activation of phospholipase c-b2 mutants by g protein cyq and

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 268, No. 34, Issue of December 5, pp. 25952-25957,1993 Printed in U. S. A.

Activation of Phospholipase C-B2 Mutants by G Protein cyq and ,& Subunits*

(Received for publication, June 4, 1993)

Sang Bong Lee$, Seok Hwan Shin$, John R. HeplerQ, Alfred G. Gilmanj, and Sue Goo Rhee$n From the $Laboratory of Bkhemistry, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland 20892 and $Department of Pharmacology, University of Texas Southwestern Medical Center, Dallas, Texas 75235

The 13- but not the y- and &type isozymes of inositol phospholipid-specific phospholipase C (PLC) are activated by G protein a, and By subunits. The &type PLC isozymes differ from other isozymes in that they contain a long carboxyl-terminal region downstream of the Y catalytic domain and a region rich in acidic amino acids between the two separated X and Y catalytic domains. To determine the sites on PLC-02 that participate in the interaction of the enzyme with a, and By subunits, we introduced specific truncations and substitutions in the PLC-82 cDNA at positions corresponding to the carboxyl-terminal and acidic amino acid- rich regions, respectively. After transient expression of these cDNA clones in CV- 1 cells, the mutant enzymes were partially purified and their capacity to be activated by a, and By subunits determined. Substitution of glutamine residues for three or all seven of a stretch of consecutive glutamic acids in the acidic domain of PLC-82 affected neither a,- nor By-dependent activation significantly. Carboxyl-terminal truncation to residue Gly-934 or to residue Ala-867 resulted in enzymes that were activated by By but not by a,. This result suggests that the carboxyl-terminal region of PLC-82 is required for activation by a,, and that By subunits interact with a different region of the enzyme. Thus, a, and By subunits may independently modulate a single PLC-B2 molecule concurrently.

Receptor-mediated activation of inositol phospholipid-specific phospholipase C (PLC)’ is a key mechanism by which many extracellular signaling molecules effect intracellular regulation. PLC catalyzes the hydrolysis of phosphatidylino- sitol4,5-bisphosphate (PIP2) to two second messenger molecules, inositol 1,4,5-trisphosphate (IPS) and diacylglycerol(1- 4). Molecular cloning has revealed at least three types of PLC: PLC-@, PLC-y, and PLC-6 (4-6). Each type is represented by isoforms that are products of distinct genes (5,6). The overall amino acid sequence identity among different PLC isozymes is low, and their sizes differ markedly, ranging from 85 to 150 kDa. Nevertheless, all known PLC isozymes contain two

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

7l To whom correspondence should be addressed Laboratory of Biochemistry, NHLBI, NIH, Bldg. 3, Rm. 122, Bethesda, MD 20892. Tel: 301-496-9646; Fax: 301-496-0599.

The abbreviations used are: PLC, inositol phospholipid-specific phospholipase C; PIP2, phosphatidylinositol 4,5-bisphosphat.q IP3, inositol 1,4,5-trisphosphate; PCR, polymerase chain reaction; GTP+, guanosine 5’-O-(thiotriphosphate); HPLC, high perform- ance liquid chromatography; bp, base pair.

conserved domains, the so-called X domain of -160 amino acids and the Y domain of -260 amino acids, that appear to constitute a catalytic site (6). In addition, all PLC isozymes contain an amino-terminal region of -300 amino acids that precedes the X region but which exhibits no significant sequence identity between different types of PLC. The X and Y domains are separated by 70-140 amino acids in the @-type isozymes, by 40-70 amino acids in the 6-type isozymes, and by -400 amino acids in the y-type isozymes (6). Furthermore, unlike those in the 6- and y-type isozymes, the regions sepa- rating the X and Y domains in the PLC-/3 isozymes are rich in acidic residues: 20 of 70, 26 of 76, 29 of 137, and 24 of 100 residues are acidic in PLC-Bl (7,8), PLC-@2 (9), PLC-83 (10, l l ) , and PLC-84 (12), respectively. Another distinct structural feature of the @-type isozymes is a carboxyl-terminal sequence of -400 amino acids that follows the Y domain. The carboxyl- terminal region is short (-80 amino acids) in the y-type isozymes and virtually nonexistent in the &type isozyme&.

The distinct structural features of the different PLC types appear to correlate with differences in their mechanisms of activation. Two y-type isozymes, PLC-y1 and PLC-72, are activated as a result of phosphorylation by a number of protein-tyrosine kinases (6). In contrast, three @-type isozymes, PLC-Bl, PLC-82, and PLC-/33, are activated to varying degrees by heterotrimeric G proteins. Among 21 known G protein a subunits (13), five members (aq, all, a149 a16, and ale) of the Gqa subfamily activate PLC-8 isozymes (10, 14- 21).’ The aq, all, and a16 subunits each activate PLC-81 and PLC-83 to a much greater extent than PLC-82 (10, 19-21).’ Recently, the By subunits of G proteins have also been +own to activate PLC-p isozymes (20, 21, 23-26). The rank order for extent of activation by By subunits is PLC-@3 > PLC-p2 > PLC-p1, which differs from that for activation by aq (20, 26).

The observation that PLC-@ isozymes are activated by both aq and @y subunits leads one to the question of whether PLC- @ isozymes contain separate sites of interaction for these subunits. We investigated this possibility by measuring the aq- and py-dependent activation of various PLC-p2 mutants that were generated by altering the two PLC-@-specific regions: the carboxyl-terminal region downstream of the Y domain and the acidic amino acid-rich region between the X and Y domains.

EXPERIMENTAL PROCEDURES

Construction of PLC-f12 Mutants-The cDNAs corresponding to wild-type and mutant PLC-fl2 molecules (see Fig. 1) were cloned into the pTMl expression vector. pTMl (27) contains the encephalomy- ocarditis virus untranslated region downstream of the bacteriophage

2T. Kozasa, J. R. Hepler, A. V. Smrcka, M. I. Simon, S. G., Rhee, P. C. Sternweis, and A. G. Gilman, manuscript submitted for publication.

25952

Phospholipase C-p2 Mutants 25953

T7 promoter and a NcoI site. The NcoI site contains the translation initiation codon and was used for insertion of the 5' end of PLC-j32 cDNA. The 5' region of PLC-j32 cDNA was reconstructed with the polymerase chain reaction (PCR) from the PLC-j32 pMT2 plasmid (9), which contains cDNA encoding the entire human PLC-j32 amino acid sequence. The forward primer, CGATACATGTCTCTGCT- CAACCCTGTG, contained sequences corresponding to nucleotides 1-213 (underlined) and an AflIII site (overlined), which has a cohesive end compatible with that generated by NcoI. The reverse primer, AAAGGAGTACTCGGAGACAGGAGC, corresponded to nucleotides 630-653. The PCR fragment was digested with AfCIII and AccI to produce a 620-bp fragment, which was then ligated to the AccI-XbaI fragment (3,220 bp) of PLC-j32 pMT2. The resulting 3,840-bp AflIII- XbaI fragment was joined with pTMl vector that had been digested with NcoI and SpeI (cleavage by SpeI generates a cohesive end compatible with that generated by XbaI). The resulting PLC-82 pTMl plasmid contained the entire coding sequence of PLC-j32 downstream of the bacteriophage T7 promoter.

PLC-j32 contains seven consecutive glutamic acid residues (amino acids 507 to 513) in the region located between the X and Y domains. Two substitution mutants, E507-509Q and E507-513Q, were generated by replacing three (507-509) or seven (507-513) glutamic acids with an equal number of glutamine residues. The site-directed mu- tagenesis was accomplished by overlap extension with the use of PCR as described by Saiki et al. (28). Outside primers corresponded to

primers were 5' GAGGGAGGAGGAGGTGCAACAGCAAGAGGA- nucleotides 1206-1228 and to nucleotides 1814-1836. The mutagenic

GGAGGAGTCAGGAAACCTG 3' for E507-509Q and 5' CTGGAG- GAGGAGGAGGTGCAACAG"ACAGCAGCAGCAGTCAG3'for E507-513Q. Final PCR products were isolated by agarose gel electrophoresis, digested with AgeI and NdeI, and ligated with PLC-j32 pTMl that had also been cleaved with AgeI and NdeI.

Two truncated mutants, A935-1181 and A868-1181, were generated by eliminating residues carboxyl-terminal to Gly-934 or Ala-867, respectively. PLC-j32 pTMl was cleaved with AuaI and religated to generate A935-1181. Mutant A868-1181 was obtained by cleaving PLC-82 pTMl with BstEII and XhoI and blunt-end ligating after filling in nucleotides with the Klenow fragment. The sequences of the constructs were confirmed by dideoxy sequencing (Applied Bio- physics) and restriction endonuclease analyses.

Expression and Cell Culture-Expression of wild-type and mutant PLC-j32 enzymes was achieved by transfecting the recombinant plas- mids into CV-1 cells that had been infected with a recombinant vaccinia virus, vTF7-3, that contained the T7 RNA polymerase gene (29). Briefly, CV-1 cells (1.5 X lo6) were incubated in a 10-cm dish with 10 plaque-forming units of vTF7-3 per cell for 30 min. After infection, the virus inoculum was aspirated from the cells, and a mixture of 20 pg of plasmid DNA and 100 pg of lipofectin (Life Technologies, Inc.) was added. The cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum for 12 h after transfection and then harvested by scraping.

Partial Purification of PLC-j32 Enzymes-Harvested cells from monolayers in 10 10-cm dishes were washed three times with 10 volumes of cold homogenization buffer (50 mM Tris (pH 7.4), 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, leupeptin (10 pg/ml), aprotinin (10 pg/ml), and calpain inhibitors I and I1 (each at 4 pglml)) and then suspended in 2 ml of the same buffer. Cells were disrupted by sonication, and solid KC1 was added to the lysate to a concentration of 2 M. The lysate was stirred for 1 h at 4 "C and then centrifuged at 300,000 X g for 20 min. The resulting supernatant was stored at -70 "C. Five such supernatants, corresponding to cells from 50 10-cm dishes, were thawed and centrifuged at 300,000 X g for 15 min. The resulting supernatant (-10 mg of protein) was applied to an analytical TSK gel phenyl-5PW HPLC column (75 X 7.5 mm) (TosoHaas) that had been equilibrated with 20 mM Hepes (pH 7.0), 3 M NaCl, and 1 mM EGTA. Proteins were eluted at a flow rate of 1 ml/min by successive applications of the equilibration buffer for 15 min, a decreasing linear gradient from 3.0 to 1.2 M NaCl for 10 min, and a second decreasing linear NaCl gradient from 1.2 to 0 M for 25 min. The column was then washed with NaC1-free buffer. Fractions (1 ml) were collected and assayed for PLC activity. All operations were performed at 4 "C or on ice, unless otherwise indicated. PLC activity was monitored by measuring [3H]phosphatidylinositol-hydrolyzing activity as previously described (30). Peak fractions of PLC activity (three fractions) were pooled,

The first nucleotide of the ATG triplet encoding the initiating methionine is assigned residue 1 in the PLC-82 nucleotide sequence.

concentrated to -0.3 ml, divided into portions, and stored at -70 "C. G Proteins and Antibodies-The a, subunit was purified from Sf9

insect cells that had been infected simultaneously with three different recombinant baculoviruses encoding a,, 82, and 72 G protein subunits (21). G protein j3r subunits were purified from bovine brain (26). Antisera to PLC-82, the sequence common to PLC X regions (X antibody), and the sequence common to PLC Y regions (Y antibody) were as described elsewhere (9).

PLC Assay-Unless otherwise specified, PLC activity was measured as previously described (21). Briefly, substrate was prepared as sonicated micelles of 75 p~ [3H]PIP2 (7,000-9,000 cpm/assay) and 750 p~ phosphatidylethanoloamine. CaClz was added to the assay mixture to give the indicated free Ca2+ concentrations, which were calculated as described elsewhere (31). Assays were performed for 5 min at 30 "C. Within experimental error, [3H]IP3 formation was linear with respect to time and enzyme concentration when less than 20% of substrate was consumed. Therefore, when necessary, the amount of enzyme was reduced so as not to produce more than 1,500 cpm of product during the 5-min incubation, and activities were corrected by multiplying by the dilution factor. Activation by aq was achieved by first incubating purified a, for 1 h at 30 "C with 1 mM guanosine GTPrS; a, was then stored on ice before being added to the PLC assay mixture.

RESULTS

Activation by aq and j3-y subunits of G proteins is specific to the @type PLC isozymes, the structural characteristics of which include the acidic amino acid-rich region between the X and Y domains and the long carboxyl-terminal region that follows the Y domain (Fig. 1). To investigate the roles of these two PLC-j3-specific regions in G protein-dependent activation, we constructed four PLC-82 mutants by substituting glutamines for the first three of seven consecutive glutamic acid residues (mutant E507-509Q) or for all seven glutamic acids (mutant E507-513Q), and by eliminating residues carboxyl-terminal to Gly-934 (mutant A935-1181) or Ala-867 (mutant A868-1181). The wild-type and mutant enzymes were transiently expressed by transfecting CV-1 cells with the mammalian expression vector pTMl containing PLC-82 cDNA.

The expression of PLC-82 was monitored with the use of antisera prepared against the entire PLC-82 molecule (Fig. 2). Each of the proteins encoded by the various constructs

1 289 464 541 3 1181 WildTypc I

VEEEEEEES

PLC-B2 enzymes and the PLC-82 pTMl vector. Open boxes X FIG. 1. Schematic representation of wild-type and mutant

and Y denote the sequences that share extensive homology with other eukaryotic PLCs. The numbers refer to amino acid residues. Residues subjected to amino acid substitution are indicated by the standard one-letter code. PLC-j32 cDNA cloned into the pTMl vector is depicted with the thick line representing coding region and the thin line representing the 3'-noncoding sequence. Restriction sites are indicated; those that were used for the generation of compatible cohesive ends but which are not present in the PLC-j32 pTMl vector are shown in parentheses.

25954

kDa 1 2 215 -

3 4 5 6 7

105 -

Phospholipase C-p2 Mutants

70 - FIG. 2. Immunoblot analysis of wild-type and mutants of

P L C - ~ ~ enzymes expressedin CV-1 cells.-CV-1 cells were transfected with the vector pTMl without insert ( l a n e 7) or with pTMl containing cDNA corresponding to wild-type ( l a n e 2 ) , A935-1181 ( l a n e 3), A.868-1181 ( l a n e 4 ) , E507-509Q ( l a n e 5), or E507-513Q ( l a n e 6). CV-1 transfectants were briefly sonicated in a buffer containing 50 mM Tris (pH 7.4), 1 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol, leupeptin (10 pg/ml), aprotinin (10 pg/ ml), calpain inhibitors I and I1 (each at 4 pg/ml), and 2 M KCl. The lysate was centrifuged at 300,000 X g for 20 min. The resulting supernatant (2 M KC1 extract) was adjusted to 10% (w/v) trichloro- acetic acid to precipitate proteins. The precipitated proteins (3 pg per lane) were separated on a 6% SDS-polyacrylamide gel. Lune 1 received purified PLC-82 as standard. The separated proteins were transferred to nitrocellulose paper, which was then incubated with rabbit anti- serum to PLC-82. Immunoreactive proteins were visualized with alkaline phosphatase-conjugated goat antibodies to rabbit immuno- globulin G . The positions of molecular size markers are indicated.

E 2 2000

E F 0, 1000

c)

0 pTMl WT A935 A868 E507 E507

-1181 -1181 -5WQ -513Q

FIG. 3. PIPz-hydrolyzing activity of the extracts of CV-1 transfectants. Extracts of CV-1 transfectants (1 pg of protein), prepared in the presence of 2 M KC1 as described in the legend to Fig. 2, were assayed in the presence 0.2 pM (open bars) or 2 p M (hatched bars) free Ca2+ as described under “Experimental Procedures.” Data shown are means of duplicate determinations from a single experiment and are representative of three such experiments. WT, wild type.

was synthesized as judged from specific recognition by antibodies to PLC-82 and from their electrophoretic mobilities. CV-1 cells, nontransfected or transfected with vector alone, do not contain detectable amounts of PLC-j32, an observation that is consistent with previous reports that PLC-j32 is re- stricted to hematopoietic cells (20).

The PIP2-hydrolyzing activity associated with 1 pg of cell extracts was measured a t 0.2 and 2 p~ Ca2+ (Fig. 3). Cell extracts were prepared in the presence of 2 M KC1; PLC isozymes are present in both cytosolic and particulate fractions of mammalian tissues, and most of the particulate fraction-associated enzyme, particularly in the case of PLC-8 isozymes, can be solubilized by extraction with 2 M KC1 (10, 32). Transfection with wild-type or mutant PLC-j32 vectors

resulted in an increase in PLC activity. The -fold increase over the control value (PLC activity obtained with the extract of cells transfected with pTM1 alone) varied, ranging from -1.5 for A868-1181 to -7 for E507-513Q when activities obtained at the two Ca2+ concentrations were averaged. De- spite the absence of PLC-82 in the control cells and the significant expression of PLC-82 in transfected cells, the increases in PLC activity were not marked. This fact appears to be attributable to the presence of other PLC isozymes in control cells: PLC-83 and PLC”y1 were easily detectable by immunoblot analysis (data not shown); the presence of other isozymes (PLC-j31, -j34, -72, -61, and -62) was not investigated.

The effects of G protein subunits on the PLC activity of 2 M KC1 cell extracts were evaluated with the use of aq and 8-y purified from insect (SB) cells harboring recombinant bacu- lovirus and from bovine brain, respectively (Fig. 4). The aq subunit stimulated PLC activity in all extracts. However, the extent of stimulation was much greater for the wild-type enzyme and substitution mutants (E507-509Q and E507- 513Q) than for the truncation mutants (A935-1181 and A868- 1181), which exhibited an extent of stimulation similar to that observed with control cells. In contrast, j3-y had no significant effect on the activity of control extracts but markedly stimulated PLC activity in extracts expressing the wild- type and mutant enzymes. CV-1 cells contain endogenous PLC-83, which is stimulated by aq to a much greater extent than by 8-y (20, 21).

Because of the presence of endogenous PLCs, the relative responses of the various PLC-j32 enzymes to ag and 8-y could not be evaluated quantitatively in cell extracts. To remove the endogenous PLCs and to minimize possible artifacts attributable to unknown protein factors, the 2 M KC1 extracts were fractionated on an HPLC phenyl-5PW column with a decreasing NaCl gradient. Fractions were assayed for PLC activity with phosphatidylinositol as substrate. One minor peak and one major peak, centered at 29 and 34 min, respectively, were detected for extracts of transfected cells expressing wild-type PLC-82 (Fig. 5A). The retention time of the major peak was 35 min for E507-509Q, E507-513Q, and A868- 1181, and 45 min for A935-1181, whereas the retention times and intensities of the minor peaks were similar in all extracts.

E 3000

2 2000 - r

0, 1000

0 pTMl WT A935 A868 E507 E507

-1181 -1181 -509Q -513Q

FIG. 4. Effects of ap and 87 subunits on PLC activity in extracts of CV-1 transfectants. KC1 extracts of CV-1 transfectants were prepared as described in the legend to Fig. 2. PIP,- hydrolyzing activity of each crude extract was determined either in the absence of G protein subunits (open bars), or in the presence of 5 nM ctq (hatched bars) or 3 p~ 6-y (solid bars). The ctq subunit was activated with 1 mM GTP-yS for 1 h at 30 “C prior to assay. The amount of each crude extract (0.25-2 pg of protein) was adjusted to give similar PIPp-hydrolyzing activities in the absence of aq and 8-y subunits. Free Cap+ concentration in the assay was 0.2 p ~ . Results are presented as means of duplicate determinations from a single experiment and are representative of two similar experiments.

Phospholipase C-p2 Mutants 25955 A 6000 1 .o

Wild Type B 1 2 3 4 5 6 7 8 4ooo t.p .. '...

h

c

g 0 1 0 20 30 4 0 50 60 70"-

0 1 0 20 30 40 50 do 70-

Elution Time. min

0.8 -

rlr E507 E507 -509Q -5134

FIG. 5. Partial purification and quantitation of wild-type and mutant PLC-B2 enzymes expressed in CV-1 cells. A, partial purification. The 2 M KC1 extracts of CV-1 transfectants (10 mg of protein) were resolved on a TSK gel phenyl-5PW HPLC column as described under "Experimental Procedures." Fractions (1 ml) were collected and assayed for [3H]phosphatidylinositol-hydrolyzing activity. Three fractions (3 ml) of each major peak were pooled, concentrated to -0.3 ml, and used as the source of PLC-82. Shown are chromatograms for cells expressing wild-type and A935-1181 PLC-82. B, quantitation. Five microliters of each the concentrated fractions from A were separated by electrophoresis on a 6% polyacrylamide gel. Proteins were then transferred to a nitrocellulose membrane and probed with a mixture of rabbit antisera to the PLC X and Y domains. The immune complexes were detected with '251-labeled protein A. The amounts of radioactivity in the PLC-82 bands were determined with the PhosphorImager (Molecular Dynamics), and enzyme concentration was expressed as picomoles of enzyme per pl of sample after comparison with the radioactivity present in bands containing known amounts of purified PLC-82. Results shown are means 2 S.D. of five separate experiments. Inset, the nitrocellulose membrane was subjected to autoradiography and the PLC-82 (wild-type and mutant) bands are shown. Lanes I , 2, and 3 contain 300, 200, and 100 ng, respectively, of purified PLC-82; lane 4, wild type; lane 5, A935-1181; lane 6, A868-1181; lane 7, E507-509Q; and lane 8, E507-513Q.

The extract of control cells (cells transfected with PTM1) yielded only one recognizable peak, centered at 29 min, the intensity of which (for similar amounts of protein applied to the column) was similar to those centered at 29 min for the extracts expressing PLC-82 enzymes (data not shown). Im- munoblot analysis indicated the presence of PLC-83 in fractions 24-28 and PLC-71 in fractions 27-31 (data not shown). All of the major peaks for extracts expressing wild-type and mutant PLC-82 enzymes contained proteins that reacted with antibodies to PLC-82 (data not shown), indicating that the expressed PLC-82 enzymes were responsible for the major peaks of activity. Fractions (3 ml) corresponding to each major peak were pooled and concentrated to -0.3 ml. The amount of PLC-82 (wild type or mutant) in the concentrated fractions was quantitated by immunoblot analysis with a mixture of antibodies to the X and Y domains of PLC and by comparison with the immunoreactivity of purified PLC-82 (Fig. 5B).

With knowledge of the concentrations of the purified enzymes, we were then able to compare the PIPz-hydrolyzing activities of the wild-type and mutant PLC-82 at various Ca2+ concentrations (Fig. 6A). At all Ca2+ concentrations, the activity of the wild-type enzyme was lower than those of the substitution mutants (E507-509Q and E507-5136) but higher than those of the truncation mutants (A935-1181 and A868- 1181). The mutant with seven amino acid substitutions showed the highest activity. The wild-type enzyme and substitution mutants showed similar sensitivities to Ca", whereas the sentitivity of A868-1181 was shifted to higher Ca2+ concentrations and A935-1181 showed little sensitivity to Ca". The normalized activities for the various PLC-82 enzymes measured at 0.2 and 2 p~ Ca2+ are shown in Fig. 6B.

The responses of the purified PLC-82 enzymes to aq were

evaluated in the presence of GTPrS and 0.2 p~ Ca2+ (Fig. 7). Because the specific activities of the enzyme preparations differed, the amounts of enzyme present in the assay were adjusted so that activities in the absence of as and GTPrS were similar. The aq subunit activated the wild-type enzyme and the two substitution mutants. The extents of activation and the sensitivities to aq were similar for all three enzymes. In contrast, neither of the two truncation mutants was significantly activated by aq.

Purified brain 87 subunits stimulated all five expressed PLC-82 enzymes (Fig. 8). Truncated mutants, especially A868-1181, were activated to a greater extent than the wild- type enzyme, whereas the extent of activation for the substitution mutants was slightly less than that of wild-type PLC-82.

DISCUSSION

By subjecting KC1 extracts of CV-1 cells transiently expressing wild-type and mutant PLC-82 enzymes to a one-step HPLC purification procedure, we obtained PLC-82 preparations virtually free of endogenous PLC isozymes. The PIPz- hydrolyzing activities of the partially purified enzymes sug- gested that the catalytic efficacy of PLC-82 was significantly affected by the various mutations. Unfortunately, our current knowledge of the structure-function relations of PLC isozymes is not sufficient to allow us to explain these results.

We have previously shown that PLC-81 is cleaved by the Caz+-dependent protease calpain to yield a 100-kDa enzyme that lacks the 336 residues carboxyl-terminal to His-880 (33). This 100-kDa enzyme, which retained the catalytic domains (X and Y) and 90 residues carboxyl-terminal to the Y domain, showed the same catalytic activity as intact PLC-81 but lost

25956 Phospholipase

A 90007

[Ca2 +],M

t#

200 .-

u 8

d .$ 100

d

0

0 WT A935 A868 E507 E507

-1181 -1181 -509Q -5134

FIG. 6. Caa+ dependence of PIPa hydrolysis by wild-type and mutant PLC-82 enzymes. A, PIPZ-hydrolyzing activities of wild-type (O), A935-1181 (O), A868-1181 (B), E507-509Q (A), and E5074136 (A) PLC-82 enzymes in the partially purified and concentrated fractions described in the legend to Fig. 5A were measured at the indicated free Ca2+ concentrations as described under “Experi- mental Procedures.” PLC activity is expressed as [3H]IP3 (cpm) generated per 0.4 pmol of enzyme/5 min. B, PIPz-hydrolyzing activities were measured with 0.35 pmol of the various enzymes at 0.2 p~ Caz+ (open bars) and with 0.07 pmol of enzymes at 2 p~ Caz+ (hatched bars). The results are expressed as percentages of the corresponding values for the wild-type enzyme.

the capacity to be activated by as. In another study, transient expression of a series of specific deletion and truncation mutants of PLC-Bl further localized the region required for interaction with aq to residues 903-1142 (22). We have now shown that the PLC-82 mutants A935-1181 and A868-1181, which retain a carboxyl-terminal region of only 141 and 74 residues, respectively, are not activated by as. This observation is thus consistent with requirement for the carboxyl- terminal region of PLC-@1 for activation by as. In contrast to their insensitivity to aq, A935-1181 and A868-1181 were activated by @r to an extent similar to that for the wild-type enzyme, suggesting that the carboxyl-terminal region is not essential for interaction with Dr. It is interesting to note that loss of aq effect appears to parallel loss or alteration of the sensitivity to Ca2+.

The acidic amino acid-rich region that is characteristic of @-type PLC isozymes appears not to participate in the interaction with G protein subunits. Substitution of three (E507- 509Q) or all seven (E507-E513Q) of a stretch of consecutive acidic residues in this region of PLC-82 had no effect on aq- or Bydependent activation. If we exclude the X and Y domains as the common catalytic sites of PLCs, as well as the carboxyl-terminal region that follows the Y domain and the

C-p2 Mutants

4000 m 3000

2 2000 -

1000 P I a q l N

FIG. 7. Effects of a,, on the PIPa-hydrolyzing activities of wild-type and mutant of PLC-82 enzymes. PIPz-hydrolyzing activities of wild type (0), 8935-1181 (O), A868-1181 (W), E507-509Q (A), and E507-513Q (A) PLC-82 enzymes in the concentrated, partially purified fractions described in the legend to Fig. 5A were measured in the presence of the indicated concentrations of aq The aq subunit was activated with 1 mM GTPyS for 1 h at 30 “C prior to assay, and GTP+ was present in all assays at a final concentration of 167 p ~ . The amount of each enzyme (0.02-0.4 pmol) was adjusted to give similar PIPz-hydrolyzing activities in the absence of aq Free Ca2+ concentration in the assay was 0.2 pM. Results are means of duplicate determinations from a single experiment and are representative of at least two similar experiments.

n 0 F- 0, 2000

3000

1000

04 I o 1 0 . ~ 10.’ 1 0 - 6 1 0 - 5

r P n 3 M

FIG. 8. Effects of 87 on the PIPa-hydrolyzing activities of wild-type and mutant of PLC-82 enzymes. PIPz-hydrolyzing activities of wild-type (O), A935-1181 (O), A868-1181 (W), E507-509Q (A), and E507-513Q (A) PLC-02 enzymes in the concentrated, partially purified fractions described in the legend to Fig. 5A were measured in the presence of the indicated concentrations of 87 subunits. The amount of each enzyme (0.02-0.4 pmol) was adjusted to give similar PIPz-hydrolyzing activities in the absence of By. Free Ca” concentration in the assay was 0.2 p ~ . h s u l t s are presented as means of duplicate determinations from a single experiment and are representative of at least three similar experiments.

region between the X and Y domains, the remaining candidate site for interaction of PLC-82 with @r is the amino-terminal region that precedes the X domain (unless the @r interaction site is comprised of residues from various regions). All known eukaryotic PLC isozymes possess an amino-terminal region of -300 amino acids (6). Only eight amino acids are conserved in the amino-terminal domain among all PLC isozymes, but the @-type PLC isozymes show 40 to 50% sequence identity in this region (6). It is thus possible that the conserved residues in the amino-terminal region of PLC-@ isozymes

Phospholipase C-82 Mutants 25957

constitute the By-interaction site. While our work was in progress, Smrcka and Sternweis (20)

investigated whether PLC-j31, PLC-82, and PLC-83 could be activated by adll (a mixture of a, and all) and By subunits simultaneously. The effects of adll and By subunits were not additive for PLC-Bl and PLC-82. However, PLC-B3 was activated by adll in the presence of a virtually saturating concentration of By subunits, suggesting the existence of separate sites on the PLC-BS molecule for interaction with adll and #?y subunits. Our observation that the carboxyl- terminal truncation mutants of PLC-/32 are activated by By but not by a, also indicates the existence of separate aq- and Byinteraction sites on PLC-B2. Because activation of PLC-/3 isozymes by a, and By is markedly dependent on the lipid composition of substrate vesicles, the concentration of M$+, and the detergent in the assay (20, 21), the observation that adll and j3r subunits do not simultaneously activate PLC-Bl or PLC-B2 may not reflect the situation in vivo. It is thus probable that two different receptors, one linked to a Gq protein and the other to a non-G, G protein, can activate a single PLC-8 molecule concurrently by generating a, and By subunits, the relative contributions by a, and By to activation depending on the particular PLC-8 isozyme.

REFERENCES

2. &a, . L., and Hokm, L. E. (1990) PhysWL Reu. 70,115-164 1. B e r r i y M. J. (1993). Nature 361,315-325

3. Majerus, P. W. (1992) Annu Reu. Biochem. 61,225-250 4. Cockcroft, S., and Thomas, G. M. H. (1992) Biochem. J. 288.1-14 5. Rhee, S. G., Suh, P.-G., Ryu, S. H., and Lee, S. Y. (1989) Science 244,

6. Rhw, S. G., and Choi, K. D. (1992) J. Biol. Chem. 267,12393-12396 7. Suh, P.-G., Ryu, S. H., Moon, K. H., Suh, H. W., and Rhee, S. G. (1988)

8. Katan, M., Kriz, R. W., Totty, N., Philp, R., Meldrum, E., Aldape, R. A.,

546-550

Cell 64,161-169

9. Park, D., Jhon, D.-Y., Kriz, R., Knopf, J., and Rhee, S. G. (1992) J. BWl.

10. Jhon, D.-Y., Lee, H.-H., Park, D., Lee, C.-W., Lee, K.-H., Yoo, 0. J., and

11. Carozz~. A. J.. Knz. R. W.. Webster. C.. and Parker. P. J. (1993) Eur. J .

Knopf, J. L., and Parker, P. J. (1988) Cell 64, 171-177

Chem. 267,16048-16055

Rh?, S. G. (1993) J. BioL Chem. 268,6654-6661

Biockm. 2i0, 521-529 ’

Biol. Chem. 268,21318-21327

I . . ,

12. Lee, C.-W., Park, D. J., Lee, K.-H., Kim, C. G., and Rhee, S. G. (1993) J.

13. Simon, M. I., Strathmann, M. P., and Gautam, N. (1991) Science 262,

14. Smrcka, A. V., Hepler, J. R., Brown, K. O., and Sternweis, P. 0. (1991)

15. Taylor, S. J., Chae, H. Z., Rhee, S. G., and Exton, J. H. (1991) Nature 360,

16. Waldo. G.. Bover. J.. Morris. A.. and Harden. T. K. (1991) J. BWL Chem.

802-808

Science 260,804-807

516-518

17.

18.

19.

20. 21.

266’,14217114225 Blank, J. L., Ross, A. H., and Exton, J. H. (1991) J. Biol. Chem. 266, 18206-18216

Wu, D., Lee, C.-H., Rhee, S. G., and Simon, M. I. (1992) J. Biol. Chem. 267,1811-1817

Lee, C. H., Park, D., Wu, D., Rhee, S. G., and Simon, M. I. (1992) J. Biol. Chem. 267,16044-16047

Smrcka, A. V., and Sternweis, P. C. (1993) J. BWl. Chem. 268,9667-9674 He ler, J. R., Kozaaa, T., Smrcka, A. V., Simon, M. I., Rhee, S. G.,

fternweis, P. C., and Gilman, A. G. (1993) J. BWL Chern. 268, 14367- 14375

, , . ,

22. W;,-D.: Jiang, H., Katz, A., and Simon, M. I. (1993) J. Biol. Chem. 268,

23. Camos. M.. Carozzi. A.. Schnabel. P.. Scheer. A.. Parker. P. J.. and Gier- 3704-3709

sch&, P.’(1992) Nature 360, 6&& ’ ’ , .

24. Katz, A,, Wu, D., and Simon, M. I. (1992) Nature 360,686-689 25. Boyer, J. L., Waldo, G. L., and Harden, T. K. (1992) J. Biol. Chem. 267,

25451-25465

BWL Chem. 268,4573-4576 26. Park, D., Jhon, D.-Y., Lee, C.-W., Lee, K.-H., and Rhee, S. G. (1993) J.

27. Elroy-Stein 0. Fuerst T. R., and Moss, B. (1989) Proc. Natl. Acad. Sei. 11. s. A. da. i;12fi-mkn

28. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G.

29. Fuerst. T. R.. Niles. E. G.. Studier. F. W.. and Moss. B. (1986) Proc. Natl. T., Mullis, K. B., and Erlich, H. A. (1988) Science 239,487-491

A c d . Sci. U . S. A. 83,8122-8126 ’ I . I

~~

30. Hofmann, S. L., and Majerus, P. (1982) J. Biol. Chem. 267,14359-14364 31. Fabiato, A. (1988) Methods Enzymol. 167,378-417 32. Lee, K.-Y., Ryu, S. H., Suh, P.-G., Choi, W. C., and Rhee, S. G. (1987)

Proc. Natl. Acad. Sci. U. S. A. 84, ~

33. Park, D., Jhon, D.-Y., Lee, C.-W., R BWL Chem. 268,3710-3714

5540-5544 l yu , S. H., and Rhee, 9. G. (1993) J.

activation of phospholipase c-b2 mutants by g protein cyq and

Documents