adjacent nuclear factor-1 and activator protein binding sites in the

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 267, No. 20, Issue of July 15, pp. 14204-14211, 1992 Printed in U. S. A.

Adjacent Nuclear Factor-1 and Activator Protein Binding Sites in the Enhancer of the Neurotropic JC Virus A COMMON CHARACTERISTIC OF MANY BRAIN-SPECIFIC GENES*

(Received for publication, January 21, 1992)

Kei AmemiyaSs, Renee Traub, Linda Durham, and Eugene 0. Major From the Molecular Virology and Genetics Section, Laboratory of Viral and Molecular Pathogenesis, National Institute of Neurological Disorders and Stroke, National Institute of Health, Bethesda, Maryland 20892 and SIgen, Inc., Rockuille, Maryland 20852

JC virus is a neurotropic virus that causes the demyelinating disease progressive multifocal leukoencephalopathy in humans. In order to understand the neurotropic nature of this virus, we examined the binding of nuclear proteins to the viral regulatory region. A close association of nuclear factor-1 (NF-1) and Jun protein binding sites was found. These binding sites were either adjacent or overlapped each other. De- pending on the order of binding, there was some inter- ference of binding of the NF-1 protein by Jun even at a non-dun binding site. This suggests that there may be a direct interaction between these proteins. Exam- ination of the regulatory region of a number of genes expressed in the central and peripheral nervous sys- tems revealed that many of these genes apparently have adjacent NF- 1 and activator protein binding sites immediately upstream from the the mRNA start site. Since it had been demonstrated that nuclear proteins from brain and non-brain cells could interact with these sites, it is probable that the NF-1- and Jun- related proteins which interact at these sites are involved in the basal activity of these genes. It appears that adjacent binding sites for NF-1 and Jun immediately upstream from the mRNA start site may be a characteristic of many genes expressed in the nervous system.

Transcription of a gene is a complex process which requires the direct or indirect involvement of many proteins (for review see: Dynan, 1989; Maniatis et al., 1987; Roeder, 1991). Some of these proteins may be part of the general machinery required for basal transcription of many genes. Stimulation of the basal transcriptional activity would require the involvement of another set of proteins which may recognize specific cis-acting elements in the regulatory region of the gene. A wide variety of these proteins can determine the activity of the gene under different physiological conditions or in different tissues. Because of the almost unlimited number of possibilities in type, number, and arrangement of the protein factors which are in this category, the expression of many genes can be unique with respect to temporal and/or tissue- specific expression. Nevertheless, the expression of a set of

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

!$ To whom correspondence should be addressed NINDS, LVMP, Bldg. 36, Rm. 5C03, NIH, Bethesda, MD 20892. Tel.: 301-496-2043; Fax: 301-402-0828.

genes can be regulated by a singular transacting factor or set of these factors which are required for the activity of these genes. The availability of this factor(s) or the activity of this factor(s) can dictate when or where the gene(s) may be expressed. The final level of expression is affected by the combinatorial activity of both general and specific factors required for the activation of the gene(s).

JC virus (JCV),’ which is a human polyomavirus, has a relatively restricted host range (Padgett et al., 1977). It is the etiological agent of the human demyelinating disease, progressive multifocal leukoencephalopathy (see review Major et al., 1992). Progressive multifocal leukoencephalopathy is the result of the lytic infection of oligodendrocytes, which are the myelin-producing cells in the central nervous system. One question then arises as to what enables JCV to specifically target glial cells in the central nervous system. It has been shown that one restriction to the host range of JCV is at the level of transcription (Kenney et al., 1984). The regulatory region of JCV consists of two direct 98-bp repeat units (Fris- que et al., 1984). Unlike other primate polyomaviruses like SV40 and BK virus, each repeat unit of the prototype virus, Madl, contains a T/A-rich region which presumably serves as the TATA box. The early region of the virus codes for the only regulatory proteins encoded by the viral genome: the large T and small t proteins. The large T antigen is a multi- functional protein which is required for viral DNA replication and is involved in the switch from early to late transcription (Salzman et al., 1986). Expression of the JCV genome is dependent on the availability of active host factors. In order to determine what factors are involved in the tissue-specific expression of JCV, we are characterizing nuclear proteins from glial and nonglial cells which interact with the JCV promoter-enhancer region.

In several regions of the JCV promoter-enhancer region, we have found a close association of nuclear factor-1 (NF-1) and Jun-related protein binding sites. The binding sites for these two factors are either adjacent or overlapping. In the central portion of the 98-bp repeat unit, NF-1 and Jun proteins can bind to adjacent sites, although they protect overlapping nucleotides when examined individually. It appears, however, that prebinding of Jun protein could slightly inter- fere with binding of NF-1 protein even at a site at which Jun does not bind. These results suggest that there could be a direct interaction of Jun with NF-1 under some conditions. Examination of the regulatory region of a number of glial- or

The abbreviations used are: JCV, J C virus; bp, base pair(s); NF- 1, nuclear factor-1; HFG, human fetal glial; CRE, cyclic AMP- responsive element; AP-1, activator protein-1; ATF, activation transcription factor; MBP, mylein basic protein; CMV, cytomegalovirus.

14204

Adjacent NF-1 and Ac

neuronal-specific genes has revealed that many of these have apparent adjacent binding sites for NF-1- and Jun-related proteins. The binding site for these two proteins is located a short distance from the mRNA start site.

MATERIALS AND METHODS

Cell Lines-Primary (8-16 weeks gestation) human fetal glial (HFG) cells, a transformed HFG (SVG) cell line (Major et al., 1985), a glioma (A172) cell line, and HeLa cells were grown in Eagle's minimum essential medium with 10% fetal bovine serun, L-glutamine (0.3 mg/ml), and antibiotics. Cells were grown at 37 "C with 5% Cot in 150 X 25-mm culture dishes and harvested after 3-5 days.

DNA Probes and Oligonucleotides-The 368-bp HindIII-AccI DNA fragment used in the binding studies was obtained from the plasmid pJC188,,i which contains only one 98-bp repeat unit (Amemiya et al., 1989). It was labeled with '*Po4 at the 5'-end of the HindIII site with T4 polynucleotide kinase, digested with AccI, gel-purified, and con- centrated. The 278-bp AccI-FokI fragment came from pJC582,h, which contains the JCV 582-bp StuI-AccI fragment covering the regulatory region cloned into the EcoRV-AccI site of pBR322. ~JC582,,~ was digested with AccI, dephosphorylated, kinased, and digested with FokI to yield the 278-bp AccI-FokI fragment. The 337- bp HindIII-ApaI fragment which contained part of the regulatory region of the mouse MBP gene came from the plasmid pJCC138 which was a kind gift from Dr. Lynn Hudson in our laboratory.

Oligonucleotides used in this study were prepared essentially as described previously (Amemiya et al., 1989). The following oligonucleotides were used site A/B (34-mer), 5'-GATCTGGAAGGGA TGGCTGCCAGCCAAGCATGAA-3'; site A/Bm (34-mer), 5'-GAT CTGGAAGGGATTACTGCCAGCTGAGCATGAA-3'; site C (38- mer), 5'-GATCTAGCTGTTTTGGCTTGTCACCAGCTGGCCAT A-3'; site D (38-mer), 5"AGGATCTAGCTGTTTTGGCTTGTCA CCAGCTGGCCATA-3'; site E (38-mer), 5"GATCTCCATGGT

Nuclear Extract Preparation-Nuclear extracts were prepared by the method of Dignam et al. (1983) with the following modifications as described by Dynan (1987). After the nuclei were lysed and ex- tracted, the mixture was centrifuged at 50,000 rpm for a t least 60 min. The proteins from the supernatant were precipitated by the addition of solid ammonium sulfate (0.33 g/ml). After stirring the

TCTTCGCCAGCTGTCACGTAAGGCTA-3'.

A.

<

B.

8, 274

8"' 207

711169

W131

t I E ? I

i

1 274

Q,, 231

0,

I

8, 274

B"l

207

711m

W131

tivator Protein Sites 14205

mixture for 30 min, the precipitate was collected at 10,000 rpm and resuspended in 0.1 volume of the original packed cell volume in TMO.1M buffer and dialyzed overnight against at least 1 liter of TMO.1M buffer. After dialysis, insoluble material was sedimented at 10,000 rpm for 5 min. The supernatant was stored in small aliquots after quick-freezing in solid dry ice a t -70 "C. Protein was determined by the method of Bradford (1976).

The following purified factors were kindly provided by Dr. Robert Tjian (University of California, Berkeley, CA) and the following people: HeLa CTF/NF-1, Dr. Naoko Tanese; recombinant c-Jun, Dr. Richard Turner; and recombinant SP-1, Dr. Steve Jackson. Recom- binant C/EBP protein was kindly provided by Dr. Steven McKnight and Dr. Jon Shuman (Carnegie Institution of Washington, Baltimore, MD).

Gel Retardation and DNase I Protection Assays-Binding reactions for gel retardation assays and DNase I protection assays were carried out as described previously (Amemiya et al., 1989) except for the following changes. The binding reactions were incubated at 22 "C for 15 min. For gel retardation assays the binding reaction mix was analyzed on a 6% polyacrylamide gel containing 25 mM Tris acetate (pH 8.3), 190 mM glycine, 1 mM EDTA, and 5% glycerol. Labeled DNA fragments were sequenced for markers for footprint gels (Maxam and Gilbert, 1980).

RESULTS

Nuclear Protein Binding Sites in the Regulatory Regwn- In order to examine binding of nuclear proteins to the JCV regulatory region, a 368-bp HindIII-AccI DNA restriction fragment labeled at the HindIII site was used. This DNA fragment contains only one 98-bp direct repeat unit (Amemiya et al., 1989). Increasing amounts of nuclear proteins from primary HFG cells, a transformed HFG cell line (SVG; Major et al., 1985), and HeLa cells were allowed to bind to the 368- bp HindIII-AccI DNA fragment, and binding was examined by DNase I protection analysis. As Fig. 1 shows, most of the DNase I-protected regions with the three different nuclear protein preparations were identical and were labeled as sites A B , C, and D. Site A/B (nucleotides 32-71) was labeled as such because it was located within the 98-bp repeat unit and

C.

< 8,

274

231

8, 711168

W131

274

8, 231

0,

FIG. 1. Identification of nuclear protein binding sites. Binding sites were detected on a 368-bp HindIII-AccI fragment (5 ng) labeled at the 5'-end of the HindIII site. The HindIII site is toward the bottom of each panel, and the right panel of each pair is an expansion of the upper part of the left panel. A, nuclear extract from HFG cells: lane I, no extract; lane 2, 35 pg; lane 3, 70 pg; and lane 4, 105 pg. B, nuclear extract from SVG cells: lane I , no extract; lane 2, 37 pg; lane 3, 74 pg; and lane 4, 111 pg; C, nuclear extract from HeLa cells: lane I, no extract; lane 2,33 pg; lane 3,65 pg; lane 4,104 pg. Lanes labeled G and G+A are markers. The open boxes on the right of each panel shows the protected sites and on the left of each panel a diagram of the JCV regulatory region.

14206 Adjacent NF-1 and Activator Protein Sites a +

~ ~ 1 2 3 4 5 6

n

FIG. 2. Binding of nuclear proteins toward the late region. The binding sites were detected on a 278-bp AccI-FokI fragment (12.5 ng) labeled at the 5'-end of the AccI site. Lane 1 is without extract. Lanes 2-4 are with 24, 48, and 96 pg, respectively, of glioma A172 extract. Lane 5 is with extract (95 pg) from SVG cells. Lane 6 is with extract (104 pg) from HeLa cells. Lanes labeled G and G+A are markers. Open boxes on the right show the protected sites. The schematic on the left shows the JCV regulatory region with the AccI site toward the bottom. The ATG is the putative beginning of the agnoprotein open reading frame.

J C V S I T E S E Q U E N C E

A/ B 331131AAGG G A m C T GCC A-G CATGA

A/Bm 331131AAGG G A m C T GCC A-G CATGA

C 207GGGA A G m A A AGC AG.SXMG GGAAC

D 2 5 1 C T G T T T E G C T T G T CACCAGC TGGCC

E 271TGGC C A m T T C T T CGXA!X TGTCA

N F - 1 C o n s e n s u s m C N NNN N W N

FIG. 3. Comparison of nucleotide sequences within the nuclear binding sites. Nucleotide sequences within the binding sites A/B, C, D, and E were aligned relative to the apparent NF-1 sequence in each site (Chodosh et al., 1988). The numbering of the nucleotides represents their position in the JCV regulatory region (Frisque et al., 1984). Nucleotide sequence A/B represents comparable sites in each of the 98-bp repeat units. A/Bm, which was used as a competitor, has the same nucleotide sequence as A/B except for the nucleotides shown in boldface.

is also present in the second repeat unit (as site B). Site C is outside and adjacent to the 98-bp repeat unit (nucleotides 207-231), and site D is further toward the late region (nucleotides 252-274). At lower concentrations of HFG and SVG nuclear extracts, a partial DNase I-protected region can be seen at site A/B (Fig. 1, A and B, lune 2). This protected region is closer to the size initially reported for this region (Amemiya et al., 1989). Increasing the protein concentration from HFG and SVG cells increased the size of protected region (Fig. 1, A and B, lanes 3 and 4 ) . Nuclear proteins from

HeLa cells, on the other hand, protected the whole region even at the lowest protein concentration (Fig. lC, lunes 2-4).

One site which was weakly protected by nuclear proteins from only HeLa cells was found between site C and D (Fig. lC, far right panel, lunes 2-4). A new hypersensitive band appears which has not been seen with nuclear extracts from HFG and SVG cells. We also examined the binding by the nuclear extracts from the three cell lines on the opposite strand of the 368-bp HindIII-AccI DNA fragment and found the same protected sites including the site between sites C and D by the HeLa nuclear proteins (data not shown). An- other DNase I-resistant region seen with all three nuclear extract (and others not shown) was seen at the end of the probe located at the bottom of Fig.1 (bottom of each left panel). This protected region was found primarily on one strand and appeared to be independent of the nucleotide sequence of the DNA fragment.'

We examined the region toward the late region more closely by using a 278-bp AccI-FokI DNA fragment labeled at the 5'- end of the AccI site. Nuclear proteins from a glioma cell line A172, SVG cells, and HeLa cells were used to examine binding to this region (Fig. 2). As shown previously, nuclear proteins from SVG cells protected sites C and D (Fig. 2, lune 5 ) . The same results were obtained with nuclear extracts from HFG cells on this DNA fragment (data not shown). However, nuclear proteins from HeLa cells protected an additional site (site E) which was adjacent to site D and further into the late region of JCV (Fig. 2, lune 6 ) . Interestingly, similar results were obtained with the glioma A172 nuclear proteins (Fig. 2, lunes 2-4). In addition, the region between sites C and D was also partially protected by nuclear proteins from the glioma cell line besides that from HeLa cells. In summary, nuclear proteins from brain and nonbrain cells could bind to at least five sites in the JCV regulatory region. Three of these sites (A/B, C, and D) were recognized by all cell lines examined, but two sites (E and the region between sites C and D) were weakly or moderately bound by nuclear proteins from HeLa and a glioma cell line, which, interestingly, do not support the growth of JCV.

When the nucleotide sequences within the binding sites A/ B, C, D, and E were aligned (Fig. 3), the sequence and arrangement of a common motif present in all the sites suggests that it was the binding site for one of the members of the family belonging to the NF-1 transcription factors. Binding of nuclear proteins from brain or Hela cells to oligonucleotides containing the putative NF-1 sites (A/B-D) showed that binding was different, and little or no binding occurred to an oligonucleotide containing an altered (site A/ Bm) NF-1 concensus sequence (data not shown). Weak binding occurred to the oligonucleotide containing site E with nuclear proteins from HeLa cells and even less binding with nuclear extracts from brain cells, although the protein-DNA complexes were similar. These results suggest that the protein(s) from brain and HeLa cells binding to the putative NF- 1 sites A/B-D may be different and that the protein(s) binding to site E is different than that binding to sites A/B-D.

Recognition of Binding Sites by Purified CTF/NF-1 and Jun-In order to confirm the putative NF-1 binding sites (A/ B, C, and D) a purified HeLa cell CTF/NF-1 preparation was used to examine binding to the 368-bp HindIII-AccI DNA fragment. Three sites were protected by the CTF/NF-1 preparation in this DNA fragment (Fig. 4A and B). These protected sites were at sites A/B (nucleotides 34-56), C (nucleotides 210-233), and D (nucleotides 252-274). Site E was not protected by the CTF/NF-1 preparation when binding was

K. Amemiya, unpublished data.

FIG. 4. Binding of purified nuclear factor CTF/NF-1 to the JCV regulatory region. A, a 368-bp HindIII-AccI fragment (10 ng) labeled at the 5’-end of the HindIII site was used. The left panel is shown with the HindIII site toward the bottom, and the right panel is an expansion of the upper portion of the left panel. Lane 1 is with no protein. Lane 2 is with HeLa cell extract (104 pg). Lanes 3 and 4 are with 5 and 10 ng, respectively, of CTF/NF-1 protein. B, a 278-bp Ad-FokI fragment (10 ng) labeled at the 5’-end of the AccI site was used. Lane 1 is with no protein. Lane 2 is with SVG cell extract (105 pg). Lane 3 is with HeLa cell extract (130 pg). Lanes 4 and 5 are with 10 and 20 ng, respectively, of CTF/NF-1 protein. On the left of each panel is a schematic of the JCV regulatory region, and the ATG is the putative start of the agnoprotein open reading frame. The open boxes on the right of each panel depicts the protected region. Lanes labeled G and G+A are markers.

Adjacent NF-1 and Activator Protein Sites

a + 0 0 1 2 3 4

examined with the 278-bp AccIIFokI DNA fragment (Fig. 4B, lanes 4 and 5). Interestingly, the full length of site A/B was not protected by the purified CTF/NF-1 preparation as was seen with the crude nuclear extract (Fig. 4A, lane 2).

We also examined binding to the JCV regulatory region with a purified recombinant Jun preparation. Two regions were protected in the 368-bp HindIII-AccI DNA fragment from DNase I digestion with the Jun protein (Fig. 5A). One of the protected sites (nucleotides 50-70) was located toward the latter half of site A/B (Fig. 5A, left panel, compare lane 2 with lanes 3 and 4 ) . Inspection of the nucleotides in the protected region revealed the sequence 5’-TGAGCTCA-3’. This is similar to the recognition sequence (5”TGACGTCA- 3’) for the activation transcription factor (ATF) or the cyclic AMP-responsive element (CRE) (Hai and Curran, 1991; Roesler et al., 1988). Another site protected by the Jun preparation (nucleotides 252-273) coincided with site D which was also protected by the CTF/NF-1 preparation (Fig. 5A, lanes 2-4). Within these protected nucleotides, the sequence 5’-TGTCACCA-3’ is present, and it resembles the sequence (5”TGACATCA-3’) for an activator protein-1 (AP-1) binding site (Angel et al., 1987; Lee et al., 1987). Further into the late region we observed another protected site (nucleotides 277-300) with the Jun preparation which overlapped site E which was previously protected only by nuclear proteins from HeLa and glioma cells (Fig. 5B, lanes 2-5). It is not clear a t this time which are the important nucleotides within this protected region, although there is a sequence (5”AGCTG-

I

n t - ? a

0)

3 U

14207

B.

n

a + 0 0 1 2 3 4 5

IC

TCA-3’) which has some partial homology to a ATF/CRE binding site. The Jun preparation also protected some regions in the vector portion of the DNA fragment (see upper part of Fig. 5A, lanes 3 and 4 ) . Examination of the nucleotides in these protected regions revealed some homology to a AP-1 binding site. In addition to examining the binding by CTF/ NF-1 and Jun preparations, we tested binding of the transcription factor Sp-1 (Dynan and Tjian, 1983) to the JCV 368-bp HindIII-AccI DNA fragment; however, no binding by Sp-1 could be detected.

Interaction between NF-1 and Jun Proteins-Since site A/ B appeared to be occupied by at least two proteins simulta- neously, we wanted to determine if the prior occupancy of one site would affect the binding to the adjacent site. This was examined by allowing one protein to bind first before adding the second nuclear protein. The CTF/NF-1 protein was allowed to bind to the 368-bp HinIII-AccI DNA fragment for 10 min before adding purified Jun protein to the binding mixture, and the incubation period was continued for an additional 10 min before treating the mixture with DNase I. The results show that the protected regions appeared identical to that obtained with the crude nuclear protein preparation (Fig. 6, compare lane 2 with lane 4 ) . When the order of addition was reversed (Jun before CTF/NF-1; Fig. 6, lane 5)) there was a slight inhibition of binding of the CTF/NF-1 protein to site A/B (seen more clearly on longer exposed autoradiograms). Unexpectedly, binding of CTF/NF-1 protein to site C was partially inhibited, although Jun protein

14208 Adjacent NF-1 and Activator Protein Sites

A. a +

001 2 3 4

FIG. 5. Binding of nuclear factor Jun to the JCV regulatory region. A, a 368-bp HindIII-AccI fragment (17 ng) labeled at the 5'-end of the HindIII site was used. The left panel is shown with the HindIII site toward the bottom, and the right panel is an expansion of the upper portion of the left panel. Lane I is without protein. Lane 2 is with HeLa cell extract (98 pg). Lanes 3 and 4 are with 0.5 and 1.0 pl, respectively, of Jun protein. B, a 278-bp AccI-FokI fragment (2 ng) labeled at the 5'-end of the AccI site was used. The panel is shown with the AccI site toward the bottom. Lane I is without protein. Lane 2 is with HeLa cell extract (98 pg). Lanes 3-5, are with 0.5, 1.0, and 3.0 pl, respectively, of Jun protein. On the left of each panel is a schematic of the JCV regulatory region. The ATG is the putative start site of the agnoprotein open reading frame. The open boxes on the right of each panel depict the protected sites. Lanes labeled G and G+A are markers.

n a .

8

does not bind to this site. No difference in binding could be detected at site D, since either CTF/NF-1 or Jun proteins can bind to this site. These results suggest that i t may be important for the CTF/NF-1 protein to bind to its cognate binding site before the binding of Jun to its adjacent binding site. In addition, there may be a direct interaction between CTF/NF-1 and Jun proteins which can affect binding of CTF/ NF-1 to its cognate binding site. In summary, the binding studies with the purified protein preparations suggest that depending on the conditions site A/B can be occupied simul- taneously by a CTF/NF-1-like factor and a CRE-related factor. Site C appears to be recognized by a CTF/NF-1-like factor, but site D appears to contain binding sites for either a CTF/NF-1-like factor or Jun-related (AP-1-like) factor. Fi- nally, site E appears to be recognized by a Jun-related factor (ATF/CRE), although it contains a putative consensus sequence for a CTF/NF-1 like factor.

DISCUSSION

We had suggested previously that a NF-1-like factor could interact with the JCV regulatory region and possibly be involved in the restricted expression of JCV (Amemiya et al., 1989). The CTF/NF-1 preparation used in this study is be- lieved to be a member of a family of proteins which recognizes a specific nucleotide sequence or a subset of the sequence (Dorn et al., 1987; Raymondjean et al., 1988, Chodosh et al.,

+ 0 0 1 2 3 4

6. a

w 0 1 2 3 4 + 5

f

1988). Another member of this family is the CTF protein which recognizes the pentanucleotide 5"CCAAT-3' (Graves et al., 1986). It has also been reported that the CTF/NF-1 protein can recognize both the NF-1 and CTF binding sites (Jones et al., 1987; Santoro et al., 1988). Several pieces of evidence suggest that the nuclear protein binding to the JCV regulatory region is a NF-1 protein and not a CTF protein. First, a binding assay with an oligonucleotide containing the adenovirus 2 NF-1 binding site was able to compete with the binding of nuclear proteins to the JCV regulatory region (Amemiya et al., 1989). Second, an oligonucleotide containing the CCAAT sequence of the adenovirus 2 major late promoter could not compete with the binding of nuclear proteins to the JCV regulatory sequences (Amemiya et al., 1989). Finally, we were not able to detect binding of a recombinant CCAAT/ enhancer-binding protein (C/EBP; Landschulz et al., 1988) by footprint analysis to the JCV regulatory region, although very weak binding was detected to a distal portion of the 98- bp repeat unit by gel retardation assays.* Our results suggest that the CTF/NF-1 protein can bind to the NF-1 recognition sequence and possibly to a CCAAT sequence, but the C/EBP factor can only recognize its cognate binding site and not the NF-1 binding site. For simplicity and the evidence cited above, we are calling the protein binding to the NF-1 recognition sequence as NF-1.

Because we have been able to detect binding of NF-1 and a

Adjacent NF-1 and Activator Protein Sites 14209

4 + 0 0 1 2 3 4 5

c - a.

a + 0 0 1 2 3 4 5

.~

FIG. 6. Binding of CTF/NF-1 and Jun to JCV site A/B is partially exclusive. A 368-bp HindIII-AccI fragment (5 ng) labeled a t the 5‘-end of the HindIII site was used. The left panel is shown with the HindIII site toward the bottom, and the right panel is an expansion of the upper portion of the left panel. Lane 1 is with no protein. Lane 2 is with HeLa cell extract (98 pg). Lane 3 is with 1 pl of Jun protein. Lane 4 is with CTF/NF-1 protein (10 ng) for 10 min and then followed by Jun protein (1 pl) for another 10 min. Lane 5 is with Jun protein (1 pl) for 10 min and followed by CTF/NF-1 protein (IO ng) for another 10 min. On the left of each complex panel is a schematic of the regulatory region. The open boxes on the right depict the protected sites with the HeLa cell extract. Lanes labeled C and G+A are markers.

Jun-related protein within the JCV regulatory region by nuclear proteins from both brain and nonbrain cells, we believe that the binding of these two diverse proteins to the regulatory region may be involved in regulating the basal expression of the viral genome. The basal expression of the JCV promoter- enhancer could be modulated at least several ways. The concentration or binding activity of these factors could increase in response to extracellular signals (Morgan and Curran, 1991; Roesler et al., 1988). Since Jun and its related proteins function as dimers, the composition of the active dimer could influence its binding affinity to the CRE- or AP-1-like sites (Hai and Curran, 1991; Nakabeppu et al., 1988). I t has been reported that Jun can interact with the glucocorticoid receptor and thereby prevent its binding to the glucocorticoid response element (Diamond et al., 1990; Jonat et al., 1990; Schule et al., 1990a; Yang-Yen et al., 1990). In addition, the binding of Jun/Fos protein to a AP-1 site within a CTF recognition site excludes CTF protein binding and down-regulates the expres-

sion of the osteocalcin gene (Owen et al., 1990; Schule et al., 199Ob). Besides these possible mechanisms to regulate the basal expression of the JCV promoter-enhancer, there is the potential to negatively regulate JCV gene expression by nuclear proteins from cells which do not support the growth of JCV. We observed binding or partial binding to at least two sites within the JCV regulatory region by nuclear proteins from HeLa and glioma cells. One binding site was between NF-1 binding site C and D and the other at site E. The identification of these proteins is still in progress.

Since we identified binding of NF-1 and a Jun-like protein to the promoter-enhancer region of JCV, we wanted to examine the regulatory region of other glial- or neuronal-specific genes for the possible presence of similar regulatory elements. Fig. 7 shows the immediate upstream nucleotide sequence of some genes which are expressed in the central nervous system or peripheral nervous system. In the regulatory region of both the mouse mylein basic protein (mMBP) and human glial fibrillary acidic protein (hGFAP) genes, the putative NF-1 binding site has been detected by DNase I protection analysis (Tamura et al., 1988; Besnard et al., 1991). Except for some minor differences in the nucleotide sequence between the mMBP and human MBP (hMBP) (Kamholz et al., 1988), the hMBP regulatory region does appear to have a NF-1-like binding site in the same region. In the upstream region of the rat proteolipid protein (rPLP) gene, two adjacent binding sites have been found within 100 bases upstream from the mRNA start site (Nave and Lemke, 1991). The nucleotides underlined for the rPLP gene which most represent a possible NF-1 binding site are located within the two reported binding sites. On examination of the regulatory region of the human SlOOB (hS100B) gene two putative NF-1-like binding sites can be seen (Allore et al., 1990). The SlOOB gene codes for a low molecular weight calcium binding protein expressed pre- dominately in astrocytes. We also show part of the regulatory region of two neuronal-specific genes. In the regulatory region of the mouse neurofilament L (mNF-L) gene (Nakahira et al., 1990), we see a possible NF-1 binding site. Examination of the regulatory region of the human NF-H gene (not listed), however, did not reveal a possible NF-1 binding site near the same region as in the mNF-L gene (Lees et al., 1988). In the regulatory region of the human proenkephalin (hPROENK) gene, multiple binding sites have been found with nuclear proteins from HeLa and rat c 6 glioma cell lines immediately upstream from the mRNA start site (Comb et al., 1988). One of these sites was reported to be protected by a protein called ENKTF-1. On close inspection of the protected region, a reasonable facsimile of a NF-1 recognition sequence can be found. Of the seven separate genes listed in Fig. 7, three of them (JCV, mMBP, and hGFAP) have identified an NF-1 site by footprint analysis, and a fourth (hPROENK) has reported binding to a similar sequence, but has called the protein by another name.

Besides looking for a possible NF-1 binding site in these genes, we examined the neighboring nucleotides for potential binding sites for an activator-like protein. Of the six separate genes examined, five of them (mMBP, hMBP, hGFAP, mNF- L, SlOOB, and hPROENK) appear to have potential binding sites for an activator or related protein. Of these five genes, two of them (hGFAP and hPROENK) have identified an activator protein binding site (AP-2) by footprint analysis. Of the remaining genes listed (mMBP, hMBP, rPLP, mNF-L, and SlOOB), only the rPLP gene did not appear to have a potential binding site for an activator-like protein. However, it was reported that there were two binding sites in the region of the rPLP gene for unidentified proteins (Nave and Lemke,

14210 Adjacent NF-1 and Activator Protein Sites

GENE/VIRUS

JCV

mMBP

hMBP

hGFAP

rPLP

sloop

mNF-L

hPROENK

CELL TYPE

EXPRESSION

GLIAL

GLIAL

GLIAL

GLIAL

GLIAL

GLIAL

NEURON

NEURON

NUCLEOTIDE SEQUENCE

NF-1 SITE ACTIVATOR PROTEIN SITE

CRE -58- - ~ ~ G C A ~ T A C C T A G

TRE -124-GCGCCm - 11 OCCCAGC-GGGAA

TRE -127- -113CCCAGCTGACCCAGGGAG

AP-2 -114- - ~ O ~ A ~ C C T C A G G C T

-102- -B~AGGAGGTGGGGACAAGGG

AP-2 -128- -114CCCCGTTGGCTQXCAT

-78[PGGGCT- -64GGTTCATCCATCCTCCTG

AP-2 -104- -~~CGCTGCCCCCACTGGCCT

AP-2 -104- -~~CGTCAGCTGCAGGCUX.C

FIG. 7. Comparison of nucleotide sequences in the regulatory region of genestvirus expressed in the central nervous system/ peripheral nervous system. The nucleotide sequences were aligned relative to a putative NF-1 binding site. The numbering of the nucleotides is relative to the mRNA start site. The direction of early transcription of JCV is to the left, whereas the direction of transcription of the other genes is toward the right. The data were derived from the following sources: JCV, this paper; mouse myelin basic protein (mMBP), Tamura et al., 1988; human MBP (hMBP), Kamholz et al., 1988, human glial fibrillary acidic protein (hGFAP), Besnard et al., 1991; rat proteolipid protein (rPLP), Nave and Lemke, 1991; human SlOOB (hSlOOB), Allore et al., 1990; mouse neurofilament L (mNF-L), Nakahira et al., 1990; human proenkephalin (hPROENK), Comb et al., 1988. The putative NF-1 and activator protein binding sites are underlined.

1991). In the same region of the hPROENK gene, it was also demonstrated that two other binding sites (AP-1 and AP-4) could be discerned which overlap each other and overlap the ENKFl (NF-1) and AP-2 binding sites (Comb et al., 1988). We have confirmed the presence of the NF-1 binding site and putative activator protein binding site in the regulatory region of the mouse MBP gene by DNase I protection analysis with nuclear extracts from brain and HeLa cells and purified Jun protein, respectively (data not shown). The region protected by the Jun protein (nucleotide 93-109) contained the sequence 5’-TGACCCA-3’. This sequence element is similar to the phorbol ester (12-O-tetradecanoylphorbol-13-acetate)-responsive element found in the regulatory region of SV40 virus and the human metallothionein IIA gene (Angel et al., 1987; Lee et al., 1987).

It appears that the presence of adjacent NF-1 and activator protein binding sites immediately upstream from the mRNA start site may be a characteristic of many genes which are expressed in a glial- or neuronal-specific manner. Interest- ingly, the activity of the activator protein(s) which binds to this immediate region can be stimulated or activated by changes in environmental or cellular conditions (Morgan and Curran, 1991), and it may be the component responsible for activating the NF-1-activator protein complex under certain conditions. Adjacent NF-1 and activator protein binding sites can also be found in the proximal 68-bp repeat unit of the BK virus enhancer (Sundsfjord et al., 1990; Markowitz et al., 1991). BK virus which is closely related to JCV, is not nor- mally considered to be neurotropic; however, there are reports that it is associated with some human brain tumors (Corallini et al., 1987; Dorries et al., 1987). The human cytomegalovirus (CMV), which belongs to the herpes virus group, has been

found to infect the central nervous system in patients with aquired immunodeficiency syndrome (Morgello et al., 1987; Vinters et al., 1989; Wiley et al., 1986). In many cases, CMV has been found not only in microglial cells but also in cells of astroglial and neuronal origin (Morgello et al., 1987; Wiley et al., 1986). Examination of the regulatory region of the CMV immediate early (IE) gene did not reveal adjacent NF-1 and activator protein binding sites. What was seen, however, was a number of CRE and AP-1 sites with other repeat elements in the CMV enhancer region, followed further upstream by a cluster of NF-1 sites (Hennighausen and Fleckenstein, 1986; Jeang et al., 1987; Sambucetti et al., 1989; Stamminger et al., 1990).

It has not been clearly demonstrated that there are brain- specific NF-1 or activator-related protein factors. Kerr and Khalili (1991) have reported that a recombinant cDNA clone isolated from a brain expression library codes for a protein which can recognize nucleotide sequences located in the central portion of the JCV 98-bp repeat unit. The gene of this protein, however, is expressed in other tissues besides brain. There are other possible mechanisms by which positive-negative or tissue-specific expression of neurotropic genes may be affected. In some of the glial-specific genes (JCV, MBP, PLP, and S100B) there is a purine-rich region between the adjacent NF-1 and activator protein binding sites and the mRNA start site. Whether this purine-rich region can interact with glial-specific factor(s) is not known. Recently, it has been shown (Dynlacht et al., 1991; Meisterernst and Roeder, 1991) that the transcription factor TFIID may be associated with a number of cofactors or coactivators which together with other transcription activators stimulated transcription. It is conceivable that in different cell types that some of these

Adjacent NF-1 and Activator Protein Sites 14211

cofactors or coactivators could be "tissue-specific" and may be responsible for the ability of TFIID to function in this manner. Studies with a crude preparation of TFIID from mouse brain have shown that it can endow some tissue- specific expression of the mMBP gene (Tamura et al., 1990). Besides these possibilities there still may exist a tissue-specific cellular homolog of the herpes virus VP16 or adenovirus EIA protein (see review Nevins, 1991), which can act through another transcription factor to activate transcription.

We have cloned the JCV NF-1 or NF-1-like sites (A/B-E) upstream from a chloramphenicol acetyltransferase (CAT) reporter gene, but we have not obtained any appreciable CAT expression above the parent CAT vector after transfection of primary HFG cells. We are in the process of obtaining recombinant CAT vectors which contain adjacent NF-1 and activator protein binding sites to examine their activity in both brain and non-brain cells. In addition, we are continuing our studies to further characterize the exact nature of the nuclear proteins which interact with several other sites in the JCV regulatory region. It is likely that the expression of JCV is dependent on the combinatorial action of all these proteins (Dynan, 1989; Maniatis et al., 1987), and some of these may function in a positive or negative fashion depending on the type and state of the cell in which the virus finds itself.

Acknowledgments-We thank Robert Tjian and laboratory members (Naoko Tanese, Richard Turner, and Steve Jackson) and Steven McKnight and Jon Shuman for the transcription factors. We thank Lynn Hudson for the mMBP clone. We thank Peter Paras for the oligonucleotides. We thank Carlo Tornatore for discussions on neurotropic viruses.

REFERENCES Allore, R. J., Friend, W. C., OHanlon, D., Neilson, K. M., Baumal, R., Dunn,

Amemiya, K., Traub, R., Durham, L., and Major, E. 0. (1989) J. Eiol. Chern.

Angel, P., Imagawa, M., Chiu, R:, Stein, B., Imra, R. J., Rahmsdorf, H. J.,

Besnard, F., Brenner, M., Nakatani Y. Chao, R., Purohit, H. J., and Freese, E.

Bradford, M. M. (1976) Anal. Eiochern. 72,248-254 Chodosh, L. A., Baldwin, A. S., Carthew, R. W., and Sharp, P. A. (1988) Cell

R. J., and Marks, A. (1990) J. Biol. Chern. 265,15537-15543

264,7025-7032

Jonat, C., Herrllch, P., and Kann, M. (1987) Cell 49,729-739

(1991) J. Biol. Chern. 266,188771-18883

53. 1 1 -74 Comb, M., Mermod, N., Hyman, S. E., Pearlberg, J., Ross, M. E., and Goodman,

Corallini, A., Pagnani, M., Viadana, P., Silini, E., Mottes, M., Milanesi, G., H. M. (1988) EMBO J. 7,3797-3805

Gerna. G.. Vettor. R., Rtauella. G.. Sivani. V.. Gaist. G.. Barbanti-Brodano.

- - , - - - -

G. (1987) Cancer 39,.60-67 . . , ,

Curran, T., and Franza, B. R., Jr. (1988) Cell 55,395-397 Diamond, M. I., Miner, J. N., Yoshinaga, S. K., and Yamamoto, K. R. (1990)

Dignam, J. D., Lebovitz, R. M., and Roeder, R. (1983) Nucleic Acids Res. 11 ,

Dorn, A., Bollekens, J., Staub, A., Benoist, C., and Mathis, D. (1987) Cell 5 0 ,

Science 249,1266-1272

1475-1489

MLR77 "_ Dorries, K., Loeber, G., and Meixensberger, J. (1987) Virology 160,268-270 Dynan, W. S. (1987) Genet. Eng. 9 , 7 5 4 7 Dynan, W. S. (1989) Cell 5 8 , 1-4

Dynan, W. S., and Tjian, R. (1983) Cell 32,669-680

Frisque, R., Bream, G., and Cannella, M. (1984) J. Virol. 5 1 , 458-469 Dynlacht, B. D., Hoey, T., and Tjian, R. (1991) Cell 66,563-576

Graves, B. J., Johnson, P. F., and McKnight, S. L. (1986) Cell 44,565-576 Hai, T., and Curran, T. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,3720-3724

Jeang, K.-T., Rawlins, D. R., Rosenfeld, P. J., Shero, J. H., Kelly, T. J., and Hennighausen, L., and Fleckenstein, B. (1986) EMEO J. 5 , 1367-1371

Jonat, C., Rahmsdorf, H. J., Park, K.-K., Cato, A. C. B., Gebel, S., Ponta, H.,

Jones, K. A,, Kadonaga, J. T., Rosenfeld, P. J., Kelly, T. J., and Tjian, R.

Kamholz, J., Toffenetti, J., and Lazzarini, R. A. (1988) J. Neurosci. Res. 2 1 ,

Hayward, G. S. (1987) J. Virol. 61,1559-1570

and Herrlich, P. (1990) Cell 62,1189-1204

(1987) Cell 4 8 , 7 9 4 9

~ - 7 n Kenney, S., Natarajan, V., Strike, D., Khoury, G., and Saltzman, N. P. (1984)

Kerr, D., and Khalili, K. (1991) J. Eiol. Chern. 2 6 6 , 15876-15881 Landschulz, W. H., Johnson, P. F., Adashi, E. Y., Graves, B. J., and McKnight,

Lees. J. F.. Shneidman. P. 4.. Skuntz. S. F.. Carden. M. J.. and Lazzarini. R. Lee, W., Mitchell, P., and T'ian, R. (1987) Cell 49, 741-752

." Science 2 2 6 , 1337-1339

S. L. (1988) Genes & Deu. 2,786-800

~ . ' (1988j EMEOJ. i, 1947"1955 , ,

Major, E. O., Miller, A. E., Mourrain, P., Traub, R., De Widt, E., and Sever, J.

Major, E. O., Amemiya, K., Tornatore, C. S., Houff, S. A,, and Berger, J. R. (1985) Proc. Natl. Acad. Sei. U. S. A. 82,1257-1261

(1992) Clin. Mzrobzol. Reu. 5.49-73 Maniatis, T., Goodourn, S., andFischer, J. A. (1987) Science 236 , 1237-1245 Markowitz, R.-B., Eaton, B. A., Jubik, M. F., Latorra, D., McGregor, J. A., and

Meisterernst, M., and Roeder, R. G. (1991) Cell 67, 557-567 Maxam, A., and Gilbert, W. (1980) Methods Enzyrnol. 65,499-560

Morgan, J. I., and Curran, T. (1991) Annu. Reu. Neurosci. 14,421-451 Morgello, S., Cho, E . 4 , Nielsen, S., Devinsky, O., and Petito, C. K. (1987)

Nakabeppu, Y., Ryder, K., and Nathans, D. (1988) Cell 55,907-915 Nakahira, K., Ikenaka, K., Wada, K., Tamura, T., Furuichi, T., and Mikoshiba,

Nave, K. A., and Lemke, G. (1991) J. Neurosci. 11,3060-3069 Nevins, J. (1991) Trends Eiochern. Sci. 16,435-439 Owen, T. A., Bortell, R., Yocum, S. A., Smock, S. L., Zhang, M., Abate, C.,

Curran, T., Lian, J. B., and Stein, G. S. (1990) Proc. Natl. Acad. Sci. U. S. A. Shalhoub, V., Aronin, N., Wright, K. L., van Wijnen, A. J., Stein, J. L.,

Padgett, B. L., Rogers, C. M., and Walker, D. L. (1977) Infect. Irnrnun. 15 , 87,9990-9994

fi5fi-fifi3

Dynan, W. S. (1991) J. Virol. 65,4515-4519

Hum. Pathol. 18,289-297

K. (1990) J. Eiol. Chern. 265,19786-19791

Raymondjean, M., Cereghini, S., and Yaniv, M. (1988) Proc. Natl. Acad. Sei.

Roeder, R. G. (1991) Trends Eiochern. Sci. 16,402-408 Roesler. W. J.. Vandenbark. G . R.. and Hanson. R. W. (1988) J. Biol. Chern.

_I- "-

U. S. A. 8 5 , 757-761

263,'9063-9066 Salzman, N., Natarajan, V., and Selzer, G. (1986) in The Papouiridae I: The

Sambucetti, L. C., Cherrington, J. M., Wilkinson, G. W. G., and Mocarski, E. Polyomuiruses (Salzman, N. P., ed) pp. 27-98, Plenum Press, New York

Santoro, C., Mermod, N., Andrew, P. C., and Tjian, R. (1988) Nature 334, S. (1989) EMEO J. 8,4251-4258

218-224

. .

Schule,R., Rangarajan, P., Kliewer, S., Ransone, L. J., Bolado, J., Yang, N.,

Schule, R., Umesono, K., Mangelsdorf, D. J., Bolado, J., Pike, J. W., and Evans,

Stamminger, T., Fickenscher, H., and Fleckenstein, B. (1990) J. Cen. Virol.

Sundsfjord, A., Johansen, T., Flaegstad, T., Moens, U., Villand, P., Subramani,

Tamura, T., Miura, M., Ikenaka, K., and Mikoshiba, K. (1988) Nucleic Acids

Verma, I. M., and Evans, R. M. (1990a) Cell 6 2 , 1217-1226

R. M. (1990b) Cell 61,497-504

71,105-113

S., and Traavik, T. (1990) J. Virol. 64,3864-3871

Res. 16.11441-11459 Tamura, T., Sumita, K., Hirose, S., and Mikoshiha, K. (1990) EMEO J. 9,

~~ ~~

3101-3108 Vinters. H. V.. Kwok. M. K.. Ho. H. W.. Andes. K. H.. Tomivasu. U.. Wolfson. . ~ " ~" .

W. L:, and bbert , 'F . (1989) Brain 112,2451268 ' " ' ' ~ ' Wiley, C. A., Schrier, R. D., Denaro, F. J., Nelson, J. A,, Lampert P. W., and

Oldstone, M. B. A. (1986) J. Neuropathol. Er Neurol. 45 , 1271139 Yang-Yen, H.-F., Chambard, J. C., Sun, Y. f?, Smeal, T., Schmidt, T. J.,

Droulm, J., and Karln, M. (1990) Cell 6 2 , 1205-1215

adjacent nuclear factor-1 and activator protein binding sites in the

Documents