insulin Resistance 929

that AE significantly reduced the absolute (�12:4%)and relative (�9:3%) liver weight (p < 0:01 and p <0:001, respectively). Liver cholesterol of the F groupwas lower than that of the N group (p < 0:01). Therewas no appreciable difference in liver TG among allgroups.

Blood glucose and insulinFigure 1 shows that blood glucose in the F group was

much higher than that in the N group (174� 9mg/dL,151� 7mg/dL, p < 0:05). Treating with AE signifi-cantly reduced the blood glucose level (�16:5%,p < 0:01). The serum insulin level in the F group was2.2-fold higher than that in the N group (5:22� 0:51 vs.2:37� 0:19, p < 0:001). The HOMA-R level in the Fgroup was 2.6-fold higher than that in the N group(64:3� 8:4 vs. 25:1� 2:3, p < 0:001). AE markedlysuppressed the fructose-induced increase in insulin level(�47:3%, p < 0:001) and HOMA-R level (�56:4%,p < 0:001).

Serum lipids (TG, FFA and cholesterol)Figure 2 shows the level of serum lipids at the end of

the experiment. The serum TG level in the F group was

2.1-fold higher than that in the N group (301� 21mg/dLvs. 143� 14mg/dL, p < 0:001). Treating with AEmarkedly suppressed the fructose-induced increase inserum TG (�24:2%, p < 0:01). The serum FFA level inthe F group was appreciably higher than that in the Ngroup (p < 0:05). AE significantly reduced the serumFFA level (p < 0:05). The serum total and HDL-cholesterol levels in the F-AE group (89:5� 2:7mg/dLand 48:6� 1:6mg/dL, respectively) were much higherthan those in both the N group (62:4� 1:9mg/dL and33:7� 1:2mg/dL, respectively) and F group (68:6�2:9mg/dL and 33:9� 1:1mg/dL, respectively).

Serum adiponectinFigure 3 shows that the serum adiponectin concen-

tration in the F group was much lower than that in the Ngroup (3:34� 0:16 vs. 4:78� 0:43, p < 0:01). Serumadiponectin in the F-AE group (4:25� 0:29) tended tobe higher than that in the F group (p ¼ 0:055).

Hepatic gene expressionThe hepatic mRNA expression levels of the genes

involved in lipid and glucose metabolism are shown inTable 3. The mRNA levels of acyl-CoA oxidase 1(ACO1), medium-chain acyl-CoA dehydrogenase(MCAD), apolipoprotein-A1 (Apo-A1), and ABCA1 inthe F group were much lower than those in the N group,while there was no appreciable difference in the mRNAlevels of peroxisome proliferator-activated receptor-�(PPAR-�), carnitine palmitoyltransferase-1 (CPT-1) andthe low-density lipoprotein receptor (LDLR) betweenthe F group and N group. The mRNA levels of ACO1,MCAD, CPT-1, Apo-A1 and ABCA1 at 11 weeks wereappreciably more up-regulated in the F-AE group thanin the F group.

CBA

N F F-AE N F F-AE FN F-AE

10080

120140160180200

6040200

5

4

6

7

8

3

2

1

0

5040

60708090

100

3020100

Glu

cose

(m

g/dL

)

Insu

lin (

ng/m

L)

HO

MA

-R

##

*

###

***

###

***

Fig. 1. Effects of AE on the Levels of Blood Glucose, Insulin and HOMA-R in Fructose-Drinking Rats.The blood glucose (A) and insulin (B) levels were measured and HOMA-R (C) was calculated after 11 weeks of feeding as described in the

Materials and Methods section. Data are shown as the mean� SEM (n ¼ 8). �p < 0:05, ���p < 0:001 (vs. the N group). ##p < 0:01,###p < 0:001 (vs. the F group).

TG

(m

g/dL

)

400

HD

L-ch

oles

tero

l (m

g/dL

)

Tot

al c

hole

ster

ol (

mg/

dL)

N F F-AE N F F-AE

N F F-AE N F F-AE

200

250

300

350

100

50

0

150

1.21.41.61.8

0.20

0.81.0

0.40.6F

FA

(m

Eq/

L)

5040

60708090

100

3020100

30

40

50

60

10

0

20

##

***

**

*#

***###

*** ###

A B

C D

Fig. 2. Effects of AE on the Serum TG, FFA, Total Cholesterol andHDL-Cholesterol Levels in Fructose-Drinking Rats.The serum TG (A), FFA (B), total cholesterol (C) and HDL-

cholesterol (D) levels were measured after 11 weeks of feeding asdescribed in the Materials and Methods section. Data are shown asthe mean� SEM (n ¼ 8). �p < 0:05, ��p < 0:01, ���p < 0:001 (vs.the N group). #p < 0:05, ##p < 0:01, ###p < 0:001 (vs. the F group).

Adi

pone

ctin

(µg

/mL)

N F F-AE

2

3

4

5

1

0

6

**

Fig. 3. Effect of AE on the Serum Adiponectin Level in Fructose-Drinking Rats.

Data are shown as the mean� SEM (n ¼ 8). ��p < 0:01 (vs. theN group).

930 H. OHNOGI et al.

Discussion

We evaluated in the present study the effect of AE oninsulin resistance and hypertriglyceridemia in fructose-drinking rats. It is well known that dietary fructoseinduces insulin resistance, hypertension, dyslipidemiaand the metabolic syndrome in humans27) and animals.28)

We confirmed that fructose drinking definitely inducedhyperinsulinemia, insulin resistance and hypertriglycer-idemia in this study. Figure 2 shows that fructoseincreased the respective serum insulin and HOMA-Rlevels by 2.2-fold and 2.6-fold. Treating with AE for 11weeks reduced the serum insulin, blood glucose andHOMA-R levels. These results clearly suggest that AEimproved the insulin resistance. We have previouslyreported that XA and 4HD, the major substances in AE,enhanced the glucose uptake in matured 3T3-L1 adipo-cytes and suppressed hyperglycemia and polydipsia inKK-Ay diabetic mice.22) Kawabata et al. have reportedthat XA and 4HD enhanced the glucose uptake incultured skeletal muscle cells by inducing translocationof GLUT4, the insulin-responsive glucose transporter, tothe plasma membrane, and that an acetic acetate extractof A. keiskei improved acute hyperglycemia in an oralglucose tolerance test on ICR mice.24) These reportssuggests that the anti-hyperinsulinemic and anti-hyper-glycemic effects of AE were possibly due to the directinsulin-like activity of chalcones from A. keiskei.

Insulin resistance is not only a major incidence ofT2DM, but is also deeply related to dyslipidemia. AEmarkedly reduced the serum TG level caused by excessingestion of fructose in this study. To clarify themechanism for the anti-hypertrigliceridemic action ofAE, we analyzed the expression levels of the genesrelated to fatty acid �-oxidation in the liver. Theexpression of the ACO1 and MCAD genes in the Fgroup was lower than that in the N group. ACO1 andMCAD are the key enzymes respectively involved infatty acid �-oxidation in peroxisomes and mitochondria.Our results suggest that ingesting fructose suppressedfatty acid �-oxidation activity in the liver and thenelevated the serum TG level. AE improved the ex-pression of the ACO1 and MCAD genes that had beenreduced by fructose. Moreover, AE enhanced the geneexpression of CPT-1, the key enzyme that transportslong-chain fatty acids into mitochondria. These obser-vations indicate that AE could possibly reduce the blood

TG level by enhancing fatty acid �-oxidation in theliver.It has recently been proposed that insulin resistance

and the metabolic syndrome are caused by the reducedproductivity of adiponectin, an adipocytokine secretedfrom adipose tissue.29) Adiponectin activates AMP-activated protein kinase (AMPK), enhances fatty acid�-oxidation and improves insulin resistance via adipo-nectin receptors in the liver and skeletal muscle.30,31)

Thiazolidinediones (TZDs), PPAR-� agonists, havebeen widely used for treating T2DM as an insulinsensitizer. TZDs have improved the insulin resistanceand increased the plasma adiponectin level in T2DMpatients, high fat/sucrose-fed rats and ZDF rats.32–34) Ithas been reported that TZDs enhanced adipogenicdifferentiation in 3T3-L1 cells by PPAR-� activation,35)

and increased the number of small adipocytes whichhighly expressed adiponectin in obese animal mod-els.36,37) We have already reported that AE, XA and4HD also induced differentiation in 3T3-L1 preadipo-cytes, while they exhibited no PAR-� activation in theGAL4-PPAR-� ligand-binding domain chimeric sys-tem.22) Moreover, we have confirmed that 3T3-L1adipocytes differentiated by XA or 4HD were capableof producing adiponectin (Ohnogi, H. and Kudo, Y.,unpublished data).The serum adiponectin level in the F group of this

study was lower than that in the N group. AE tended toincrease the adiponectin level. Our previous humanstudy has reported that the long-term ingestion of greenjuice of A. keiskei appreciably increased the serumadiponectin level (total and high-molecular-weighttypes, respectively) and reduced the HbA1c level whencompared with chalcone-removed placebo juice inborderline and mild diabetes.38) Taken together, it ispossible to conclude that AE and the two chalconesshowed their anti-metabolic syndrome action, at leastin part, by enhancing adiponectin production.The serum levels of total cholesterol and HDL-

cholesterol in the F-AE group were higher than those inthe F and N groups, while fructose had no influence onthe serum cholesterol level. The results in Fig. 2 lead tothe supposition that the elevated level of serum totalcholesterol was mainly due to an increase in HDL-cholesterol. HDL has a role to transport peripheralcholesterol to the liver, and a low level of serum HDL isa major risk factor of CVD. The genetic analysis showsthat AE enhanced the expression of the genes related toHDL production, Apo-A1 and ABCA1. Apo-A1 is amajor component of HDL and ABCA1 is an HDLtransporter in the liver. Ogawa et al. have reported thatan ethyl acetate extract of A. keiskei increased the levelsof serum total cholesterol and HDL-cholesterol inspontaneously hypertensive rat.39) According to theirreport, the serum Apo-A1 and Apo-E levels wereincreased by treating with the extract of A. keiskei.Although the detailed mechanism of action is stillunclear, these findings indicate that AE possiblyenhanced reverse cholesterol transport by increasingHDL production in the liver.In conclusion, AE improved insulin resistance and

hypertriglyceridemia in fructose-drinking rats whichwere used as the metabolic syndrome model. Thegenetic analysis showed that AE enhanced the expres-

Table 3. Effect of AE on the Hepatic mRNA Expression in Fructose-Drinking Rats

N F F-AE

ACO1 1:00� 0:05 0:519� 0:038��� 1:02� 0:05###

MCAD 1:00� 0:08 0:319� 0:033��� 0:764� 0:035��;###

PPAR-� 1:00� 0:15 0:745� 0:090 0:937� 0:118CPT-1 1:00� 0:11 0:828� 0:092 1:12� 0:08#

Apo-A1 1:00� 0:08 0:570� 0:080��� 0:837� 0:068#

ABCA1 1:00� 0:03 0:839� 0:054� 0:998� 0:044#

LDLR 1:00� 0:07 0:887� 0:065 1:02� 0:03

mRNA was isolated from the liver after 11 weeks of feeding. The mRNA

levels were analyzed by real-time RT-PCR and normalized to �-actin. The

gene expression levels are indicated as relative values compared to those of

the Normal group (N).

Data are shown as the mean� SEM (n ¼ 8).�p < 0:05, �� p < 0:01, ��� p < 0:001 (vs. the N group)#p < 0:05, ### p < 0:001 (vs. the F group)

Angelica keiskei Extract Improves Insulin Resistance 931

sion of the genes related to fatty acid �-oxidation andHDL production in the liver. Although further studiesare needed to clarify these effects, A. keiskei and itschalcones would be useful for preventing the metabolicsyndrome.

Acknowledgment

We thank Y. Hirota, K. Ishihara and H. Nakahara fortheir expert technical assistance.

References

1) Lann D, Gallagher E, and Leroith D, Minerva Med., 99, 253–

262 (2008).

2) Reddy KJ, Singh M, Bangit JR, and Batsell RR, J. Cardiovasc.

Med., 11, 633–647 (2010).

3) Hou Z, Zhang Z, and Wu H, Diabetes Res. Clin. Pract., 68,

3–11 (2005).

4) Hsu JH, Wu YC, Liu IM, and Cheng JT, J. Ethnopharmacol.,

112, 577–584 (2007).

5) Liu IM, Tzeng TF, and Liou SS, Phytother. Res., 24, 233–239

(2010).

6) Jin X, Amitani K, Zamami Y, Takatori S, Hobara N, Kawamura

N, Hirata T, Wada A, Kitamura Y, and Kawasaki H,

J. Ethnopharmacol., 128, 672–678 (2010).

7) Kannappan S and Anuradha CV, Indian J. Med. Res., 129, 401–

408 (2009).

8) Shih CC, Lin CH, Lin WL, and Wu JB, J. Ethnopharmacol.,

123, 82–90 (2009).

9) Hininger-Favier I, Benaraba R, Coves S, Anderson RA, and

Roussel AM, J. Am. Coll. Nutr., 28, 355–361 (2009).

10) Vazquez-Prieto MA, Renna NF, Diez ER, Cacciamani V,

Lembo C, and Miatello RM, Am. J. Hypertens., 24, 234–240

(2011).

11) Kozawa M, Morita N, Baba K, and Hata K, Yakugaku Zasshi

(in Japanese), 98, 210–214 (1978).

12) Baba K, Nakata K, Taniguchi M, Kido T, and Kozawa M,

Phytochemistry, 29, 3907–3910 (1990).

13) Nakata K, Taniguchi M, and Baba K, Nat. Med., 53, 329–332

(1999).

14) Akihisa T, Tokuda H, Ukiya M, Iizuka M, Schneider S,

Ogasawara K, Mukainaka T, Iwatsuki K, Suzuki T, and Nishino

H, Cancer Lett., 201, 133–137 (2003).

15) Aoki N, Muko M, Ohta E, and Ohta S, J. Nat. Prod., 71, 1308–

1310 (2008).

16) Okuyama T, Takata M, Takayasu J, Hasegawa T, Tokuda H,

NishinoA, Nishino H, and Iwashima A, Planta Med., 57, 242–

246 (1991).

17) Kimura Y and Baba K, Int. J. Cancer, 106, 429–437 (2003).

18) Kimura Y, Taniguchi M, and Baba K, Planta Med., 70, 211–219

(2004).

19) Inamori Y, Baba K, Tsujibo H, Taniguchi M, Nakata K, and

Kozawa M, Chem. Pharm. Bull., 39, 1604–1605 (1991).

20) Murakami S, Kijima H, Isobe Y, Muramatsu M, Aihara H,

Otomo S, Baba K, and Kozawa M, J. Pharm. Pharmacol., 42,

723–726 (1990).

21) Matsuura M, Kimura Y, Nakata K, Baba K, and Okuda H,

Planta Med., 67, 230–235 (2001).

22) Enoki T, Ohnogi H, Nagamine K, Kudo Y, Sugiyama K, Tanabe

M, Kobayashi E, Sagawa H, and Kato I, J. Agric. Food Chem.,

55, 6013–6017 (2007).

23) Enoki T, Ohnogi H, Kobayashi E, and Sagawa H, Nippon

Shokuhin Kagaku Kogaku Kaishi (in Japanese), 57, 456–463

(2010).

24) Kawabata K, Sawada K, Ikeda K, Fukuda I, Kawasaki K,

Yamamoto N, and Ashida H,Mol. Nutr. Food Res., 55, 467–475

(2010).

25) Ogawa H, Okada Y, Kamisako T, and Baba K, Clin. Exp.

Pharmacol. Physiol., 34, 238–243 (2007).

26) Ogawa H, Ohno M, and Baba K, Clin. Exp. Pharmacol.

Physiol., 32, 19–23 (2005).

27) Dekker MJ, Su Q, Baker C, Rutledge AC, and Adeli K, Am. J.

Physiol. Endocrinol. Metab., 299, 685–694 (2010).

28) Tran LT, Yuen VG, and McNeill JH, Mol. Cell. Biochem., 332,

145–159 (2009).

29) Matsuzawa Y, Funahashi T, Kihara S, and Shimomura I,

Arterioscler. Thromb. Vasc. Biol., 24, 29–33 (2004).

30) Kadowaki T and Yamauchi T, Endocr. Rev., 26, 439–451 (2005).

31) Kadowaki T, Yamauchi T, Kubota N, Hara K, Ueki K, and Tobe

K, J. Clin. Invest., 116, 1784–1792 (2006).

32) Tonelli J, Li W, Kishore P, Pajvani UB, Kwon E, Weaver C,

Scherer PE, and Hawkins M, Diabetes, 53, 1621–1629 (2004).

33) Tsuchiya K, Akaza I, Yoshimoto T, and Hirata Y, Endocr. J.,

56, 691–698 (2009).

34) Yang B, Brown KK, Chen L, Carrick KM, Clifton LG, McNulty

JA, Winegar DA, Strum JC, Stimpson SA, and Pahel GL, BMC

Pharmacol., 4, 23 (2004).

35) Ohsumi J, Sakakibara S, Yamaguchi J, Miyadai K, Yoshioka S,

Fujiwara T, Horikoshi H, and Serizawa N, Endocrinology, 135,

2279–2282 (1994).

36) Yamauchi T, Kamon J, Waki H, Murakami K, Motojima K,

Komeda K, Ide T, Kubota N, Terauchi Y, Tobe K, Miki H,

Tsuchida A, Akanuma Y, Nagai R, Kimura S, and Kadowaki T,

J. Biol. Chem., 276, 41245–41254 (2001).

37) Okuno A, Tamemoto H, Tobe K, Ueki K, Mori Y, Iwamoto K,

Umesono K, Akanuma K, Fujiwara T, Horikoshi H, Yazaki Y,

and Kadowaki T, J. Clin. Invest., 101, 1354–1361 (1998).

38) Ohnogi H, Enoki T, Hino F, and Kato I, Jpn. Pharmacol. Ther.

(in Japanese), 35, 647–660 (2007).

39) Ogawa H, Nakashima S, and Baba K, Clin. Exp. Pharmacol.

Physiol., 30, 284–288 (2003).

932 H. OHNOGI et al.