analysis of yolk cell microtubule network dynamics …...ii analysis of yolk cell microtubule...
TRANSCRIPT
Analysis of Yolk Cell Microtubule Network Dynamics and Organization during Zebrafish Epiboly
by
Koeun Bae
A thesis submitted in conformity with the requirements for the degree of Master of Science
Department of Cell & Systems Biology University of Toronto
© Copyright by Koeun Bae 2015
ii
Analysis of Yolk Cell Microtubule Network Dynamics and
Organization during Zebrafish Epiboly
Koeun Bae
Master of Science
Department of Cell & Systems Biology University of Toronto
2015
Abstract
Epiboly, the first morphogenetic event in zebrafish development, is a coordinated process of the
blastoderm and yolk syncytial layer spreading over the yolk cell. In the yolk cell, microtubule
arrays extend longitudinally and their dynamics have been suggested to be important for normal
epiboly. Despite these findings, the function of the yolk cell microtubules remains unclear. Live
imaging of EB3-GFP, a microtubule plus-end tracking protein, revealed a change from active
microtubule growth during early epiboly to a non-growing state during late epiboly. Antibody
staining for tyrosinated and detyrosinated tubulin, markers of dynamic and stabilized
microtubules respectively, revealed the presence of stable microtubules during late epiboly but
not during early epiboly. The yolk microtubule network also appeared to be more resistant to the
microtubule depolymerizing agent nocodazole at late epiboly stages. My work reveals, for the
first time, changes in yolk microtubule dynamics that suggest they play different roles
throughout epiboly.
iii
Acknowledgments First and foremost, I would like to express my sincere gratitude to my graduate supervisor Dr.
Ashley Bruce for her support throughout my graduate studies. Thank you for giving me this
opportunity to pursue my interest in developmental biology and scientific research. I had limited
knowledge and skills when I started in the lab two years ago, but you were always available to
give me guidance. You helped me build my confidence and taught me to persevere. I recognize
that my graduate research would have not been possible without your encouragement,
understanding, and kindness. This thesis also could have not been possible without your
expertise and patient guidance.
I would like to thank my graduate advisory committee members, Dr. Tony Harris and Dr. Rudolf
Winklbauer, for their vast knowledge and assistance of my research project. Thank you Tony for
providing me direction and support with imaging and FRAP analyses. I also thank Rudi for
constantly challenging me with ideas and inspiring me to think with a different perspective.
I would like to thank Dr. Brian Ciruna as well for taking his time to serve as external committee
member. Thanks also goes out to Zhonghui Fei for generating the tuba8l fish line, Dr. Vince
Tropepe for sharing reagents, and Dr. Akhmanova for the Camsap constructs. My research
would have not been possible without your help.
A special thanks goes out to all the past and present members of Ramsay Wright 5th and 6th floor,
Cell & Systems Biology imaging facility, and administration staff. I would also like to thank all
the members to Bruce and Tropepe Lab, particularly Molly Allen and Natalie Sorfazlian for their
amazing friendship. You really made my graduate experience enjoyable and thank you for all
your moral support. I also thank Junior West for answering FRAP SOS calls promptly and
always helping me out in time of need.
Finally, to my family and all my friends, I am very grateful for all the unconditional support and
love provided to me throughout my graduate studies. Thank you for always being there for me at
times I needed you most.
iv
Table of Contents Acknowledgments .......................................................................................................................... iii
Table of Contents ........................................................................................................................... iv
List of Abbreviations .................................................................................................................... vii
List of Figures ................................................................................................................................ ix
List of Appendices ......................................................................................................................... xi
Chapter 1 Introduction .................................................................................................................... 1
1 Epiboly in zebrafish ................................................................................................................... 1
1.1 Zebrafish anatomy .............................................................................................................. 2
1.2 Epiboly movement of zebrafish: initiation and progression ............................................... 3
1.3 Mechanism of epiboly ......................................................................................................... 7
1.3.1 Epiboly of EVL ....................................................................................................... 7
1.3.2 Epiboly of deep cells ............................................................................................... 8
1.3.3 Epiboly of YSL ....................................................................................................... 9
2 Current view: the yolk cell as the driver of epiboly ................................................................. 14
3 Microtubules ............................................................................................................................ 16
3.1 Overview ........................................................................................................................... 16
3.2 Known models of microtubule organization ..................................................................... 21
3.3 Known mechanisms of nuclei movement by microtubules .............................................. 23
4 Objective .................................................................................................................................. 25
Chapter 2 Results .......................................................................................................................... 27
1 Characterization of the YCL microtubule network dynamics during epiboly ......................... 27
1.1 Overview of YCL microtubule dynamic changes during late epiboly ............................. 30
1.2 YCL microtubules appear to be more stable at later epiboly stages ................................. 33
1.3 E-YSN appears to be pulled vegetally by stabilized microtubules during late epiboly .... 40
v
2 Characterization of the YCL microtubule network organization during epiboly .................... 47
2.1 Overview of longitudinal YCL microtubule networks ..................................................... 47
2.2 Various approaches to visualize microtubule structure within the YCL microtubule network ............................................................................................................................. 52
2.3 Microtubule fragments are observed during early cleavage stages .................................. 54
2.4 Microtubule severing protein Katanin appears present in and near the e-YSL ................ 57
2.5 Investigating other noncentrosomal minus-end microtubule markers .............................. 60
2.6 Movement towards the blastoderm ................................................................................... 61
Chapter 3 Discussion .................................................................................................................... 65
1 A change in YCL microtubule dynamics from early to late epiboly stages ............................ 68
2 The mechanism of e-YSN movement by microtubules ........................................................... 73
3 Implications of the growing ends of the YCL microtubule network models ........................... 77
3.1 Future directions ............................................................................................................... 81
4 Conclusions .............................................................................................................................. 83
Chapter 4 Materials and Methods ................................................................................................. 85
1 Zebrafish embryo collection and maintenance ........................................................................ 85
2 Fish strains ............................................................................................................................... 85
3 PCR genotyping of eGFP-tuba8l transgenic strain ................................................................. 86
4 Whole-mount immunohistochemistry ...................................................................................... 86
5 Fusion constructs and capped RNA synthesis ......................................................................... 88
5.1 Construction of EB3-TagRFPT and EB3-mCitrine expression vectors ........................... 88
5.2 Construction of Kif5Bb-pGEM and Dync1i2a-pGEM expression vectors ...................... 88
5.3 Construction of Katna1-eGFP and Katna1-TagRFPT expression vectors ....................... 89
5.4 Construction of mVenus-camsap1 expression vector and eGFP-camsap2 template ........ 89
6 Microinjection .......................................................................................................................... 90
7 Microscopy ............................................................................................................................... 91
vi
8 Image processing ...................................................................................................................... 91
9 FRAP and FRAP analyses ....................................................................................................... 92
10 Nocodazole treatment ............................................................................................................... 93
References ..................................................................................................................................... 94
Appendix I – Supplementary figures .......................................................................................... 108
Appendix II - Supplementary tables ........................................................................................... 114
1 PCR primer sequences ........................................................................................................... 114
2 Rating of different methodologies for yolk antibody staining ............................................... 116
3 FRAP half time values ........................................................................................................... 117
4 Raw data for FRAP analysis .................................................................................................. 118
4.1 Late epiboly .................................................................................................................... 118
4.2 Early epiboly ................................................................................................................... 124
5 Persistence .............................................................................................................................. 128
Appendix III - Supplementary movie captions ........................................................................... 129
vii
List of Abbreviations α alpha
γ gamma
β beta
EVL enveloping layer
i/e-YSL internal/ external yolk syncytial layer
YCL yolk cytoplasmic layer
i/e-YSN internal/ external yolk syncytial nuclei
hpf hour post fertilization
MAP microtubule associated protein
MTOC microtubule organizing center
UV ultraviolet
A-V animal-vegetal
Cldn E Claudin E
Cdh 1 epithelial cadherin 1
EpCAM epithelial cell adhesion molecule
ERM Ezrin-radixin-moesin
Eomesa eomesodermin a
MZspg maternal zygotic spiel ohne grenzen
MZeomesa maternal zygotic eomesa
cyp11a1 Cytochrome p450 subfamily XIA polypeptide I
CLIP-170 plus-end binding cytoplasmic linker protein-170
F-actin filamentous actin
Tnika TRAF2 and NCK interacting kinase a
MLCK myosin light chain kinase
viii
GTP guanine triphosphate
GDP guanosine diphosphate
γTuRC γ-tubulin ring complex
CAMSAPs calmodulin-regulated spectrin associated protein
+TIPs plus-end tracking proteins
EB end-binding protein
APC adenomatous polyposis coli
PTM post-translational modifications of tubulin
LINC liner of nucleoskeleton and cytoskeleton
FRAP fluorescent recovery after photobleaching
tuba8l tubulin alpha 8 like
dclk2 double-cortin like kinase 2
FRET fluorescence resonance energy transfer
Katna1 katanin p60 subunit α1
ROI region of interest
ix
List of Figures
Figure 1. Stages of zebrafish epiboly 5
Figure 2. Schematic of the zebrafish embryo and yolk cell anatomy 6
Figure 3. Yolk as epiboly driver via shortening of longitudinal microtubules in the YCL 15
Figure 4. An overview of yolk microtubule network during epiboly 28
Figure 5. A widespread microtubule polymerization until 60% epiboly stage 29
Figure 6. An overview of the YCL microtubule dynamic change during late epiboly 31
Figure 7. Yolk microtubules appear lateral to the blastoderm-yolk margin during late epiboly 32
Figure 8. Tyrosinated-tubulin present in yolk cell at early, but not late epiboly 36
Figure 9. Detyrosinated-tubulin present in yolk cell at late, but not early epiboly 37
Figure 10. YCL microtubules appears to be less susceptible to nocodazole at later epiboly stages
38
Figure 11. Comparing half-time of fluorescence recovery (T ½) between early and late epiboly
FRAP experiments 39
Figure 12. An overview of e-YSN movement during late epiboly 43
Figure 13. e-YSN appears to be pulled vegetally by stabilized microtubules during late epiboly
44
x
Figure 14. 3D morphology of e-YSN and associated microtubules 45
Figure 15. Microtubules extending from e-YSN appear stabilized 46
Figure 16. 3D morphology of the longitudinal microtubule networks in the YCL 50
Figure 17. γ-tubulin appears confined to the blastoderm and e-YSL in the yolk cell 51
Figure 18. Microtubule fragments observed during repeated cycles of YCL network disassembly
and reassembly at early cleavage stages 56
Figure 19. Microtubule severing protein katanin appears present in and adjacent to the e-YSL 59
Figure 20. Centrin-GFP movement towards the blastoderm 64
Figure 21. Schematic view of microtubule dynamic change during epiboly 67
Figure 22. Schematic views of the potential mechanism of e-YSN movement 76
Figure 23. Schematic views of the potential models of YCL microtubule organization 80
xi
List of Appendices
Appendix I. Supplementary figures 108
Appendix II. Supplementary tables 114
Appendix III. Supplementary movie captions 129
1
Chapter 1
Introduction
During early embryonic development, cells rearrange and organize into three germ layers to
establish the basic body plan of an organism. This fundamental evolutionarily conserved process
during animal development, known as gastrulation, involves four basic morphogenetic
movements: emboly, epiboly, convergence and extension (reviewed in Solnica-Krezel, 2005).
This thesis focuses on epiboly, which is defined as a process of thinning and spreading of single
or multilayered cell sheet (reviewed in Lepage and Bruce, 2010). Epiboly is a widely used cell
movement throughout animal development. Yet, it is unclear whether or not there are unifying
mechanisms underlying epiboly across species (Solnica-Krezel and Sepich, 2012). In this thesis,
I focus on one potential mechanism, pulling forces generated by microtubules, using zebrafish
(Danio rerio) embryos as a modeled organism.
1 Epiboly in zebrafish
Epiboly was described first in teleost fish Cyprinus in 1835 (reviewed in Betchaku and Trinkaus,
1978) and earlier studies of the teleost Fundulus heteroclitus set the groundwork for zebrafish
epiboly due to the similarities between the two species (Betchaku and Trinkaus, 1978). Zebrafish
embryos have advantageous properties for developmental studies and serve as an excellent
model organism to study epiboly. Embryos are large in size, transparent, and develop externally.
Most importantly, epiboly initiation is isolated from other morphogenetic movements and many
genetic and molecular tools are available. In the following section, the architecture of zebrafish
2
embryo will be introduced and mechanisms involved in epiboly movements specified by embryo
region will be discussed.
1.1 Zebrafish anatomy
As the oocyte matures during oogenesis, animal-vegetal polarity is established (Langdon and
Mullins, 2011). Upon fertilization, yolk cytoplasm streams toward the animal pole to form a
single cell blastodisc on top of a large yolk cell (Kimmel et al, 1995). This single cell undergoes
cleavage divisions every 15 minutes for a total of 10 cleavage cycles, to become a multilayered
blastoderm that consist of deep cells and single cell thick epithelial enveloping layer (EVL)
(Kimmel et al, 1995). The blastoderm eventually gives rise to all embryonic tissues (Warga and
Kimmel, 1990; Kimmel et al, 1995). The marginal blastomeres at the blastoderm-yolk cell
interface undergo incomplete cytokinesis and remain cytoplasmically connected to the yolk cell
(Kimmel et al, 1995). At the 512-cell stage, 2.75 hours post-fertilization (hpf), the marginal
blastomeres release their nuclei and cytoplasm into the yolk to form the yolk syncytial layer
(YSL). The yolk syncytial nuclei (YSN), nuclei in the YSL, undergo 3 to 5 cycles of
synchronous mitotic division and stop dividing at sphere stage (Kane et al, 1992).
By sphere stage (4hpf), the zebrafish embryo has three main regions: EVL, deep cells, and yolk
cell (Fig. 2). The yolk cell is comprised of YSL, yolk cytoplasmic layer (YCL), and inner yolk
mass (Kimmel et al, 1995). The YSL, located in the interface between the yolk and deep cells, is
divided into the external YSL (e-YSL) and internal YSL (i-YSL) (Kimmel and Law, 1985). The
e-YSL is populated with a thick band of external yolk syncytial nuclei (e-YSN) in the superficial
yolk layer. A population of internal yolk syncytial nuclei (i-YSN) are found in i-YSL below the
blastoderm. These YSNs actively transcribe RNA (Kimmel and Law, 1985). The YCL is a thin
3
layer of cytoplasm surrounding the inner yolk mass and is continuous with the e-YSL (Solnica-
Krezel and Driever, 1994). Within the YCL, longitudinal microtubule arrays are oriented along
the animal-vegetal (A-V) axis, with the minus-ends (-) at e-YSL and the plus-ends (+) extended
towards the vegetal pole (Solnica-Krezel and Driever, 1994). These yolk microtubules have been
implicated in epiboly by previous studies which will be further discussed below.
1.2 Epiboly movement of zebrafish: initiation and progression
Epiboly in zebrafish is a two phase process; initiation and progression (Fig. 1) (reviewed in
Lepage and Bruce, 2010). All three regions of the embryo, the EVL, deep cells, and YSL,
undergo epiboly beginning at sphere stage (4hpf) (Fig. 2). During initiation (4 to 4.3 hpf),
doming of the yolk cell takes place rapidly and the contact area increases between blastoderm
and i-YSL interface as the yolk cell bulges upward. The overlying deep cells in the blastoderm
intercalate, forming an inverted cup over the yolk cell (Kimmel et al, 1995; Warga and Kimmel,
1990) (Fig. 1a-b). Despite the well-characterized events highlighting epiboly initiation, the
mechanism of the yolk cell doming is not understood.
During epiboly progression (5.25 to 10 hpf), the overlying blastoderm and e-YSL continue to
thin and spread vegetally over the yolk cell (Kimmel et al, 1995) (Fig. 1c-f). As epiboly
progresses, other morphogenetic movements such as involution, convergence, and extension also
occur. Specifically, involution begins at 50% epiboly (5.3hpf) and a germ ring that consist of an
outer epiblast (containing ectodermal precursors) and an inner hypoblast (containing
mesendoderm precursors) forms. At this stage, epiboly temporarily stops and continues again
after the shield (dorsal organizer) is formed (Kimmel et al, 1995). Epiboly is complete at bud
stage (10hpf) when the blastopore closes at the vegetal pole (Kimmel et al, 1995). Although
4
epiboly initiation and progression appears tightly coordinated, work from our lab and others
revealed that these phases are genetically separable (Kane et al, 1996; Du et al, 2012)
Figure 1. Stages of zebrafish epiboly. DIC images of a zebrafish embryo undergoingepiboly. (A-B) Initiation phase of epiboly with yolk cell doming into the blastoderm. (C-F) Progression phase of epiboly with blastoderm spreading over the yolk towardsvegetal pole. Orientation of embryo: animal pole up. Abbreviation: hpf, hour postfertilization.
5
Figure 2. Schematic of the zebrafish embryo and yolk cell anatomy. Anatomy ofembryo at sphere stage (4 hpf). A) Schematic of a sphere stage embryo with differentcomponents of the embryo (lateral view). B) Schematic of a sphere stage embryowith different components of the yolk cell (cross section view). Orientation ofembryo: animal pole up. Abbreviations: EVL, enveloping layer; I-YSN, internal-yolksyncytial nuclei; E-YSN, external-yolk syncytial nuclei; YSL, yolk syncytial layer; YCL,yolk cytoplasmic layer.
6
7
1.3 Mechanism of epiboly
Several research groups have identified various mechanisms underlying epibolic movements in
zebrafish. Although it is uncertain whether or not they are the active drivers of epiboly, these
factors are important for epiboly to proceed normally. In this section, I will briefly discuss these
mechanisms for each of the three embryonic regions that undergo epiboly movements: the EVL,
deep cells, and YSL.
1.3.1 Epiboly of EVL
The EVL establishes a permeability barrier and maintaining its integrity is important during
epiboly. Work on Fundulus suggested that EVL is passively pulled vegetally by its attachment to
the e-YSL via tight junctions and thus unlikely to undergo active migration during epiboly
(Betchaku and Trinkaus, 1978). Additionally in the zebrafish embryo, disrupting the tight
junction component Claudin E (Cldn E) resulted in epiboly delay, hence tight junction
attachment at EVL-YSL interface was also shown to be important in zebrafish (Siddiqui et al,
2010).
During EVL spreading, it is crucial to maintain EVL integrity. Proper adhesion between EVL
cells is essential to enable EVL spreading and cell elongation (Fukazawa et al, 2010; Sabel et al,
2009; Siddiqui et al, 2010; Carreira-Barbosa et al, 2009; Pei et al, 2007). In zebrafish, epithelial
cadherin 1 (Cdh1) and its role in epiboly have been studied by several groups. Maternally
deposited Cdh1 protein is strongly localized to the EVL (Babb et al, 2001; Babb and Marrs,
2004; Kane et al, 2005; Montero et al, 2005). Work from several groups indicated that maternal
and zygotic Cdh1 are required in EVL for deep cell epiboly to proceed normally (Shimizu et al,
8
2005; Slanchev et al, 2009). In embryos in which Cdh1 function is disrupted, epiboly delay is
confined to the deep cells (Babb and Marrs, 2004; Shimizu et al, 2005; Kane and Adams, 2002)
and the role of Cdh1 in deep cell is described below. Furthermore, the epithelial cell adhesion
molecule (EpCAM) was also reported to be important for maintaining EVL integrity and EVL-
deep cell adhesion during epiboly (Slanchev et al, 2009).
A recent report suggested that cell division orientation may have a role in EVL spreading
(Campinho et al, 2013). Coinciding with the EVL spreading vegetally along A-V axis, EVL cells
divide along the A-V axis between sphere and 55% epiboly. After 55 % epiboly, EVL cell
division is reduced (Campinho et al, 2013). The authors proposed that EVL cell division releases
tension along A-V axis which enables EVL spreading (Campinho et al, 2013). There also are
reports of actin protrusions on the marginal EVL cells in zebrafish. Several studies proposed that
they are present predominantly at early epiboly stages to facilitate active EVL migration via
migratory cues towards the vegetal pole (Cheng et al, 2004; Zalik et al, 1999). It remains
uncertain whether they are involved in active EVL migration. Despite this uncertainty, the
presence of actin protrusion and increased EVL cell division along A-V axis during early epiboly
stages suggest that there may be differential regulation of epiboly from early to late stages.
Overall, these findings demonstrate that EVL integrity is essential for normal epiboly and
suggest that actin protrusions and cell division orientation may have roles in EVL epiboly.
1.3.2 Epiboly of deep cells
For the blastoderm to thin during epiboly, the deep cells rearrange by cell intercalation (Warga
and Kimmel, 1990; Bensch et al, 2013). Deep cells are motile once zygotic transcription is
9
initiated (Kane et al, 1992) and deep cell movement was previously suggested to have a passive
role during epiboly (Wilson et al, 1995).
As mentioned above, Cdh1 plays an important role in epiboly and recent studies suggest that
Cdh1 trafficking is also important. A significant deep cell epiboly delay was observed in
maternal zygotic spiel ohne grenzen (MZspg) embryos which are mutant for the transcription
factor pou5f3 (previously called pou5f1) (Lachnit et al, 2008). Although the deep cell defects
appeared to be related to reduced cell adhesion, Cdh1 transcript and protein levels in the mutants
embryos were comparable to wild type embryos (Lachnit et al, 2008; Reim et al, 2006). Work
from Song and colleagues showed that Cdh1 is enriched at the deep cell membrane in MZspg
mutant embryos and greatly reduced in intracellular puncta, suggesting that Cdh1 trafficking is
impaired. The authors proposed that Pou5f3 may regulate Cdh1 trafficking by controlling the
localization of p120 which stabilizes the Cdh1-catenin complex at the membrane (Song et al,
2013). Furthermore, the authors suggested that MZspg mutants have a Cdh1 trafficking defect
due to defective EGF signaling (Song et al, 2013). They showed that EGF is a likely
transcriptional target of Pou5f3 and it is downregulated in MZspg mutant embryos. Thus, they
proposed that reduced Cdh1 trafficking results in reduced deep cell adhesion in MZspg mutant
embryos. Deep cells in mutants are unable to intercalate effectively to allow blastoderm epiboly
to proceed. In summary, the deep cells rearrange via intercalation passively over the yolk cell
and Cdh1 is indispensable during epiboly, recent findings suggest that the Cdh1 trafficking via
EGF and other Pou5f3 targets may be a potential underlying mechanism for deep cell epiboly.
1.3.3 Epiboly of YSL
In zebrafish embryo, YSL epibolic movement is a unique process whereby a syncytium spreads
vegetally. The i-YSL expands to cover the surface of the yolk and shifts the e-YSL vegetally
10
(Kimmel et al, 1995) while the YCL is reduced (Cheng et al, 2004). Although the mechanism of
yolk cell doming/ i-YSL expansion is unclear, many factors from the yolk cell have been
considered as active drivers of epiboly. Yolk cell factors implicated in epiboly will be discussed
below including; cytoskeletal networks, calcium wave propagation, and endocytosis.
The longitudinal microtubule networks in the YCL have been proposed to drive e-YSL epiboly
by exerting a pulling force as these microtubules shorten throughout epiboly (Strahle and
Jesuthasan, 1993; Solnica-Krezel and Driever, 1994). Two early studies investigated the effect
on epiboly caused by microtubule depolymerizing and stabilizing agents. In the first study,
Strahle and Jesuthasan depolymerized microtubules using UV light and nocodazole (a
microtubule polymerization blocking agent) and they observed a delay in epiboly initiation and
progression (Strahle and Jesuthasan, 1993). In a second study, Solnica-Krezel and Driever
treated embryos with nocodazole and observed YSN epiboly delay. They suggested that the
longitudinal YCL microtubule network facilitated the epibolic movement of the e-YSN because
elongated e-YSN were surrounded by microtubule baskets associated with the YCL microtubule
network. They also observed partial epiboly progression delay of the blastoderm (Solnica-Krezel
and Driever, 1994). This analysis was further supported by treating embryos with taxol to
stabilize the microtubules which resulted in epiboly arrest, suggesting that the stabilized
microtubule networks were unable to shorten in the YCL and drive epiboly. These studies
showed that yolk microtubule dynamics are critical for normal epiboly.
Hsu and colleagues also demonstrated the importance of the yolk cell microtubule network in
epiboly. The cyp11a1 (Cytochrome p450 subfamily XIA polypeptide I) gene that encodes an
enzyme involved in catalyzing cholesterol to pregnenolone is expressed strictly in the YSL
during epiboly (Hsu et al, 2006). Antisense morpholino oligonucleotide experiments to reduce
11
the expression of Cyp11a1 resulted in epiboly delay of the blastoderm but YSL epiboly was not
investigated (Hsu et al, 2006). Interestingly, YCL microtubule networks in cyp11a1 morphants
were more susceptible to nocodazole treatment and the microtubule defects were rescued by
pregnenolone. This study suggests that pregnenolone binds to and stabilizes yolk microtubules
thus preventing them from depolymerizing. A recent study further proposed that pregnenolone
also assembles yolk cell microtubules by binding and activating a plus-end binding cytoplasmic
linker protein-170 (CLIP-170) (Weng et al, 2013). CLIP-170 bind to the growing ends and
promote assembly of microtubules. Furthermore, they modulate dynein (Lis1) and its cofactor
dynactin (p150Glued) localization to the plus-end of microtubules, which stabilizes microtubules
(reviewed in Galijart, 2005).
In several studies, yolk microtubule defects have been shown to be present in maternal zygotic
mutant embryos that exhibit epiboly delays. Work in our lab demonstrated that a T-box
transcription factor, Eomesodermin A (Eomesa), is important for epiboly initiation (Du et al,
2012). In maternal zygotic eomesa (MZeomesa) mutants, the yolk microtubule networks
displayed a prominent phenotype at dome stage correlating with a doming delay; including
bundled, broken, and absent networks (Du et al, 2012). Epiboly progression proceeds normally
in MZeomesa mutant embryos and interestingly, the yolk microtubules also recover (Du et al,
2012). Another study implicated Pou5f3 in epiboly. MZspg embryos, as previously mentioned,
exhibit epiboly initiation and progression delays (Lachnit et al, 2008). During epiboly
progression, YCL microtubule networks had a similar phenotype as taxol treated embryos. YCL
regions were devoid of microtubules, suggesting that the expression of microtubule stabilizing
factors may be regulated by Pou5f3. Both Eomesa and Pou5f3 transcriptional factors have been
reported to modulate microtubules dynamics and regulate epiboly. However, it appears likely
that the microtubule network defects are secondary to the epiboly defects in blastoderm since
12
these proteins are only present in the blastoderm and not in YSL during epiboly (Du et al, 2012;
Lippok et al, 2014).
In summary, there is an elaborate longitudinal microtubule array in the yolk cell and many
studies have revealed that microtubule defects coincide with epiboly defects. Although, the yolk
cell is proposed as the active driver of epiboly, the exact role of these yolk microtubules still
remains uncertain. Studying the yolk microtubule arrays in zebrafish embryos, not only gives us
the chance to investigate their role in epiboly, but also provides an excellent model to study
microtubule dynamics and organization in nature.
Actin disruption also results in epiboly progression arrest and yolk cell lysis (Cheng et al, 2004).
By late epiboly stages, three filamentous actin (F-actin) structures appear in marginal EVL, deep
cells, and e-YSL. There is also a F-actin mat in the yolk vegetal cortex, which is thought to
provide structural integrity (Cheng et al, 2004). In the e-YSL, a wide circumferential actomyosin
band begins to form around 40% epiboly and it narrows over the course of epiboly, compacting
into a ring (Cheng et al, 2004; Koppen et al, 2006; Behrnt et al, 2012). Myosin is also recruited
by the TRAF2 and NCK interacting kinase a (Tnika) (Koppen et al, 2006). These findings
suggested that the circumferential actin ring contracts to close the blastopore during epiboly
progression. It is thought that constriction of the actomyosin ring in the e-YSL provides active
motor forces for blastopore closure during epiboly progression and has been dubbed the cable
constriction motor (Cheng et al, 2004; Koppen et al, 2006; Behrndt et al, 2012). Recently it was
shown that in addition to cable constriction motor, the e-YSL actomyosin also functions in a
second motor referred to as the flow-friction (Behrndt et al, 2012). The flow-friction model is
based on the observation that an actomyosin flow in the vegetal to animal direction exists from
40% to 70% epiboly (Behrndt et al, 2012). The actin mat along the vegetal cortex present at early
13
stages is thought to contribute as the source of actin, since it gradually reduces by 95% epiboly.
This upward flow creates friction force, which in turn generate pulling force on the blastoderm.
In addition, this model is geometry independent as the contractile force can be generated as long
as friction is present during epiboly (Behrndt et al, 2012). The authors suggested that one source
of friction that could help drive the motor may result from microtubule flow. An upward
microtubule flow towards the animal pole at a slower rate than actin at 70% epiboly was
observed, suggesting that yolk microtubules may be involved in the flow-friction motor as the
source of friction (Behrndt et al, 2012).
Other work revealed that calcium waves in the YSL are important for epiboly (reviewed in Webb
and Miller, 2006). Recent findings confirm that calcium waves originate in the YSL (Yuen et al,
2013). More specifically, calcium waves were detected starting at dome to 30% epiboly stages in
the dorsal e-YSL region. Yuen and colleagues further reported that calcium waves propagated
when e-YSNs were within 8µm apart and not when the distance was greater, suggesting the e-
YSN spacing is important for maintaining propagation. Other findings disrupting calcium levels
during early epiboly demonstrated a delay in epiboly progression. These calcium waves are
hypothesized to initiate actomyosin ring formation and contraction in the YSL by activating
myosin via calcium/calmodulin dependent MLCK phosphorylation (Geguchadze et al, 2004).
Marginal endocytosis also is reported as one potentially contributing factor to the yolk cell
epiboly motor, particularly during epiboly progression. In the e-YSL, 87% of the external yolk
membrane is removed during epiboly (Cheng et al, 2004) likely via a region of marginal
endocytosis in the e-YSL. This region of endocytosis is thought to generate pulling forces on the
e-YSL (Solnica-Krezel and Driever, 1994). However, there is conflicting data on whether
marginal endocytosis is an active component of the epiboly motor (Lepage et al, 2014).
14
2 Current view: the yolk cell as the driver of epiboly
Many early studies proposed that the yolk cell is the fundamental player in epiboly. In Fundulus,
the YSL undergoes epiboly at an accelerated rate upon removal of the blastoderm from the yolk
cell, suggesting that it is normally responsible for pulling the EVL and deep cells during epiboly
(Betchaku and Trinkaus, 1978; Trinkaus, 1951). Although the role of yolk cell during doming in
epiboly initiation phase remains uncertain, studies propose three potential motors driving epiboly
progression in zebrafish. The shortening of the extensive longitudinal YCL microtubules at the
plus-end near the vegetal pole via depolymerization has been proposed to generate pulling forces
to assist the e-YSL epiboly process (Solnica-Krezel and Driever, 1994; Strahle and Jesuthasan,
1993) (Fig. 3). Marginal endocytosis in the e-YSL also has been proposed as a contributing
factor and is thought to generate pulling forces on the e-YSL via internalization of yolk cell
membrane (Solnica-Krezel and Driever, 1994; Cheng et al, 2004; Betchaku and Trinkaus, 1986).
Lastly, two actomyosin based motors function in the yolk. The flow-friction motor has been
identified to generate frictional force derived from A-V directed actomyosin flow against its
neighbouring structure (Behrndt et al, 2012) and the cable constriction motor drives contraction
of the circumferential actomyosin band at the margin to close the blastopore (Cheng et al, 2004;
Koppen et al, 2006).
The current view proposes that all these factors together generate force to move e-YSL vegetally.
Due to the tight association of the EVL margin and the e-YSL via tight junctions, e-YSL exerts a
pulling force on the blastoderm to tow it towards the vegetal pole. The EVL cells spread in A-V
direction and deep cells undergo passive cell rearrangements in response.
Figure 3. Yolk as epiboly driver via shortening of longitudinal microtubules in theYCL. Anatomy of embryo at sphere stage (4hpf). Model predicts depolymerization ofmicrotubules at the plus end near vegetal pole, resulting in pulling the minus end (e-YSN). The e-YSNs are coloured in brown and green dots represent free tubulinsubunits. Orientation of embryo: animal pole up.
15
16
3 Microtubules
The cytoskeleton plays a key role in regulating cell shape. It consists of several types of
filaments including: actin filaments, intermediate filaments, and microtubules (reviewed in
Mimori-Kiyosue, 2011). In this section, I will focus on microtubules and provide a brief
overview followed by detailed subsections on two main topics of interest: models of microtubule
organization and mechanisms of nuclear movement via microtubules.
3.1 Overview
Microtubules are involved in various biological functions: they facilitate chromosome separation
during mitosis by generating pulling forces, serve as tracks for intracellular transport, establish
polarity, and provide structural support for cilia and flagella. They also play key roles, in tissue
morphogenesis and cell differentiation (Alberts et al, 2008).
An individual microtubule (25 nm in diameter) is a hollow cylindrical tube composed of 11-16
protofilaments. Each protofilament is an assembled polymer made of alpha (α)-tubulin and beta
(β)-tubulin monomer subunits (~50kDa) in heterodimer form. Microtubules are polarized
structures in which α-tubulin is exposed at the minus-end and β-tubulin is exposed at the plus-
end (Alberts et al, 2008; Desai and Mitchison, 1997).
Microtubules are highly dynamic and repeatedly assemble and disassemble. Although
microtubules are known to be stable structures during cell shape change and intravascular
transport, their intrinsic property of “dynamic instability” causes microtubules to switch between
growth and shrinkage states (Desai and Mitchison, 1997). Microtubules are energetically favored
to disassemble (shrink state) rather than stay assembled (growth state). Microtubules assemble
17
from nucleation sites composed of tubulin complex and free tubulin subunits are then added onto
the nucleation site. The additional free tubulin subunits continuously bind onto the polymer,
forming a static polymer (Alberts et al, 2008).
The α-tubulin and β-tubulin monomers share 50% amino acid similarity (Desai and Mitchison,
1997) and they both have guanine triphosphate (GTP) binding site, but only the β-tubulin can
catalyze GTP hydrolysis (Weisenberg et al, 1968; Berry and Shelanski, 1972). The guanine
triphosphate (GTP) bound β-tubulin is hydrolyzed to guanosine diphosphate (GDP) when it is
incorporated into the microtubules lattice (Weisenberg and Deery, 1976). If a new subunit is
added to the polymer before the β-tubulin is hydrolyzed, then a GTP cap is formed that stabilizes
the lattice by keeping its structure straight (Desai and Mitchison, 1997). Hence, the GTP bound
tubulin in microtubule lattices is stable and GDP bound tubulins are likely to dissociate from the
lattice by adding curvature and putting strain on the lattice (Elie-Caille et al, 2007; reviewed in
Howard and Hyman, 2009). The transition between catastrophe and rescue of microtubules
depends on having either a GTP cap or GDP on the plus-end of the polymer (Desai and
Mitchison, 1997).
Much of our understanding of dynamic instability comes from in vitro studies using purified
tubulin (Desai and Mitchison, 1997). In vitro, microtubules polymerize spontaneously in high
concentrations of free α/β-tubulin subunits. Hence, the rate of polymerization depends on the
availability of free tubulin subunits. It was also reported that protofilaments are established first
and then multiple protofilaments, associated laterally, roll into a tube to form a single
microtubule (Desai and Mitchison, 1997). In living cells however, microtubule dynamics are
regulated and nucleated from a specific site; the microtubule organizing center (MTOC) (Alberts
et al, 2008). Centrosomes, an example of MTOC, consist of a pair of centrioles encased in
18
pericentriolar material containing gamma (γ)-tubulin (Alberts et al, 2008). γ-tubulin, a homolog
of α-tubulin and β-tubulin, has been identified as a microtubule nucleator (Alberts et al, 2008;
Kollman et al, 2011). A group of γ-tubulins aggregate into a γ-tubulin ring complex (γTuRC) and
free α/β-tubulin subunits are added to this minus-end complex (Alberts et al, 2008; Kollman et
al, 2011). Microtubules assemble around the ring of γ-TuRC in a spiral manner in vivo as
opposed to the sheet of protofilament rolling into a tube as seen in vitro. Furthermore, the minus-
ends of the microtubules nucleated from MTOCs are capped and do not polymerize from this
end in vivo, whereas both minus-end / plus-ends polymerize during spontaneous microtubule
assembly in vitro (Desai and Mitchison, 1997; Kollman et al, 2011). The minus-end cap also
protects the microtubule lattice from depolymerizing continuously, overcoming its intrinsic
property to disassemble. It is clear from this work that in vitro experiments are not the best
method to reveal the properties of microtubules in living cells.
Microtubules can also be nucleated from non-MTOC locations which are referred to as
noncentrosomal minus-end nucleation sites (reviewed in Bartolini and Gundersen, 2006). For
example, plant cells lack centrosomes, but contain microtubule arrays and cortical microtubules
(Lindeboom et al, 2013). As in animals, γ-tubulin is responsible for nucleating microtubules in
plants (Murata et al, 2005). It appears that γ-tubulin is involved in both noncentrosomal and
centrosomal microtubule nucleation in vivo. Recent studies also demonstrated that calmodulin-
regulated spectrin associated protein (CAMSAPs) regulate microtubule minus-end growth and
decorate noncentrosomal minus-end microtubule stretches. Three CAMSAPs; CAMSAP1, 2,
3/Nezha, exist in mammals and have been reported to have distinct behavior at the microtubule
minus-ends (Jiang et al, 2014; Hendershott & Vale, 2014). Specifically, CAMSAP1 polymerize
minus-end while CAMSAP2 and CAMSAP3 stabilize the minus-ends of microtubules.
19
Various proteins have been identified that interact with microtubules and are referred to as
microtubule associated proteins (MAPs). They are classified into four main groups (reviewed by
Subramanian and Kapoor, 2012): motor proteins, microtubule cross linkers, plus-end trackers
(+TIPs), and microtubule nucleation regulators and severing proteins.
Microtubules play a prominent role in vesicle trafficking. Three major groups of motor proteins
involved in vesicular transport are kinesin, dynein, and myosin. The kinesin and dynein motor
proteins use ATP hydrolysis to move along microtubule tracks (Desai and Mitchison, 1997;
Vale, 2003). Kinesin family members are commonly known to move towards the plus-end of
microtubules, however C-kinesins, that have a motor domain in the carboxy-terminal region,
appear to be minus-end directed (reviewed by Hirokawa et al, 2009). Some kinesin groups
(kinesin-8/13/14) are known to depolymerize microtubules at the plus-end (reviewed in Howard
and Hyman, 2009). Dyneins, on the other hand, are known to be minus-end directed motors
(reviewed by Hirokawa et al, 2009).
Microtubule cross linking proteins have been proposed to stabilize microtubules and cause
microtubule sliding (Peterman and Scholey, 2009). The most commonly known crosslinkers are
the motor proteins: kinesin-5 and kinesin-14, and the non-motor protein Ase1 (Braun et al, 2009;
Braun et al, 2011). The kinesin-5 and 14 motors have been proposed to crosslink anti-parallel
microtubules and slide against one another using their motor function to generate pushing forces.
More specifically, kinesin-5 motors are plus-end directed motors and kinesin-14 is minus-end
directed. In addition to generating pushing forces, Ase1 has also been identified to assemble
during anaphase at the spindle midzone with the kinesin motors (reviewed in Peterman and
Scholey, 2009). These crosslinkers are shown to be important for spindle elongation and
cytokinesis after chromosomes are separated (reviewed in Peterman and Scholey, 2009).
20
Plus-end tracking proteins (+TIPs) are proteins that bind to the growing plus-end of microtubules
and regulate dynamic instability. Many +TIPs have been identified, including end-binding
protein (EBs), CLIP-170 and microtubule-actin crosslinker adenomatous polyposis coli (APC)
and depolymerizing kinesins (kinesin 13 and 8) to name few (reviewed in Howard and Hyman,
2007; Akhmanova and Steinmetz, 2010). A recent study proposed that kinesin-2 (Kif17)
interacts with EB1 and APC at the microtubule plus-end to stabilize microtubules in epithelial
cells (Jaulin and Kreitzer, 2010). Although the mechanism of stabilization remains uncertain, it
has been proposed that Kif17 binds and moves to the plus-end of dynamic microtubules and
interacts with EB1. This interaction promotes Kif17 protein accumulation and its captured at the
membrane cortex. It is suggested that Kif17 may stabilize microtubules by accumulating at plus-
ends and forming bridges between microtubule and cortex (Jaulin and Kreitzer, 2010; Espenel et
al, 2013).
Lastly, microtubule nucleation regulators and microtubule severing proteins are responsible for
controlling microtubule number (Kollman et al, 2011; Roll-Mecak and McNally, 2010). The
commonly known microtubule nucleation regulator is γ-tubulin that was discussed previously.
One microtubule severing protein, Katanin, consists of an enzymatic p60 subunit that severs
microtubules and a non-catalytic p80 subunit that localizes to the centrosome (reviewed in Sharp
and Ross, 2012). FRET studies suggest that six p60 subunits surround the microtubule and break
the lattice by generating torque (Baas et al, 2005). Interestingly, it was recently reported that
Katanin regulates minus-end assembly to drive the noncentrosomal microtubule stabilization
(Jiang et al, 2014).
Although numerous MAPs have been identified, the mechanism for binding selectively to
microtubules in vivo is unclear. It has been proposed that post-translational modifications of
21
tubulin (PTMs) provide a potential recognition site to recruit MAPs (Janke and Bulinski, 2011).
Although there are many PTMs for α- and β-tubulins, detyrosinated and tyrosinated tubulin that
are unique tubulin modifications that will be discussed here. Tyrosinated-tubulin refers to the
tyrosine residue that can be reversibly added to the C-terminus of α-tubulin (Gundersen et al,
1984). When the tyrosine is removed, it exposes a glutamate residue and the tubulin polymer
becomes detyrosinated (Janke and Bulinski, 2011; Wloga and Gaertig, 2010). Detyrosination
results in decreased microtubule depolymerization via kinesin-13 (Peris et al, 2009).
Tyrosinated-tubulin is a known marker for dynamic microtubules, whereas detyrosinated-tubulin
is used as a marker for stabilized microtubules (Westermann and Weber, 2003).
3.2 Known models of microtubule organization
In nature, microtubules are complex structures in accordance with their physiological role. Their
structures are dependent on intrinsic properties and extrinsic environmental cues (reviewed in
Vignaud et al, 2012). Since their formation is not spontaneous, understanding microtubule
organization can provide insight into the mechanism underlying their organization (reviewed in
Vignaud et al, 2012).
Microtubule organization at its simplest is in a single cell without any contact from other
neighbouring cells. Microtubules typically have the minus-ends at the cell center where MTOC
and minus-end associated organelles (e.g. nucleus and golgi network) are located. The plus-ends
of the microtubules orient radially outwards to the cell periphery (reviewed in Mimori-kiyosue,
2011). This is the standard model in that centrosomes nucleate microtubules and cap the minus-
end, while plus-ends continuously elongate by GTP addition (Bergen et al, 1980; Brinkley et al,
1985). Due to intrinsic dynamic instability, microtubules probe or search the cell space until they
22
are captured by factors such as organelles, proteins, or the cell cortex. It has been proposed that
specific subsets of microtubules are stabilized by either stabilizing factors or by attachment of
the plus-end to the cell cortex via motor proteins (Kirschner and Mitchison, 1986).
In more complex systems, microtubules are rearranged into more complex organization. In
nature, long microtubule structures, such as those found in neuronal projections, are organized in
overlapping short fragments (Conde and Caceres, 2009) as proposed by the “cut and run” model
(Baas et al, 2005). The cut and run model proposes that a microtubule severing protein (katanin),
located in the cell bodies of neurons, where microtubules are nucleated from MTOCs, severs
newly nucleated microtubules into fragments (Baas et al, 2005). The severed microtubule
fragments are unable to elongate and are transported down the bundles in the axon by motor
proteins and then incorporated into the microtubule bundles by MAPs (Baas et al 2005, Baas et
al 2006). Once incorporated, they are able to elongate as indicated by the observation of plus-end
trafficking proteins (+TIPs) distributed throughout neuronal projections (Baas et al, 2005).
Nucleation also has been proposed to occur from the side of existing microtubules or from golgi
membranes within the aster producing branched microtubules (Pollard and Borisy, 2003; Efimov
et al, 2007; Rivero et al, 2009). There is precedent for this in other systems such as plant cells
and fission yeast (Schizosaccharomyces pombe) (Murata et al, 2005; Chan et al, 2009; Kirik et
al, 2012). In plant cells, microtubule arrays nucleate from noncentrosomal γ-tubulin and it has
been found that cytosolic γ- tubulin is recruited to cortical microtubules to allow new
microtubule nucleation as a branch off of the cortical microtubules (Murata et al., 2005). Recent
work on large microtubule asters in the interphase egg cytoplasm of Xenopus proposed that the
centrosome initiates microtubule growth and these pre-existing microtubules stimulate branched
microtubule nucleation, maintaining further growth. Similarly, the branched model may explain
23
the organization of longitudinal microtubule networks in the zebrafish yolk cell (Ishihara et al,
2014).
3.3 Known mechanisms of nuclei movement by microtubules
Nuclei are known to reposition in the cytoplasm during diverse biological phenomena and this
process has been studied in variety of organisms. There are two main groups of proteins that
mediate nuclear positioning: proteins that interact at the plus-ends of microtubules and the cell
cortex; and proteins that interact with minus-end microtubule and the nucleus (reviewed in
Morris, 2003). Dynein and its cofactor dynactin have been reported to be involved in this process
by interacting at both the minus and plus-ends of the microtubule (reviewed in Morris, 2003). In
addition, it is well established that microtubule depolymerization and polymerization can
generate pulling and pushing forces respectively (Tolic-Norrelykke, 2008). Taken together, a
combination of these proteins and forces generated by microtubules are involved in the nuclear
positioning. For example during cell division, aster microtubules radiate from MTOCs out to the
cell cortex where cortically anchored dynein and dynactin pull the MTOCs to position them
close to the cell membrane (reviewed in Markus and Lee, 2011).
There appear to be two types of nuclear movement in animal and fungi. The first is centrosome
associated nuclear movement by which MTOCs tightly associate with the nuclear envelope and
microtubules connected to the nucleus drive the movement via generating pushing or pulling
forces. One classic example of this is male pronuclear movement, which has been described in
C. elegans, Drosophila oocytes, and cultured mammalian cells to name few (reviewed in Morris,
2003). In this case, the centrosome is tightly attached to the pronucleus and microtubules
dynamics at the plus-ends interact with the cell cortex to generate forces to drive the pronuclear
24
movement (reviewed in Starr, 2011). Interestingly, microtubule pulling forces can also be
generated by cortically anchored dynein and have been shown to contribute to nuclear movement
in large cells such as budding yeast (Grill et al, 2003; Schmoranzer et al., 2009). In yeast, the
microtubules anchored to the cortex via dynein and dynactin can either undergo
depolymerization or glide along the cortex as the dynein walks towards the minus-end and the
plus-end of the microtubule is fed through dynein (Adames and Cooper, 2003). These plus-end
microtubules depolymerize and pull the nucleus towards the cortex (Adames and Cooper, 2003;
Yamamoto et al, 2001). In syncytial hyphae, microtubules anchored at cortical sites appear to
evenly space nuclei and it has been suggested that motor proteins are involved in this process.
The mechanism underlying the multinuclear movement is unclear (Gladfelter and Berman,
2009).
The second type of nuclear movement is independent of centrosomes (reviewed in Morris,
2003). Although centrosomes are present, they are not tightly associated with the nucleus. One
possibility is that in zebrafish embryos the yolk cell microtubules connect to the e-YSN by the
LINC complex or motor proteins. In the nuclear envelope, the liner of nucleoskeleton and
cytoskeleton (LINC) complex mediates the connection of both microtubules and actin filaments
to the nucleus (Crisp et al, 2006). LINC is composed of KASH proteins on the outer nuclear
membrane and SUN proteins in the inner nuclear membrane (Fridolfsson and Starr, 2010).
Dynein and its cofactor dynactin can also attach to the nuclear envelope via LINC protein
complexes, nuclear pore proteins or adaptor proteins (Meyerzon et al, 2009; Starr, 2009; Zhang
et al, 2009; Yu et al, 2011; Splinter et al, 2010; Tanenbaum et al, 2010; Bolhy et al, 2011). For
example, the female pronucleus moves along microtubules driven by motors that associate with
the nuclear envelope. In C. elegans, KASH (Unc83) and SUN (Unc84) proteins recruit dynein
and kinesin1 to the nuclear envelope during nuclear movement (Fridolfsson et al, 2010) and
25
kinesin-1 was proposed as the power source for nuclear migration and dynein for directionality
of the movement (Fridolfsson and Starr, 2010). Recent work on migrating granule cells observed
that the nucleus is enveloped by a cage of dynamic microtubules and stable microtubules extend
from the leading end of the nucleus (Umeshima et al, 2007). These stabilized microtubule
extensions appeared to be independent of the centrosome. This work suggested that stable
microtubules are crucial for nuclear movement since disruption of stable microtubules slowed
the nuclear movement whereas disruption of dynamic microtubules did not (Umeshima et al,
2007). It was also proposed that the dynein/LIS1 complex may be involved in driving the nuclear
movement along the microtubule by directly binding the nuclear envelope (Umeshima et al,
2007).
In zebrafish embryos, it has been previously shown that e-YSNs move towards the vegetal pole
during epiboly progression, but how they move remains unclear. Two types of nuclear
movement have been described in animal and fungi and these mechanisms could be applied to
understanding zebrafish e-YSN movement.
4 Objective The objective of my thesis was to gain a comprehensive understanding of the organization and
dynamics of the yolk cell longitudinal microtubule network, in order to gain insights into their
function during zebrafish epiboly.
Although various studies support the idea that the longitudinal YCL microtubule network is
important for epiboly to proceed normally, its role in epiboly is still unclear. It has been
hypothesized that the yolk cell microtubule networks pull the e-YSL and EVL towards the
vegetal pole, and passively move the deep cells over the yolk cell. Recently, it was also
hypothesized that these microtubules generate friction in the flow-friction model. There is,
26
however, no definitive evidence supporting YCL microtubules as a driver of epiboly. Altogether,
whether or not they play a role in epiboly remains uncertain. Despite this, the elaborate array of
longitudinal microtubules in the yolk cell also provides an excellent model for studying
microtubule arrays in living organism.
My two research aims are as follows:
1. To examine the YCL microtubule dynamics during epiboly
2. To characterize the organization of YCL microtubule networks during epiboly
27
Chapter 2
Results
1 Characterization of the YCL microtubule network
dynamics during epiboly
Previous work by Zhonghui Fei in the lab focused on characterizing the longitudinal YCL
microtubule network organization and dynamics during epiboly to investigate their exact role.
Her results call into question some aspects of the current view, which proposes that the yolk cell
microtubule network is established prior to epiboly initiation and subsequently depolymerizes to
pull e-YSL vegetally during epiboly (Fig. 3). Contrary to the expected depolymerization at the
plus-end near the vegetal pole, she observed extensive vegetally directed microtubule growth
during early epiboly stages. Live imaging of the microtubule plus-end associated protein EB3
fused to GFP, EB3-GFP, revealed constant nucleation of new microtubules in YSL and
widespread microtubule growth in the vegetal direction in the YCL during early epiboly.
Although the microtubule networks are present in the yolk cell at late epiboly (Fig. 4b), EB3-
GFP was no longer detected in the YCL suggesting that there is a change in the YCL
microtubule dynamics from early to late epiboly stages (Fig. 5). To further investigate this
change in microtubule dynamics, we worked in collaboration to test the hypothesis that
microtubules become stabilized over the course of epiboly. We took several approaches to do
this as described below.
Figure 4. An overview of yolk microtubule network during epiboly. Confocalprojection of a dclk2 transgenic embryo at sphere (A) and 60% epiboly (B) stages. Anoverview of the longitudinal microtubule networks in the yolk cytoplasmic layerduring early and late epiboly. Orientation of embryo: animal pole up.
28
Figure 5. Widespread microtubule polymerization until 60% epiboly stage. Liveconfocal projection of a eb3-egfp injected wildtype embryo from sphere to 75%epiboly stages (A-F). The YCL revealed widespread EB3-GFP localization during earlyepiboly (A-D) and absence of EB3-GFP at 60% epiboly (E-F). After 60% epiboly, EB3-GFP was only detected in the YSL (F). Orientation of embryo: animal pole up.
29
30
1.1 Overview of YCL microtubule dynamic changes during late
epiboly
To investigate changes in YCL microtubule dynamics, live-imaging of Tg (X1Eeflal: eGFP-
Tuba8l) transgenic embryos was performed to observed whether any visible changes in the
microtubule dynamics were apparent around 60% epiboly, at the time when the EB3-GFP
dynamic change was observed. Tg (X1Eeflal: eGFP-Tuba8l) embryos, which will henceforth be
referred to as tuba8l embryos, enable direct visualization of microtubules. Tuba8l embryos were
time lapsed over the course of late epiboly via confocal microscopy. Live imaging revealed few
straight microtubule around shield stage, but a drastic change in microtubule dynamics was not
apparent from 40% to 90% epiboly stages (Fig. 6). To investigate this further, we postulated that
EB3 would be a good marker to use in conjunction with the tuba8l line because it could be used
to indicate the exact time when the change in microtubule dynamics occurred. Therefore, we
generated EB3-mCitrine, EB3-mCherry, and EB3-TagRFPT to co-visualize EB3 and GFP
labeled microtubules. However, we were unable to use these fusion constructs because mCitrine
and GFP emission overlapped (Supplementary Fig. 1) and we found that red-tagged protein
expression is very poor in the zebrafish yolk cell (data not shown).
One change observed in a live imaging of tuba8l embryo during late epiboly was the movement
of microtubules to assume a lateral orientation in the e-YSL where the microtubules meet the
blastoderm (Fig. 7). It is uncertain as to what causes this, but a possible explanation for the
orientation of these microtubules parallel to the blastoderm margin could be that they become
cross linked to the circumferential actin band, which has been previously reported to be present
in the e-YSL starting at 50% epiboly (Cheng et al, 2004; Behrndt et al, 2012)
Figure 6. An overview of the YCL microtubule dynamic change during late epiboly.Confocal projections from a time lapse movie of tuba8l embryo at 40% to 90%epiboly. A-A’’) The YCL microtubule bundling during late epiboly. Dotted boxsurrounds MT bundling. Orientation of embryo: animal pole oriented up.
31
Figure 7. Yolk microtubules appear lateral to the blastoderm-yolk margin duringlate epiboly. Live imaging of tuba8l embryo from 50% to 60% epiboly stages. A-A’’)Microtubule networks align lateral to blastoderm-yolk margin. Orientation of embryo:animal pole up. White dotted line indicate microtubules changing its orientation.
32
33
1.2 YCL microtubules appear to be more stable at later epiboly
stages
To further confirm potential changes in YCL microtubule dynamics over the course of epiboly
that were difficult to detect by live imaging, we performed antibody staining for tyrosinated and
detyrosinated tubulin which are markers of dynamic and stabilized microtubules respectively
(Westermann and Weber, 2003). During early epiboly, tyrosinated microtubules were present in
the yolk cell and resembled the patterns observed by α-tubulin immunostaining although fewer
microtubules were labeled. This suggested that at this stage, the majority of yolk cell
microtubules are dynamic (Fig. 8a). This was further supported by the lack of staining for
detyrosinated tubulin in the yolk cell of sphere staged embryos (Fig. 9a). In contrast at 65%
epiboly, embryos immunostained for tyrosinated-tubulin revealed a lack of tyrosinated-tubulin
(Fig. 8b), whereas detyrosinated-tubulin was detected in the yolk cell (Fig. 9b). These data
suggest that microtubules are more stable at late epiboly than they are at early epiboly. One
caveat to this study however, was that the same laser settings on the confocal microscope were
not used to image embryos stained for tyrosinated-tubulin. More specifically, a lower laser
power was used to image the embryo at late epiboly compared to early staged embryos and
therefore a direct comparison of fluorescence intensity cannot be made. However, in a
subsequent experiment embryos imaged under the same laser setting and immunostained under
same conditions did show a drastic difference in the fluorescence intensity of the blastoderm
between early and late epiboly (data not shown).
To further investigate the possibility of stabilized yolk cell microtubules during late epiboly,
Tg(XlEef1a1:dclk2DeltaK-GFP) embryos, which will be henceforth be referred to as dclk2
embryos, were imaged. This line allows the indirect visualization of microtubules, and dclk2
34
embryos were treated with nocodazole to test the susceptibility of yolk cell microtubules to
depolymerization, as a means to assess microtubule stability. Nocodazole blocks microtubule
polymerization by interfering with β-tubulin subunits (Jordan et al, 1992). Dclk2 transgenic
embryos treated with 10µg/mL of nocodazole for 30 minutes (Solnica-Krezel and Driever, 1994)
at dome stage appeared to be more susceptible to the drug than ones treated at 60% epiboly stage
as shown by the reduced number of YCL microtubules present in the early treated embryo
compared to the late treated ones (Fig. 10). This suggests that YCL microtubules are less stable
or more dynamic at early stages and more stable at late epiboly stages. These results are
consistent with the change in microtubule dynamics observed using EB3-GFP. This is under the
assumption that the number of microtubules in the YCL microtubule network remains constant
throughout the course of epiboly.
To provide additional evidence of stabilized yolk cell microtubules, we performed fluorescent
recovery after photobleaching (FRAP) experiments on tuba81 embryos at early and late epiboly
stages. We expected dynamic microtubules that switch between polymerization and
depolymerization would recover rapidly after photobleaching by exchanging photobleached
tubulin subunits with new fluorescent tubulin subunits. In contrast, we expected stable
microtubules to exhibit either a slow partial or no recovery after photobleaching. If the
photobleached YCL microtubule is an individual microtubule, we expected no recovery of
photobleached region because GTP-bound tubulin subunits are less likely to disassociate in the
middle of a stable lattice (reviewed in Howard and Hyman, 2009). If the microtubules are
bundled, a partial recovery could be a possible outcome if some of the microtubules within the
bundle remain dynamic. To test these predictions, I compared the half time values of recovering
photobleached YCL microtubules between early and late epiboly stages. The mean half time (T
½) of recovery is the time unit taken from bleached (Tb) to when half of the final recovered
35
fluorescence intensity (Th) is reached. To obtain this, we generated normalized recovery curves
for each FRAP experiment. The averaged half time value for early epiboly was 5.66±2.23 SEM
in seconds. For late epiboly, the averaged half time value was 9.15±1.42 SEM in seconds (Fig.
11). Although the half time at late epiboly was greater than at early epiboly as predicted, the
difference was not statistically significant by two tailed t-test analysis when p < 0.05 (p value =
0.303). This is most likely due to the small sample size (n=3) for early epiboly and more FRAP
data is required to obtain a significant finding in the future.
In summary, we observed a change in the yolk cell microtubule dynamics during epiboly which
has not previously been reported. It appears that there are growing microtubules in the yolk cell,
polymerizing towards vegetal pole during early epiboly, while during late epiboly, microtubules
appear cease growth and become stabilized.
Figure 8. Tyrosinated-tubulin present in yolk cell at early, but not late epiboly.Tyrosinated-tubulin is a marker of dynamic microtubules. A) Tyrosinated-tubulinantibody staining at sphere stage (4hpf) B) Lack of tyrosinated-tubulin at 60% epibolystage (~7hpf) in the yolk. Orientation of embryo: animal pole up.
36
Figure 9. Detyrosinated-tubulin present in yolk cell at late, but not early epiboly.Detyrosinated-tubulin is a marker of stabilized microtubules. A) Lack ofdetyrosinated-tubulin antibody staining at sphere stage (4hpf) B) Detyrosinated-tubulin at 60% epiboly stage (~7hpf) present in the yolk. Orientation of embryo:animal pole up.
37
Figure 10. YCL microtubules appears to be less susceptible to nocodazole at laterepiboly stages. Nocodazole treatment at 10µg/mL for 30 minutes. A,A‘) dclk2transgenic embryos at early epiboly stage and at late epiboly stage. B,B’) dclk2transgenic embryos treated with nocodazole at dome stage and at 60% epiboly stage.Orientation of embryo: animal pole up.
38
Figure 11. Comparing half-time of fluorescence recovery (T1/2) between early andlate epiboly FRAP experiments. T1/2, a required time for half of the fluorescencemolecules to exchange between bleached and non-bleached regions, is determinedby the following equation: T1/2 = Th –Tb. (Tb is the time of bleaching and Th is thetimepoint at which half of the final fluorescence intensity (Fh) is reached post bleach).The Fh is calculated by the following equation: Fh= (Ff+ Fb) /2 (Fb is the fluorescenceintensity after bleaching and Ff is the final fluorescence intensity reached post bleach,which was read manually from the normalized FRAP recovery curve). Tuba8ltransgenic embryos were used for both early (n=3) and late epiboly (n=14) FRAPexperiments. The level of significance obtained by comparing two groups with two-tailed t-test analysis was not significant (n.s) at p < 0.05. Error bars are indicated onthe bar graph.
39
40
1.3 E-YSN appears to be pulled vegetally by stabilized
microtubules during late epiboly
The differential yolk cell microtubule dynamics suggested that they may have distinct roles
during early and late epiboly that are reflected by these differences in dynamics. It has been
postulated that YCL microtubules are involved in pulling the e-YSN (Solnica-Krezel and
Driever, 1994; Strahle and Jesuthasan, 1993). The e-YSN can be observed to begin moving
vegetally during epiboly progression in both tuba8l and dclk2 transgenic embryos. The
mechanism involved in e-YSN movement is unclear, but e-YSN movement correlates with the
presence of stable microtubules. Interestingly, recent literature proposed that stabilized
microtubules and the microtubule motor dynein are crucial for nuclear movement in C. elegans,
budding yeast, and migrating granule cells to name few (Fridolfsson and Starr, 2010; Adames
and Cooper, 2003; Umeshima et al, 2007). Nuclear movement was delayed by disrupting stable
microtubules and also cortically anchored dynein has been shown to contribute to nuclear
movement by generating microtubule pulling forces (Grill et al, 2003; Schmoranzer et al, 2009;
Gladfelter and Berman, 2009). I hypothesize that the stabilized microtubules present in the YCL
during late epiboly may be important for movement of the e-YSN, similar to migrating granule
cells, and furthermore, that pulling forces driven by cortically anchored dynein may generate e-
YSN movement towards the vegetal pole.
To test this hypothesis, I first wanted to directly observe the movement of e-YSNs during late
epiboly via live imaging of nuclei labeled tuba8l embryos in order to investigate whether any
notable changes to the e-YSN or microtubules occurred as they migrated vegetally. Tuba8l
embryos were injected with h2a-gfp RNA to label nuclei, thus enabling simultaneous imaging of
both the microtubules and YSN. Live imaging revealed that e-YSN undergo a shape change from
41
round to elongated with the leading end pointing in the direction of movement towards the
vegetal pole (Fig. 13). This e-YSN shape change was most prominent around the 50% epiboly
stage. In addition, YSN appeared to become surrounded by an increasing number of wavy
microtubules that moved towards the animal pole. Over the course of late epiboly, straight
microtubule bundles extending vegetally from the e-YSN appeared. Live confocal imaging of an
injected tuba8l embryo from 50% to 90% epiboly further revealed that these straight
microtubules appear to extend from the YSN to the yolk cortex. At 80% epiboly, YSN
movement stopped and the microtubules appeared wavy (Fig. 12).
Preliminary analysis of the morphology of the YSN and associated microtubules in 3D structural
view using Imaris software showed that the most superficial surface of the e-YSN appeared
flattened, while the other side was more rounded and bulged into the inner yolk mass. This
conclusion is made with the reasonable assumption that the black void wrapped by microtubules
is where the YSN was located (Supplementary movie. 9). In addition, a case of two linked e-
YSNs was seen but whether this linkages is a protrusion from the nuclei or a microtubule bundle
remains unclear since both the YSN and microtubules were fluorescently labeled with GFP (Fig.
14a; Supplementary movie. 7).
To provide evidence that the straight microtubules extending from YSN during late epiboly are
stabilized, I performed FRAP experiments on tuba8l embryos at approximately 70% epiboly
stage. After these microtubules were photobleached, the fluorescence intensity either did not
recover or partially recovered. The bleached region remained in place as the e-YSN moved
vegetally into the area and narrowed the bleached area (Fig. 15). Qualitative observations
suggested that the microtubules were likely to be stabilized, since they either partially recovered
or did not recover after bleaching. Additionally, these findings provide insights into potential
42
mechanisms of YSN movement and we postulated two possibilities (Fig. 21). The first potential
mechanism for vegetal e-YSN movement is dynein or kinesin mediated e-YSN movement along
the stable YCL microtubules (Fridolfsson and Starr, 2010; Starr, 2011). It has been shown in
other systems that dynein and its cofactor dynactin can attach to the nuclear envelope via LINC
protein complexes, nuclear pore proteins or adaptor proteins (Meyerzon et al, 2009; Starr, 2009;
Zhang et al, 2009; Yu et al, 2011; Splinter et al, 2010; Tanenbaum et al, 2010; Bolhy et al,
2011). Since e-YSN moves towards the vegetal pole where plus-end microtubules are located, it
appears likely that plus-end directed Kinesins are involved in transporting the e-YSN. The
second possibility is that stable microtubules, anchored to the yolk cortex, shorten and pull the
YSN vegetally via cortically anchored dynein, similar to nuclear movement in budding yeast
(Adames and Cooper, 2003).
To gain insight into the mechanism of the YSN movement, the morphology of the YSN relative
to the associated microtubules needed to be fully characterized first. To distinguish microtubules
from nuclei, RNA encoding red fluorescently labeled H2A-mcherry was injected into the yolk
cell of tuba8l embryos at 128-cell stage to label predominantly the YSN. The 3D structural view
confirmed the presence of straight microtubules, but information relating to how they associate
with the e-YSN could not be determined (Fig. 14b; Supplementary movie. 8).
Figure 12. An overview of e-YSN movement during late epiboly. Lateral confocalprojections from a time lapse movie of h2a-gfp RNA injected tuba8l from 50% to 90%epiboly. Orientation of embryo: animal pole oriented up. A-B) The e-YSN of interest(arrows) change from round shape to oval shape as they move towards vegetal pole.The straight microtubules form and extend from the YSN to yolk cortex (arrowheads).C) At 80% epiboly, YSN movement stops and the microtubules appear wavy (asterisk).Orientation of embryo: animal pole up.
43
Figure 13. e-YSN appears to be pulled vegetally by stabilized microtubules duringlate epiboly. Lateral confocal projections from a time lapse movie of h2a-gfp RNAinjected Tuba8l from 50% to 65% epiboly. Elongated e-YSN with the leading endpoints to the vegetal pole (red arrows). YSN appears to be surrounded by increasednumber of wavy microtubules (red arrows). Straight microtubule bundles extendvegetally from the YSN (red arrowheads). Orientation of embryo: animal poleoriented up.
44
Figure 14. 3D Morphology of e-YSN and associated microtubules. Confocalprojection of h2a-gfp injected tuba8l embryo to visualize YSN and microtubules (A-A’’) and 3D reconstruction of YSN generated with the Imaris software (A-A’’). Confocalprojection of h2a-mcherry injected tuba8l embryo (B) and computationalreconstruction of YSN and microtubules using the Imaris software (B’). Orientation ofembryo: animal pole up.
45
Figure 15. Microtubules extending from e-YSN appear stabilized. Confocalprojection of photobleached tuba8l transgenic embryo at various time points ofrecovery throughout late epiboly stages. Microtubules extending from the e-YSNwere photobleached (T0: time of photobleaching) and reduced fluorescence recoverywas observed. The e-YSN moved towards the vegetal pole and into photobleachedarea. Red rectangle: region of interest (ROI). White circles: regions withoutmicrotubules to measure background fluorescence intensity. Red circle: microtubulesaway from ROI to measure total fluorescence intensity. Orientation of the embryo:animal pole up.
46
47
2 Characterization of the YCL microtubule network
organization during epiboly
2.1 Overview of longitudinal YCL microtubule networks
The previous section discussed a change in the YCL microtubule dynamics that occurs from
early to late epiboly stages that may indicate distinct roles for the network at different times
during epiboly. We also investigated the organization of YCL microtubules to gain further
insight into potential roles of YCL microtubules during epiboly. It is known from other studies
that microtubules organize in particular way to perform specific functions (Baas et al, 2005;
Conde and Caceres, 2009; Murata et al, 2005; Ishihara et al, 2014).
To characterize the organization of the YCL microtubule network, I first visualized the
microtubules using tubulin antibodies. α-tubulin antibody staining of sphere staged embryos
revealed an elaborate array of microtubules spanning the entire length of the yolk cell
corresponding to approximately 400µm (Fig 16. a). To further decipher the details of the
microtubule structures, a section of the network was computationally reconstructed using Imaris
software and visualized in 3D (Fig. 16 a’). Unfortunately, the microtubule network was too
complex to allow the structure of even a single microtubule network to be deciphered.
The YCL microtubule networks are nucleated from e-YSN in YSL, where the MTOCs are
located (Solnica-Krezel and Driever, 1994). γ-tubulin is a marker for MTOCs and is known to be
important for microtubule nucleation at both centrosomal and noncentrosomal sites (Desai and
Mitchison, 1997; Kollman et al, 2011). Specifically in plant cells, γ-tubulin is recruited to
noncentrosomal sites at cortical microtubule structures to nucleate microtubule arrays (Murata et
al, 2005). To determine whether noncentrosomal nucleation sites in the YCL microtubule
48
network are also present, I co-visualized γ-tubulin and α/β-tubulin via immunostaining. The
previously used α-tubulin was same species with γ-tubulin antibody and could not be used for
double antibody staining. Antibody staining for γ-tubulin and α/β-tubulin at sphere stage showed
that γ-tubulin was only detected in the blastoderm and the YSL, and not in the YCL.
Additionally, only a few embryos displayed partial staining for α/β-tubulin in the YCL (Fig. 17)
which was presumably due to technical issues surrounding antibody staining the yolk cell.
Several different published immunostaining protocols listed in Supplementary table. 2 were
tested in an attempt to resolve the antibody staining problems. Although the best results were
obtained using the Solnica-Krezel protocol (Solnica-Krezel and Driever, 1994) with modified fix
solution (refer to the Materials and Methods), the immunostaining protocol still needs to be
optimized in the future. Staining was inconsistent and it was time consuming to image numerous
embryos individually by confocal microscopy. Furthermore, excessive background produced by
secondary antibody trapping in the yolk cell made it difficult to clearly visualize the microtubule
network. Although no γ-tubulin was detected in the YCL and there appeared to be no other
nucleation sites other than the YSN, since immunostaining in the yolk cell remains problematic
for certain antibodies, the presence of non-centrosomal nucleation sites in the YCL cannot be
ruled out.
As an alternative approach, dclk2 and tuba8l transgenic embryos were used for microtubule
visualization. YCL microtubule network overviews in these embryos at sphere stage resembled
α-tubulin immunostained embryos, demonstrating elaborate arrays of microtubules (Fig. 16 b). It
is important to note that these overviews are maximum confocal projections of the yolk cell
microtubules due to the curvature of the embryo. By doing this, the 3 dimensional perspective of
the yolk cell microtubules was lost and their organization within the YCL depth was uncertain.
Two potential organizations were predicted as shown in (Fig. 16 c); microtubules extending only
49
in the most superficial layer of the YCL or diagonal extension of microtubules by which only the
microtubule ends are on the most superficial layer. To examine this, a dclk2 transgenic embryo
was visualized in cross-sectional 3D using Imaris software (Fig. 16 b’). Due to insufficient
image resolution, yolk cell microtubule organization within the YCL remains unclear (Fig. 16
b’’).
Figure 16. 3D morphology of the longitudinal microtubule networks in the YCL.Confocal projection of α-tubulin immunostained embryo (A) and dclk2 transgenicembryo at sphere stage (B) in lateral view. (A’) Computational reconstruction ofmicrotubule network of α-tubulin immunostained embryo generated with the Imarissoftware. (B’-B’’) Cross sectional 3D views of dclk2 transgenic embryo using Imarissoftware. (C-C’) schematic view of two potential microtubule organizations within theYCL: C) microtubule on the most superficial layer and C’) diagonally extendingmicrotubule. Green line- microtubule and white rectangle- section of YCL. Orientationof embryo: animal pole up.
50
Figure 17. γ-tubulin appears confined to the blastoderm and e-YSL in the yolk cell.Confocal projections of γ-tubulin and α/β-tubulin immunostained embryos at spherestage. A) Co-visualization of γ-tubulin and α/β-tubulin. A’) Blastoderm was imaged at40x at sphere stage. B, B’) Antibody staining for γ-tubulin is present in the blastodermand e-YSL. Orientation of embryo: animal pole up. Red: γ-tubulin, green: α/β-tubulin,arrowheads: MTs, arrows: γ-tubulin.
51
52
2.2 Various approaches to visualize microtubule structure within
the YCL microtubule network
Living imaging and antibody-staining of microtubules did not provide information as to how the
microtubules are structured within the YCL. We only observed that they were elaborate
longitudinal microtubule arrays emanating from MTOCs in the e-YSNs, but how this is
established remains uncertain. Our goal was first to determine if the longitudinal microtubule
network is arranged in long continuous strands, all of which are anchored to the MTOC in the e-
YSL. This arrangement would support the current view proposing that epiboly proceeds via
depolymerization at the plus-end of microtubules near the vegetal pole and this shortening results
in the microtubule pulling on the minus-end attached e-YSN. To test this, we took two
approaches: fluorescent recovery after photobleaching (FRAP) and nocodazole treatment.
To investigate the composition of the YCL microtubule network, FRAP experiments were
performed on tuba8l transgenic embryos at sphere to dome stages when the microtubule network
is extensive and dynamic. If the network were comprised of continuous strands of microtubules
all anchored to MTOCs, we predicted that recovery of bleached regions would occur via
microtubule growth starting from the upper photobleached region. Unfortunately, the
photobleached region recovered too rapidly to make precise qualitative observations. In several
FRAP experiments fluorescent tubulin unexpectedly appeared along the photobleached
microtubule network apparently from all directions (data not shown). Molecular sieving effects
may explain this effect as it occurs when a microtubule network temporarily traps freely
diffusing fluorescence tubulin and it gives the appearance that there is binding of fluorescent
tubulin along the microtubule network (Sprague & McNally, 2005).
53
As an alternative experimental approach to overcome the limitations of FRAP, dclk2 and tuba8l
embryos were treated with a microtubule depolymerizing agent nocodazole and the recovery of
microtubule network was observed over the course of epiboly. This procedure, known as the
nocodazole-recovery regime, was first employed by Ahmad and Baas to study microtubule
organization in axons (1995). In this regime, treatment with high doses of nocodazole is used to
depolymerize existing microtubules. The drug is then washed out allowing new microtubules to
be polymerized at the centrosome (Ahmad and Baas, 1995). We predicted that it would be easier
to determine how the microtubules are organized by observing how the network reforms. We
postulated that newly nucleated microtubules would grow continuously from MTOC. dclk2
transgenic embryos were used initially to optimize the nocodazole concentration and treatment
time needed to completely depolymerize the yolk cell microtubules. Three different
concentrations of nocodazole and two different treatment times (30 minutes and 1hr) were used
based on Solnica-Krezel (Solnica-Krezel and Driever, 1994). Surprisingly, the yolk cell
microtubules did not completely depolymerize. Although dclk2 transgenic embryos contain a
kinase dead version of the transgene, Dclk2 may still stabilize the microtubules to some extent
and protect them from degradation. Interestingly, the partially depolymerized microtubules did
not recover over the course of epiboly (Supplementary fig. 6). Due to the issues encountered
using dclk2 transgenic embryos for these experiments, the tuba8l transgenic embryos were used
instead. Tuba8l transgenic embryos were treated with nocodazole at 0.5µg/mL, 1.5µg/mL,
2.5µg/mL, 5µg/mL, and 10µg/mL for times ranging from 10 minutes to 30 minutes. Confocal
imaging of live nocodazole treated embryos revealed complete depolymerization with no
recovery at higher concentrations and partially depolymerized microtubules at lower
concentrations (Supplementary fig. 5). The partially depolymerized microtubules may have
resulted from recovery prior to imaging due to limitations in rinsing, mounting, and imaging
54
treated embryo in less than ten minutes. To overcome this, nocodazole treated tuba8l transgenic
embryos were fixed over the course of recovery and immunostained with α-tubulin antibody
(data not shown). This also did not reveal newly nucleated microtubules in the yolk cell due to
inconsistency with immunostaining in the yolk cell. Although we expected to see new
microtubules forming at MTOCs (e-YSL) after few minutes of recovery from nocodazole
treatment, qualitative observation of microtubule recovery of live and fixed nocodazole treated
tuba8l transgenic embryos did not reveal this information via SP8 confocal microscopy and α-
tubulin antibody staining. To prevent any complications from disrupting the microtubules in the
blastoderm, yolk-biased nocodazole treatment needs to be performed in the future. This has been
done successfully in zebrafish by another group using nocodazole soaked beads (Tran et al,
2012) and appears to be a promising technique.
2.3 Microtubule fragments are observed during early cleavage
stages
The longitudinal YCL microtubule network during epiboly is dense and complex, making its
organization difficult to discern. In an attempt to circumvent this issue, the initial formation of
the network during early cleavage stages was observed. This idea was that microtubule arrays
should be less complex earlier before the extensive network forms. We predicted that imaging
the network during cleavage stages might reveal how it forms and how the later organization is
established.
During cleavage stages, cells (or blastomeres) divide and remain interconnected to the yolk cell.
The microtubules in the yolk cell are therefore nucleated from the blastoderm cells prior to YSL
formation (Kimmel et al, 1995). Live imaging of a dclk2 transgenic embryos during early
cleavage stages (from 1-cell to high stage using confocal microscopy) revealed the presence of
55
microtubule fragments during repeated cycles of longitudinal YCL network formation, which
presumably correlated with cleavage divisions (Fig. 18; Supplementary movie. 11). The
longitudinal microtubule networks in the YCL repeatedly flowed towards the blastoderm and all
disassembled simultaneously (Fig. 18 a-c). Once fully disassembled, microtubule fragments
appeared to travel from the blastoderm cells to the YCL (Fig. 18 d-f). The longitudinal network
then reassembled in the YCL. This cycling of network formation terminated prior to YSL
formation, when the final longitudinal YCL networks are established. Although the tuba8l
transgenic line allows direct visualization of microtubules compared to the dclk2 transgenic line,
there were yolk granules obstructing the visualization of microtubules and thus this line was not
useful for this study (data not shown). The fluorescently label tubulin was too faint and yolk
granules obstructed the view of microtubule network, making observations difficult.
Figure 18. Microtubule fragments observed during repeated cycles of YCL networkdisassembly and reassembly at early cleavage stages. Live confocal imaging of adclk2 embryo during cleavage stages, starting from 2-cell stage to high stage (n=3). A)and B) Microtubule network in the yolk is flowed into the blastoderm. C)Microtubules simultaneously disassembled. D-F) Microtubule fragments travel fromthe blastoderm to yolk. Orientation of embryo: animal pole up. Arrows indicates thedirection of microtubule flow. Dotted line indicates the blastoderm-yolk margin.
56
57
2.4 Microtubule severing protein Katanin appears present in and
near the e-YSL
We observed short microtubule fragments traveling to YCL from blastoderm and reassembling
in the YCL. The cycling of assembly and disassembly ceases when the longitudinal YCL
networks are established. Although this data suggests that the network is comprised of short
fragments, it is known that Katanin, a microtubule severing protein, activity is highest in mitotic
cells of Xenopus eggs (McNally & Thomas, 1998) to allow tubulin subunits to flux during
chromosome segregation.
Although unpublished, the Perkins lab previously reported that morpholino knock down of the
microtubule severing protein Katanin in the zebrafish YSL caused an epiboly delay (reported in
Bruce and Sampath, 2008). It is known that Katanin consists of an enzymatic p60 subunit that
severs microtubules and a non-catalytic p80 subunit that localizes to the centrosome (reviewed in
Sharp and Ross, 2012). We hypothesized that the Katanin might be important for maintaining the
YCL microtubule dynamics, perhaps by severing the microtubules near the e-YSNs. To
characterize the localization of Katanin, Katanin p60 antibody was used, which has been used
previously in zebrafish embryos (Butler et al, 2010). Katanin p60 appeared to be localized in e-
YSL, where the MTOCs nucleate new microtubules (Fig. 19 b). Although Katanin antibody
staining was apparent in the e-YSL as large puncta at sphere stage, it was difficult to interpret
whether or not the staining was real because of secondary antibody trapping and the fact that the
puncta varied in size (Fig. 19 b).
To further investigate this further, the catalytic Katanin p60 subunit α1 (Katna1) was amplified
from shield stage cDNA and used to generate a Katna1-eGFP fusion protein. This construct was
58
used to see whether it would be localized in the YSL. In wild-type embryos injected with katna1-
egfp RNA, Katanin-GFP puncta localized in and adjacent to e-YSL, however these puncta were
larger (Fig. 19 a) than those detected by immunostaining Katanin. katanin-gfp injected embryos
showed that exogenous fusion protein can become localized to the YCL, whereas the
endogenous appears to be localized in e-YSL suggesting that the localization in katanin-gfp
injected embryos may result from overexpression of the construct. Together, these results
suggest that the Katanin appears localized in and near e-YSL where new microtubules nucleate
in the yolk cell and may possibly sever nucleated microtubules into fragments, consistent with
the situation in neuronal cell bodies (Baas et al, 2005).
Figure 19. Microtubule severing protein katanin appears present in and adjacent tothe e-YSL. Close up lateral view of embryo margin at sphere stage (4hpf). A) katna1-gfp RNA overexpression in WT embryo. B) Katanin p60 antibody staining in the e-YSL.Orientation of embryo: animal pole up. Arrows indicate the localization of Katanin.The yolk is below the red dotted line.
59
60
2.5 Investigating other noncentrosomal minus-end microtubule
markers
The potential presence of noncentrosomal minus-ends was examined as a means to indirectly
determine if microtubules are severed. In addition, this could tell us whether they are organized
in short microtubule fragments similar to the microtubule organization of axonal projections. In
this case, microtubules will have minus-ends that are not associated with centrosomes when
severed from the MTOCs. Recent studies demonstrated that calmodulin-regulated spectrin
associated proteins (CAMSAPs) regulate microtubule minus-end growth and decorate
noncentrosomal minus-end microtubule stretches. Three CAMSAPs; CAMSAP1, 2, and
3/Nezha, exist in mammals and have been reported to have distinct behaviours at microtubule
minus-ends (Jiang et al, 2014; Hendershott & Vale, 2014). Specifically, CAMSAP1 only tracks
polymerizing minus-end while CAMSAP2 and CAMSAP3 stabilize the minus-ends of
microtubules. It was also reported that Katanin binds to CAMSAP2 and CAMSAP3 and restrict
minus-end growth, capping/stabilizing the minus-end of the noncentrosomal microtubules (Jiang
et al, 2014).
In plant cells, Katanin and non-centrosomal microtubules were both present (reviewed in Lloyd
and Chan, 2004). Based this work, we hypothesized that microtubules may have noncentrosomal
minus-ends suggesting that not all microtubules in the YCL microtubule network anchor to the
centrosomal MTOCs in e-YSL. To visualize non-centrosomal minus-ends, human CAMSAP
constructs (gifts from A. Akhmanova) were obtained so that they could be used to visualize
microtubule minus-ends. CAMSAP1-mVenus and full-length CAMSAP2-GFP fusion constructs
were made and RNA was injected into 1-cell staged embryos. Unfortunately there was too much
61
background fluorescence making the distribution difficult to determine (Supplementary Fig. 3
and 4).
Several attempts to mark the noncentrosomal minus-ends in the yolk cell using available tools,
such as fluorescently tagged CAMSAPs and γ-tubulin antibody, were unsuccessful. It is notable
that camsap constructs and γ-tubulin antibody could be visualized clearly in the blastoderm,
indicating that part of the issue was related to the difficulties inherent in visualizing fluorescent
proteins in the yolk cell. Whether noncentrosomal microtubules are present or not in the yolk cell
remains undetermined. Interestingly, live imaging of tuba8l transgenic embryos at sphere stage
revealed a couple of instances when microtubules appeared to detach and reattach to another
microtubule in the yolk cell suggesting that there may be noncentrosomal microtubules
(Supplementary Fig. 2). The exact location of these fragments in the yolk cell could not be
determined.
2.6 Movement towards the blastoderm
Centrin, a calcium-binding phosophoprotein, is associated with centrioles and used as a marker
for centrosomes (Salisbury, 1995). centrin-gfp RNA was injected into tuba8l transgenic
embryos. The goal of this experiment was to use Centrin-GFP as a reference marker for a single
microtubule array and observe whether all microtubules anchor to the centrosome or not. Live
imaging of centrin-gfp RNA injected tuba8l transgenic embryos revealed unexpectedly large
aggregates of Centrin-GFP that underwent bursts of movement towards the blastoderm. It has
been previously shown that overexpressed Centrin-GFP forms large aggregrates (Schoppmeier et
al, 2005). This may explain the larger aggregates observed from Centrin-GFP overexpression in
the yolk cell. Smaller Centrin puncta were also observed and were distributed along the
62
microtubule network during late epiboly. Although both Centrin and Tubulin were GFP labeled,
these aggregates appeared to be Centrin, rather than Tubulin, since they were not detected in
uninjected tuba8l transgenic embryos (Supplementary movie. 3). In human cell culture, most
Centrin was also found to be noncentrosomal but the function of this noncentrosomal Centrin
remains unknown (Paoletti et al, 1996). It may be that the smaller Centrin puncta along the
microtubules are similar to noncentrosomal centrin shown in cell culture.
As for their movement towards the blastoderm, Centrin-GFP puncta appeared to change
direction frequently. (Fig. 20). This was further confirmed by calculating the persistence of each
Centrin-GFP movement. The persistence values (ratio of D2S/Len) of each Centrin movement
were less than one. This suggested that Centrin-GFP changed direction frequently since Len
(total length of the track) was greater than D2S (net distance Centrin-GFP moves from first point
to last point of the track) (Supplementary table. 5). Overall, Centrin-GFP appeared to move
directionally towards the animal pole (Fig. 20). One possibility is that motor proteins such as
dynein or minus-directed kinesin may be involved in transporting Centrin-GFP towards the
microtubule minus-ends. To investigate this, the speed for each point interval of each Centrin-
GFP puncta was calculated manually. The speed range was approximately 0.1µm/seconds to
1.55µm/seconds (Fig. 20), which suggest that the movement could be directed by minus-directed
motors. Kinesin movement speeds vary from 0.02 µm/seconds to 2µm/ seconds and dynein can
move at speeds faster than kinesin (Alberts et al, 2008).
The results described above were similar to nocodazole treated dclk2 embryos, in which small
microtubule fragments were observed which appeared to move directionally (Supplementary
fig. 6). Some fragments moved upwards towards the blastoderm in saltatory bursts of movement
with speeds ranging from 0.007µm/sec to 0.39µm/sec. Other fragments moved downwards
63
towards the vegetal pole with speeds ranging from 0.049µm/sec to 0.34µm/sec (Supplementary
fig. 6). Motor proteins are known to directly move microtubules (Alberts et al, 2008). In one
study, the average microtubule velocity at low and high dynein density ranged from
0.058±0.002µm/sec to 0.256±0.002µm/sec. It has been shown that the minus-end directed motor,
cortical dynein, produces forces that power directional microtubule movements along the plasma
membrane (Mazel et al, 2014). Short microtubules at the cell cortex after nocodazole washout in
cell culture were shown to undergo saltatory bursts of rapid directional movements (Mazel et al,
2014). Without cortical dynein, short microtubules displayed random Brownian motion (Mazel
et al, 2014). The average velocity of short microtubule directional movement depends on dynein
density and half-life (Mazel et al, 2014). Taken all together, these results suggest that motor
proteins, such as cortical dynein, might be involved in directed movement of short microtubules
after nocodazole treatment, suggesting that they may normally play a role in the assembly or
maintenance of the network during early epiboly stages. It could be that different minus-end
directed motors are involved in Centrin-GFP movement and short microtubule movement. To
directly determine whether motor proteins are involved in this movement, functional studies
need to be done in the future.
Figure 20. Centrin-GFP movement towards the blastoderm. Live confocal projectionsof centrin-gfp RNA overexpression in injected tuba8l embryo at 60% epiboly (A,B).
A,B) The first point of the track indicated by circles. Total of five (A’) and ten (B’)Centrin-GFP tracks selected manually. The distance measurements generated by
automated application: ImageJ plugin-MTrackJ. A’’,B’’) Graph of various speed
measured for each point interval and track ID is coloured. Animal pole is indicated by
arrows.
64
65
Chapter 3
Discussion
The current view of zebrafish epiboly proposes the yolk cell as the active driver, at least during
epiboly progression. Several studies have suggested key factors in the yolk cell that may be
involved in generating forces to move the e-YSL vegetally (Solnica-Krezel and Driever, 1994;
Strahle and Jesuthasan, 1993; Cheng et al, 2004; Koppen et al, 2006; Behrndt et al, 2012;
Betchaku and Trinkaus, 1986). One key factor, the longitudinal microtubule networks in the
yolk cell, was hypothesized to be established prior to epiboly and to shorten over the course of
epiboly via depolymerization, and thereby generate pulling forces to assist epiboly (Solnica-
Krezel and Driever, 1994; Strahle and Jesuthasan, 1993). In addition, the yolk cell is thought to
pull on the blastoderm via tight junction connections between the marginal EVL cells and the e-
YSL, which then moves the blastoderm passively towards the vegetal pole. Although this simple
model appears plausible, there is no definitive evidence supporting the proposed role of the yolk
cell microtubules. Recently, it was suggested that upward flow of yolk microtubules might
provide some of the friction required for the actomyosin flow friction motor to function in the e-
YSL to drive epiboly progression (Behrndt et al, 2012). It appears that all proposed contributors
to the epiboly driver in the yolk cell may interact in intricate ways to drive the process. Perhaps
they must work synergistically to generate the force needed for epiboly, which in this case it
appears likely that the simple model is no longer sufficient.
In this thesis, I report findings that contradict this simple model and show that there is a dynamic
change in the yolk cell microtubules from early to late epiboly stages. These findings lead to the
proposal that the yolk cell microtubules actively polymerize in the YCL during early epiboly,
66
and then undergo stabilization during late epiboly (Fig. 21). Although the role of polymerizing
YCL microtubules remain uncertain, I postulate that the stabilized microtubules may be involved
in the e-YSN movement during late epiboly stages.
Figure 21. Schematic view of microtubule dynamic change during epiboly. A)Polymerizing microtubule networks in the yolk cell during epiboly initiation. Greenmicrotubules indicate polymerizing microtubules. B) Stabilized microtubule networksin the yolk cell. Dark green microtubules indicate stabilized microtubules. Red arrowsindicate direction of microtubule polymerization.
67
68
1 A change in YCL microtubule dynamics from early to
late epiboly stages
Our findings reveal that yolk cell microtubules are unexpectedly dynamic during early epiboly.
We saw extensive EB3-GFP puncta, which reveal sites of active microtubule polymerization at
the plus-ends of microtubules. At early epiboly stages, antibody staining revealed the presence of
tyrosinated tubulin and the absence of detyrosinated tubulin in the yolk cell, which are markers
of dynamic and stabilized microtubules respectively. Our data suggest that the yolk microtubule
network is still being established during sphere to 60% epiboly stages via polymerization. This is
in contrast to the simple model, in which the yolk cell microtubule network is established prior to
epiboly initiation and depolymerizes during epiboly. The role of these widespread polymerizing
YCL microtubules in the context of epiboly remains uncertain and needs to be addressed in the
future. One possible function of the polymerizing YCL microtubules could be in maintaining the
positions of YSN in the e-YSL during epiboly initiation. A recent study demonstrated that e-
YSN spacing is important for the propagation of calcium waves that start in the dorsal e-YSL
region between dome and 30% epiboly (Yuen et al, 2013). Particularly, only e-YSNs positioned
8µm or less apart were able to propagate the YSL calcium transients that begin at this time
(Yuen et al, 2013). One idea is that the microtubules generate pushing forces against the yolk
cortex via polymerization to keep the e-YSNs apart. It is well established that microtubule
polymerization can generate pushing forces and that microtubules are involved in positioning
MTOCs via pushing or sliding along the cell cortex (Tolic-Norrelykke, 2008). Although we have
no data to support this idea, it will be interesting to look for a potential link between
microtubules and e-YSN spacing in the future.
69
During late epiboly stages, a striking change in the YCL microtubule dynamics was observed.
After 60% epiboly, EB3-GFP puncta were absent from the YCL, suggesting that widespread
microtubule polymerization stops during epiboly progression stages. I postulate that the yolk cell
microtubules switch from growth to stabilization after 60% epiboly. Consistent with this idea, at
60% epiboly I reported the absence of tyrosinated-tubulin (indicating dynamic microtubules) and
the presence of detyrosinated-tubulin (indicating stable microtubules) antibody staining. In
addition, dclk2 and tuba8l transgenic embryos treated with nocodazole (microtubule
depolymerizing agent) at 60% epiboly appeared less susceptible to the drug than embryos treated
during early epiboly. It is important to note that this study was conducted with the assumption
that the number of microtubules in the YCL remains constant throughout the course of epiboly,
which may not be the case.
In live time-lapse movies of tuba8l embryos, dramatic visible changes in the yolk cell
microtubules from early to late epiboly were not apparent. The only change that was observed,
was the appearance of a subset of straight microtubules during late epiboly. This morphology is
often associated with stabilized microtubule lattices which result from GTP bound tubulin
composition (Desai and Mitchison, 1997). FRAP analyses were conducted, in which the half
time of microtubule fluorescence recovery after photobleaching was compared at sphere and
65% epiboly stages. It was expected that stable microtubules would have a larger recovery rate
since GTP bound tubulin do not easily exchange with free tubulin in the middle of the lattice.
Unfortunately, although the half time fluorescence recovery rate was larger at late epiboly than at
early epiboly, the difference was not statistically significant. There are number of caveats to this
study which are likely to explain why the data were not statistically significant. The most
obvious one is that the sample size of only three FRAP experiments at early epiboly was too
small to determine statistical significance and therefore more data needs to be obtained. Second,
70
the size of the selected region of interest (ROI) varied from experiment to experiment and the
ROI moved over time due to the movement in the yolk cell itself. Hence, instead of using an
automated FRAP analysis program, the ROI was manually reposition over time. Lastly, it was
difficult to find the best-fitting mathematical model for the normalized graph and the component
needed to calculate the half time was manually read from the graph. These issues could have led
to inaccuracies in the half time calculations.
Taken together, the data suggests that the yolk microtubule network is still being established
during early epiboly and becomes stabilized by late epiboly (~60% epiboly), demonstrating for
the first time that there is a change in yolk microtubules dynamics from early to late epiboly.
These findings contradict the simple model that the yolk cell microtubule network is established
prior to epiboly initiation and depolymerizes during epiboly. We propose that this difference in
yolk cell microtubule dynamic may reflect distinct functions during epiboly initiation and
progression. During late epiboly, it has been postulated that the YCL microtubules are involved
in moving e-YSNs towards the vegetal pole (Solnica-Krezel and Driever, 1994) and this timing
correlates with yolk cell microtubule stabilization. Therefore, I hypothesize that the stabilized
YCL microtubules may be involved in e-YSN movement during late epiboly rather than the
pulling force being generated by microtubule depolymerization. The potential mechanism that
may be involved in this process is discussed below.
In addition to a role in e-YSN movement, the YCL microtubules could interact with other
contributors to epiboly progression such as actin and calcium. Changes in both actin organization
and calcium transients in the yolk cell occur between early and late epiboly, similar to the
microtubule dynamic change we observed around 60% epiboly. Actin and calcium, have been
postulated to be important during epiboly progression (Behrndt et al, 2012; Cheng et al, 2004;
71
Koppen et al, 2006). The actomyosin band in the e-YSL begins to form at 40% epiboly and
functions in closing the blastopore during late epiboly (Cheng et al, 2004; Koppen et al, 2006;
Behrndt et al, 2012). Furthermore, calcium wave propagation in the YSL during epiboly
initiation reduces around 60% epiboly, but inhibiting these waves affects epiboly progression
and not initiation (Yuen et al, 2013). In addition, there are marginal deep cell calcium waves
during epiboly progression that could also influence the YSL via gap junction connections (Yuen
et al, 2013). A recent study proposed that the calcium/calmodulin complex may initiate YSL
actomyosin ring contraction by activating myosin via calcium/calmodulin-dependent MLCK
phosphorylation during epiboly progression (Geguchadze et al, 2004). I hypothesize that
calmodulin directly binds to microtubules during early epiboly (Burgardt et al, 2015), keeping
the microtubules in a dynamic state. Meanwhile at late epiboly, calmodulin is needed to interact
with calcium to lead to calcium/calmodulin dependent MLCK phosphorylation and release its
attachment to microtubules. By doing this, microtubules could potentially become stabilized.
Currently there is no data supporting this idea, but we can test this by blocking calcium using
5,5’-dibromo BAPTA, 2-APB, or ryanodine in tuba8l embryos and then examining yolk cell
microtubule dynamics. These calcium inhibitors have been used previously in zebrafish embryos
(Yuen et al, 2013) and has been shown to cause epiboly progression delays, thus it would be
interesting to see if microtubule stability is changed.
Future studies should explore additional mechanisms that may explain how the change in yolk
cell microtubules dynamic is controlled. YCL microtubule networks in MZspg (pou5f3) mutant
embryos have been reported to have a similar phenotype as taxol treated embryos during epiboly
progression (Lachnit et al, 2008). In particular, microtubules appeared to be broken and bundled,
and regions of the YCL were devoid of microtubules (Lachnit et al, 2008). This suggested that
the transcription factor Pou5f3 may be involved in regulating a microtubule stabilizing factor.
72
Since Pou5f3 is a transcription factor expressed exclusively in the blastoderm, any affect on the
yolk cell microtubules must be indirect. Pou5f3 might regulate signaling molecules that act in the
yolk cell to regulate microtubule stability. If such signaling molecules could be identified,
potentially via RNA-seq data, future experiments could examine the consequences of blocking
the function of signaling molecules and seeing the affect it has on yolk cell microtubules.
Another possibility is that dynamic microtubules in the yolk cell could bind to the yolk cortex to
become stabilized. Recent studies in epithelial cells suggest that motor proteins such as kinesin2
(kif 17) interact with EB1 and APC at the microtubule plus-end to stabilize microtubules. It was
proposed that Kif17 accumulates at the plus-end and interacts with EB1 to form bridges between
microtubules and the cortex (Jaulin and Kreitzer, 2010; Espenel et al, 2013). In zebrafish,
microtubule plus-ends are also near the yolk cortex, similar to the epithelial cells, and kinesins
could be involved in interacting with +TIPs to assist in microtubule binding to the yolk cortex. It
would be interesting to use plus-end directed kinesin inhibitors and observe if the dynamic
microtubules stay dynamic throughout epiboly progression.
Lastly, a recent study revealed that the steroid pregnenolone binds and activates the plus-end
binding protein CLIP-170 (Weng et al, 2013). CLIP-170 binds to the growing plus-ends of
microtubules and polymerizes microtubules (Nakano et al, 2010). CLIP-170 binding has been
shown in vitro to depend on tyrosinated-tubulin and EB proteins (Bieling et al, 2008; Peris et al,
2006). This is consistent with our data showing that tyrosinated-tubulin is present during early
epiboly. Thus a possible scenario is that during early epiboly the plus-ends of tyrosinated
microtubules are decorated with CLIP-170 and EB to keep the microtubules in a polymerizing
state. During late epiboly, I showed that yolk cell microtubules become detyrosinated and Clip-
170 normally does not localize to detyrosinated microtubule ends (Peris et al, 2006). This
73
suggests that as microtubules become detyrosinated Clip-170 is released which may facilitate the
switch from dynamic to stable microtubules.
2 The mechanism of e-YSN movement by microtubules
It has been postulated that YCL microtubules are involved in pulling the e-YSN (Solnica-Krezel
and Driever, 1994; Strahle & Jesuthasan, 1993). e-YSN undergo a shape change from round to
elongated with the leading end pointing in the direction of movement towards the vegetal pole
around 50% epiboly stage (Solnica-Krezel and Deriver, 1994). In addition, I observed straight
thick microtubule bundles associated with the YSN to the yolk cortex when the e-YSN move.
Thus, there is a correlation between straight microtubules and e-YSN movement, leading to the
hypothesis that e-YSN movement is mediated by stabilized microtubules. Additionally,
qualitative observations from FRAP experiments revealed partial or no recovery of fluorescence
intensity of bleached microtubules during late epiboly stages. Therefore, the FRAP results are
consistent with the straight microtubules associated with YSN being stabilized since it is known
that GTP bound tubulin composition in the stable microtubule lattice are not easily exchanged in
the middle of the polymer (Desai and Mitchison, 1997).
We propose that stabilized microtubules may be involved in pulling the e-YSN vegetally by one
of the following two mechanisms: 1) motor protein mediated e-YSN movement; 2) shortening or
gliding of microtubules anchored to the yolk cortex (Fig. 22).
Recent work on migrating granule cells in vitro proposed that the nucleus is caged by dynamic
microtubules and stable microtubules extend from the leading end of the nucleus (Umeshima et
al, 2007). Upon disruption of these stabilized microtubule extensions, slower nuclear movement
resulted whereas disruption of dynamic microtubules had no effect (Umeshima et al, 2007). It
74
was further proposed that the centrosome is not directly involved in the pulling and that the
dynein/LIS1 complex may be involved in driving the nuclear movement along the microtubule
by directly binding the nuclear envelope (Umeshima et al, 2007). Similar to granule cells, YSNs
may be caged in microtubules. I have shown that microtubules appear to surround an empty
space, where YSN are assumed to be located. In our case however, a plus-end directed motor
such as kinesin would be required to power the nuclear movement along the microtubule.
Interestingly, female pronuclei are known to move along microtubules driven by motors that
associate with the nuclear envelope. In C. elegans, KASH (Unc83) and SUN (Unc84) proteins
recruit dynein and kinesin1 to the nuclear envelope during nuclear movement (Fridolfsson et al,
2010) and kinesin-1 was proposed as the power source for nuclear migration and dynein for
directionality of the movement (Fridolfsson and Starr, 2010). Hence, kinesin-mediated nuclear
movement may be a potential mechanism for e-YSN movement during epiboly. This could be
tested by disrupting kinesin function using kinesin inhibitors and kinesin function blocking
antibodies and observing if movement of the e-YSN towards the vegetal pole was disrupted.
Other studies show that cortically anchored dynein is involved in nuclear movement. In budding
yeast, dynein anchored to the cortex was reported to move the nucleus towards the bud neck
during mitosis by interacting with microtubules (Adames and Cooper, 2003). It was proposed
that long and dynamic microtubules probe the cortex and then become anchored to it. More
specifically, nuclear movement to the bud neck appeared to be mediated by cortically anchored
microtubules depolymerizing as microtubules slide along. As for movement of spindles into the
bud neck, this was reported to occur by cortically anchored microtubules gliding along the cortex
via dynein and its cofactor dynactin (Adames and Cooper, 2003). Similarly, it is also possible
that e-YSNs move vegetally by microtubules anchoring to the yolk cortex which either glide or
depolymerize via dynein. In this case, microtubules could be connected to e-YSN by the LINC
75
complex composed of KASH and SUN proteins on the outer and inner nuclear membrane
respectively (Fridolfsson and Starr, 2010).
In the future, functional studies disrupting dynein and kinesin could be done to confirm that these
motor proteins are involved in the e-YSN movement. Additionally, this would establish which
model of the two proposed models is most likely. Any delayed nuclear movement resulting from
kinesin inhibition would support the kinesin-mediated nuclear movement model, whereas defects
associated with dynein inhibition would support the cortically anchored dynein-mediated model.
To disrupt dynein function, function-blocking antibodies and the dynein inhibitor ciliobrevin D
that targets the dynein intermediate chain (αDIC) could be used. αDIC-function-blocking
antibodies have been shown to delay EVL epiboly in zebrafish (Campinho et al, 2013).
Ciliobrevin D is a very specific inhibitor as it inhibits the ATPase activity by binding to the
highly conserved AAA+ ATPases motor domain making it likely to work in zebrafish (Firestone
et al, 2012), although the optimal treatment protocol would have to be determined. In neurons,
100 µM impaired dynein and blocked axon elongation and 10-40µM at 30min-1hr treatment has
been tested in the Xenopus melanophores. Hence, we can consider these protocols first (Firestone
et al, 2012; Roossien et al, 2014). It is also important to consider that all inhibitor treatment
experiments should be targeted to the yolk cell if possible to prevent complications of blocking
motor protein function in the blastoderm. This can be achieved by using beads soaked in
ciliobrevin D, which has been successfully done using nocodazole before in zebrafish (Tran et al,
2012). Another potential approach is to inject the drug into the yolk.
Figure 22. Schematic views of the potential mechanism of e-YSN movement. A-A’)motor protein mediated e-YSN movement along microtubule B-B’) e-YSN movementby depolymerization or gliding via cortically anchored dynein. Green-microtubule.Green dotted line- depolymerizing microtubule. Red- e-YSN. Yellow circle-motorproteins. Microtubule polarity: minus end-up and plus end- down. Black arrowindicate the direction movement.
76
77
3 Implications of the growing ends of the YCL
microtubule network models
Another goal of my work was to understand how the YCL microtubules grow to establish an
elaborate array during early epiboly, which in turn could explain the mechanisms underlying the
formation of the longitudinal YCL microtubule networks. I propose three potential models that
could explain the organization of the YCL microtubule network: 1) continuous; 2) fragmented;
3) branched.
Similar to the standard model, the continuous model proposes that the microtubule network is
arranged in long continuous strands of microtubules, all of which have their minus-ends
anchored to the MTOCs in the e-YSL. (Fig. 23 b). The fragmented and branched models propose
that not all of the microtubules are anchored to the MTOCs. Rather, the fragmented model
proposes that microtubule severing proteins sever newly nucleated microtubules into short
fragments which are then incorporated into the microtubule network (Fig. 23 a). This model is
derived from the “cut and run” model proposed for neuronal projections (Baas et al, 2005;; Bass
et al, 2006). Although the YCL microtubule networks are long structures similar to those found
in the neuronal projections and they have similar polarity with the plus-end near the cell cortex,
the microtubule arrays in the yolk cell have curvatures and appear wavy as opposed to the
straight microtubule morphology in neurons. In addition, we reported that microtubule fragments
are present during repeated cycles of longitudinal YCL network formation during early cleavage
stages that could reflect the organization of YCL network. We also reveal that the microtubule
severing protein, katanin, localization appears in the e-YSL where new microtubules nucleate
and suggest that they may sever microtubules into fragments similar to neuronal projection.
78
However, it is known from work on Xenopus eggs that Katanin activity is highest in mitotic cells
(McNally and Thomas, 1998) which allows tubulin subunits to flux during chromosome
segregation. Additionally, it was difficult to interpret whether or not the Katanin antibody
staining was real in the e-YSL because of secondary antibody trapping and the fact that the
puncta varied in size.
In order to support the fragmented model, future studies need to aim at revealing other key
components, including the presence of short microtubule fragments and the movement of these
fragments towards the vegetal pole. FRAP experiments were done to see whether short
microtubule fragments could be observed to move vegetally across the bleached region, but there
was no evidence of fragments due to the fast fluorescence recovery. In addition, nocodazole
experiments did not reveal newly nucleated microtubules because microtubules either partially
depolymerized or did not recover. We also report that non-centrosomal minus-ends of potential
short fragments were not apparent in the YCL fluorescently labeled CAMSAPs. In summary, we
do not have strong evidence to support the fragmented model.
More recently, studies of large microtubule asters in the interphase egg cytoplasm of Xenopus
proposed that the microtubules grow by branching off pre-existing microtubules (Ishihara et al,
2014). This organization which we refer to as branched model, appears promising (Fig. 23 c)
given the similarities between zebrafish yolk cell and Xenopus eggs. The large microtubule asters
in the Xenopus egg cytoplasm have similarities to the yolk cell microtubule arrays in zebrafish
embryos in terms of morphology and its environment- yolk cytoplasm. In plant cells, γ-tubulin is
recruited to noncentrosomal sites at the cortical microtubule structures to nucleate microtubule
arrays (Murata et al, 2005). In the branched model, I expect γ-tubulin to be distributed at
noncentrosomal nucleation sites along the pre-existing YCL microtubules where microtubules
79
may potentially be branched. Although no γ-tubulin was detected in the YCL via
immunostaining and there appear to be no other nucleation sites other than the YSNs, due to the
fact that yolk immunostaining still remains difficult for certain antibodies, it remains unclear
whether there might be non-centrosomal nucleation sites in the YCL. γ-tubulin is known to be
important for microtubule nucleation at both centrosomal and noncentrosomal sites (Kollman et
al, 2011). Hence, an experiment that may provide support for the branched model would be to
generate a γ-tubulin-GFP transgenic line.
Figure 23. Schematic views of the potential models of YCL microtubuleorganization. A) Fragmented model: short overlapping microtubule fragmentcomposition of a microtubule network. B) Continuous model: continuous tubulinpolymers all anchored to minus-end MTOC. C) Branched model: microtubulenucleating from noncentrosomal sites along the microtubule array. Green-microtubule network. Pink circle-MTOC. Yellow circle-microtubule severing proteinkatanin. Blue line-noncentrosomal short microtubule. Red circle-noncentrosomalnucleation site. Arrow- direction of the noncentrosomal microtubule movement.Microtubule polarity: minus end-up and plus end- down
80
81
3.1 Future directions
Despite the available tools, both live imaging of transgenic tuba8l and dclk2 embryos as well as
antibody-staining of microtubules conveyed limited information on how microtubules are
structured within the YCL. How these complex structures are established during early epiboly
remains unclear. Various approaches were taken, such as FRAP and nocodazole treatment,
which unfortunately were not informative. The idea behind the nocodazole-recovery regime still
remains promising and yolk-biased nocodazole treatment needs to be performed in the future to
avoid complications from disrupting the microtubules in the blastoderm. Yolk-biased nocodazole
treatment has been done successfully in zebrafish using nocodazole soaked beads (Tran et al,
2012). In addition, the nocodazole-vinblastine regime appears to be more ideal for determining
the YCL microtubule organization. A study done by Ahmad and Baas (1995) used this regime to
determine the fate of nucleated microtubules at the centrosome in neurons. Nocodazole treatment
was used to depolymerize existing microtubules and a short period of recovery allowed after
nocodazole wash out. Then, vinblastine treatment at low levels was done to inhibit subsequent
microtubule polymerization. Vinblastine suppressed new microtubule assembly without
depolymerizing already existing microtubules, to allow a small number of recovered
microtubules to be observed over time. Using this method, we would like to visualize where the
newly nucleated microtubules end up which could support any of the proposed models. We
expect the following outcomes for each model: 1) in continuous model, newly nucleated
microtubules would be anchored to MTOCs and continuously extend down the YCL; 2) in the
fragmented model, newly nucleated microtubules would detached from MTOCs and short
fragmented microtubules would travel vegetally; 3) in the branched model additional
82
microtubule nucleation extending from pre-existing microtubules anchored to MTOCs would
observed.
Another experiment that can test the proposed models is colcemid treatment. Colcemid is a
microtubule depolymerizing drug that has two distinct mechanisms that can be useful for this
experiment. At low concentrations, microtubule dynamics are suppressed by the drug binding to
the microtubule plus-end (Yang et al, 2010). At high concentrations, microtubules detach from
the MTOCs (Yang et al, 2010). High concentrations of colcemid could be used on tuba8l
transgenic embryos to test the models. Microtubule depolymerization rate measurements after
drug treatment could help determine the organization and distinguish between the continuous and
fragmented models. Since the fragmented model proposed that the microtubule network consists
of microtubule fragments that are already detached from MTOCs, we expect that there will be no
change in the already existing depolymerization rate if the fragments are capped on their minus-
end or treadmilling. In neurons, short fragments undergo treadmilling, adding subunits to the one
end and simultaneously losing subunits from the other end, and the lattice appears stationary
(Baas et al, 2005). Alternatively for the continuous model, we predict an increase in microtubule
depolymerization rate because detachment of continuous tubulin polymer from MTOCs will
leave their minus-ends unprotected which are then likely to depolymerize. Generally, it is more
energetically favorable for microtubules to depolymerize than polymerize (Alberts et al, 2008).
Colcemid treatment has previously been performed in the zebrafish embryo using concentrations
of 0.35µM for 1hr (Abraham et al, 1993) and this protocol could be used as a starting point when
optimizing the drug treatment protocol. Interestingly, colcemid can also be locally inactivated by
UV light and this was done successfully in sand dollar eggs (reviewed in Grill and Hyman,
2005). We can also globally treat with colcemid to prevent microtubule growth and locally
inactive colcemid by UV light in the yolk cell and then watch the recovery of microtubules.
83
Lastly, newer technologies are emerging for example, light sheet microscopy enables imaging of
the whole sample volumes over periods of time without photobleaching or phototoxicity. We
could benefit from this by imaging whole tuba8l embryos to distinguish between the proposed
YCL organization models. For one, we may be able to distinguish between the continuous and
non-continuous (fragmented and branched model) by counting the total number of microtubule
ends around the circumference near e-YSL and near the vegetal pole. If the continuous model
was true, the total number of microtubule ends near e-YSL should constant at vegetal pole under
the assumption that all the microtubules extend down to the vegetal pole. If either the fragmented
or branched model was true, the total number of microtubule ends near the e-YSL should be less
in comparison to ends near vegetal pole. It is also possible that at least some yolk cell
microtubules do not extend all the way to the vegetal pole. To account for this possibility, plus-
ends could also be counted at the middle of the yolk cell.
4 Conclusions
Our findings lend support to the growing evidence suggesting that early and late epiboly are
regulated by different genetic and molecular mechanisms. It appears likely that YCL
microtubules have distinct roles during early and late epiboly that are reflected by these
differences in dynamics that I observed.
Future studies should focus on characterizing the yolk microtubule dynamics in more detail and
investigating the potentially distinct roles of the yolk microtubules during early and late epiboly.
It still needs to be determined whether stabilized yolk microtubules are involved in the e-YSN
movement during epiboly progression and if so, what mechanisms are involved. Additionally,
84
future studies examining the implications of growing microtubule ends may provide insight to
their organization and potential role during epiboly initiation.
Ultimately, there is an elaborate array of longitudinal microtubules in the yolk cell of zebrafish
embryo and whether or not they are important for epiboly is uncertain. Nonetheless, they provide
an excellent model for studying microtubule dynamic properties and organization in living
organism.
85
Chapter 4
Materials and Methods
1 Zebrafish embryo collection and maintenance
Embryos were obtained from natural matings and raised in embryo medium at 29°C
(Westerfield, 1993). Embryos were staged as described in Kimmel et al. (1995) and
dechorionated manually with forceps.
2 Fish strains
The AB wild-type strain and the following transgenic fish lines were used: Tg
(XlEef1a1:dclk2Delta-GFP) (Tran et al, 2012) and Tg (XlEef1a1:eGFP-tubα8l) (generated by
Zhonghui Fei). In both transgenic fish lines transgene expression is driven by the Xenopus
maternal eukaryotic translation elongation factor 1 alpha 1 (Eef1a1) promoter, ensuring early
expression of fluorescently labeled tubulin and MAP. Tg(XlEef1a1:dclk2DeltaK-GFP) expresses
GFP fused to a kinase dead version of the zebrafish microtubule associated protein doublecortin-
like kinase 2 (dclk2DeltaK) which allows for indirect visualization of microtubules.
Dclk normally binds to microtubule bundles and stabilizes them (Shimomura et al., 2007), but
the kinase dead version prevents kinase activity and microtubule dynamics remain unaffected. Tg
(X1Eeflal:eGFP-Tuba8l) enables direct visualization of microtubules by expressing GFP fused
to alpha tubulin (tuba8like).
86
AB embryos were used for immunostaining, nocodazole treatment, and RNA injections of the
following: eb3-egfp, katna1-egfp, mvenus-camsap1, egfp-camsap2, and h2a-egfp. Tg
(XlEef1a1:dclk2Delta-GFP) embryos were used for microtubule network overviews; eb3-
mcitrine, eb3-tagrfpt, and katna1-tagrfpt RNA injections; and nocodazole treatment. Tg
(XlEef1a1:eGFP-tubα8l) embryos were used for the following RNA injections: centrin-egfp,
h2a-mcherry, h2a-egfp; nocodazole treatment; FRAP experiments; and confocal time-lapse live
imaging of late epiboly.
3 PCR genotyping of eGFP-tuba8l transgenic strain
Genotyping the first generation of Tg (XlEef1a1:eGFP-tubα8l) for the presence of egfp was
performed by outcrossing to AB and collecting the embryos. Dechorionated embryos at 24hpf
(n= ~100 for each pair) were digested with DNA juice (10 mM Tris-HCl (pH8), 10 mM EDTA,
210 mM NaCl, 0.5% SDS) plus protenaise K, and incubated at 55°C for 2hrs. Phenol-chloroform
extraction was performed to purify the gDNA which was then diluted to 1µg/µL. PCR
amplification was performed using Taq polymerase (NEB). The cycling parameters and primer
sequences for the genotyping assay are listed in Supplementary table 1.
4 Whole-mount immunohistochemistry
The following primary antibodies (1:500 dilution) were used: mouse polyclonal anti-katna1
(Abcam), rabbit polyclonal anti-tubulin-detyrosine (EMD Millipore), mouse monoclonal anti-
tubulin-tyrosine (Sigma-Aldrich), mouse monoclonal anti-γ-tubulin (Sigma-Aldrich), mouse
monoclonal anti-α-tubulin (Sigma-Aldrich), sheep polyclonal anti-α/β-tubulin (Cytoskeleton),
and mouse monoclonal anti-acetylated-tubulin (Sigma-Aldrich). The secondary antibodies
87
(1:1000 dilution) used were goat-anti-rabbit Alexa 488 (Invitrogen), goat-anti-mouse Alexa 488
(Invitrogen), donkey-anti-sheep Alexa 488 (Invitrogen), and goat-anti-mouse Cy3 (Invitrogen).
For Katanin immunostaining, dechorionated embryos were staged and fixed in 4% formaldehyde
in PBS overnight at 4°C. Fixed embryos were permeabilized with PBST for 10 minutes and
washed in PBS for 30 minutes (3x 10 minutes each) at room temperature. Embryos were blocked
for 1 hour at room temperature in block solution (1% BSA, 1% DMSO, and 0.8% Triton in
PBS). Primary anti-katna1 antibody was diluted in block solution and embryos were incubated in
primary overnight at 4°C. Embryos were washed with several changes of PBS/DMSO/Triton
(1% DMSO, 0.8% Triton in PBS) and then incubated overnight at 4°C in secondary antibody
diluted in block solution. Embryos were washed with many changes of PBS/DMSO/Triton.
Individual embryos were mounted in 80% glycerol on a glass bottom dish (MatTek Corporation)
for imaging.
Microtubule antibody staining was performed as described (Topczewski and Solnica-Krezel,
1999) with the following modifications: fix solution (3.7% formaldehyde, 0.2% triton x-100 in
MAB) and fixation time of 1.5hrs at room temperature or overnight at 4°C. For co-staining with
γ and α/β- tubulin antibodies, embryos were incubated simultaneously in both primary antibodies
diluted in mixed block solution followed by sequential addition of secondary antibodies.
88
5 Fusion constructs and capped RNA synthesis
5.1 Construction of EB3-TagRFPT and EB3-mCitrine expression
vectors
To create the EB3-TagRFPT and EB3-mCitrine fusion constructs, the eb3 coding sequence was
PCR amplified from the plasmid pCS2+ EB3-eGFP (Shindo et al, 2008) using Q5 hot start high
fidelity PCR master mix (NEB) and primers listed in Supplementary table 1. The tagrfpt coding
sequence was amplified from TagRFPT-Rab5 (Addgene: 37537) using PCR cycling parameters
and primers listed in Supplementary table 1 to create pCS2+TagRFPT vector. eb3 was cloned
upstream of TagRFPT and mCitrine into BamHI and ClaI site of the pCS2+TagRFPT and
pCS2+8mCitrine (Addgene: 34950) vector.
5.2 Construction of Kif5Bb-pGEM and Dync1i2a-pGEM
expression vectors
The kif5bb and dyncli2a coding sequences were amplified from shield stage cDNA using Q5 hot
start high fidelity PCR (NEB) and primers listed in Supplementary table 1. To increase yield,
PCR reactions were combined, ethanol precipitated and purified (Qiagen min-elute gel
purification kit or phenol-chloroform extraction) for subsequent A’ overhang addition. To clone
into pGEM-T easy vectors (Promega), A’ overhangs were added and pGEM ligations were
transformed into DH5α competent cells (Invitrogen). Insertion was verified by colony PCR,
restriction enzyme digest and sequencing of mini-prepped DNA.
89
5.3 Construction of Katna1-eGFP and Katna1-TagRFPT
expression vectors
katna1, ATPase containing subunitA1 (Katanin p60), was amplified from shield stage cDNA
using Q5 PCR (NEB) and primers listed in Supplementary table 1. The A’ overhangs were added
to the amplified katna1 sequence and cloned in frame into pGEM-T easy vector (Promega). To
create Katna1-eGFP and Katna1-TagRFPT fusion constructs, katna1 coding sequence was
amplified from Katna1-pGEM vector using Q5 PCR (NEB) and primers listed in Supplementary
table 1. The katna1 was cloned in frame upstream of TagRFPT and eGFP into BamHI and ClaI
sites of the pCS2+TagRFPT and pCS2+ 8eGFP (Addgene: 34952) vectors.
5.4 Construction of mVenus-camsap1 expression vector and
eGFP-camsap2 template
The camsap1 coding sequence was amplified from the EGFP-Camsap1 plasmid (gift from A.
Akhmanova) using Q5 PCR (NEB) and primers listed in Supplementary table 1. camsap1 was
cloned in frame downstream of mvenus using the StuI and XhoI sites in the pCS2+mVenus
vector. To create eGFP-camsap2 template for RNA transcription, the full sequence was PCR
amplified from the eGFP-camsap2 plasmid (gift from A. Akhmanova) using expand high fidelity
PCR mix (Roche) and primers as listed in Supplementary table 1. PCR products were purified
(Qiagen or phenol-chloroform extraction) for subsequent SP6 transcription.
The following pCS2+/pCS2+8 expression vectors were linearized using NotI-HF restriction
enzyme: EB3-TagRFPT, EB3-mCitrine, Katna1-eGFP, Katna1-TagRFPT, and mVenus-
Camsap1. To generate capped RNA, all linearized expression vectors were transcribed for 2
90
hours using the SP6 mMessage mMachine kit (Invitrogen) and purified using the MEGAclear kit
(Invitrogen) by following the manufacturer’s instructions. To generate egfp-camsap2 RNA, the
SP6 transcription reaction was incubated for 4hours.
6 Microinjection
Embryos were injected either at the 1-cell stage to achieve global expression (Bruce et al, 2003)
or into the yolk at the 128-cell stage to bias expression to the YSL (Lepage et al, 2014).
All RNAs in the following table were injected into the yolk cell.
Fish strain RNA Amount of
injection (pg)
Stage of injection
AB
eb3-egfp 110 1-cell
katna1-egfp 60 1-cell
mvenus-camsap1 134-268 1-cell
egfp-camsap2 267-427 1-cell
h2a-egfp 26 1-cell
Tg (XlEefla1:dclk2DeltaK-GFP)
eb3-mcitrine 150 1-cell
eb3-tagrfpt 52- 546 1-cell
katna1-tagrfpt 54 1-cell
91
Tg (XlEefla1: eGFP-Tuba18l)
h2a-egfp 66 128-cell
h2a-mcherry 94 128-cell
centrin-gfp 267 1-cell
7 Microscopy
Live confocal imaging was performed on a Quorum WAVEFX spinning disk confocal using a
63x objective or on Leica TCS SP8 confocal resonant and non-resonant microscopes using 20-
63X objectives. Microinjected embryos at the appropriate stages were dechorionated and
mounted in 0.4% low melt agarose with embryo medium on coverslip bottom dishes (MatTek).
Immunostained embryos were mounted in small drops of 80% glycerol on coverslip bottom
dishes (MatTek) and imaged with a voxel size of approximately 750nm x 750nm x 1.04µm at
20x on average.
8 Image processing
All confocal files were visualized using Volocity 5.3 software. For live time-lapse confocal
images, the z-planes were merged using ‘Merged planes’ and then exported in .tiff format for
subsequent image processing, which was performed using ImageJ (Rasband, 2014). The
following features were applied: brightness and contrast adjustment, 2D maximum projection,
image calibration for scale bars, addition of scale bar, time-lapsed movie file exportation, and
image rotation. For tracking Centrin-GFP movements, an automated application of MTrackJ
92
plugin was used (Meijering et al, 2012). All 3D reconstructions were generated using Imaris v
7.7 software (Bitplane).
9 FRAP and FRAP analyses
All FRAP experiments were performed on Tg (XlEefla1: eGFP-Tuba18l) transgenic embryos.
Live time-lapse images were taken on a Quorum WAVEFX spinning disk confocal with a 63x
objective lens using a z-step size of 0.3µm. For FRAP experiments, a rectangular box was drawn
on the yolk cell (lateral side) and microtubules were photobleached for 4 seconds with an argon
laser. The microtubules were imaged less than a minute before photobleaching and an average of
7 minutes after photobleaching.
For FRAP analyses, fluorescence intensity of the ROI (regions of interest) was measured by
obtaining the mean grey values using Image J software for each time point. To account for the
movement of ROI over time, the rectangular box drawn to outline the ROI was manually
repositioned for each time point before taking the fluorescence intensity measurement. To obtain
the background corrected values, four background measurements for each time point were
measured and the averaged background fluorescence intensity was subtracted from ROI
fluorescence intensity measurement for each time point. To correct for photobleaching, the total
fluorescence intensity of microtubules farthest away from the ROI was measured at each time
point. Background-subtracted intensity values were divided by the total intensity value at each
time point to obtain total corrected values. To normalize the values in relative fluorescence units,
the total corrected values at each time point were divided by fluorescence intensity of the time
point prior to bleaching. Normalized FRAP recovery curves were generated (relative
fluorescence on y-axis and relative time unit on x-axis) as described (Kang et al, 2012).
93
Half time (T ½) values were calculated by the following equation:
T1/2 = Th –Tb,
Tb is the time of bleaching and Th is the timepoint at which half of the final fluorescence
intensity (Fh) is reached post bleach. T ½ values are in seconds.
Fh values were calculated by the following equation:
Fh= (Ff+ Fb) /2,
Fb is the fluorescence intensity after bleaching and Ff is the final fluorescence intensity
reached post bleach that was manually read from the normalized FRAP recovery curve.
Statistical comparisons between FRAP experiments of early and late epiboly were completed
using two tailed t-test analysis: http://www.socscistatistics.com/tests/studentttest/Default2.aspx
10 Nocodazole treatment
To depolymerize yolk microtubules, Tg (XlEefla1:dclk2DeltaK-GFP) and Tg (XlEefla1: eGFP-
Tuba18l) transgenic embryos were treated with nocodazole (Sigma-Aldrich) at 0.5µg/mL to
10µg/mL diluted in embryo medium. The stock nocodazole powder was dissolved in 100%
DMSO as described (Baas and Ahmad, 1992). Dechorionated embryos at appropriate stages
were treated with the drug in the 1% agar noble coated ‘treatment’ dishes and rinsed with
embryo medium three times in separate agar noble coated ‘rinse’ dishes. Treatment times,
ranging from 10-30 minutes, included the rinsing and mounting of embryos.
94
References
Adames, N. R., & Cooper, J. a. (2000). Microtubule interactions with the cell cortex causing
nuclear movements in Saccharomyces cerevisiae. Journal of Cell Biology, 149(4), 863–874.
Ahmad, Fridoon J, & Peter W Baas. (1995). Microtubules Released from the Neuronal
Centrosome Are Transported into the Axon 2769: 2761–2769.
Akhmanova, A., & Steinmetz, M. O. (2010). Microtubule +TIPs at a glance. Journal of Cell
Science, 123(Pt 20), 3415-3419.
Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., & Walter, P. (2008) Molecular biology
of cell. In Marjorie
Baas, P.W., and F.J. Ahmad., (1992). The plus ends of stable microtubules are the exclusive
nucleating structures for microtubules in the axon. J Cell Biol. 116(5), 1231-41.
Baas, P. W., Karabay, A., & Qiang, L. (2005). Microtubules cut and run. Trends in Cell Biology,
15(10), 518-524.
Babb, S. G., Barnett, J., Doedens, a L., Cobb, N., Liu, Q., Sorkin, B. C., Marrs, J. a. (2001).
Zebrafish E-cadherin: expression during early embryogenesis and regulation during brain
development. Developmental Dynamics : An Official Publication of the American
Association of Anatomists, 221(September 2000), 231–237.
Babb, S. G., & Marrs, J. a. (2004). E-cadherin regulates cell movements and tissue formation in
early zebrafish embryos. Developmental Dynamics, 230(April), 263–277.
Baas, P. W., Vidya Nadar, C., & Myers, K. A. (2006). Axonal transport of microtubules: The
long and short of it. Traffic (Copenhagen, Denmark), 7(5), 490-498.
Bartolini, F., & Gundersen, G. G. (2006). Generation of noncentrosomal microtubule arrays.
Journal of Cell Science, 119, 4155–4163.
Behrndt, M., Roensch, J., Grill, S. W., & Heisenberg, C. (2012). Forces Driving Epithelial
Spreading in Zebrafish Gastrulation. Science, 338 (6104), 257-260
95
Bensch, R., Song, S., Ronneberger, O., & Driever, W. (2013). Non-directional radial
intercalation dominates deep cell behavior during zebrafish epiboly. Biology Open, 2, 845–
54.
Betchaku, T., & Trinkaus, J. P. (1978). Contact relations, surface activity, and cortical
microfilaments of marginal cells of the enveloping layer and of the yolk syncytial and yolk
cytoplasmic layers of fundulus before and during epiboly. The Journal of Experimental
Zoology, 206(3), 381-426.
Bergen, L. G., Kuriyama, R., & Borisy, G. G. (1980). Polarity of microtubules nucleated by
centrosomes and chromosomes of Chinese hamster ovary cells in vitro. Journal of Cell
Biology, 84(January), 151–159.
Berry RW and Shelanski ML (1972). Interactions of tubulin with vinblastine and guanosine
triphosphate. Journal of Molecular Biology, 1(1): 71-80
Bolhy, S., Bouhlel, I., Dultz, E., Nayak, T., Zuccolo, M., Gatti, X., & Doye, V. (2011). A
Nup133-dependent NPC-anchored network tethers centrosomes to the nuclear envelope in
prophase. Journal of Cell Biology, 192(5), 855–871.
Braun, M., Lansky, Z., Fink, G., Ruhnow, F., Diez, S., & Janson, M. E. (2011). Adaptive braking
by Ase1 prevents overlapping microtubules from sliding completely apart. Nature Cell
Biology, 13(10), 1259–1264.
Braun, M., Drummond, D. R., Cross, R. a, & McAinsh, A. D. (2009). The kinesin-14 Klp2
organizes microtubules into parallel bundles by an ATP-dependent sorting mechanism.
Nature Cell Biology, 11(6), 724–730.
Brinkley, B. R. (1985). Microtubule organizing centers. Annual Review of Cell Biology,
1(Porter 1966), 145–172. doi:10.1146/annurev.cellbio.1.1.145
Bruce, A. E. E., & Sampath, K. (2008). Morphing morphogenesis. Zebrafish, 5, 187-200.
Bruce, A. E., Howley, C., Zhou, Y., Vickers, S. L., Silver, L. M., King, M. L., & Ho, R. K.
(2003). The maternally expressed zebrafish T-box gene eomesodermin regulates organizer
formation. Development (Cambridge, England), 130(22), 5503-5517.
96
Butler, R., J. D. Wood, J. A. Landers, and V. T. Cunliffe. (2010). Genetic and Chemical
Modulation of Spastin-Dependent Axon Outgrowth in Zebrafish Embryos Indicates a Role
for Impaired Microtubule Dynamics in Hereditary Spastic Paraplegia. 751, 743–751.
Burgardt, N. I., Schmidt, A., Manns, A., Schutkowski, A., Jahreis, G., Lin, Y.-J., Weiwad, M.
(2015). Parvulin 17-catalyzed Tubulin Polymerization Is Regulated by Calmodulin in a
Calcium-dependent Manner. Journal of Biological Chemistry, 290, 16708–16722.
Campinho, P., Behrndt, M., Ranft, J., Risler, T., Minc, N., and C.P Heisenberg. (2013). Tension-
Oriented Cell Divisions Limit Anisotropic Tissue Tension in Epithelial Spreading during
Zebrafish Epiboly. Nature Cell Biology 15: 1405–14.
Carreira-Barbosa F, Kajita M, Morel V. Flamingo regulates epiboly and convergence/extension
movements through cell cohesive and signalling functions during zebrafish
gastrulation. Development (Cambridge, England). 2009; 136 (3):383-392.
Chan, C., Beltzner, C. C., & Pollard, T. D. (2009). Cofilin Dissociates Arp2/3 Complex and
Branches from Actin Filaments. Current Biology, 19(7), 537–545.
Cheng, J. C., Miller, A. L., & Webb, S. E. (2004). Organization and function of microfilaments
during late epiboly in zebrafish embryos. Developmental Dynamics: An Official
Publication of the American Association of Anatomists, 231(2), 313-323.
Conde, C., & Caceres, A. (2009). Microtubule assembly, organization and dynamics in axons
and dendrites. Nature Reviews.Neuroscience, 10(5), 319-332.
Crisp, M., Liu, Q., Roux, K., Rattner, J. B., Shanahan, C., Burke, B., & Hodzic, D. (2006).
Coupling of the nucleus and cytoplasm: Role of the LINC complex. Journal of Cell
Biology, 172(1), 41–53.
Desai, A., & Mitchison, T. J. (1997). Microtubule polymerization dynamics. Annual Review of
Cell and Developmental Biology, 13, 83-117.
Du, S., Draper, B. W., Mione, M., Moens, C. B., & Bruce, A. (2012). Differential regulation of
epiboly initiation and progression by zebrafish Eomesodermin A. Developmental Biology,
362(1), 11–23.
97
Elie-Caille, C., Severin, F., Helenius, J., Howard, J., Muller, D. J., & Hyman, a. a. (2007).
Straight GDP-Tubulin Protofilaments Form in the Presence of Taxol. Current Biology, 17,
1765–1770
Efimov, A., Kharitonov, A., Efimova, N., Loncarek, J., Miller, P. M., Andreyeva, N., Kaverina, I.
(2007). Asymmetric CLASP-Dependent Nucleation of Noncentrosomal Microtubules at the
trans-Golgi Network. Developmental Cell, 12(June), 917–930.
Espenel, C., Acharya, B. R., & Kreitzer, G. (2013). A biosensor of local kinesin activity reveals
roles of PKC and EB1 in KIF17 activation. Journal of Cell Biology, 203(3), 445–455.
Firestone, A J, J. S. Weinger, M. Maldonado, K. Barlan, L.D Langston, M. O’Donnell, V. I.
Gelfand, T. M. Kapoor, and J. K. Chen. (2012). Small-Molecule Inhibitors of the AAA+
ATPase Motor Cytoplasmic Dynein. Nature 484: 125–9.
Fridolfsson, H. N., & Starr, D. A. (2010). Kinesin-1 and dynein at the nuclear envelope mediate
the bidirectional migrations of nuclei. Journal of Cell Biology, 191(1), 115–128.
Fridolfsson, H. N., Ly, N., Meyerzon, M., & Starr, D. a. (2010). UNC-83 coordinates kinesin-1
and dynein activities at the nuclear envelope during nuclear migration. Developmental
Biology, 338(2), 237–250.
Fukazawa, C., Santiago, C., Park, K. M., Deery, W. J., Gomez de la Torre Canny, S., Holterhoff,
C. K., & Wagner, D. S. (2010). Poky/chuk/ikk1 is required for differentiation of the
zebrafish embryonic epidermis. Developmental Biology, 346(2), 272–283.
Galjart, N. (2005). CLIPs and CLASPs and cellular dynamics. Nature Reviews. Molecular Cell
Biology, 6(June), 487–498.
Geguchadze, R., Zhi, G., Lau, K. S., Isotani, E., Persechini, A., Kamm, K. E., & Stull, J. T.
(2004). Quantitative measurements of Ca2+/calmodulin binding and activation of myosin
light chain kinase in cells. FEBS Letters, 557, 121–124.
Gladfelter, A., & Berman, J. (2009). Dancing genomes: fungal nuclear positioning. Nature
Reviews. Microbiology, 7(12), 875–886.
98
Grill, S. W., Howard, J., Schäffer, E., Stelzer, E. H. K., & Hyman, A. A. (2003). The distribution
of active force generators controls mitotic spindle position. Science, 301(July), 518–521.
Grill, S. W., & Hyman, A. a. (2005). Spindle Positioning by Cortical Pulling Forces.
Developmental Cell, 8, 461–465.
Gundersen, G G, M H Kalnoski, and J C Bulinski. (1984). Distinct Populations of Microtubules:
Tyrosinated and Nontyrosinated Alpha Tubulin Are Distributed Differently in Vivo. Cell 38
(3): 779–89.
Hendershott, Melissa C, and Ronald D Vale. (2014). Regulation of Microtubule Minus-End
Dynamics by CAMSAPs and Patronin. Proceedings of the National Academy of Sciences
of the United States of America 111 (16): 5860–5.
Hsu, H. J., Liang, M. R., Chen, C. T., & Chung, B. C. (2006). Pregnenolone stabilizes
microtubules and promotes zebrafish embryonic cell movement. Nature, 439(7075), 480-
483.
Hirokawa, N., Noda, Y., Tanaka, Y., & Niwa, S. (2009). Kinesin superfamily motor proteins and
intracellular transport. Nature Reviews. Molecular Cell Biology, 10, 682–696.
Howard, J., & Hyman, A. a. (2007). Microtubule polymerases and depolymerases. Current
Opinion in Cell Biology, 19, 31–35.
Ishihara, K., Nguyen, P. a., Groen, A. C., Field, C. M., & Mitchison, T. J. (2014). Microtubule
nucleation remote from centrosomes may explain how asters span large cells. Proceedings
of the National Academy of Sciences, 111(50), 17715–17722.
Janke, C., & Chloë Bulinski, J. (2011). Post-translational regulation of the microtubule
cytoskeleton: mechanisms and functions. Nature Reviews Molecular Cell Biology,
12(November), 773–786.
Jaulin, F., & Kreitzer, G. (2010). KIF17 stabilizes microtubules and contributes to epithelial
morphogenesis by acting at MT plus ends with EB1 and APC. Journal of Cell Biology,
190(3), 443–460.
99
Jiang, Kai, Shasha Hua, Renu Mohan, Ilya Grigoriev, Kah Wai Yau, Qingyang Liu, Eugene a
Katrukha, et al. (2014). Microtubule Minus-End Stabilization by Polymerization-Driven
CAMSAP Deposition. Developmental Cell 28 (3): 295–309.
Jordan, M. a, Thrower, D., & Wilson, L. (1992). Effects of vinblastine, podophyllotoxin and
nocodazole on mitotic spindles. Implications for the role of microtubule dynamics in
mitosis. Journal of Cell Science, 102 (Pt 3), 401–416
Kane, D., & Adams, R. (2002). Life at the edge: Epiboly and involution in the zebrafish. Results
and Problems in Cell Differentiation, 40, 117-135.
Kane, D. A., McFarland, K. N., & Warga, R. M. (2005). Mutations in half-baked/E-cadherin
block cell behaviors that are necessary for teleost epiboly. Development (Cambridge,
England), 132(5), 1105-1116.
Kane, D. A., Warga, R. M., & Kimmel, C. B. (1992). Mitotic domains in the early embryo of the
zebrafish. Nature, 360(6406), 735-737.
Kane, D. a, Hammerschmidt, M., Mullins, M. C., Maischein, H. M., Brand, M., van Eeden, F. J.,
Nüsslein-Volhard, C. (1996). The zebrafish epiboly mutants. Development (Cambridge,
England), 123, 47–55.
Kang, M., Day, C. a., Kenworthy, A. K., & DiBenedetto, E. (2012). Simplified equation to
extract diffusion coefficients from confocal FRAP data. Traffic, 13, 1589–1600.
Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., & Schilling, T. F. (1995). Stages of
embryonic development of the zebrafish. Developmental Dynamics: An Official Publication
of the American Association of Anatomists, 203(3), 253-310.
Kimmel, C. B. and Law, R. D. (1985). Cell lineage of zebrafish blastomeres. II. Formation of the
yolk syncytial layer. Developmental Biology, 108(1), 86-93.
Kirik, U., Cifani, P., Albrekt, A. S., Lindstedt, M., Heyden, A., & Levander, F. (2012).
Multimodel pathway enrichment methods for functional evaluation of expression regulation.
Journal of Proteome Research, 11, 2955–2967.
100
Kirschner, M. W., Kirschner, M. W., Mitchison, T., & Mitchison, T. (1986). Microtubule
dynamics. Nature.
Kollman, J. M., Merdes, A., Mourey, L., & Agard, D. a. (2011). Microtubule nucleation by γ-
tubulin complexes. Nature Reviews Molecular Cell Biology, 12(11), 709–721.
Koppen, M., Fernandez, B. G., Carvalho, L., Jacinto, A., & Heisenberg, C. P. (2006).
Coordinated cell-shape changes control epithelial movement in zebrafish and drosophila.
Development (Cambridge, England), 133(14), 2671-2681.
Lachnit, M., Kur, E., & Driever, W. (2008). Alterations of the cytoskeleton in all three
embryonic lineages contribute to the epiboly defect of Pou5f1/Oct4 deficient MZspg
zebrafish embryos. Developmental Biology, 315(1), 1-17.
Langdon, Y. G., & Mullins, M. C. (2011). Maternal and Zygotic Control of Zebrafish
Dorsoventral Axial Patterning. Annual Review of Genetics, 45, 357–377.
Lepage, S. E., & Bruce, A. E. (2010). Zebrafish epiboly: Mechanics and mechanisms. The
International Journal of Developmental Biology, 54(8-9), 1213-1228.
Lepage, S. E., Tada, M., & Bruce, A. E. E. (2014). Zebrafish Dynamin is required for
maintenance of enveloping layer integrity and the progression of epiboly. Developmental
Biology, 385(1), 52–66.
Lindeboom, J. J., Nakamura, M., Hibbel, A., Shundyak, K., Gutierrez, R., Ketelaar, T., Ehrhardt,
D. W. (2013). A mechanism for reorientation of cortical microtubule arrays driven by
microtubule severing. Science, 342(December), 1245533.
Lippok, B., Song, S., & Driever, W. (2014). Pou5f1 protein expression and posttranslational
modification during early zebrafish development. Developmental Dynamics, 243(October
2013), 468–477.
Lloyd, C., & Chan, J. (2004). Microtubules and the shape of plants to come. Nature Reviews.
Molecular Cell Biology, 5(January), 13–22.
101
Markus, S. M., & Lee, W.-L. (2011). Microtubule-dependent path to the cell cortex for
cytoplasmic dynein in mitotic spindle orientation. BioArchitecture, 1(July 2015), 209–215.
McNally, F J, and S Thomas. (1998). Katanin Is Responsible for the M-Phase Microtubule-
Severing Activity in Xenopus Eggs. Molecular Biology of the Cell, 9 (7), 1847–61.
Meijering E, Dzyubachyk O, and Sma I (2012). Methods for cell and particle tracking. Methods
in enzymology, 504, 183-200
Meyerzon, M., Gao, Z., Liu, J., Wu, J.-C., Malone, C. J., & Starr, D. A. (2009). Centrosome
attachment to the C. elegans male pronucleus is dependent on the surface area of the nuclear
envelope. Developmental Biology, 327(2), 433–446.
Mimori-Kiyosue, Y. (2011). Shaping microtubules into diverse patterns: Molecular connections
for setting up both ends. Cytoskeleton, 68(November), 603–618.
Montero, J.-A., Carvalho, L., Wilsch-Bräuninger, M., Kilian, B., Mustafa, C., & Heisenberg, C.-
P. (2005). Shield formation at the onset of zebrafish gastrulation. Development (Cambridge,
England), 132(1), 1187–1198.
Morris, N. R. (2002). Nuclear positioning: The means is at the ends. Current Opinion in Cell
Biology, 15, 54–59.
Murata, T., Sonobe, S., Baskin, T. I., Hyodo, S., Hasezawa, S., Nagata, T., & Hasebe, M. (2005).
Microtubule-dependent microtubule nucleation based on recruitment of gamma-tubulin in
higher plants. Nature Cell Biology, 7(10), 961–968.
Nakano, A., Kato, H., Watanabe, T., Min, K.-D., Yamazaki, S., Asano, Y., Takashima, S. (2010).
AMPK controls the speed of microtubule polymerization and directional cell migration
through CLIP-170 phosphorylation. Nature Cell Biology, 12(6), 583–590.
Paoletti, A., Moudjou, M., Paintrand, M., Salisbury, J. L., & Bornens, M. (1996). Most of centrin
in animal cells is not centrosome-associated and centrosomal centrin is confined to the
distal lumen of centrioles. Journal of Cell Science, 109 (13), 3089–3102
102
Pei, W., Noushmehr, H., Costa, J., Ouspenskaia, M. V., Elkahloun, A. G., & Feldman, B. (2007).
An Early Requirement for Maternal FoxH1 during Zebrafish Gastrulation. Developmental
Biology, 310(1), 10–22.
Peterman, E. J. G., & Scholey, J. M. (2009). Mitotic Microtubule Crosslinkers: Insights from
Mechanistic Studies. Current Biology, 19(23), R1089–R1094.
Peris, L., Thery, M., Fauré, J., Saoudi, Y., Lafanechère, L., Chilton, J. K., Job, D. (2006).
Tubulin tyrosination is a major factor affecting the recruitment of CAP-Gly proteins at
microtubule plus ends. Journal of Cell Biology, 174(6), 839–849.
Peris, L., Wagenbach, M., Lafanechère, L., Brocard, J., Moore, A. T., Kozielski, F., Andrieux, A.
(2009). Motor-dependent microtubule disassembly driven by tubulin tyrosination. Journal
of Cell Biology, 185(7), 1159–1166.
Pollard, T. D., & Borisy, G. G. (2003). Cellular motility driven by assembly and disassembly of
actin filaments. Cell, 112, 453–465.
Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, Maryland, USA,
http://imagej.nih.gov/ij/, 1997-2014.
Reim, G., & Brand, M. (2006). Maternal control of vertebrate dorsoventral axis formation and
epiboly by the POU domain protein Spg/Pou2/Oct4. Development (Cambridge, England),
133, 2757–2770.
Rivero, S., Cardenas, J., Bornens, M., & Rios, R. M. (2009). Microtubule nucleation at the cis-
side of the Golgi apparatus requires AKAP450 and GM130. The EMBO Journal, 28(8),
1016–1028.
Roll-Mecak, A., & McNally, F. J. (2010). Microtubule-severing enzymes. Current Opinion in
Cell Biology, 22(1), 96–103.
Roossien, Douglas H, Phillip Lamoureux, and Kyle E Miller. (2014). Cytoplasmic Dynein
Pushes the Cytoskeletal Meshwork Forward during Axonal Elongation. Journal of Cell
Science 127
103
Sabel, J. L., d’Alençon, C., O’Brien, E. K., Otterloo, E. Van, Lutz, K., Cuykendall, T. N.,
Cornell, R. a. (2009). Maternal Interferon Regulatory Factor 6 is required for the
differentiation of primary superficial epithelia in Danio and Xenopus embryos.
Developmental Biology, 325(1), 249–262.
Salisbury, J. L. (1995). Centrin, centrosomes, and mitotic spindle poles. Current Opinion in Cell
Biology, 7(1), 39–45.
Schmoranzer, J., Fawcett, J. P., Segura, M., Tan, S., Vallee, R. B., Pawson, T., & Gundersen, G.
G. (2009). Par3 and Dynein Associate to Regulate Local Microtubule Dynamics and
Centrosome Orientation during Migration. Current Biology, 19(13), 1065–1074.
Schoppmeier, J., Mages, W., & Lechtreck, K. F. (2005). GFP as a tool for the analysis of
proteins in the flagellar basal apparatus of Chlamydomonas. Cell Motility and the
Cytoskeleton, 61, 189–200.
Sharp, D. J., & Ross, J. L. (2012). Microtubule-severing enzymes at the cutting edge. Journal of
Cell Science, 125, 2561–2569.
Shimomura, S., Nagamine, T., Nimura, T., Sueyoshi, N., Shigeri, Y., & Kameshita, I. (2007).
Expression, characterization, and gene knockdown of zebrafish doublecortin-like protein
kinase. Archives of Biochemistry and Biophysics, 463(2), 218-230.
Shimizu, T., Yabe, T., Muraoka, O., Yonemura, S., Aramaki, S., Hatta, K., Bae, Y. K., Nojima,
H., Hibi, M. (2005). E-cadherin is required for gastrulation cell movements in zebrafish.
Mechanisms of Development, 122(6), 747-763.
Siddiqui, M., Sheikh, H., Tran, C., & Bruce, a. E. (2010). The tight junction component Claudin
E is required for zebrafish epiboly. Developmental Dynamics : An Official Publication of
the American Association of Anatomists, 239(December 2009), 715–722.
Slanchev K, Carney TJ, Stemmler MP, Koschorz B, Amsterdam A, et al. (2009) The Epithelial
Cell Adhesion Molecule EpCAM Is Required for Epithelial Morphogenesis and Integrity
during Zebrafish Epiboly and Skin Development. PLoS Genet 5(7)
104
Solnica-Krezel, L. (2005). Conserved patterns of cell movements during vertebrate gastrulation.
Current Biology: CB, 15(6), R213-28.
Solnica-Krezel, L., & Driever, W. (1994). Microtubule arrays of the zebrafish yolk cell:
Organization and function during epiboly. Development, 120(9), 2443-2455.
Solnica-Krezel, L., & Sepich, D. S. (2012). Gastrulation: Making and Shaping Germ Layers.
Annual Review of Cell and Developmental Biology, 28, 687–717.
Song, S., Eckerle, S., Onichtchouk, D., Marrs, J. A., Nitschke, R., & Driever, W. (2013). Pou5f1-
dependent EGF expression controls E-cad endocytosis, cell adhesion, and zebrafish epiboly
movements. Developmental Cell, 24(5), 486–501.
Splinter, D., Tanenbaum, M. E., Lindqvist, A., Jaarsma, D., Flotho, A., Yu, K. Lou, &
Akhmanova, A. (2010). Bicaudal D2, dynein, and kinesin-1 associate with nuclear pore
complexes and regulate centrosome and nuclear positioning during mitotic entry. PLoS
Biology, 8(4).
Sprague, B. L., & McNally, J. G. (2005). FRAP analysis of binding: Proper and fitting. Trends in
Cell Biology, 15(2), 84–91.
Starr, D. A. (2009). A nuclear-envelope bridge positions nuclei and moves chromosomes.
Journal of Cell Science, 122, 577–586.
Starr, D. A. (2011). Watching nuclei move: Insights into how kinesin-1 and dynein function
together. Bioarchitecture, 1(1), 9–13.
Strahle, U., & Jesuthasan, S. (1993). Ultraviolet irradiation impairs epiboly in zebrafish embryos:
Evidence for a microtubule-dependent mechanism of epiboly. Development (Cambridge,
England), 119(3), 909-919.
Subramanian, R., & Kapoor, T. M. (2012). Building Complexity: Insights into Self-Organized
Assembly of Microtubule-Based Architectures. Developmental Cell, 23(5), 874–885.
Tanenbaum, M. E., Akhmanova, A., & Medema, R. H. (2010). Dynein at the nuclear envelope.
EMBO Reports, 11(9), 649.
105
Topczewski, J., & Solnica-Krezel, L. (1999). Cytoskeletal dynamics of the zebrafish embryo.
Methods in Cell Biology, 59, 205-226.
Tran, Long Duc, Hiromu Hino, Helen Quach, Shimin Lim, Asako Shindo, Yuko Mimori-
Kiyosue, Marina Mione. (2012). Dynamic Microtubules at the Vegetal Cortex Predict the
Embryonic Axis in Zebrafish. Development (Cambridge, England) 139 (19): 3644–52.
Trinkaus, J. P. (1951). A study of mechanisms of epiboly in the egg of Fundulus heteroclitus J
Exp Zool 118: 269-320
Umeshima, H., Hirano, T., & Kengaku, M. (2007). Microtubule-based nuclear movement occurs
independently of centrosome positioning in migrating neurons. Proceedings of the National
Academy of Sciences of the United States of America, 104(41), 16182–16187.
Vignaud, T., Blanchoin, L., and Thery, M.(2012). Directed cytoskeleton self-organization.
Trends cell biology, (22)12: 671-682
Warga, R. M., & Kimmel, C. B. (1990). Cell movements during epiboly and gastrulation in
zebrafish. Development (Cambridge, England), 108: 569–580.
Webb, S. E., & Miller, A. L. (2006). Ca2+ signaling and early embryonic patterning during the
Blastula and Gastrula Periods of Zebrafish and Xenopus development. Biochimica et
Biophysica Acta - Molecular Cell Research, 1763, 1192–1208.
Weisenberg RC, Borisy GG, and Taylor EW. (1968). The colchicine-binding protein of
mammalian brain and its relation to microtubules. Biochemistry. 7(12): 4466-79
Weisenberg RC and Deery WJ. (1976). Role of nucleotide hydrolysis in microtubule assembly.
Nature. 263(5580): 792-793
Weng JH, Liang MR, Chen CH, Tong SK, Huang TC, Lee SP, Chen YR, Chen CT, and Chung
BC. (2013). Pregnenolone activates CLIP-170 to promote microtubule growth and cell
migration. Nat Chem Biol. 9 (10): 636-42
Westerfield, M. (1993). The zebrafish book. Eugene: University of Oregon Press.
106
Westermann, S., & Weber, K. (2003). Post-translational modifications regulate microtubule
function. Nature Reviews. Molecular Cell Biology, 4(December), 938–947. Wilson, E. T.,
Cretekos, C. J., & Helde, K. A. (1995). Cell mixing during early epiboly in the zebrafish
embryo. Developmental Genetics, 17(1), 6-15.
Wloga, D., & Gaertig, J. (2010). Post-translational modifications of microtubules. Journal of Cell
Science, 124, 154–154.
Xie, Z., Sanada, K., Samuels, B. A., Shih, H., & Tsai, L. H. (2003). Serine 732 phosphorylation
of FAK by Cdk5 is important for microtubule organization, nuclear movement, and
neuronal migration. Cell, 114, 469–482.
Yamamoto, A., Tsutsumi, C., Kojima, H., Oiwa, K., & Hiraoka, Y. (2001). Dynamic behavior of
microtubules during dynein-dependent nuclear migrations of meiotic prophase in fission
yeast. Molecular Biology of the Cell, 12(12), 3933-3946.
Yang, Hailing; Ganguly, Anutosh; Cabral, Fernando (2010). Inhibition of Cell Migration and
Cell Division Correlates with Distinct Effects of Microtubule Inhibiting Drugs. The Journal
of Biological Chemistry 285 (42): 32242–50.
Yu, J., Lei, K., Zhou, M., Craft, C. M., Xu, G., Xu, T., & Han, M. (2011). KASH protein Syne-
2/Nesprin-2 and SUN proteins SUN1/2 mediate nuclear migration during mammalian
retinal development. Human Molecular Genetics, 20(6), 1061–1073.
Yuen, M. Y. F., Webb, S. E., Chan, C. M., Thisse, B., Thisse, C., & Miller, A. L. (2013).
Characterization of Ca2+ signaling in the external yolk syncytial layer during the late
blastula and early gastrula periods of zebrafish development. Biochimica et Biophysica
Acta - Molecular Cell Research, 1833(7), 1641–1656.
Zhang, X., Lei, K., Yuan, X., Wu, X., Zhuang, Y., Xu, T., & Han, M. (2009). SUN1/2 and
Syne/Nesprin-1/2 Complexes Connect Centrosome to the Nucleus during Neurogenesis and
Neuronal Migration in Mice. Neuron, 64(2), 173–187.
107
Zalik, S. E., Lewandowski, E., Kam, Z., & Geiger, B. (1999). Cell adhesion and the actin
cytoskeleton of the enveloping layer in the zebrafish embryo during epiboly. Biochemistry
and Cell Biology, 77, 527–542.
Supplementary Figure 1. Expression of EB3-mCitrine in the wild type zebrafishembryo. Microinjection of EB3-mCitrine construct. (A) Confocal microscopy of EB3-mCitrine expression in the blastoderm at sphere stage (Lateral view) B) Confocalmicroscopy of EB3-mCitrine expression in the blastoderm at sphere stage (Crosssection view) C) Schematic of 1-cell stage injection into the yolk cell. D) Schematic ofEB3-mCitrine fusion construct. Orientation of embryo: animal pole up.
108
Appendix I – Supplementary Figures
Supplementary Figure 2. Microtubule appear to detach and reattach in the yolkcell. Live imaging of tuba8l embryo at sphere stage reveal microtubule from onenetwork detach and reattach to another microtubule in the yolk cell. Orientation ofembryo: animal pole on right. Red dotted line indicate the microtubule of interest.
109
Supplementary Figure 3. Expression of mVenus-Camsap1 in the wild type embryo.Confocal projection of mvenus-camsap1 injected wild type embryo at sphere stage.A) imaged at 20x B) imaged at 40x. Orientation of embryo: animal up
110
Supplementary Figure 4. GFP-Camsap2 distribution in the yolk cell. Confocalprojections of A) wildtype embryos injected with gfp-camsap2 RNA at 1-cell stageand B) 1in8 cell gfp-camsap2 RNA overexpression in WT embryos. Noncentrosomalminus end, gfp-camsap2 RNA, distribution was difficult to determine in theblastoderm and yolk cell. Orientation of embryo: animal pole up.
111
Supplementary Figure 5. Nocodazole-recovery regime reveals no yolk microtubulerecovery and partially depolymerized microtubules. Live imaging of tuba8l embryosat sphere stage treated with 1µg/mL and 5µg/mL nocodazole via SP8 confocalmicroscopy. A) Treated tuba8l transgenic embryo at [high] for 30minutes. A’) no yolkmicrotubule recovery observed after ~1hr 30minutes. B) Treated tuba8l transgenicembryo at [low] for 10minutes. B’) partial microtubule depolymerization after~30minutes. B’’’) untreated tuba8l embryo overview at 20X. Orientation of embryo:animal pole up.
112
Supplementary Figure 6. Movement of microtubule fragments after nocodazoletreatment during early epiboly. Live confocal imaging of a dclk2 embryo. Nocodazolewas treated at 10µg/mL. A) Downward movement after 30 minute treatment. B)Downward movement after 1 hour treatment. C-G) Upward movement ofmicrotubule fragments toward animal pole. C,D) nocodazole treatment for 30minutes. E-G) nocodazole treatment for 1hr. Microtubules simultaneouslydisassembled. D-G) Microtubule fragments travel from the blastoderm to yolk. H)Speed range of microtubule fragment movement after nocodazole treatment.Orientation of embryo: animal pole up. Dotted red line indicates the fragment ofinterest.
113
114
Appendix II - Supplementary tables
1 PCR primer sequences
Amplified Gene Forward primer (5’ to 3’)
Reverse primer (5’ to 3’)
Added Site Size (bp)
Camsap2-GFP for RNA transcription
ATTTAGGTGACACTATAGAAGAGATGGTGAGCAAGGGCGAGGA
CTATGCCTTAGTGGGTAAAAGTT
SP6 by forward primer
~5000
Camsap1 for mVenus-Camsap1 fusion
AAGGCCTTCGGGAAAAGAGAGCGTCCCC
TCTCGAGTCATTTACGAGTCTGGGCCTT
StuI by forward primer and XhoI by reverse primer
386
TagRFPT for pCS2+TagRFPT fusion
TACTTGAATTCGATGGTGTCTAAGGGCGAAGA
TATCCTCGAGTTACTTGTACAGCTCGTCCA
EcoRI by forward primer and XhoI by reverse primer
735
EB3 for EB3-TagRFPT fusion
ACGGGATCCGCCACCATGGCCGTCAATGTGTACTC
GACCATCGATGTACTCGTCCTGGTCTTCTT
Kozac sequence, BamHI by forward primer, and ClaI by reverse primer, no stop codon
850
EB3 for EB-mCitrine fusion
ACGGGATCCGCCACCATGGCCGTCAATGTGTACTC
GACCATCGATCGTACTCGTCCTGGTCTTCTT
Kozac sequence, BamHI by forward primer, 1nt (btw cla and last EB3), and ClaI by reverse primer, no stop codon
850
(Zebrafish) Katna1 for pGEM-Katna1 fusion
ATGAGTTTGGGGGAGATCAA
GCAGGAGCCAAACTCTGCAA
~1500
115
(Zebrafish) Kif5Bb for pGEM-Kif5Bb fusion
ATGGCGGACCCGGCGGAGTG
TTACTGTTTGACTCCGCCTC
2880
(Zebrafish) Dync1i2a for pGEM-Dync1i2a fusion
ATGACCGAGCAGAAGGACGA
AGCGGCGAGGCGTTGTGCGG
~1500
Katna1 for Katna1-TagRFPT fusion
CTCGGATCCGCCACCATGAGTTTGGGGGAGATCAA
GCTCATCGATTTAGCAGGAGCCAAACTCTGCAA
BamHI by forward primer, ClaI by reverse primer, Kozac sequence
~1500
Katna1 for Katna1-eGFP fusion
CTCGGATCCGCCACCATGAGTTTGGGGGAGATCAA
GCTCATCGATAGCAGGAGCCAAACTCTGCAA
BamHI by forward primer, ClaI by reverse primer, Kozac sequence, 1nt btw Katna1 and eGFP
~1500
eGFP for genotyping Tuba8l-eGFP
ACGGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG
TCGCCCTCGAACTTCACCTC
Mid EGFP antisense 350bp
350
eGFP for Katna1-eGFP
ACGGGATCCGCCACCATGGTGAGCAAGGGCGAGGAG
ATGAACTTCAGGGTCAGCTTGC
122-143bp EGFP primer R
~122
EB3+mCitrine ACGGGATCCGCCACCATGGCCGTCAATGTGTACTC
TCGACCAGGATGGGCACCAC
Kozac sequence, BamHI by forward primer, Mid mCitrine antisense
~1200
116
2 Rating of different methodologies for yolk antibody staining
4% FA fixed
2hrs at RT,
chorion
intact, glass tube,
4% FA
fixed 2hrs at
RT, chori
on intac
t, glass plate
4% FA
fixed 2hrs
at RT, chorio
n intact,
no metha
nol
4% FA
fixed O/N,
chorion
intact, no
methanol
stabilized, then
4% FA fixed 2hrs,
chorion
intact, no
methanol
MSB fixed 1.5hrs at RT,
chorion
removed
MSB fixed 4hrs
at RT, chori
on removed
MSB fixed 1.5hrs at RT, chorio
n intact,
no metha
nol
MSB fixed 3hrs at
4°C, chori
on removed
stabilized, then MSB fixed 2hrs,
chorion
intact, no
methanol
MT morphology in YSL
++ + ++ + - +++ ++ ++ ++ -
MT morphology in YCL
- - - - - ++ + + + -
117
3 FRAP half time values
Late Epiboly-FRAP Early Epiboly-FRAP
Experiment Half time Experiment Half time
041215-EM1 4.6068 093015-EM1 exp.4 10.0476
041215-EM2 5.0784 100314-EM4 2.7895
041415-EM1 exp.1 5.37 050214-EM1 4.132
041415-EM2 9.2021 Mean 5.656366667
041415-EM3 4.8717 Standard Error 2.229557071
041415-EM4 6.4956
041415-EM5 5.413
051215-EM1 exp.2 5.0796
051215-EM2 exp. 2 11.556
051215-EM3 exp. 1 21.4928
051215-EM4 18.4776
051315-EM1 exp. 4 10.1568
051315-EM2 exp. 3 12.6975
051315-EM3 7.6185
Mean
9.151171429
Standard Error
1.422878733
118
4 Raw data for FRAP analysis
4.1 Late epiboly
1 2 3 4
6 1 27.744 0.074 0.019 0.03 0.2 0.08075 32.937 27.66325 0.839883717 0.932462843 0.900715482 27.528 0.086 0.007 0.037 0.235 0.09125 31.782 27.43675 0.863279529 0.932462843 0.9258058233 27.161 0.091 0.01 0.048 0.237 0.0965 30.267 27.0645 0.894191694 0.932462843 0.9589569184 27.049 0.156 0.014 0.036 0.32 0.1315 30.113 26.9175 0.893883041 0.932462843 0.9586259095 27.445 0.111 0.026 0.04 0.295 0.118 28.949 27.327 0.943970431 0.932462843 1.0123410696 27.059 0.282 0.067 0.098 0.884 0.33275 28.662 26.72625 0.932462843 0.932462843 17 14.309 0.067 0.021 0.036 0.138 0.0655 28.437 14.2435 0.500879136 0.932462843 0.5371572078 18.619 0.038 0.019 0.018 0.161 0.059 26.705 18.56 0.695000936 0.932462843 0.7453390149 20.264 0.062 0.017 0.05 0.171 0.075 25.611 20.189 0.788294092 0.932462843 0.845389281
10 21.151 0.022 0.014 0.02 0.238 0.0735 26.549 21.0775 0.793909375 0.932462843 0.85141127211 21.18 0.069 0.029 0.052 0.456 0.1515 26.304 21.0285 0.79944115 0.932462843 0.85734370612 20.966 0.095 0.01 0.024 0.442 0.14275 26.576 20.82325 0.783535897 0.932462843 0.84028645513 21.438 0.056 0.014 0.016 0.201 0.07175 25.903 21.36625 0.824856194 0.932462843 0.88459953214 21.097 0.066 0.007 0.026 0.262 0.09025 26.598 21.00675 0.789786826 0.932462843 0.84699013215 21.46 0.072 0.017 0.022 0.153 0.066 26.923 21.394 0.794636556 0.932462843 0.85219112216 21.484 0.046 0.022 0.01 0.139 0.05425 27.535 21.42975 0.778273107 0.932462843 0.83464248817 21.487 0.046 0.029 0.046 0.217 0.0845 27.18 21.4025 0.787435614 0.932462843 0.84446862518 21.296 0.06 0.015 0.028 0.23 0.08325 26.762 21.21275 0.792644421 0.932462843 0.85005469919 21.33 0.069 0.01 0.028 0.232 0.08475 26.833 21.24525 0.791758283 0.932462843 0.84910437920 21.694 0.044 0.007 0.024 0.201 0.069 27.263 21.625 0.793199575 0.932462843 0.85065006121 21.379 0.034 0.012 0.02 0.246 0.078 26.987 21.301 0.789305962 0.932462843 0.84647443922 21.105 0.042 0.014 0.014 0.168 0.0595 26.246 21.0455 0.801855521 0.932462843 0.85993294823 21.663 0.034 0.019 0.02 0.12 0.04825 26.833 21.61475 0.80552864 0.932462843 0.86387210624 21.513 0.054 0.007 0.03 0.138 0.05725 26.85 21.45575 0.799096834 0.932462843 0.85697445325 21.668 0.03 0.005 0.038 0.093 0.0415 27.406 21.6265 0.789115522 0.932462843 0.84627020626 20.934 0.042 0.007 0.016 0.091 0.039 27.527 20.895 0.75907291 0.932462843 0.81405164427 20.886 0.052 0.02 0.016 0.1 0.047 28.379 20.839 0.734310582 0.932462843 0.7874958128 20.882 0.065 0.017 0.025 0.068 0.04375 28.743 20.83825 0.724985214 0.932462843 0.77749501729 20.957 0.04 0.007 0.02 0.087 0.0385 28.865 20.9185 0.724701195 0.932462843 0.77719042730 21.062 0.046 0.014 0.028 0.052 0.035 27.647 21.027 0.760552682 0.932462843 0.81563859431 21.378 0.056 0.005 0.016 0.144 0.05525 28.25 21.32275 0.754787611 0.932462843 0.80945596532 20.745 0.05 0.017 0.018 0.083 0.042 28.666 20.703 0.72221447 0.932462843 0.77452359233 20.946 0.091 0.005 0.022 0.165 0.07075 30.071 20.87525 0.69419873 0.932462843 0.74447870534 21.252 0.094 0.01 0.034 0.132 0.0675 30.777 21.1845 0.688322449 0.932462843 0.73817681235 21.176 0.054 0.019 0.02 0.101 0.0485 30.829 21.1275 0.68531253 0.932462843 0.73494888936 21.34 0.022 0.012 0.016 0.096 0.0365 31.946 21.3035 0.666859701 0.932462843 0.71515954337 22.112 0.026 0.007 0.012 0.111 0.039 30.642 22.073 0.720351152 0.932462843 0.77252531638 21.41 0.028 0.005 0.014 0.085 0.033 31.086 21.377 0.687672907 0.932462843 0.73748022539 21.423 0.019 0.008 0.02 0.044 0.02275 31.312 21.40025 0.683452031 0.932462843 0.73295363640 21.778 0.038 0.007 0.025 0.087 0.03925 31.643 21.73875 0.687000284 0.932462843 0.73675888541 21.444 0.028 0.01 0.006 0.134 0.0445 31.9 21.3995 0.670830721 0.932462843 0.7194181842 21.403 0.026 0.01 0.038 0.117 0.04775 32.262 21.35525 0.661931994 0.932462843 0.70987492943 21.429 0.023 0.01 0.01 0.136 0.04475 32.438 21.38425 0.65923454 0.932462843 0.70698210144 21.424 0.026 0.017 0.01 0.17 0.05575 31.534 21.36825 0.677625737 0.932462843 0.72670535145 21.33 0.032 0.005 0.014 0.107 0.0395 31.443 21.2905 0.677114143 0.932462843 0.72615670246 21.079 0.032 0.005 0.012 0.166 0.05375 30.129 21.02525 0.697840951 0.932462843 0.74838472847 21.737 0.06 0.01 0.024 0.07 0.041 29.351 21.696 0.739191169 0.932462843 0.79272989248 21.514 0.022 0.01 0.028 0.058 0.0295 31.202 21.4845 0.688561631 0.932462843 0.73843331849 21.068 0.038 0.012 0.024 0.024 0.0245 30.701 21.0435 0.685433699 0.932462843 0.73507883450 20.67 0.02 0.017 0.01 0.038 0.02125 31.262 20.64875 0.660506366 0.932462843 0.70834604451 21.145 0.036 0.01 0.022 0.044 0.028 30.272 21.117 0.697575317 0.932462843 0.74809985552 20.607 0.064 0.014 0.014 0.084 0.044 30.18 20.563 0.681345262 0.932462843 0.73069427653 21.411 0.042 0.01 0.02 0.036 0.027 31.644 21.384 0.675767918 0.932462843 0.72471297254 21.384 0.043 0.03 0.02 0.071 0.041 34.503 21.343 0.618583891 0.932462843 0.66338717555 20.614 0.038 0.031 0.01 0.055 0.0335 34.011 20.5805 0.605113052 0.932462843 0.64894065956 20.421 0.014 0.032 0.008 0.054 0.027 34.248 20.394 0.595480028 0.932462843 0.63860992757 20.792 0.016 0.005 0.026 0.032 0.01975 34.196 20.77225 0.607446777 0.932462843 0.65144341458 20.977 0.024 0.012 0.016 0.046 0.0245 34.04 20.9525 0.615525852 0.932462843 0.66010764659 20.851 0.016 0.007 0.006 0.036 0.01625 32.391 20.83475 0.643226514 0.932462843 0.68981463360 21.076 0.014 0.012 0.022 0.018 0.0165 31.401 21.0595 0.670663355 0.932462843 0.71923869161 21.054 0.047 0 0.012 0.036 0.02375 33.242 21.03025 0.632640936 0.932462843 0.67846235562 21.756 0.008 0.015 0.01 0.017 0.0125 33.931 21.7435 0.640815184 0.932462843 0.68722865363 21.571 0.02 0.002 0.02 0.018 0.015 34.084 21.556 0.632437507 0.932462843 0.67824419264 21.091 0.034 0.007 0.012 0.008 0.01525 34.138 21.07575 0.617369207 0.932462843 0.66208451365 21.591 0.034 0.01 0.018 0.016 0.0195 33.773 21.5715 0.63872028 0.932462843 0.68498201866 21.332 0.018 0.007 0.008 0.018 0.01275 34.246 21.31925 0.622532559 0.932462843 0.6676218467 21.05 0.008 0 0.022 0.022 0.013 34.656 21.037 0.607023315 0.932462843 0.6509892868 20.816 0.018 0.007 0.012 0.024 0.01525 32.678 20.80075 0.636536814 0.932462843 0.68264040669 20.681 0.014 0.01 0.014 0.01 0.012 32.338 20.669 0.639155173 0.932462843 0.68544841170 21.246 0.024 0.005 0.01 0.028 0.01675 31.184 21.22925 0.680773794 0.932462843 0.730081418
Normalized values in
relative Fluo units
041215-EM1
Ave. Background Fluo Int.
measurements for each
timepoint
Measure Total Fluo Int. of MTs
farthest away from ROI at each timepoint
Background corrected values
Total corrected
values
Fluo Intensity of Timepoint prior
to bleaching
Approx. MT # in ROI
Time points
Fluo Int. measurements of ROI for
each timepoint
Background Fluo Int. measurements for each timepoint
Experiment #
119
14 1 35.488 5.372 2.932 5.514 7.932 5.4375 50.931 30.0505 0.590023758 0.548232125 1.0762298132 35.042 6.079 3.219 4.616 7.096 5.2525 50.793 29.7895 0.586488296 0.548232125 1.0697809723 34.838 6.049 2.815 6.322 6.158 5.336 49.824 29.502 0.592124277 0.548232125 1.0800612564 34.732 7.25 3.774 6.87 7.075 6.24225 49.319 28.48975 0.577662767 0.548232125 1.0536828125 34.649 8.561 5.575 6.26 7.966 7.0905 49.836 27.5585 0.552983787 0.548232125 1.0086672446 34.16 7.463 4.425 5.795 7.705 6.347 49.693 27.813 0.559696537 0.548232125 1.0209116027 33.37 6.61 3.329 5.986 8.459 6.096 49.749 27.274 0.548232125 0.548232125 18 9.794 2.616 2.267 5.007 7.014 4.226 47.399 5.568 0.117470833 0.548232125 0.2142720719 16.47 4.091 3 4.082 5.164 4.08425 46.168 12.38575 0.268275645 0.548232125 0.489346817
10 18.513 4.14 2.733 5.514 7.521 4.977 47.005 13.536 0.287969365 0.548232125 0.52526904511 19.949 4.701 2.973 6.363 4.568 4.65125 46.431 15.29775 0.329472766 0.548232125 0.60097311212 20.962 4.768 2.555 7.986 6.466 5.44375 45.635 15.51825 0.340051496 0.548232125 0.62026918913 21.888 7.079 4.486 5.493 8.205 6.31575 45.836 15.57225 0.339738415 0.548232125 0.61969811614 22.368 6.537 4.589 6.5 9.685 6.82775 45.4 15.54025 0.342296256 0.548232125 0.62436373215 22.893 6.03 5.301 6.336 9.411 6.7695 46.685 16.1235 0.345367891 0.548232125 0.62996653316 23.091 5.024 4.507 3.342 5.486 4.58975 45.501 18.50125 0.406611943 0.548232125 0.74167843217 23.441 5.628 4.712 3.541 5.87 4.93775 44.039 18.50325 0.420155998 0.548232125 0.76638339718 24.102 5.75 2.281 5.486 7.452 5.24225 46.063 18.85975 0.409433819 0.548232125 0.74682566119 24.259 8.744 3.096 5.89 6.884 6.1535 45.967 18.1055 0.393880392 0.548232125 0.71845551320 24.783 9.159 3.753 7.116 8.062 7.0225 46.012 17.7605 0.385997131 0.548232125 0.7040760921 24.263 8.72 4.199 5.637 9.363 6.97975 45.382 17.28325 0.38083932 0.548232125 0.6946680122 24.237 10.287 3.514 7.377 8.753 7.48275 45.03 16.75425 0.372068621 0.548232125 0.67866986323 24.833 10.567 4.096 8.267 9.397 8.08175 44.647 16.75125 0.375193182 0.548232125 0.68436920224 24.578 8.549 5.151 7.288 12.233 8.30525 44.62 16.27275 0.364696325 0.548232125 0.66522246325 25.171 7.006 1.945 8.171 11.062 7.046 45.131 18.125 0.40160865 0.548232125 0.73255220226 25.252 9.433 2.075 7.829 13.945 8.3205 44.76 16.9315 0.378273012 0.548232125 0.6899869527 25.309 8.841 2.897 9.068 11.363 8.04225 42.731 17.26675 0.404080176 0.548232125 0.73706037628 24.982 9.11 1.603 10.726 12.384 8.45575 43.476 16.52625 0.380123516 0.548232125 0.69336235329 25.598 11.421 1.507 10.164 11.856 8.737 44.422 16.861 0.37956418 0.548232125 0.69234209930 25.647 11.075 2.295 10.452 11.623 8.86125 44.117 16.78575 0.38048258 0.548232125 0.69401730231 25.602 9.274 3.473 11.548 9.61 8.47625 43.931 17.12575 0.38983292 0.548232125 0.71107274132 25.225 10.822 4.349 6.897 11.082 8.2875 43.921 16.9375 0.385635573 0.548232125 0.70341659233 24.95 10.534 3.795 5.205 10.068 7.4005 43.509 17.5495 0.403353329 0.548232125 0.73573457434 25.542 9.664 4.034 6.705 13.432 8.45875 44.075 17.08325 0.387595009 0.548232125 0.7069906935 25.457 9.795 3.226 7.507 12.616 8.286 43.681 17.171 0.393099975 0.548232125 0.71703199636 24.99 10.589 4.452 7.74 11.377 8.5395 44.277 16.4505 0.371536012 0.548232125 0.6776983637 25.16 8.521 4.055 6.541 11.5 7.65425 43.726 17.50575 0.40035105 0.548232125 0.73025828238 25.627 10.336 5.342 6.904 11.007 8.39725 43.45 17.22975 0.396542002 0.548232125 0.72331040939 25.71 9.267 5.822 8.349 7.89 7.832 42.067 17.878 0.424988708 0.548232125 0.775198477
12 1 34.627 13.717 15.6 15.6 17.517 15.6085 29.064 19.0185 0.654366226 0.584014973 1.1204613862 34.436 14.3 16.1 15.05 17.067 15.62925 28.876 18.80675 0.651293462 0.584014973 1.1151999383 34.045 14.433 15.233 13.817 16.35 14.95825 28.906 19.08675 0.660304089 0.584014973 1.1306286994 33.926 14.65 16.233 13.683 16.717 15.32075 29.24 18.60525 0.63629446 0.584014973 1.0895173745 33.316 15.067 16.167 13.05 16.283 15.14175 28.299 18.17425 0.64222234 0.584014973 1.0996675946 33.138 15.717 15.35 13.083 16.217 15.09175 27.826 18.04625 0.648539136 0.584014973 1.1104837487 33.477 14.867 14.95 12.317 15.967 14.52525 28.326 18.95175 0.669058462 0.584014973 1.145618688 33.314 15.267 15.017 13.567 17.4 15.31275 28.572 18.00125 0.630031149 0.584014973 1.0787928029 33.455 15.617 16.317 13.283 18.567 15.946 28.906 17.509 0.605721995 0.584014973 1.037168606
10 33.246 15.967 16.667 15.017 17.933 16.396 28.852 16.85 0.584014973 0.584014973 111 13.943 16.267 16.083 15.883 19.033 16.8165 28.75 -2.8735 -0.099947826 0.584014973 -0.1711391512 20.256 15.367 16.35 15.583 18.417 16.42925 28.698 3.82675 0.133345529 0.584014973 0.22832553213 22.852 13.733 15.983 14.433 18.25 15.59975 28.503 7.25225 0.254438129 0.584014973 0.43567055814 24.582 12.7 13.95 15.417 18.483 15.1375 28.591 9.4445 0.330331223 0.584014973 0.56562115415 25.213 13.417 14.05 13.95 19.483 15.225 28.693 9.988 0.348098839 0.584014973 0.59604437516 26.037 14.717 13.65 12.783 18.65 14.95 28.273 11.087 0.392140912 0.584014973 0.67145694917 26.535 12.8 12.483 13.483 18.65 14.354 28.48 12.181 0.427703652 0.584014973 0.7323504918 26.65 14.467 13.867 14.317 18.75 15.35025 28.419 11.29975 0.397612513 0.584014973 0.68082588819 26.826 15.083 13.383 14.617 18.883 15.4915 28.058 11.3345 0.403966783 0.584014973 0.69170620920 27.235 14.35 13.45 14.7 17.717 15.05425 28.059 12.18075 0.43411205 0.584014973 0.74332349321 27.288 14.35 14.083 15.617 17.167 15.30425 27.785 11.98375 0.431302861 0.584014973 0.73851336222 27.609 14.75 13.65 16.167 18.183 15.6875 27.72 11.9215 0.430068543 0.584014973 0.73639985723 27.725 13.267 12.867 18.517 16.45 15.27525 27.951 12.44975 0.445413402 0.584014973 0.76267462824 28.227 14.167 13.1 16.117 16.95 15.0835 28.23 13.1435 0.465586256 0.584014973 0.797216325 27.816 13.933 13.817 14.517 16.717 14.746 28.04 13.07 0.466119829 0.584014973 0.79812992926 27.804 14 15.067 14.517 17.833 15.35425 27.668 12.44975 0.449969279 0.584014973 0.77047558627 27.823 14.45 14.5 14.867 17.483 15.325 27.585 12.498 0.453072322 0.584014973 0.7757888828 28.229 13.683 14.45 13.95 16.533 14.654 27.862 13.575 0.487222741 0.584014973 0.83426412529 28.276 14.1 14.367 14.467 16.783 14.92925 27.569 13.34675 0.484121658 0.584014973 0.82895418930 28.475 13.333 13 13.95 17.433 14.429 27.907 14.046 0.503314581 0.584014973 0.86181793931 28.253 13.883 13.733 13.517 18.083 14.804 27.671 13.449 0.486032308 0.584014973 0.83222576632 28.058 13.467 12.4 13.5 16.917 14.071 27.277 13.987 0.512776332 0.584014973 0.87801915333 28.261 13.75 13.417 14.717 17.583 14.86675 26.979 13.39425 0.496469476 0.584014973 0.85009717134 28.126 13.25 12.35 14.333 18.35 14.57075 26.987 13.55525 0.502288139 0.584014973 0.86006037935 28.502 12.483 12.3 14.767 19.65 14.8 27.432 13.702 0.499489647 0.584014973 0.85526856436 28.718 12.35 11.317 14.283 19.867 14.45425 27.872 14.26375 0.511759113 0.584014973 0.87627738537 28.95 12.65 12.15 14 19.267 14.51675 27.996 14.43325 0.515546864 0.584014973 0.88276309338 28.671 12.717 12.283 15.15 18.583 14.68325 27.417 13.98775 0.510185287 0.584014973 0.87358254539 28.8 12.4 12.533 15.483 19.983 15.09975 27.336 13.70025 0.501179763 0.584014973 0.85816252340 28.409 11.9 12.467 15.383 20.033 14.94575 27.136 13.46325 0.496139814 0.584014973 0.84953269641 27.828 12.383 12.583 14.133 20.733 14.958 26.828 12.87 0.479722678 0.584014973 0.82142188142 28.034 12.233 12.383 13.8 19.1 14.379 26.912 13.655 0.507394471 0.584014973 0.86880387443 27.901 11.9 12.617 14.917 17.267 14.17525 26.447 13.72575 0.518990812 0.584014973 0.88866011344 27.673 14.767 11.883 14.85 16.05 14.3875 26.113 13.2855 0.508769578 0.584014973 0.8711584545 28.022 13.283 10.7 14.717 15.183 13.47075 26.579 14.55125 0.547471688 0.584014973 0.93742748646 28.296 11.35 11.667 13.967 15.883 13.21675 26.518 15.07925 0.568642054 0.584014973 0.97367718447 28.015 12.267 13.167 13 15.867 13.57525 25.948 14.43975 0.556487976 0.584014973 0.95286594
041215-EM2
041415-EM1 exp.1
120
8 1 38.12 2.676 5.853 7.059 7.441 5.75725 37.106 32.36275 0.872170269 0.754820619 1.1554669372 37.464 5.265 6 9.5 8.941 7.4265 37.361 30.0375 0.803980086 0.754820619 1.0651273513 37.413 5.735 7.265 9.176 7.647 7.45575 37.529 29.95725 0.798242692 0.754820619 1.0575263484 37.348 6.412 10.676 12.353 9.118 9.63975 37.671 27.70825 0.735532638 0.754820619 0.9744469345 37.281 5.324 10.5 11.853 11.735 9.853 37.311 27.428 0.73511833 0.754820619 0.9738980516 37.556 5.176 10.088 11.912 13.059 10.05875 37.141 27.49725 0.740347594 0.754820619 0.9808258757 37.7 4.235 10.559 13.824 14.471 10.77225 36.782 26.92775 0.732090425 0.754820619 0.9698866288 37.58 4.765 10.294 11 13.088 9.78675 36.821 27.79325 0.754820619 0.754820619 19 19.885 3.147 7.118 4.735 7.647 5.66175 36.832 14.22325 0.386165563 0.754820619 0.511599118
10 23.3 4.5 6.971 4.147 4 4.9045 36.66 18.3955 0.501786688 0.754820619 0.66477607511 24.755 3.294 9 8.676 7.471 7.11025 36.342 17.64475 0.485519509 0.754820619 0.64322502212 25.823 3.059 8.912 9.529 7.412 7.228 36.193 18.595 0.513773382 0.754820619 0.68065626313 26.212 3.147 9.441 7.441 4.853 6.2205 35.879 19.9915 0.557192229 0.754820619 0.73817833714 26.475 3.294 10.853 8.794 5 6.98525 35.504 19.48975 0.548945189 0.754820619 0.72725250915 27.227 2.794 12.794 8.853 4.912 7.33825 35.805 19.88875 0.555474096 0.754820619 0.73590212316 27.526 1.912 9.618 10.265 5.206 6.75025 35.682 20.77575 0.582247352 0.754820619 0.77137181617 27.664 2.853 9.941 8.941 4.676 6.60275 35.303 21.06125 0.596585276 0.754820619 0.79036695718 27.816 4.147 6.529 9.059 4.324 6.01475 34.978 21.80125 0.623284636 0.754820619 0.82573875219 27.794 2.265 5.471 11.765 6.647 6.537 35.29 21.257 0.602351941 0.754820619 0.79800673920 27.786 3.706 5.824 4.971 5.676 5.04425 35.29 22.74175 0.644424766 0.754820619 0.85374557921 27.726 3.176 6.794 9.794 8.118 6.9705 34.501 20.7555 0.601591258 0.754820619 0.79699897322 27.894 2.559 5.853 8.853 8.265 6.3825 34.768 21.5115 0.618715486 0.754820619 0.81968545923 28.322 2.412 3.676 6.029 7.912 5.00725 35.016 23.31475 0.665831334 0.754820619 0.88210538724 27.975 2.794 4.029 2.382 6.382 3.89675 34.758 24.07825 0.692739801 0.754820619 0.9177542125 27.975 3.706 5.676 4.588 8.647 5.65425 34.495 22.32075 0.647072039 0.754820619 0.85725273426 27.715 1.794 5.882 5.794 6.559 5.00725 34.713 22.70775 0.654156944 0.754820619 0.86663894427 28.292 1.941 5.235 5.618 5.824 4.6545 34.829 23.6375 0.678672945 0.754820619 0.89911818528 28.53 1.412 2.441 3.676 4.059 2.897 34.712 25.633 0.738447799 0.754820619 0.97830899229 28.331 1.912 3.029 4.765 3.559 3.31625 34.112 25.01475 0.733312324 0.754820619 0.97150542230 28.572 2.971 3.441 4.147 3.735 3.5735 34.201 24.9985 0.73092892 0.754820619 0.96834784631 28.617 2.118 5.118 5.824 6.059 4.77975 34.481 23.83725 0.691315507 0.754820619 0.9158672832 28.823 2.676 4.824 7.441 5.529 5.1175 34.571 23.7055 0.685704781 0.754820619 0.90843408933 28.513 3.853 4.324 5.206 4.412 4.44875 34.406 24.06425 0.699420159 0.754820619 0.9266044734 28.335 2 3.294 4.206 6.412 3.978 34.152 24.357 0.713193956 0.754820619 0.94485224535 28.107 2.794 5.088 5.559 5.647 4.772 34.158 23.335 0.683148896 0.754820619 0.90504800636 28.35 2.176 3.618 4.794 3.647 3.55875 34.389 24.79125 0.720906394 0.754820619 0.95506982237 28.315 2.912 4.559 7.147 4.824 4.8605 35.007 23.4545 0.669994573 0.754820619 0.8876209238 28.621 3 4.647 10.588 6.294 6.13225 35.183 22.48875 0.639193645 0.754820619 0.84681529439 28.871 3.176 7.5 14.765 6.382 7.95575 35.166 20.91525 0.594757721 0.754820619 0.78794577940 28.998 4.382 8.176 14.294 7.294 8.5365 34.829 20.4615 0.587484567 0.754820619 0.77831017441 28.865 4.5 6.735 8.618 3.382 5.80875 34.453 23.05625 0.669208777 0.754820619 0.88657988442 28.317 3.059 4.353 6.265 3.853 4.3825 33.92 23.9345 0.705616156 0.754820619 0.93481303843 28.344 3.529 5.647 6.235 6.059 5.3675 33.971 22.9765 0.676356304 0.754820619 0.89604905744 28.456 2.324 4.235 4.794 7.147 4.625 33.97 23.831 0.701530762 0.754820619 0.92940063545 28.352 2.618 4.412 6.471 9.088 5.64725 33.97 22.70475 0.668376509 0.754820619 0.8854772846 28.653 2.676 3.824 5.588 9.676 5.441 34.046 23.212 0.681783469 0.754820619 0.90323906447 28.428 2.588 3.441 6.029 9.265 5.33075 34.227 23.09725 0.67482543 0.754820619 0.89402092848 28.569 3.471 4.029 6.088 5.588 4.794 34.252 23.775 0.694120051 0.754820619 0.919582791
5 1 20.791 7.3 9.15 12.01 13.212 10.418 21.405 10.373 0.4846064 0.493359299 0.9822585722 20.826 7.025 10.79 13.375 12.817 11.00175 21.224 9.82425 0.462883999 0.493359299 0.9382289953 20.898 6.062 9.53 12.885 11.885 10.0905 21.339 10.8075 0.506467032 0.493359299 1.0265683314 20.559 6.5 8.17 14.135 12.644 10.36225 20.668 10.19675 0.493359299 0.493359299 1.0000000015 6.558 6.188 9.26 12.923 13.817 10.547 19.885 -3.989 -0.20060347 0.493359299 -0.4066072546 11.079 5.625 10.2 12.615 13.288 10.432 18.802 0.647 0.034411233 0.493359299 0.0697488287 13.201 4.662 10.44 12.404 12.731 10.05925 18.49 3.14175 0.169916171 0.493359299 0.3444065448 14.287 4.962 9.35 11.49 13.663 9.86625 18.309 4.42075 0.241452291 0.493359299 0.4894045619 14.891 4.95 9.18 13.404 12.019 9.88825 18.227 5.00275 0.274469194 0.493359299 0.556327193
10 14.888 4.35 8.85 14.423 12.394 10.00425 17.941 4.88375 0.272211694 0.493359299 0.5517514211 15.251 5.825 9.37 15.038 14.183 11.104 17.972 4.147 0.23074783 0.493359299 0.46770747112 16.275 5.088 9.74 14.135 12.452 10.35375 18.306 5.92125 0.323459521 0.493359299 0.65562668413 17.113 5.762 9.31 11.721 12.663 9.864 18.809 7.249 0.385400606 0.493359299 0.78117632914 16.397 5.2 9.49 11.75 12.885 9.83125 18.616 6.56575 0.352693919 0.493359299 0.7148824815 17.006 6.85 9.34 11.067 13.894 10.28775 18.953 6.71825 0.35446895 0.493359299 0.71848032516 16.73 6.612 10.17 12.577 14.519 10.9695 18.258 5.7605 0.315505532 0.493359299 0.63950458117 16.328 6.612 10.05 11.625 13.144 10.35775 18.047 5.97025 0.330816756 0.493359299 0.67053921318 16.909 6.238 8.13 11.077 13.221 9.6665 18.061 7.2425 0.401002159 0.493359299 0.81279943519 16.62 5.55 7.76 10.865 13.144 9.32975 18.109 7.29025 0.402576067 0.493359299 0.8159896220 17.142 5.138 7.76 9.452 11.481 8.45775 18.043 8.68425 0.481308541 0.493359299 0.97557407321 17.258 5.912 8.21 11.144 11.913 9.29475 17.815 7.96325 0.446996913 0.493359299 0.90602713622 17.816 5.525 7.89 10.654 11.856 8.98125 18.067 8.83475 0.48899928 0.493359299 0.9911625923 17.652 7.3 8.41 11.01 12.587 9.82675 17.976 7.82525 0.435316533 0.493359299 0.88235193724 17.757 5.638 7.2 11.212 10.548 8.6495 17.94 9.1075 0.507664437 0.493359299 1.02899537525 16.64 6.812 7.56 10.558 11.827 9.18925 17.162 7.45075 0.434142291 0.493359299 0.87997184226 16.923 5.425 6.59 10.702 12.76 8.86925 16.902 8.05375 0.476496864 0.493359299 0.96582118827 17.323 5.438 6.59 10.769 12.423 8.805 17.651 8.518 0.482578891 0.493359299 0.978148971
041415-EM2
041415-EM3
121
13 1 40.666 7.557 13.309 8.495 13.308 10.66725 47.247 29.99875 0.634934493 0.612471112 1.0366766382 40.402 8.33 13.825 10.351 14.288 11.6985 46.955 28.7035 0.611298051 0.612471112 0.9980847093 39.846 5.938 13.144 11.093 14.721 11.224 46.732 28.622 0.612471112 0.612471112 14 6.989 8.196 12.732 7.67 10.933 9.88275 43.468 -2.89375 -0.066571961 0.612471112 -0.1086940425 12.759 7.165 12.155 6.753 9.894 8.99175 42.624 3.76725 0.088383305 0.612471112 0.144306086 15.896 7.165 12.093 6.093 9.683 8.7585 42.171 7.1375 0.169251381 0.612471112 0.2763418197 17.965 7.608 12.691 5.247 9.673 8.80475 42.045 9.16025 0.217867761 0.612471112 0.3557192448 19.241 7.784 11.979 4.351 8.865 8.24475 41.455 10.99625 0.265257508 0.612471112 0.4330939099 19.547 7.753 12.175 5 9.173 8.52525 40.913 11.02175 0.269394813 0.612471112 0.439849012
10 20.752 8.392 12.103 4.299 8.51 8.326 41.266 12.426 0.301119566 0.612471112 0.49164696911 21.687 6.907 11.577 4.948 7.683 7.77875 41.929 13.90825 0.331709557 0.612471112 0.54159216712 22.028 7.093 11.814 5.794 7.356 8.01425 42.604 14.01375 0.328930382 0.612471112 0.53705452513 22.932 6.33 11.711 5.99 8.346 8.09425 43.018 14.83775 0.344919569 0.612471112 0.5631605514 23.125 5.258 11.845 5.588 9.212 7.97575 43.252 15.14925 0.35025548 0.612471112 0.57187265315 22.681 4.969 12.144 6.722 8.442 8.06925 42.358 14.61175 0.344958449 0.612471112 0.56322403216 22.539 5.165 11.979 6.742 8.875 8.19025 41.979 14.34875 0.341807809 0.612471112 0.55807988617 23.79 4.948 12.134 6.691 9.74 8.37825 41.218 15.41175 0.373908244 0.612471112 0.610491232
9 1 31.904 0.012 0.012 0.041 0.028 0.02325 42.879 31.88075 0.743504979 0.73583396 1.0104249322 32.22 0.008 0.022 0.03 0.041 0.02525 42.625 32.19475 0.755302053 0.73583396 1.0264571823 32.171 0.02 0.023 0.025 0.033 0.02525 41.809 32.14575 0.768871535 0.73583396 1.0448981384 31.322 0.008 0.044 0.019 0.039 0.0275 41.705 31.2945 0.750377653 0.73583396 1.0197649115 31.291 0.036 0.023 0.027 0.052 0.0345 41.899 31.2565 0.745996324 0.73583396 1.0138106766 31.711 0.017 0.028 0.019 0.038 0.0255 42.354 31.6855 0.748111158 0.73583396 1.016684747 31.302 0.031 0.028 0.019 0.05 0.032 42.496 31.27 0.735833961 0.73583396 1.0000000018 11.064 0.03 0.016 0.016 0.02 0.0205 39.672 11.0435 0.278370135 0.73583396 0.3783056379 15.887 0.028 0.022 0.027 0.042 0.02975 40.457 15.85725 0.391953185 0.73583396 0.532665256
10 18.242 0.006 0.009 0.012 0.033 0.015 40.204 18.227 0.453362849 0.73583396 0.61612112811 19.799 0.027 0.016 0.012 0.023 0.0195 40.624 19.7795 0.486891985 0.73583396 0.66168729812 20.802 0.014 0.008 0.016 0.041 0.01975 40.592 20.78225 0.511978961 0.73583396 0.69578055513 21.849 0.016 0.03 0.014 0.017 0.01925 40.509 21.82975 0.53888642 0.73583396 0.73234785214 22.373 0.02 0.014 0.008 0.02 0.0155 40.276 22.3575 0.55510726 0.73583396 0.7543920115 22.759 0.017 0.027 0.011 0.059 0.0285 40.276 22.7305 0.564368358 0.73583396 0.76697786316 23.325 0.012 0.017 0.008 0.022 0.01475 40.433 23.31025 0.57651547 0.73583396 0.78348581517 23.776 0.056 0.022 0.025 0.03 0.03325 41.135 23.74275 0.577190957 0.73583396 0.78440380318 23.979 0.02 0.031 0.034 0.022 0.02675 39.51 23.95225 0.606232599 0.73583396 0.82387146119 24.284 0.019 0.039 0.023 0.045 0.0315 39.145 24.2525 0.619555499 0.73583396 0.84197731120 24.632 0.052 0.044 0.008 0.019 0.03075 39.231 24.60125 0.627086998 0.73583396 0.85221263421 25.069 0.042 0.036 0.038 0.047 0.04075 39.075 25.02825 0.640518234 0.73583396 0.87046571522 25.195 0.011 0.009 0.036 0.02 0.019 38.583 25.176 0.652515357 0.73583396 0.88676983123 25.15 0.025 0.033 0.056 0.031 0.03625 38.283 25.11375 0.656002664 0.73583396 0.8915090924 25.46 0.033 0.008 0.009 0.044 0.0235 38.2 25.4365 0.665876963 0.73583396 0.90492828525 25.779 0.033 0.047 0.006 0.028 0.0285 38.516 25.7505 0.66856631 0.73583396 0.90858311326 25.786 0.033 0.031 0.039 0.028 0.03275 38.129 25.75325 0.675424218 0.73583396 0.91790302527 25.714 0.031 0.041 0.038 0.048 0.0395 37.415 25.6745 0.68620874 0.73583396 0.93255921528 25.488 0.031 0.025 0.012 0.017 0.02125 37.727 25.46675 0.675027169 0.73583396 0.91736343529 26.078 0.012 0.023 0.031 0.045 0.02775 37.832 26.05025 0.68857713 0.73583396 0.93577786330 26.389 0.038 0.011 0.025 0.02 0.0235 38.08 26.3655 0.692371324 0.73583396 0.9409341831 27.057 0.006 0.052 0.019 0.023 0.025 37.827 27.032 0.714621831 0.73583396 0.97117266932 27.321 0.042 0.02 0.027 0.025 0.0285 37.564 27.2925 0.726560004 0.73583396 0.98739667333 27.36 0.014 0.017 0.017 0.02 0.017 37.086 27.343 0.737286308 0.73583396 1.00197374434 27.515 0.019 0.034 0.019 0.003 0.01875 37.24 27.49625 0.738352578 0.73583396 1.00342280735 27.7 0.027 0.019 0.017 0.017 0.02 37.97 27.68 0.728996576 0.73583396 0.99070798
3 1 38.514 0 0 0 0 0 34.951 38.514 1.10194272 1.013038579 1.0877598772 38.119 0 0 0 0 0 36.26 38.119 1.051268616 1.013038579 1.0377379873 38.396 0 0 0 0 0 37.398 38.396 1.026685919 1.013038579 1.0134716884 37.76 0 0 0 0 0 37.274 37.76 1.013038579 1.013038579 15 22.382 0 0 0 0 0 34.673 22.382 0.645516684 1.013038579 0.6372083926 24.064 0 0 0 0 0 34.443 24.064 0.698661557 1.013038579 0.689669257 23.855 0 0 0 0 0 34.271 23.855 0.696069563 1.013038579 0.6871106178 25.701 0 0 0 0 0 34.651 25.701 0.741710196 1.013038579 0.732163829 26.681 0 0 0 0 0 34.314 26.681 0.777554351 1.013038579 0.767546634
10 26.773 0 0 0 0 0 35.152 26.773 0.761635184 1.013038579 0.75183235911 26.415 0 0 0 0 0 35.803 26.415 0.737787336 1.013038579 0.72829145112 26.117 0 0 0 0 0 35.088 26.117 0.744328545 1.013038579 0.73474846913 25.965 0 0 0 0 0 35.005 25.965 0.741751178 1.013038579 0.73220427514 26.253 0 0 0 0 0 36.786 26.253 0.713668243 1.013038579 0.70448278915 26.809 0 0 0 0 0 35.573 26.809 0.753633374 1.013038579 0.74393353716 26.627 0 0 0 0 0 35.095 26.627 0.758712067 1.013038579 0.74894686417 27.241 0 0 0 0 0 35.47 27.241 0.768001128 1.013038579 0.75811636818 27.775 0 0 0 0 0 35.003 27.775 0.793503414 1.013038579 0.7832904219 27.28 0 0 0 0 0 34.938 27.28 0.780811724 1.013038579 0.77076208120 27.117 0 0 0 0 0 34.612 27.117 0.783456605 1.013038579 0.77337292121 27.145 0 0 0 0 0 33.576 27.145 0.808464379 1.013038579 0.79805882622 27.352 0 0 0 0 0 32.536 27.352 0.840668798 1.013038579 0.82984874923 27.711 0 0 0 0 0 33.095 27.711 0.837316815 1.013038579 0.82653990924 27.967 0 0 0 0 0 32.892 27.967 0.850267542 1.013038579 0.83932395125 27.821 0 0 0 0 0 34.2 27.821 0.813479532 1.013038579 0.8030094326 27.921 0 0 0 0 0 33.204 27.921 0.840892664 1.013038579 0.83006973427 29.054 0 0 0 0 0 32.714 29.054 0.888121294 1.013038579 0.876690495
041415-EM4
041415-EM5
051215-EM1 exp.2
122
8 1 43.944 3.456 1.826 2.646 2.209 2.53425 55.256 41.40975 0.749416353 0.753559316 0.9945021412 44.302 4.035 1.911 2.927 2.139 2.753 55.137 41.549 0.753559316 0.753559316 13 21.594 2.386 2.114 0.68 2.275 1.86375 54.042 19.73025 0.36509104 0.753559316 0.4844887894 24.827 2.345 3.658 1.759 4.538 3.075 54.309 21.752 0.400522934 0.753559316 0.5315081715 26.619 3.237 3.016 1.709 3.63 2.898 53.915 23.721 0.439970324 0.753559316 0.583856266 26.318 3.269 1.962 1.592 2.696 2.37975 53.802 23.93825 0.444932345 0.753559316 0.5904410387 26.846 3.291 2.554 1.389 2.563 2.44925 53.957 24.39675 0.452151713 0.753559316 0.6000213978 27.748 4.146 3.582 1.658 1.892 2.8195 55.118 24.9285 0.452275119 0.753559316 0.600185169 28.281 3.009 4.563 0.718 1.604 2.4735 54.96 25.8075 0.469568777 0.753559316 0.62313446
10 29.1 2.737 4.291 1.025 2.272 2.58125 55.686 26.51875 0.476219337 0.753559316 0.63195998911 28.9 3.437 3.69 0.953 7.218 3.8245 55.686 25.0755 0.450301692 0.753559316 0.59756635212 29.785 2.772 3.092 0.747 5.291 2.9755 54.789 26.8095 0.489322674 0.753559316 0.64934858313 30.558 2.943 2.019 0.658 4.035 2.41375 53.699 28.14425 0.52411125 0.753559316 0.6955142614 29.553 2.665 2.658 1.446 3.168 2.48425 54.961 27.06875 0.492508324 0.753559316 0.65357605415 30.175 1.832 3.519 2.687 4.025 3.01575 55.128 27.15925 0.492657996 0.753559316 0.65377467416 30.836 2.835 4.484 2.649 5.158 3.7815 55.809 27.0545 0.484769482 0.753559316 0.64330633517 30.624 2.873 7.028 3.272 4.386 4.38975 56.433 26.23425 0.464874276 0.753559316 0.61690468918 30.037 3.076 5.646 4.266 4.943 4.48275 55.553 25.55425 0.45999766 0.753559316 0.61043324719 29.443 3.104 3.75 2.373 4.639 3.4665 54.827 25.9765 0.473790286 0.753559316 0.62873655220 29.9 2.345 3.794 6.915 4.718 4.443 54.598 25.457 0.4662625 0.753559316 0.61874691321 30.104 1.782 4.051 5.655 5.117 4.15125 54.278 25.95275 0.478144921 0.753559316 0.63451530722 30.475 2.285 4.528 4.231 5.763 4.20175 54.072 26.27325 0.485893808 0.753559316 0.64479835623 30.356 1.845 4.291 4.342 6.155 4.15825 52.438 26.19775 0.49959476 0.753559316 0.66298000624 31.75 1.528 5.573 4.551 6.842 4.6235 52.37 27.1265 0.51797785 0.753559316 0.68737502
4 1 28.298 0.046 0.042 0.079 0.231 0.0995 48.538 28.1985 0.580957188 0.580957188 12 19.088 0 0 0.009 0.12 0.03225 47.45 19.05575 0.401596417 0.580957188 0.6912668023 20.411 0 0.046 0.06 0.06 0.0415 47.618 20.3695 0.427768911 0.580957188 0.7363174434 20.492 0.009 0.046 0.019 0.042 0.029 47.082 20.463 0.434624697 0.580957188 0.7481182895 21.059 0 0.019 0.028 0.009 0.014 45.572 21.045 0.461796717 0.580957188 0.7948894126 21.74 0.028 0.019 0.046 0.037 0.0325 43.849 21.7075 0.495051198 0.580957188 0.8521302587 22.273 0 0.037 0.032 0.028 0.02425 43.698 22.24875 0.509148016 0.580957188 0.8763950718 22.895 0.019 0 0.019 0.046 0.021 43.054 22.874 0.531286292 0.580957188 0.9145016249 23.008 0.009 0.046 0 0.106 0.04025 43.321 22.96775 0.530175896 0.580957188 0.912590303
10 23.963 0.019 0.06 0.032 0.046 0.03925 42.028 23.92375 0.569233606 0.580957188 0.97982023111 23.924 0 0.051 0.069 0.102 0.0555 41.054 23.8685 0.5813928 0.580957188 1.000749817
15 1 41.997 0.383 0.594 0.639 1.388 0.751 45.785 41.246 0.900862728 0.900862728 12 16.054 0.47 0.502 0.454 0.991 0.60425 45.54 15.44975 0.339256697 0.900862728 0.3765908913 18.928 0.477 0.414 0.509 0.984 0.596 46.302 18.332 0.395922422 0.900862728 0.4394925114 19.861 0.421 0.406 0.502 0.898 0.55675 46.354 19.30425 0.416452733 0.900862728 0.4622821225 21.473 0.3 0.452 0.477 1.167 0.599 44.877 20.874 0.465138044 0.900862728 0.5163251076 21.907 0.351 0.418 0.558 0.968 0.57375 43.021 21.33325 0.495879919 0.900862728 0.5504500347 23.217 0.364 0.342 0.405 0.933 0.511 43.613 22.706 0.520624584 0.900862728 0.5779177768 23.343 0.286 0.361 0.47 1.069 0.5465 44.38 22.7965 0.513666066 0.900862728 0.5701934939 23.314 0.223 0.374 0.46 0.866 0.48075 44.304 22.83325 0.515376715 0.900862728 0.572092395
10 23.514 0.297 0.353 0.394 0.789 0.45825 43.858 23.05575 0.525690866 0.900862728 0.58354158711 23.215 0.32 0.349 0.394 0.913 0.494 44.759 22.721 0.50762975 0.900862728 0.56349289912 22.982 0.317 0.377 0.54 0.89 0.531 45.171 22.451 0.497022426 0.900862728 0.5517182713 22.807 0.336 0.305 0.487 0.885 0.50325 46.44 22.30375 0.480270241 0.900862728 0.53312255714 21.808 0.247 0.316 0.405 0.893 0.46525 46.666 21.34275 0.457351176 0.900862728 0.50768131715 21.439 0.317 0.335 0.39 0.916 0.4895 47.764 20.9495 0.438604388 0.900862728 0.48687150116 21.45 0.216 0.23 0.403 0.803 0.413 48.954 21.037 0.429729951 0.900862728 0.47702045717 22.554 0.302 0.289 0.424 0.762 0.44425 48.776 22.10975 0.453291578 0.900862728 0.50317497218 22.366 0.19 0.271 0.305 0.881 0.41175 48.776 21.95425 0.450103535 0.900862728 0.499636094
6 1 23.664 0.096 0.747 0.813 0.506 0.5405 24.753 23.1235 0.934169596 0.934169596 12 7.978 0.193 1.078 0.265 0.494 0.5075 23.001 7.4705 0.324790227 0.934169596 0.347678013 10.453 0.512 0.976 0.488 0.361 0.58425 23.108 9.86875 0.427070711 0.934169596 0.4571661434 11.54 0.608 0.819 0.193 0.458 0.5195 22.849 11.0205 0.482318701 0.934169596 0.5163074285 12.212 0.169 0.825 0.392 0.217 0.40075 23.957 11.81125 0.493018742 0.934169596 0.5277614946 13.341 0.392 1.343 0.169 0.777 0.67025 22.68 12.67075 0.558675044 0.934169596 0.5980445597 13.412 0.265 1.193 0.44 0.831 0.68225 22.482 12.72975 0.566219642 0.934169596 0.6061208218 13.596 0.145 1.355 0.319 0.735 0.6385 21.666 12.9575 0.598056863 0.934169596 0.6402015939 14.42 0.247 0.699 0.169 0.735 0.4625 21.887 13.9575 0.637707315 0.934169596 0.682646189
10 14.504 0.193 0.771 0.319 0.789 0.518 20.612 13.986 0.678536775 0.934169596 0.72635287811 14.607 0.096 0.723 0.295 0.337 0.36275 22.187 14.24425 0.642008834 0.934169596 0.68725083412 14.618 0.096 0.892 0.217 0.554 0.43975 21.331 14.17825 0.664678168 0.934169596 0.71151766313 14.227 0.44 0.994 0.12 0.97 0.631 21.534 13.596 0.631373642 0.934169596 0.67586618614 14.059 0.44 0.825 0.241 1.042 0.637 21.333 13.422 0.629166081 0.934169596 0.67350305915 14.27 0.223 0.801 0.193 0.392 0.40225 21.545 13.86775 0.643664423 0.934169596 0.68902309216 13.991 0.217 0.994 0.048 0.313 0.393 20.921 13.598 0.649968931 0.934169596 0.69577187417 14.532 0 1.114 0.169 0.241 0.381 23.28 14.151 0.607860825 0.934169596 0.65069643418 15.258 0.024 0.801 0.072 0.289 0.2965 22.854 14.9615 0.65465564 0.934169596 0.70078885319 15.454 0 1.223 0.217 0.265 0.42625 23.228 15.02775 0.646967023 0.934169596 0.69255842320 15.017 0.024 1.06 0.289 0.361 0.4335 23.371 14.5835 0.623999829 0.934169596 0.66797274421 14.555 0.048 0.988 0.199 0.199 0.3585 24.84 14.1965 0.571517713 0.934169596 0.61179224422 14.933 0 1.349 0.241 0.048 0.4095 25.276 14.5235 0.574596455 0.934169596 0.61508794323 14.498 0.024 0.922 0.12 0.271 0.33425 24.037 14.16375 0.589247826 0.934169596 0.63077178824 14.498 0 0.566 0.223 0.193 0.2455 24.018 14.2525 0.59340911 0.934169596 0.63522631525 14.518 0 1.392 0.289 0.096 0.44425 24.257 14.07375 0.580193346 0.934169596 0.62107924426 14.401 0.096 0.819 0.289 0.12 0.331 22.837 14.07 0.616105443 0.934169596 0.659522046
051315-EM1 exp. 4
051215-EM2 exp. 2
051215-EM3 exp. 1
051215-EM4
123
10 1 31.102 8.466 9.952 11.144 10.39 9.988 35.25 21.114 0.598978723 0.598978723 1.0000000012 17.772 7.678 8.979 11.329 10.027 9.50325 32.916 8.26875 0.251207619 0.598978723 0.4193932273 19.614 8.575 9.452 11.493 9.685 9.80125 33.289 9.81275 0.29477455 0.598978723 0.4921285834 20.753 8.233 8.726 10.979 9.24 9.2945 33.653 11.4585 0.340489704 0.598978723 0.5684504155 21.19 8.151 8.863 9.233 8.932 8.79475 32.996 12.39525 0.375659171 0.598978723 0.6271661356 21.447 6.404 8.356 9.596 8.582 8.2345 32.436 13.2125 0.407340609 0.598978723 0.6800585627 22.032 8.11 8.603 9.274 9.384 8.84275 32.745 13.18925 0.402786685 0.598978723 0.6724557488 22.187 7.863 8.733 8.651 9.315 8.6405 33.333 13.5465 0.406399064 0.598978723 0.6784866459 22.199 8.973 9.918 8.644 10.082 9.40425 32.685 12.79475 0.391456326 0.598978723 0.653539618
10 22.31 8.671 8.562 9.541 9.603 9.09425 32.683 13.21575 0.404361595 0.598978723 0.67508507311 22.53 9.164 9.322 9.575 10.096 9.53925 32.663 12.99075 0.397720663 0.598978723 0.66399798112 23.065 8.267 9.233 9.315 9.795 9.1525 32.848 13.9125 0.423541768 0.598978723 0.70710653313 23.315 8.37 10.363 9.678 10.315 9.6815 32.789 13.6335 0.415794931 0.598978723 0.69417312414 23.391 8.137 9.158 9.767 9.911 9.24325 32.004 14.14775 0.44206193 0.598978723 0.73802609815 23.591 7.637 9.76 10.308 10.075 9.445 31.878 14.146 0.443754313 0.598978723 0.74085154716 23.446 8.404 9.671 9.664 9.199 9.2345 31.317 14.2115 0.453795063 0.598978723 0.75761466317 23.557 9.39 9.829 10.692 10.103 10.0035 31.168 13.5535 0.434853054 0.598978723 0.7259908218 23.555 8.877 10.219 10.37 10.452 9.9795 31.755 13.5755 0.427507479 0.598978723 0.71372732119 23.789 8.932 9.685 10.219 10.74 9.894 31.467 13.895 0.441573712 0.598978723 0.73721101520 23.883 8.048 9.808 10.301 10.637 9.6985 31.733 14.1845 0.446995242 0.598978723 0.74626230321 23.71 8.548 8.603 9.5 10.116 9.19175 31.639 14.51825 0.458871962 0.598978723 0.76609058822 23.931 8.582 9.301 9.664 9.911 9.3645 31.569 14.5665 0.461417847 0.598978723 0.77034096423 24.161 9.685 10.116 9.87 10.418 10.02225 31.887 14.13875 0.4434017 0.598978723 0.74026285524 24.801 8.404 9.952 11.199 9.952 9.87675 32.602 14.92425 0.457770996 0.598978723 0.76425251525 24.891 8.534 10.301 10.836 11.021 10.173 32.483 14.718 0.453098544 0.598978723 0.75645181826 25.523 8.274 9.664 10.699 10.493 9.7825 32.628 15.7405 0.482423072 0.598978723 0.80540936427 25.336 7.733 9.87 10.466 10.425 9.6235 33.345 15.7125 0.471210076 0.598978723 0.78668917328 25.655 7.938 8.808 9.897 10.144 9.19675 33.237 16.45825 0.495178566 0.598978723 0.82670476829 25.44 8.014 9.644 10.014 10.158 9.4575 32.053 15.9825 0.498627274 0.598978723 0.83246241430 25.491 8.281 9.856 9.726 10.514 9.59425 32.097 15.89675 0.495272144 0.598978723 0.82686099731 26.303 9.062 9.582 9.753 9.945 9.5855 32.071 16.7175 0.521265318 0.598978723 0.87025681832 26.235 9.274 10.384 9.671 10.295 9.906 31.535 16.329 0.517805613 0.598978723 0.86448081233 26.129 8.973 9.795 9.932 9.623 9.58075 31.289 16.54825 0.528883953 0.598978723 0.88297619434 26.083 9.089 10.274 9.808 10.486 9.91425 31.879 16.16875 0.507191254 0.598978723 0.84676005235 26.424 8.288 9.692 9.534 9.753 9.31675 31.414 17.10725 0.544574075 0.598978723 0.90917098436 26.194 7.747 9.644 9.322 10.404 9.27925 31.414 16.91475 0.538446234 0.598978723 0.89894050237 26.296 8.836 10.288 9.993 10.384 9.87525 31.204 16.42075 0.526238623 0.598978723 0.87855979438 26.447 9.103 9.63 10.322 11.37 10.10625 31.014 16.34075 0.526883021 0.598978723 0.8796356239 26.768 8.726 10.425 10.205 10.856 10.053 30.934 16.715 0.540343958 0.598978723 0.902108768
11 1 29.032 9.134 9.181 8.069 6.384 8.192 26.99 20.84 0.772137829 0.761667468 1.013746632 28.897 9.356 9.106 7.875 6.866 8.30075 27.041 20.59625 0.761667468 0.761667468 13 12.722 9.273 9.319 7.685 6.681 8.2395 26.286 4.4825 0.170528038 0.761667468 0.2238877794 16.023 9.38 9.495 7.921 6.556 8.338 25.623 7.685 0.299925848 0.761667468 0.3937753165 17.217 9.227 9.625 7.968 6.463 8.32075 25.323 8.89625 0.351311061 0.761667468 0.461239426 18.09 9.769 9.324 8.278 6.421 8.448 25.401 9.642 0.379591355 0.761667468 0.4983688697 18.864 10.148 9.273 8.176 6.514 8.52775 25.172 10.33625 0.410624901 0.761667468 0.5391130888 19.389 9.468 9.259 7.94 6.278 8.23625 24.975 11.15275 0.446556557 0.761667468 0.5862880799 20.133 9.694 9.042 7.62 6.185 8.13525 25.124 11.99775 0.477541395 0.761667468 0.626968349
10 20.363 9.699 9.384 7.806 6.199 8.272 24.822 12.091 0.48710821 0.761667468 0.63952870611 20.53 9.421 9.375 8.083 6.269 8.287 24.696 12.243 0.495748299 0.761667468 0.65087235612 20.833 9.449 9.431 7.824 6.31 8.2535 24.974 12.5795 0.503703852 0.761667468 0.66131727213 20.705 9.921 10.051 7.991 6.12 8.52075 24.779 12.18425 0.491716776 0.761667468 0.64557933314 21.07 10.097 10.032 8.486 6.616 8.80775 24.562 12.26225 0.499236626 0.761667468 0.65545221115 21.134 10.444 10.208 8.204 7.134 8.9975 24.458 12.1365 0.496218006 0.761667468 0.65148903816 21.276 10.583 9.866 8.62 6.676 8.93625 24.232 12.33975 0.509233658 0.761667468 0.66857740317 21.443 11.023 10.273 8.125 6.593 9.0035 24.412 12.4395 0.509564968 0.761667468 0.66901238318 21.567 10.736 10.588 8.667 7.037 9.257 24.371 12.31 0.505108531 0.761667468 0.66316148719 21.955 11.162 10.963 9.403 6.917 9.61125 24.314 12.34375 0.50768076 0.761667468 0.6665385920 22.154 11.227 10.963 9.662 7.287 9.78475 23.902 12.36925 0.517498536 0.761667468 0.67942843521 21.951 11.333 11.278 9.051 7.014 9.669 24.158 12.282 0.508403013 0.761667468 0.66748684322 21.995 11.079 10.907 9.083 7.333 9.6005 24.2 12.3945 0.512169421 0.761667468 0.67243179323 22.244 11.421 10.954 9.356 6.954 9.67125 23.854 12.57275 0.527070931 0.761667468 0.69199611924 22.505 11.824 11.431 9.352 7.5 10.02675 23.992 12.47825 0.52010045 0.761667468 0.68284451225 23.099 11.801 11.171 9.343 7.218 9.88325 23.456 13.21575 0.563427268 0.761667468 0.73972867726 23.409 11.755 11.454 9.657 7.343 10.05225 23.456 13.35675 0.569438523 0.761667468 0.74762090727 23.597 11.977 11.62 9.861 7.898 10.339 23.456 13.258 0.565228513 0.761667468 0.742093547
051315-EM2 exp. 3
051315-EM3
124
4.2 Early epiboly
1 2 3 4
12 1 34.249 12.856 5.692 11.606 8.856 9.7525 42.245 24.4965 0.5798674 0.516423266 1.1228530512 33.862 14.221 6.913 12.202 10.394 10.9325 41.943 22.9295 0.5466824 0.516423266 1.0585936743 33.51 15.567 7.567 10.394 10.529 11.01425 41.387 22.49575 0.5435463 0.516423266 1.0525209044 33.841 15.481 7.385 12.827 12.462 12.03875 41.285 21.80225 0.5280913 0.516423266 1.0225939675 33.454 14.519 7.269 13.481 12 11.81725 40.407 21.63675 0.5354703 0.516423266 1.0368826796 33.263 18.894 8.49 11.327 12.019 12.6825 39.852 20.5805 0.5164233 0.516423266 17 18.635 15.981 10.077 8.731 6.817 10.4015 36.654 8.2335 0.2246276 0.516423266 0.4349680078 20.768 16.125 8.856 7.423 6.462 9.7165 36.266 11.0515 0.3047345 0.516423266 0.5900866259 21.607 14.404 9.038 6.971 6.731 9.286 36.615 12.321 0.3365014 0.516423266 0.651600065
10 22.772 15.077 6.519 5.596 7.913 8.77625 36.922 13.99575 0.3790626 0.516423266 0.73401537711 23.508 14.712 6.856 2.26 5.096 7.231 36.933 16.277 0.440717 0.516423266 0.85340263112 23.705 15.135 6.606 2.269 5.221 7.30775 37.223 16.39725 0.4405139 0.516423266 0.85300945713 24.17 13.904 8.327 5.577 5.788 8.399 37.435 15.771 0.4212902 0.516423266 0.81578477214 24.4 17.337 10.317 8.365 6.202 10.55525 37.674 13.84475 0.3674882 0.516423266 0.71160269615 24.843 17.875 10.519 10.067 4.635 10.774 37.608 14.069 0.3740959 0.516423266 0.72439791516 25.181 18.327 10.048 11.731 5.923 11.50725 37.547 13.67375 0.3641769 0.516423266 0.70519072717 24.852 16.106 7.952 13.317 6.865 11.06 37.193 13.792 0.3708225 0.516423266 0.71805917918 25.388 13.298 7.952 10.644 8.077 9.99275 36.853 15.39525 0.4177475 0.516423266 0.80892470419 25.451 12.106 8.913 10.712 7.558 9.82225 37.126 15.62875 0.4209651 0.516423266 0.81515516420 25.627 11.577 8.558 10.019 6.74 9.2235 36.862 16.4035 0.4449976 0.516423266 0.86169153821 26.048 13.183 9.24 9.76 7.01 9.79825 37.132 16.24975 0.4376212 0.516423266 0.84740796622 26.181 14.962 8.683 12.712 5.615 10.493 36.812 15.688 0.4261654 0.516423266 0.82522498323 26.249 16.846 11.433 11.885 3.423 10.89675 36.313 15.35225 0.4227756 0.516423266 0.81866100524 26.343 16.702 9.692 12.433 3.913 10.685 36.585 15.658 0.4279896 0.516423266 0.82875741925 26.595 17.317 10.269 11.933 6.481 11.5 36.404 15.095 0.4146522 0.516423266 0.80293097426 26.972 13.904 10.625 10.942 7.462 10.73325 36.338 16.23875 0.4468807 0.516423266 0.86533799927 27.412 14.183 12.154 10.394 7.135 10.9665 36.258 16.4455 0.4535689 0.516423266 0.87828898828 27.363 12.606 9.673 10.115 5.769 9.54075 35.473 17.82225 0.5024173 0.516423266 0.97287896329 27.849 13.865 8.798 9.173 4.846 9.1705 35.392 18.6785 0.5277605 0.516423266 1.02195339730 27.876 15.346 10.029 6.875 5.337 9.39675 34.966 18.47925 0.528492 0.516423266 1.02336977931 27.938 16.048 12.077 7.077 5.337 10.13475 34.496 17.80325 0.5160961 0.516423266 0.99936641732 27.68 15.308 11.577 7 6.875 10.19 34.029 17.49 0.5139734 0.516423266 0.99525604233 27.72 13.76 11.856 6.067 7.106 9.69725 34.209 18.02275 0.5268424 0.516423266 1.02017547634 27.835 13.413 12.76 4.837 6.087 9.27425 34.026 18.56075 0.5454873 0.516423266 1.05627943335 28.123 10.481 13.106 5.346 6.587 8.88 33.866 19.243 0.56821 0.516423266 1.10027963836 28.19 10.913 11.058 7.683 5.452 8.7765 33.892 19.4135 0.5728048 0.516423266 1.10917696737 28.452 7.615 10.933 9.673 5.462 8.42075 33.668 20.03125 0.5949641 0.516423266 1.15208608938 28.464 7.587 9.49 10.519 5.885 8.37025 33.17 20.09375 0.6057808 0.516423266 1.17303163139 28.427 8.404 8.923 10.337 8.923 9.14675 33.17 19.28025 0.5812557 0.516423266 1.12554118140 28.523 10.663 9.894 12.183 9.452 10.548 33.153 17.975 0.5421832 0.516423266 1.04988145741 28.032 11.76 8.058 11.058 8.827 9.92575 32.91 18.10625 0.5501747 0.516423266 1.06535618242 27.993 11.606 8.269 11.452 10.385 10.428 33.294 17.565 0.5275725 0.516423266 1.02158940243 27.813 13.356 8.452 10.779 9.01 10.39925 33.209 17.41375 0.5243684 0.516423266 1.01538491544 27.909 13.788 7.442 10.99 10.625 10.71125 33.386 17.19775 0.5151186 0.516423266 0.99747367445 29.076 14.49 8.096 9.74 7.769 10.02375 33.707 19.05225 0.5652313 0.516423266 1.09451160546 29.01 14.615 9.692 7.548 6.337 9.548 34.249 19.462 0.5682502 0.516423266 1.10035741147 28.576 11.173 10.942 8.606 7.798 9.62975 34.525 18.94625 0.548769 0.516423266 1.06263416948 28.817 11.606 10.519 7.462 6.779 9.0915 34.464 19.7255 0.5723509 0.516423266 1.10829797349 28.977 10.519 10.404 8.192 6.163 8.8195 34.56 20.1575 0.583261 0.516423266 1.12942431950 29.233 10.885 9.933 10.606 8.702 10.0315 34.69 19.2015 0.5535169 0.516423266 1.071827898
Measure Total Fluo Int. of
MTs farthest away from ROI
at each timepoint
Background corrected
values
Total corrected
values
Fluo Intensity of Timepoint
prior to bleaching
Normalized values in
relative Fluo units
093015-EM1 exp.4
Experiment #Approx. MT # in
ROI
Time points
Fluo Int. measureme
nts of ROI for each
timepoint
Background Fluo Int. measurements for each timepoint
Ave. Background
Fluo Int. measurements
for each timepoint
125
51 29.474 12.837 10.721 9.106 8.683 10.33675 34.952 19.13725 0.5475295 0.516423266 1.0602339352 29.086 15.365 9.596 10.952 8.615 11.132 35.339 17.954 0.5080506 0.516423266 0.98378719453 29.369 14.644 7.971 11.308 8.558 10.62025 35.332 18.74875 0.530645 0.516423266 1.02753895754 29.595 14.202 7.971 9.5 8.942 10.15375 35.619 19.44125 0.5458112 0.516423266 1.05690672855 29.803 14.442 9.279 9.058 8.163 10.2355 35.462 19.5675 0.5517878 0.516423266 1.06847980256 30.086 15.5 9.654 7.788 7.538 10.12 35.678 19.966 0.5596166 0.516423266 1.08363934657 30.05 15.654 9.394 7.298 8.365 10.17775 35.196 19.87225 0.5646167 0.516423266 1.09332161258 29.876 17.75 9.933 7.25 6.952 10.47125 35.202 19.40475 0.55124 0.516423266 1.06741896259 30.112 14.769 8.115 8.067 8.048 9.74975 35.078 20.36225 0.5804849 0.516423266 1.12404873660 30.392 13.442 6.125 6.519 7.433 8.37975 35.08 22.01225 0.6274872 0.516423266 1.21506371561 30.259 10.721 4.385 5.808 7.106 7.005 34.855 23.254 0.667164 0.516423266 1.29189370262 30.428 8.029 3.212 6.529 7.471 6.31025 34.96 24.11775 0.689867 0.516423266 1.33585575363 30.68 7.885 3.471 6.538 6.077 5.99275 34.452 24.68725 0.7165694 0.516423266 1.38756225264 30.374 10.077 3.942 6.952 5.683 6.6635 34.058 23.7105 0.69618 0.516423266 1.34808032865 30.371 9.74 4.538 6.125 5.952 6.58875 33.461 23.78225 0.7107453 0.516423266 1.37628451766 30.408 11.144 5.962 5.317 6.49 7.22825 33.341 23.17975 0.6952326 0.516423266 1.34624569167 30.359 10.596 5.99 5.144 7.538 7.317 32.934 23.042 0.6996417 0.516423266 1.35478347768 31.019 12.337 7.462 4.308 7.452 7.88975 32.353 23.12925 0.7149028 0.516423266 1.38433497969 31.233 14.74 6.856 3.76 7.731 8.27175 32.579 22.96125 0.7047868 0.516423266 1.36474646370 31.411 13.202 5.5 3.74 7.644 7.5215 32.294 23.8895 0.7397504 0.516423266 1.43244982771 31.223 13.106 7.375 4.702 7.288 8.11775 31.852 23.10525 0.725394 0.516423266 1.40465013472 31.41 13.029 6.962 4.462 7.894 8.08675 31.6 23.32325 0.7380775 0.516423266 1.42921045673 31.393 13.548 6.75 4.683 7.135 8.029 31.574 23.364 0.7399759 0.516423266 1.43288650774 31.12 9.76 6.327 4.365 6.144 6.649 31.921 24.471 0.7666113 0.516423266 1.48446317675 31.065 9.827 5.173 4.769 7.375 6.786 31.282 24.279 0.7761332 0.516423266 1.50290138176 31.144 9.038 7.471 5.529 8.788 7.7065 31.456 23.4375 0.7450884 0.516423266 1.44278623177 31.107 9.375 8.519 4.837 9.721 8.113 31.433 22.994 0.7315242 0.516423266 1.41652059978 30.787 9.798 7.798 3.913 9.404 7.72825 31.483 23.05875 0.7324191 0.516423266 1.41825345979 30.786 10.327 8.433 3.885 8.356 7.75025 31.564 23.03575 0.7298109 0.516423266 1.41320290680 30.717 8.913 8.221 4.663 9.654 7.86275 31.952 22.85425 0.7152682 0.516423266 1.38504258481 30.803 8.183 8.75 4.452 9.798 7.79575 31.839 23.00725 0.7226122 0.516423266 1.39926345882 31.274 9.519 7.49 5.163 9.327 7.87475 31.808 23.39925 0.7356404 0.516423266 1.42449121483 31.097 8.962 6.048 6.029 8.798 7.45925 32.274 23.63775 0.7324084 0.516423266 1.4182328584 31.264 6.808 8.25 6.442 10.981 8.12025 32.298 23.14375 0.7165691 0.516423266 1.38756168685 31.17 6.577 6.317 6.577 10.192 7.41575 32.492 23.75425 0.73108 0.516423266 1.41566038286 31.734 6.298 5.808 5.635 9.817 6.8895 32.28 24.8445 0.7696561 0.516423266 1.49035913987 31.889 8.385 4.625 6.587 7.394 6.74775 32.911 25.14125 0.7639163 0.516423266 1.47924458588 31.976 8.846 5.038 6.846 7.327 7.01425 32.885 24.96175 0.7590619 0.516423266 1.46984447189 31.965 8.846 4.76 8.077 8.192 7.46875 33.575 24.49625 0.7295979 0.516423266 1.41279056
9 1 45.723 24.471 27.644 29.163 26.106 26.846 38.131 18.877 0.4950565 0.584440346 0.8470608152 45.459 23.829 27.115 29.038 25.837 26.45475 37.854 19.00425 0.5020407 0.584440346 0.8590110853 38.191 17.529 20.048 22.183 18.212 19.493 31.993 18.698 0.5844403 0.584440346 1.0000000014 31.368 17.3 20.212 20.5 18.413 19.10625 30.377 12.26175 0.4036524 0.584440346 0.6906649025 32.364 17.486 20.173 20.913 18.173 19.18625 30.385 13.17775 0.4336926 0.584440346 0.7420648056 32.748 17.743 20.433 21.26 18.308 19.436 30.376 13.312 0.4382407 0.584440346 0.7498467887 33.073 18.757 20.577 20.596 18.317 19.56175 30.424 13.51125 0.4440984 0.584440346 0.7598695278 33.443 17.571 20.567 20.731 18.75 19.40475 31.154 14.03825 0.4506083 0.584440346 0.7710081489 33.582 17.486 20.135 20.971 17.394 18.9965 31.299 14.5855 0.4660053 0.584440346 0.797353069
10 33.79 16.871 19.971 21.356 17.76 18.9895 31.237 14.8005 0.4738131 0.584440346 0.81071252111 33.923 17.586 19.913 20.971 17.115 18.89625 31.21 15.02675 0.4814723 0.584440346 0.82381767112 34.047 17.714 20.01 20.404 17.183 18.82775 31.422 15.21925 0.4843501 0.584440346 0.82874178713 33.991 17.229 19.846 20.279 17.058 18.603 31.254 15.388 0.492353 0.584440346 0.84243495914 34.221 17.357 19.692 19.875 17.298 18.5555 31.666 15.6655 0.4947104 0.584440346 0.84646862315 34.028 17.171 19.087 19.5 17.327 18.27125 31.583 15.75675 0.4988997 0.584440346 0.85363669416 34.133 17.8 19.577 19.913 18.096 18.8465 31.573 15.2865 0.4841637 0.584440346 0.82842275917 34.217 17.129 19.538 19.942 17.154 18.44075 31.32 15.77625 0.5037117 0.584440346 0.86187014518 34.334 16.971 19.202 20.298 17.567 18.5095 31.367 15.8245 0.5044952 0.584440346 0.86321071719 34.337 17.043 19.115 20.49 17.067 18.42875 31.011 15.90825 0.5129873 0.584440346 0.87774112520 34.455 17.729 19.048 20.048 17.962 18.69675 31.114 15.75825 0.5064681 0.584440346 0.86658656121 34.503 17.857 19.394 19.606 17.962 18.70475 31.21 15.79825 0.5061919 0.584440346 0.86611393122 34.567 17.543 19.587 20.26 17.779 18.79225 31.14 15.77475 0.5065751 0.584440346 0.86676963423 34.355 17 19.413 20.346 17.981 18.685 31.029 15.67 0.5050114 0.584440346 0.86409407624 34.333 16.686 19.635 19.962 17.846 18.53225 31.253 15.80075 0.5055755 0.584440346 0.86505914325 34.408 17.057 20.048 19.971 17.808 18.721 31.39 15.687 0.4997451 0.584440346 0.85508323526 34.365 17.2 20.462 19.587 17.51 18.68975 31.214 15.67525 0.5021865 0.584440346 0.859260526
4 1 25.41 9.077 7.981 14.096 10.038 10.298 26.426 15.112 0.571861 0.533828039 1.0712458022 25.331 9.385 8.404 16.173 10.962 11.231 26.413 14.1 0.533828 0.533828039 13 7.257 7.288 8.615 9.904 6.423 8.0575 23.785 -0.8005 -0.0336557 0.533828039 -0.0630458934 9.614 6.519 8.038 11.423 7.288 8.317 23.072 1.297 0.0562153 0.533828039 0.1053060575 11.364 7.442 8.346 10.135 7.731 8.4135 22.906 2.9505 0.128809 0.533828039 0.2412931436 12.664 7.846 9.827 8.75 7.019 8.3605 22.585 4.3035 0.1905468 0.533828039 0.3569442017 13.843 5.846 8.577 8.365 6.596 7.346 22.906 6.497 0.2836375 0.533828039 0.531327428 14.596 6.942 8.538 8.327 7.404 7.80275 22.7 6.79325 0.2992621 0.533828039 0.560596479 15.321 7.635 6.981 10.058 7.731 8.10125 22.776 7.21975 0.3169894 0.533828039 0.593804281
10 15.904 7.385 6.731 8.154 8.615 7.72125 22.967 8.18275 0.3562829 0.533828039 0.667411416
100314-EM4
050214-EM1
126
11 16.389 7.077 7.942 9.712 7.692 8.10575 22.681 8.28325 0.3652066 0.533828039 0.68412772212 16.925 6.173 6.923 9.096 9.75 7.9855 22.818 8.9395 0.391774 0.533828039 0.73389557913 17.381 6.442 6.615 8.519 6.981 7.13925 22.959 10.24175 0.4460887 0.533828039 0.83564115614 17.692 8.269 7.192 7.885 7.846 7.798 23.171 9.894 0.4269993 0.533828039 0.79988167515 17.905 7.538 8.173 7.231 7.865 7.70175 23.174 10.20325 0.4402887 0.533828039 0.82477624516 18.262 7.058 7.231 6.846 6.904 7.00975 23.093 11.25225 0.487258 0.533828039 0.91276217817 18.645 7.058 10.923 9.192 7.788 8.74025 23.215 9.90475 0.426653 0.533828039 0.79923307618 18.684 8.442 9.923 9.077 9.365 9.20175 23.319 9.48225 0.4066319 0.533828039 0.76172831219 18.877 6.654 7.75 8.712 8.731 7.96175 22.944 10.91525 0.4757344 0.533828039 0.89117536320 19.047 6.25 11.462 10.365 8.115 9.048 23.067 9.999 0.4334764 0.533828039 0.81201503721 19.197 8.404 9.404 10.538 7.077 8.85575 23.198 10.34125 0.445782 0.533828039 0.83506659722 19.397 8.404 10.327 10.442 8.288 9.36525 23.246 10.03175 0.4315474 0.533828039 0.80840145423 19.512 6.692 8.962 11.788 7.462 8.726 23.537 10.786 0.4582572 0.533828039 0.8584360124 19.656 7.577 9.538 9.808 7.788 8.67775 23.481 10.97825 0.4675376 0.533828039 0.87582058125 19.788 7.808 8 10.827 9.615 9.0625 23.608 10.7255 0.4543163 0.533828039 0.8510537126 19.91 7.808 8.75 11.558 9.769 9.47125 23.66 10.43875 0.4411982 0.533828039 0.82648005127 19.939 8.442 7.788 12.038 8.558 9.2065 23.686 10.7325 0.4531158 0.533828039 0.8488047328 20.033 7.673 8.538 12.692 9.25 9.53825 23.636 10.49475 0.4440155 0.533828039 0.83175751829 20.146 8.75 7.25 12.808 10.481 9.82225 23.733 10.32375 0.4349956 0.533828039 0.81486086130 19.99 7.019 7.308 12.885 10.173 9.34625 23.578 10.64375 0.4514272 0.533828039 0.84564156431 20.178 7.75 6.692 12.981 8.692 9.02875 23.653 11.14925 0.4713673 0.533828039 0.88299458632 20.232 7.769 6.25 11.692 8.731 8.6105 23.737 11.6215 0.4895943 0.533828039 0.91713860733 20.363 6.923 5.885 12.558 10.865 9.05775 23.603 11.30525 0.4789751 0.533828039 0.89724610834 20.489 6.923 5.577 14.635 9.885 9.255 23.695 11.234 0.4741085 0.533828039 0.8881295635 20.607 7.173 5.942 13.346 10.5 9.24025 23.468 11.36675 0.484351 0.533828039 0.90731658136 20.607 8.346 7.212 14.712 10.904 10.2935 23.583 10.3135 0.4373277 0.533828039 0.81922960937 20.745 7.962 6.75 14.615 11.231 10.1395 23.819 10.6055 0.4452538 0.533828039 0.83407718638 20.829 7.058 7.096 14.635 14.712 10.87525 23.882 9.95375 0.4167888 0.533828039 0.78075478339 20.841 7.654 5.962 14.154 13.481 10.31275 24.019 10.52825 0.4383301 0.533828039 0.82110724840 20.945 8.615 7.096 13.788 11.442 10.23525 23.806 10.70975 0.4498761 0.533828039 0.84273595441 20.945 7.673 6.231 14.788 9.538 9.5575 24.095 11.3875 0.4726084 0.533828039 0.88531959842 21.02 7.827 6.462 15.558 10.25 10.02425 23.705 10.99575 0.4638578 0.533828039 0.86892744843 21.05 8.635 6.981 14.769 10.058 10.11075 23.756 10.93925 0.4604837 0.533828039 0.86260674544 21.16 9.077 6.538 14.731 9.269 9.90375 23.747 11.25625 0.4740072 0.533828039 0.88793995145 21.232 7.731 7.712 13.846 12.192 10.37025 23.621 10.86175 0.4598345 0.533828039 0.86139062746 21.32 8.673 5.808 14.538 10.942 9.99025 23.713 11.32975 0.4777864 0.533828039 0.8950193947 21.327 8.673 5 16.308 12.442 10.60575 23.802 10.72125 0.4504348 0.533828039 0.8437826548 21.341 7.096 5.327 16.712 13.462 10.64925 23.767 10.69175 0.4498569 0.533828039 0.84270010549 21.538 6.885 6.346 14.442 12.404 10.01925 23.658 11.51875 0.486886 0.533828039 0.91206532350 21.684 7.269 6.058 16.231 13.769 10.83175 23.82 10.85225 0.455594 0.533828039 0.85344718751 21.652 8 6.385 15.058 15.327 11.1925 23.985 10.4595 0.4360851 0.533828039 0.81690173852 21.639 9.212 5.577 16.365 11.327 10.62025 23.986 11.01875 0.4593826 0.533828039 0.86054407653 21.818 9.923 5.558 12.615 11.673 9.94225 23.939 11.87575 0.4960838 0.533828039 0.92929512954 21.885 10.712 7.808 15.096 14.096 11.928 24.068 9.957 0.4137028 0.533828039 0.77497398355 21.916 8.942 8.442 14.25 12.096 10.9325 24.002 10.9835 0.4576077 0.533828039 0.85721930256 21.98 10.846 9.173 16.519 14.269 12.70175 23.622 9.27825 0.39278 0.533828039 0.73578007757 22.115 8 11.288 15.519 12.635 11.8605 23.894 10.2545 0.4291663 0.533828039 0.80394113258 22.122 9.942 10.096 14.423 10.115 11.144 23.854 10.978 0.4602163 0.533828039 0.86210592659 22.306 9.058 7.615 16.154 13.423 11.5625 23.872 10.7435 0.4500461 0.533828039 0.84305440360 22.404 8.692 5.038 16.635 12.942 10.82675 23.898 11.57725 0.4844443 0.533828039 0.90749130761 22.443 10.462 6.75 17.231 10.308 11.18775 23.909 11.25525 0.4707537 0.533828039 0.88184519562 22.568 10.519 6.5 14.462 9.327 10.202 23.844 12.366 0.518621 0.533828039 0.97151329463 22.554 7.692 6.577 15.538 8.654 9.61525 23.573 12.93875 0.5488801 0.533828039 1.02819641264 22.544 10.596 5.692 15.808 9.442 10.3845 23.381 12.1595 0.520059 0.533828039 0.97420701865 22.701 10.596 6.404 17.019 8.846 10.71625 23.614 11.98475 0.5075273 0.533828039 0.95073184166 22.777 9.981 7.365 15.942 7.615 10.22575 23.567 12.55125 0.5325773 0.533828039 0.99765709967 22.809 11.096 6.827 16.212 8.577 10.678 23.64 12.131 0.5131557 0.533828039 0.96127522568 22.842 11.846 7.673 15.962 11.538 11.75475 23.768 11.08725 0.466478 0.533828039 0.87383577469 22.893 10.038 7.115 16.654 11.192 11.24975 23.824 11.64325 0.4887194 0.533828039 0.91549960470 22.998 9.038 7.154 15.558 8.942 10.173 23.876 12.825 0.5371503 0.533828039 1.00622342271 22.967 9.442 6.865 16.5 8.885 10.423 24.174 12.544 0.5189046 0.533828039 0.97204449872 23.107 9.442 5.827 16.5 10.192 10.49025 23.881 12.61675 0.5283175 0.533828039 0.98967729773 23.058 7.577 5.808 15.692 9.231 9.577 24.073 13.481 0.560005 0.533828039 1.04903628874 23.091 10.288 8.173 15.865 10.423 11.18725 24.11 11.90375 0.4937267 0.533828039 0.92487961175 23.157 8.442 7.923 15.519 9.654 10.3845 24.228 12.7725 0.5271793 0.533828039 0.98754516176 23.153 9.058 8.654 15.462 8.673 10.46175 24.378 12.69125 0.5206026 0.533828039 0.97522526877 23.279 7.827 6.904 14.173 11.423 10.08175 24.717 13.19725 0.5339341 0.533828039 1.00019874478 23.206 10.269 6.596 16.269 9.981 10.77875 25.066 12.42725 0.4957811 0.533828039 0.9287281779 23.389 10.923 7.577 15.827 8.308 10.65875 25.05 12.73025 0.5081936 0.533828039 0.95197999280 23.395 12.865 8.212 16.654 10.154 11.97125 25.06 11.42375 0.4558559 0.533828039 0.853937808
127
81 23.476 14.212 7.423 14.846 10.75 11.80775 25.01 11.66825 0.4665434 0.533828039 0.87395818282 23.452 13.577 8.346 14.808 13.019 12.4375 24.891 11.0145 0.4425093 0.533828039 0.82893611583 23.478 12.885 10.038 15.615 10.904 12.3605 25.148 11.1175 0.4420829 0.533828039 0.82813722284 23.352 11.654 11.769 13.635 10.327 11.84625 25.12 11.50575 0.4580314 0.533828039 0.85801309785 23.632 8.75 14.731 13.904 9.269 11.6635 25.084 11.9685 0.4771368 0.533828039 0.89380247186 23.608 11.577 13.058 13.538 11.788 12.49025 25.212 11.11775 0.4409706 0.533828039 0.82605359287 23.73 13.269 15 15.269 9.865 13.35075 25.239 10.37925 0.4112386 0.533828039 0.77035773588 23.747 11.442 16.423 15.154 14.365 14.346 25.282 9.401 0.3718456 0.533828039 0.69656435189 23.758 13.404 14.019 15.538 11.654 13.65375 25.291 10.10425 0.3995196 0.533828039 0.74840503490 23.827 9.904 17.346 15.019 11.981 13.5625 25.307 10.2645 0.4055992 0.533828039 0.75979381391 23.585 14.212 18.423 14.5 11.981 14.779 25.269 8.806 0.3484902 0.533828039 0.65281367792 23.671 14.615 17.346 14.788 12.827 14.894 25.748 8.777 0.3408808 0.533828039 0.63855927493 23.591 11.519 19.058 17.192 11.75 14.87975 25.879 8.71125 0.3366146 0.533828039 0.63056753394 23.558 11.981 21.096 16.154 12.327 15.3895 25.565 8.1685 0.3195189 0.533828039 0.59854269595 23.789 14.442 22.577 17 11.769 16.447 25.801 7.342 0.2845626 0.533828039 0.53306044896 23.78 15.404 19.788 16.327 17.308 17.20675 25.54 6.57325 0.2573708 0.533828039 0.48212302897 23.905 14.135 21.346 15.769 14.635 16.47125 25.944 7.43375 0.2865306 0.533828039 0.53674701198 23.916 10.788 21.308 14.25 13.885 15.05775 25.996 8.85825 0.3407543 0.533828039 0.63832230999 23.918 9.173 19.788 14.788 15.712 14.86525 25.807 9.05275 0.3507866 0.533828039 0.657115368
100 23.882 9.404 19.519 16.75 13.5 14.79325 25.743 9.08875 0.3530571 0.533828039 0.661368673101 23.891 10.365 22.731 16.269 12.981 15.5865 25.693 8.3045 0.3232203 0.533828039 0.605476499102 23.952 9.308 22.212 14.731 12.981 14.808 25.676 9.144 0.3561302 0.533828039 0.667125389103 24.082 9.673 21.808 13.827 12.981 14.57225 25.572 9.50975 0.3718814 0.533828039 0.696631363104 24.125 7.769 22.769 15.481 12.981 14.75 25.666 9.375 0.3652692 0.533828039 0.684245114
128
5 Persistence
Track ID
net distance a cell
moves (D2S: first
point to last point)
Total length of the
track (Len: the total
distance moved along
the track).
presistence
041515-
Centrin
EM1_2
1 37.373 45.997 0.812509511
2 23.231 26.125 0.88922488
3 13.059 19.426 0.672243385
4 30.744 34.912 0.880614115
5 3.528 3.817 0.924286089
6 13.21 16.332 0.808841538
7 6.22 17.249 0.360600615
8 14.913 18.097 0.824059236
9 5.285 5.714 0.924921246
10 2.437 17.61 0.13838728
041215-
Centrin
EM1
1 39.768 42.099 0.944630514
2 23.28 28.893 0.805731492
3 3.367 8.462 0.397896478
4 4.455 6.664 0.668517407
5 14.988 16.204 0.924956801
129
Appendix III - Supplementary movie captions
Supplementary movie 1. The eb3-egfp travel vegetally in the YCL during early epiboly.
Confocal lateral view of eb3-egfp RNA injected wildtype embryo during epiboly initiation (4 hpf
to 4.3 hpf). Time lapse of a single z-plane imaged using Leica TCS SP8 confocal microscope.
The EB3-GFP comets travel towards the vegetal pole in the YCL. Orientation of the embryo:
animal pole up
Supplementary movie 2. Thick microtubule bundles form during late epiboly. Time lapse
live imaging of tuba8l embryo during late epiboly stages (40% to 90% epiboly) by Leica TCS
SP8 confocal microscope at an acquisition speed of 37 seconds/ z-stack. Few thick microtubule
bundles around shield stage. Orientation of the embryo: animal pole up.
Supplementary movie 3. Lateral orientation of microtubule during late epiboly. Time lapse
live imaging of tuba8l embryo during late epiboly stages (50% to 60% epiboly) by Leica TCS
SP8 confocal microscope at an acquisition speed of 24 seconds/ z-stack. Microtubule networks
align lateral to the blastoderm-yolk margin. Orientation of embryo: animal pole up.
Supplementary movie 4. e-YSN moves vegetally during late epiboly. Time lapse live imaging
of h2a-gfp injected tuba8l embryo by Leica TCS SP8 confocal microscope at an acquisition
speed of 24 seconds/ z-stack. Overview of e-YSN movement during late epiboly stages (50% to
70% epiboly). Straight microtubules appear to extend from YSN to the yolk cortex. Orientation
of embryo: animal pole up.
Supplementary movie 5. e-YSN shape changes from round to elongated. Time lapse live
imaging of h2a-gfp injected tuba8l embryo by spinning disk confocal microscope at an
acquisition speed of 11 seconds/ z-stack. Leading end of e-YSN points in the direction of
130
movement towards the vegetal pole at ~50% epiboly stage. Orientation of embryo: animal pole
up.
Supplementary movie 6. Straight microtubule bundles extend vegetally from e-YSN. Time
lapse live imaging of h2a-gfp injected tuba8l embryo by spinning disk confocal microscope at an
acquisition speed of 11 seconds/ z-stack. Straight microtubule bundles extend vegetally from the
e-YSN and wavy microtubules move towards the animal pole at ~60% epiboly stage. Orientation
of embryo: animal pole upper left.
Supplementary movie 7. Linked e-YSNs during late epiboly. Confocal projection of h2a-gfp
injected tuba8l embryo by spinning disk confocal microscope. 3D reconstruction of two linked e-
YSNs using Imaris software.
Supplementary movie 8. 3D morphology of the e-YSN and straight microtubules. Confocal
projection of h2a-mcherry injected tuba8l embryo by spinning disk confocal microscope. 3D
computational reconstruction of YSN and microtubules using Imaris software. Most surficial
surface of the e-YSN appears flat, while the other side is rounded and bulges into the yolk mass.
Supplementary movie 9. Microtubules wraps around e-YSN. Confocal projection of tuba8l
embryo by spinning disk confocal microscope. 3D computational reconstruction of microtubules
using Imaris software. The black void, where YSN is assumed to be located, is wrapped by
microtubules.
Supplementary movie 10. Microtubule extending from e-YSN appear stabilized via FRAP.
Time lapse live imaging of tuba8l embryo by spinning disk confocal microscope at an
acquisition speed of 7.7 seconds/ z-stack. Microtubules extending from the e-YSN were
photobleached. Reduced fluorescence recovery observed and e-YSN moves into the
131
photobleached area. Orientation of embryo: animal pole up. White circles: regions without
microtubules. Red circle: microtubules away from ROI.
Supplementary movie 11. Cycles of YCL microtubules disassemble and reassemble at
early cleavage stages. Time lapse live imaging of dclk2 embryo by spinning disk confocal
microscope at an acquisition speed of 5.8 seconds/ z-stack. Starting from 2-cell stage,
microtubule network in the yolk flows into the blastoderm and disassembles. Microtubule
fragments appear and travel from blastoderm to yolk. Orientation of embryo: animal pole up.
Supplementary movie 12. Microtubule detach and reattach in the yolk cell. Time lapse of a
single z-plane imaged using laser-spinning disk confocal microscope. Live imaging of tuba8l
embryo reveal microtubule detach and reattach to another microtubule in the yolk cell.
Orientation of embryo: animal pole on right.