abstracts presented for the thirty-sixth annual meeting of the association for academic surgery

ABSTRACTS

Abstracts Presented for the Thirty-Sixth Annual Meeting

Journal of Surgical Research 107, 267–338 (2002)doi:10.1006/jsre.2002.6536

Brigham and Women’s Hospital, Harvard Medical

PLENARY SESSION

1. Hospital Volume and Surgical Outcomes for ColorectalCancer in the Elderly. J. B. Dimick, M.D., J. A. Cowan, Jr.,M.D., G. R. Upchurch, Jr., M.D., and L. M. Colletti, M.D. Univer-sity of Michigan Medical Center, Ann Arbor, Michigan.

Background. Recent emphasis has been placed on the quality ofsurgical care in the United States. As such, patients, providers, andpayers are increasingly aware of the outcomes of surgical care as amarker of quality. The objective of this study was to determine theimpact of hospital volume on mortality for patients of different agegroups to determine if elderly patients would derive more benefitfrom selective referral policies. Methods. Data from the NationwideInpatient Sample for all patients undergoing surgery for colorectalcancer during 1997 were obtained (N � 20,862). Differences in mor-tality associated with increasing age and hospital volume quartileswere determined. Risk-adjusted analyses of mortality were per-formed using multiple logistic regression. Results. The overall mor-tality rate was 3.1% for the 842 hospitals included. Patient agebreakdown was the following: ages 56 to 80 (51%), age �80 (22%),ages 50 to 65 (19%), and age �50 (7%). Increasing age was associatedwith higher mortality rates: age �50, 0.8%; ages 51 to 65, 1.3%; ages66 to 80, 2.9%; and �80, 6.9%. Overall, the highest volume hospitals(HVH) (�150/year) had lower mortality than the lowest volumehospitals (LVH) (�55/year) (2.5 vs. 3.7%; P � 0.006). However, theeffect of volume on mortality was primarily due to differences inolder patients. For patients greater than 65 years old, the mortalityrate was 3.1% at HVH and 4.5% at LVH (P � 0.03). For patientsgreater than 80 years old, the mortality rate was 4.6% at HVH and7.3% at LVH (P � 0.04). The results were unchanged after adjust-ment for patient demographics, comorbid disease, site of cancer, andtype of resection. Conclusions. The majority of deaths after surgeryfor colorectal cancer occur in older patients. Hospitals that performhigher volumes of colorectal resection have lower mortality rates,especially for older patients. In the absence of other informationabout the quality of surgical care, provider volumes are a usefulmarker of postoperative outcomes for older patients in need of sur-gery for colorectal cancer.

2. Treatment of Post-Infarction Heart Failure with Hepato-cyte Growth Factor. V. Jayasankar, M.D., L. T. Bish, T. J.Pirolli, S. Chatterjee, M.D., J. Burdick, T. J. Gardner, M.D., H. L.

267

hool, Boston, Massachusetts, November 7–9, 2002

Introduction. This study was designed to investigate the abilityof hepatocyte growth factor (HGF) to prevent postinfarction heartfailure in rats. Background. Progressive ventricular dilatation withheart failure remains a major cause of postinfarction morbidity andmortality. HGF is a potent cardiotrophic and angiogenic proteinwhose receptor is upregulated after human and experimental animalmyocardial infarction. We hypothesized that overexpression of HGFmay prevent the postinfarction progression to heart failure. Meth-ods. Lewis rats underwent ligation of the left anterior descendingcoronary artery followed by direct intramyocardial injection withrecombinant adenovirus encoding HGF (n � 7) or null virus ascontrol (n � 7). After 6 weeks, all animals underwent analysis ofcardiac function by in vivo pressure–volume conductance cathetermeasurements. Left ventricular free wall thickness was measured,Von Willebrand’s factor (vWF) staining was performed to measureangiogenesis, and HGF expression was analyzed by Western blot.Results. Rats treated with adeno-HGF demonstrated greater pres-ervation of contractility as measured by maximum pressure devel-oped per cardiac cycle (HGF 78 � 5.5 vs. null 47 � 3.1 mm Hg, P �0.0008), maximum dV/dt (160 � 19.1 vs. 77 � 9.1 �l/s, P � 0.004),and stroke work (136 � 29.7 vs. 53.6 � 7.3, P � 0.037). Left ventric-ular wall thickness was greater but not statistically significant in theadeno-HGF group (1.54 � 0.04 vs. 1.38 � 0.08 mm, P � 0.15), andvWF staining revealed greater angiogenesis in HGF-treated animalsas measured by capillaries/HPF (172 � 12.2 vs. 92 � 8.7, P � 0.001).There was significant overexpression of HGF protein in the adeno-HGF group at 6 weeks by Western blot. Conclusions. Adenoviral-mediated gene transfer and overexpression of HGF results in signif-icant angiogenesis, preservation of cardiac contractile function, anda trend toward greater preservation of ventricular geometry 6 weeksafter myocardial infarction in rats. This technique may be useful asan adjunct or alternative to standard revascularization techniques inpatients with ischemic cardiomyopathy.

3. Growth Hormone and Epidermal Growth Factor TogetherEnhance Two Sodium-Dependent Glutamine (GLN) Trans-port Systems in Remnant Small Intestine after MassiveEnterectomy. E. C. Ray, M.D., N. E. Avissar, Ph.D., D. Vukcevic,D.V.M., L. Toia, M.S., J. Berlanga-Acosta, Ph.D., and H. C. Sax,M.D. Department of Surgery, University of Rochester, Rochester,New York.

Introduction. Successful adaptation after massive enterectomydepends upon up-regulation of nutrient transport in the remnantbowel. Studies have shown decreased GLN transport after 70% en-

of the Association f

Sweeney, Ph.D., and Y. J. Woo, M.D. Departments of Physiologyand Surgery, University of Pennsylvania School of Medicine, Phil-adelphia, Pennsylvania.

Academic Surgery

terectomy. Growth factors may enhance transport, but the effects onindividual transport systems and on gut-axis transport gradientshave not been defined. We hypothesize that parenteral epidermal

orSc

0022-4804/02 $35.00© 2002 Elsevier Science (USA)

All rights reserved.

growth factor (EGF) and growth hormone (GH) together accelerateGLN uptake by systems A, B0,�, and B0 in a synergistic andtransporter-specific manner. Methods. New Zealand White rabbitsunderwent 70% midgut enterectomy and were randomized to notreatment (RC), EGF (36 �g/kg/day), GH (0.2 mg/kg/day), or both(n � 5 per group). Four additional animals served as unresectedcontrols (UC). After 2 weeks, Na�-dependent uptake of [3H]GLN wasmeasured in intestinal brush border membrane vesicles with andwithout the inhibitors MeAIB (5 mM, transported by A) and arginine(5 mM, transported by B0,�) individually and together. Total uptakeof GLN (50 �M) was measured in the absence of inhibitors. Datawere analyzed by ANOVA. Results. Overall uptake was higher indistal (D) than proximal (P) remnant small bowel. Resection causeda 50% decrease in GLN transport, which was restored by combinedEGF and GH therapy. Combined therapy increased system A trans-port activity six- and eightfold in D and P, respectively, and systemB0,� fourfold in both D and P (see table). EGF and GH individuallydid not significantly alter transport. No change in system B0 uptakewas seen with any of the treatments. Conclusions. EGF and GHsynergistically accelerate small bowel adaptation by increasing totalNa�-dependent GLN uptake through system A and system B0,�. Thiscombination has therapeutic potential in patients with the short gutsyndrome.

4. A Brief Intervention by Surgeons Can Influence MedicalStudents toward a Career in Surgery. R. A. Kozar, M.D.,Ph.D., A. Lucci, M.D., C. C. Miller, Ph.D., A. Azzizadeh, M.D.,C. S. Cocanour, M.D., J. R. Potts, M.D., C. P. Fischer, M.D., andS. I. Brundage, M.D. University of Texas–Houston and BaylorCollege of Medicine, Houston, Texas.

Purpose. General surgery training programs are experiencing analarming decrease in the number of applicants. The purpose of thecurrent study was to determine if exposing students to the disciplineof surgery through a brief intervention early in their medical educa-tion could influence perceptions toward surgery as a career choice.Methods. First-year medical students were asked to rank 19 itemscoded on a Likert scale from 1 (not important) to 8 (very important)regarding their beliefs about surgery as a career both before andafter a brief 1-h intervention with a panel of five surgeons (two maleand three female). Each surgeon spoke about his or her personal andprofessional lives, followed by a question and answer period. Surveydata were analyzed by Wilcoxon sign rank and Spearman rankcorrelation. Results. Of 210 first-year students, 121 (58%) studentsvoluntarily attended and completed the presurvey and 94 (45%)completed the postsurvey, of which 82 were matched responses.Preintervention responses revealed that career opportunities, intel-lectual challenge, and the ability to obtain a residency position werepositively correlated with surgery (P � 0.006), while length of train-ing, lifestyle during residency, lifestyle after training, and work

hours during residency were negatively correlated (P � 0.009).Postintervention responses revealed the changes shown in the table.Conclusion. Positive encounters with practicing surgeons can fa-vorably influence the perceptions of first-year medical students to-ward a career in surgery. In addition to addressing lifestyle issues,surgeons can and must make a concerted effort to interact withmedical students early in their education and foster their interestthroughout their career.

5. Inhibition of CD1d Activation Suppresses Septic Mortal-ity: A Role for NK-T-Cells Septic Immune Dysfunction. R. J.Rhee, B.S., S. Carlton, B.S., C. Chung, Ph.D., J. L. Lomas, M.S.,W. G. Cioffi, M.D., and A. Ayala, Ph.D. Division of Surgical Re-search, Department of Surgery, Rhode Island Hospital/BrownUniversity, Providence, Rhode Island.

Studies indicate that following septic insult there is a developmentof generalized immune dysfunction in T-/B-cells as well as phago-cytes, which is thought to contribute to morbidity and mortality.Specifically, studies have reported that there is a shift in septicanimals’ lymphocytes toward production of increased release of Th2cytokines. Concurrently NK-T-cells have been shown to contribute topropagation of the Th2 response. However, the influence of NK-T-cells on the immune response to the septic challenge is poorly un-derstood. The aim of this study was to examine whether NK-T-cellscontribute to immune dysfunction seen following the onset of polymi-crobial sepsis, as produced by cecal ligation and puncture (CLP).Methods. To investigate this, we pretreated mice with either ratIgG (isotypic control) or monoclonal antibody to CD1d (clone 1B1),which block signaling/antigen presentation via the CD1d cell surfacereceptor, thereby ablating the activation/differentiation of the NK-T-cell. Septic survival with and without anti-CD1d (CLP/CD1d) pre-treatment was followed. Subsequently, the spleen, liver, and bloodwere harvested 24 h postoperation and assessed phenotypic shift inpercentage of NK-T-cell (by FACS) as well as the levels of pro-/anti-inflammatory cytokines (ELISA). Results. The results indicatedthat administration of anti-CD1d for �14 h reduced septic mortality35% at 6–10 days (Fig. 1). Further, we found there was a consistentincrease in the percentage of CD3� NK1.1� cell population (NK-T-cells) in septic mice, which was markedly suppressed by pretreat-ment with anti-CD1d. Concomitantly, we found septic mouse bloodIL-6/IL-10 levels were also suppressed by anti-CD1d in the spleen,liver, and blood (Figs. 2 and 3). Conclusions. Together these find-ings imply that NK-T-cells may play a role in mediating immunesuppression seen in sepsis.

6. Restoration of SMAD4 to SMAD4-Null Human PancreaticCancer Cells Reverses Aggressive in Vivo Growth Pheno-type. J. B. Fleming, M.D., R. M. Jaber, M.D., M. Davis, B.S., andJ. F. Huth, M.D. Department of Surgery, University of TexasSouthwestern Medical Center, Dallas, Texas.

TABLE—ABSTRACT 3

System Comparison Uptake (pmol/mg/10 s) � SEM P value

All 3 UC vs. RC P: 236.3 � 38.6 vs. 111.7 � 12.5 �0.05D: 308.3 � 38.5 vs. 147.3 � 51.8 �0.05

All 3 Resected EGFand GHvs. RC

D: 360.2 � 40.5 vs. 147.3 � 51.8 �0.05

A Resected EGFand GHvs. RC

P: 121.0 � 38.6 vs. 14.8 � 5.8 �0.05D: 116.0 � 31.8 vs. 19.0 � 3.2 �0.05

B0,� Resected EGFand GHvs. RC

P: 155.7 � 36.8 vs. 39.8 � 9.4 �0.01D: 190.5 � 36.3 vs. 50.3 � 17.7 �0.05

TABLE—ABSTRACT 4

Factors Influenced by a Brief Interventionwith Surgeons

Variable � Likert scale (No. of points) P value

Academic opportunities �0.64 0.02Patient relationships �1.05 0.004Prestige �0.54 0.006Gender distribution �1.74 0.0001Concern about debt �0.93 0.0011Length of training �1.80 0.0001

268 ASSOCIATION FOR ACADEMIC SURGERY—ABSTRACTS

Introduction. The signal transduction protein SMAD4 is absentin 50% of human pancreatic adenocarcinomas, and loss of SMAD4 isassociated with decreased patient survival. We hypothesize thatSMAD4-null human pancreatic cancer cells will grow aggressively invivo and that adenoviral Smad4 gene restoration by will reversethis aggressive phenotype. Methods. SMAD4-null (Capan-1) andSMAD-4 wild-type (Panc-1) human pancreatic adenocarcinoma celllines were used. Cells (5 106) were injected in to the flank ofirradiated nu/nu mice and growth curves established. Cells wereexposed in vitro to empty adenoviral vector (CV) or one containingSmad4 (AdSmad4); SMAD4 expression after gene transfer was doc-umented by Western blot. SMAD4-null tumors (200 mm3) were es-tablished in nu/nu mice, intralesional injection of CV or AdSmad4(6 109 pfu) was performed, and tumors were measured weekly.Gene transfer was documented by Western blot analysis of proteinfrom cells and established tumors. Experiments were performed intriplicate and data expressed as mean tumor volume (�SEM). Re-sults. SMAD4-null cell lines established tumor volumes of 928 mm3

at day 40, while the Smad4-wild-type cell lines reached volumes of142 mm3. AdSmad4 gene transfection was achieved in the SMAD4-null cell lines and tumors at 50 and 100 multiplicity of infection.Intralesional injection of AdSmad4 reduced in vivo tumor growthsignificantly compared to empty virus-treated and control tumorgrowth (P � 0.05). Immunohistochemistry documented the presenceof viable tumor and successful SMAD4 restoration. Conclusion.Intralesional AdSmad4 restores SMAD4 expression to SMAD4-nullhuman pancreatic adenocarcinoma tumors and reverses their ag-gressive in vivo growth phenotype.

7. Fibroblast Growth Factor 10 (Fgf10) Signaling Is Requiredfor Development of the Cecum. R. C. Burns, M.D., T. Fair-banks, M.D., D. Warburton, M.D., K. D. Anderson, M.D., and S.Bellusci, Ph.D. Childrens Hospital Los Angeles–USC, Los Ange-les, California.

Introduction. Intestinal development proceeds as a tube-likestructure with differentiation along its axis. The intestine differen-tiates along its axis with the cecum marking the transition fromsmall to large intestine. Fgf10 is known to serve a key role in buddingmorphogenesis; however, little is known about its role in the devel-opment of the transitional structure (cecum) between small andlarge intestine. The cecum is first recognized at 11 days postconcep-tion (dpc) in the mouse as a single bud. We sought to evaluate therole of Fgf10 in the development of the cecum. Methods. Wild-typeC57Bl/6 and Fgf10�/� embryos were harvested from timed preg-nant mothers at 10.5, 12.5, and 14.5 dpc and were analyzed for cecalphenotype and Fgf10 expression. Fgf10 expression in WT embryoswas evaluated using whole mount in situ hybridization. Results.Results are presented in the figure. WT cecal development is evidentat 12.5 dpc and progresses at E14.5. Fgf10 is discreetly expressed inthe area of the developing cecum immediately before the cecal budforms and continues to maturity. Fgf10�/� embryos demonstratefailure of cecal development, leaving only a rudimentary cecal ves-tige without a lumen. Conclusions. These data demonstrate normal

cecal development in WT, the discreet expression of Fgf10 in the areaof the developing cecum, and the failure of cecal development in theFgf10�/�. Fgf10 clearly serves a central role in the development ofthe cecum. Further investigation of the role of Fgf10 in cecal devel-opment may lead to better understanding of the transition fromsmall to large intestine, which may also have implications for intes-tinal adaptation.

8. The Small Heat-Shock-Related Protein, HSP20, Is Dynam-ically Associated with the Actin Cross-Linking Protein Ac-tinin. D. J. Tessier, M.D., and C. M. Brophy, M.D., Mayo Grad-uate School of Medicine, Mayo Clinic, Scottsdale, Arizona;Department of Bioengineering, Arizona State University, Tempe,Arizona; and Carl T. Hayden VAMC, Phoenix, Arizona.

Phosphorylation of the small heat-shock-related protein HSP20mediates vascular smooth muscle relaxation. Actinin forms the dy-namic cross-links between actin filaments. We hypothesized thatHSP20 may mediate relaxation via an association with actinin. Ho-mogenates of bovine carotid arteries were immunoprecipitated withHSP20 (IP) or with preimmune serum (-AB). Immunoblots fromthese fractions, as well as the supernatant (S) from the immunopre-cipitations, were probed with anti-HSP20 or anti-actinin antibodies.Both HSP20 (20 kDa) and actinin (110 kDa) immunoprecipitatedwith anti-HSP20 (see figure A). Immunostaining of carotid tissuewith HSP20 or actinin revealed colocalization of the two proteins(figure B). To determine if the association between HSP20 and acti-nin was modulated by the contractile state, strips of bovine carotidartery smooth muscle were unstimulated (control), contracted withserotonin (5HT, 10�6 M, 15 min), or contracted with serotonin and

269ASSOCIATION FOR ACADEMIC SURGERY—ABSTRACTS

relaxed with forskolin (FSK, 10�6 M, 15 min). Homogenates wereimmunoprecipitated with anti-actinin antibodies (IP) or with non-specific immunoglobulin (C) and probed with anti-HSP20 antibodies.HSP20 coimmunoprecipitated with actinin in control and contracted(5HT), but not relaxed (FSK), muscles (figure C). These data supporta role for phosphorylated HSP20 in modulating relaxation by adynamic association with the actin filament cross-linking proteinactinin.

9. Carbon Monoxide Protects against Organ Injury in Hem-orrhagic Shock/Resuscitation. G. E. Bracho, II, M.D., B. S.Zuckerbraun, M.D., C. A. McCloskey, M.D., L. E. Otterbein,Ph.D., and T. R. Billiar, M.D. Department of Surgery, Universityof Pittsburgh, Pittsburgh, Pennsylvania.

Background. Hemorrhagic shock followed by resuscitation(HS/R) leads to a systemic inflammatory response, which can becomplicated by organ injury and failure. Studies have shown thatheme oxygenase-1 (HO-1) is upregulated in HS/R and protectsagainst organ damage. HO-1 converts heme to biliverdin, free iron,and the diffusible gas molecule carbon monoxide (CO). Based on theprotective actions of HO-1 in HS/R and the observation that COalone exerts anti-inflammatory antiapoptotic properties in vitro, wehypothesized that inhaled CO administration would be protective ina model of HS/R. Methods. Anesthetized male mice (n � 3 pergroup) were hemorrhaged to a MAP of 25 mm Hg, which was main-tained for 2.5 h followed by resuscitation. Sham-cannulated animalsserved as controls. Animals received either CO (250 ppm) or stan-dard room air throughout the duration of HS/R. Mice were sacrificed4 h following the initiation of resuscitation. Plasma IL-6 and IL-10levels were measured by ELISA. Liver injury was assayed by color-imetric analysis for plasma alanine aminotransferase (ALT). Re-sults. As shown in the figure, CO administration completely pre-vented the increase in ALT (P � 0.001) induced by HS/R. PlasmaIL-6 levels increased threefold following HS/R compared to shamcontrols, while CO treatment reduced this elevation by 31%. PlasmaIL-10 levels following HS/R in the CO treatment group were sixfoldhigher than those that received standard room air following HS/R(P � 0.011). Conclusions. Exogenous CO protects against liverinjury in an in vivo model of HS/R. The marked reduction in IL-6levels coupled to the increase in IL-10 levels suggests that CO mayprotect by suppressing the inflammatory response. Safe delivery oflow doses of CO may be useful as a therapeutic adjunct in thetreatment of patients with hemorrhagic shock.

CLINICAL TRIALS/OUTCOMESPARALLEL SESSION

10. On-Pump Coronary Artery Bypass Surgery Activates Hu-man Myocardial NF�B and Increases TNF in the Heart.D. R. Meldrum, M.D., J. C. Cleveland, Jr., M.D., D. A. Partrick,

M.D., K. K. Meldrum, M.D., A. A. Ayala, Ph.D., J. W. Brown,M.D., and A. H. Harken, M.D. CT Surgery, Indiana University,Indianapolis, Indiana; and Department of Surgery, University ofColorado, Denver, Colorado.

Purpose. Myocardial tumor necrosis factor � (TNF) productionand nuclear factor �B (NF�B) activation have been demonstrated inchronic heart failure and experimental models of acute ischemia/reperfusion injury (I/R). Further, a cause and effect relationship hasbeen established between these events and cardiomyocyte apoptosisfollowing such conditions. It remains unknown, however, whetherthe myocardial injury associated with on-pump coronary artery by-pass surgery (CAB) results in myocardial NF�B activation and TNFproduction. We hypothesized that on-pump CAB activates humanmyocardial NF�B and increases TNF in the heart. Methods. Pa-tients, 18 to 65 years of age, scheduled for elective cardiac surgerybut without other preexisting disease were considered eligible for thestudy. Biopsies of human myocardium were obtained before andafter cardiopulmonary bypass and myocardial TNF� levels weredetermined by ELISA and cytotoxicity assay, and NF�B activationwas determined by electrophoretic mobility shift assay (EMSA; n �6 patients). NF�B activation was quantitated with gel densitometry.Results. The clinical characteristics of the study patients were asfollows (means � SEM): mean age (years) 50.0 � 5.7; male 6 (100%);cardiopulmonary bypass time (min) 107 � 37.7; cross-clamp time(min) 68 � 17.6; number of coronary artery bypasses 3.0 � 1.1; andlength of hospital stay (days) 4.8 � 0.9. Before CAB myocardialTNF� levels were 251 � 22 pg/g and 33 � 9 U/g as determined byELISA and cytotoxicity assay, respectively. Following CAB humanmyocardial TNF� levels increased to 892 � 71 pg/g (P � 0.0008) and141 � 11 U/g (P � 0.0042) by ELISA and cytotoxicity assay, respec-tively. Before CAB, the ratio bound to unbound NF�B DNA was0.009 � 0.0007, and following CAB, the ratio was 0.24 � 0.01 (P �0.0001). Conclusion. On-pump coronary artery bypass grafting re-sults in an activation of NF�B and an increase of TNF in the heart.

11. The Consequence of Delayed Graft Function (DGF) afterKidney Transplantation (KTXP). A. R. Boissy, M.D., J. C.Tan, M.D., S. M. Lerner, M.D., V. Shaw, B.A., B. Javaid, M.D.,J. D. Scandling, M.D., D. C. Dafoe, M.D., and E. J. Alfrey, M.D.Penn State University, Hershey, Pennsylvania.

Introduction. The impact of DGF, a requirement for dialysiswithin the first week after KTXP, on graft survival is difficult toanalyze due to the inability to control donor variables and recipientpostoperative management between cohorts. The relationship ofDGF and rejection is unclear. In this single-center study, we com-pared outcome in pairs of kidneys (from the same cadaveric donor)where one kidney had prompt graft function (PGF) and one DGF.Methods. There were 24 donor (D) pairs from November 1991 toJune 1999 with disparate outcome between the two recipients (onehad PGF and one had DGF). Both kidneys were sequentially trans-planted at our center. Data were entered into a relational database.The mean D age was 44 � 14 years and the mean creatinine clear-ance on admission was 92 � 31 ml/min. The immunosuppressiveprotocol was calcineurin-based triple therapy and those with DGFreceived antibody therapy. Groups were compared using the un-paired Student’s t test or �2. Graft survival is actuarial. Results. Inonly 65% of the pairs was the kidney with PGF transplanted beforethe kidney with DGF. The panel reactive antibody (PRA) level wasmeasured at the time of KTXP (see table). Conclusions. These dataconfirm that DGF increases LOS and thus hospital costs. At 5 years,there was a 20% decrease in graft survival in recipients with DGF,


despite no difference in the number of rejections. These data suggestthat there is a profound consequence of DGF after KTXP in terms of5-year graft survival.

12. Female Gender Is Associated with Adverse IntensiveCare Unit Outcomes Following Coronary Artery Bypass.M. E. Morris, M.D., M. H. Hedeshian, M.D., J. L. Blair, A.B.,C. E. Emond, A.B., S. S. Lollis, A.B., N. Namour, A.B., E.Dziadik, A.B., R. D. Stewart, M.D., M.P.H., and C. T. Campos,M.D. University of Massachusetts Medical School, Worcester,Massachusetts.

Introduction. Female gender is an established risk factor forincreased morbidity and mortality following coronary artery bypass(CABG) graft surgery. However, the impact of gender on intensivecare unit (ICU) outcomes is not well established. Methods. Weprospectively assessed ICU outcomes in a consecutive series of pa-tients undergoing primary CABG between January 1997 and June1998 and between July 1999 and January 2000. Of 1125 consecutivepatients, complete ICU outcome data were available in 1035 patients(92%). Patients intubated longer than 72 h (n � 32) were excluded.Results. Results are shown in the table. Multivariate regressionanalysis showed that female gender was an independent predictor oflonger intubation time following CABG along with older age, use ofpreoperative inotropic agents, surgical priority, preoperative myo-cardial infarction, and preoperative creatinine level. Logistic regres-sion analysis showed that older age, female gender, surgical priority,and higher preoperative creatinine level were independent predic-tors of intubation �8 h following CABG. Female gender was alsoindependently associated with increased weight gain on POD 1, morefrequent use of inotropic agents, and greater number of red blood celltransfusions. Conclusion. Gender is a significant independent pre-dictor of adverse ICU outcomes following CABG. Initiatives to im-prove CABG outcomes and reduce cost will need to focus attention onimproving outcomes in women.

13. Obesity Does Not Adversely Affect the Outcome of Lapa-roscopic Antireflux Surgery (LARS). E. R. Winslow, M.D.,M. M. Frisella, R.N., N. J. Soper, M.D., and M. E. Klingensmith,M.D. Washington University School of Medicine, St. Louis, Mis-souri.

Aims. Because it has been suggested that obesity adversely affectsthe outcome of LARS, it is unclear how surgeons should counselobese patients referred for antireflux surgery. Our purpose was tocompare the surgical outcomes of LARS in the obese and nonobese.Methods. A prospective database of patients undergoing LARS from1992 to 2001 was used to compare obese and nonobese patients.Patients were questioned about specific symptoms and medicationuse preoperatively and annually thereafter. Visual analog scale(VAS) questionnaires were completed regarding global symptomsand satisfaction. Failures were defined by objective evidence. P val-ues were determined using one-way ANOVA and the �2 test. Re-sults. Of the 505 patients, the body mass index (BMI) was �25(normal) in 16%, 25–29 (overweight) in 42%, and �30 (obese) in 42%.Preoperatively, there were no differences between groups in thefrequency of reflux symptoM.S., except that aspiration (P � 0.008)and abdominal bloating (P � 0.007) were more common in the obese.The groups had similar disease severity by endoscopy and 24-h pHtesting. Although the operative time was longer in the obese group,the time to discharge and rate of major complications did not differ(P � NS). At a mean (�SD) follow-up of 35 � 25 months, there wereno differences in the prevalence of symptoms or the overall improve-ment and patient satisfaction scores by VAS (P � NS). The rates ofanatomic failure and reoperation for failure were identical betweengroups (P � NS) (see table). Conclusions. Although the operative

time for LARS is longer in the obese, complication and anatomicfailure rates are similar to the nonobese at long-term follow-up.Further, obese patients have equivalent relief of symptoms and areequally satisfied with their operative results. Therefore, obesityshould not be a contraindication to LARS.

14. Trends in Research Support and Productivity in theChanging Environment of Academic Surgery. J. D. Jack-son, B.S., M. A. Firpo, Ph.D., H. H. Jackson, B.S., S. J. Mulvihill,M.D., and R. E. Glasgow, M.D. University of Utah, Salt LakeCity, Utah.

Introduction. Pressures on academic surgeons to generate clini-cal revenue are increasing and are a threat to research productivity.We hypothesized that increasing financial pressures on academicsurgeons would result in a decrease in surgical research funding andnumbers of basic surgical research publications. Methods. Trends inNational Institutes of Health (NIH) grant support and trends in thenumber and profile of research publications from departments sur-gery and medicine were analyzed. NIH research funding to medicalschool departments from 1992 to 2000 were evaluated. To assesstrends in research productivity, selected basic research journalswere screened for publications in which at least one author-citedaffiliation with a department of surgery or medicine. The number ofbasic research publications for each journal was plotted for 1988 to

TABLE—ABSTRACT 11

PGF (n � 24) DGF (n � 24) P value

HLA match 1.0 � 0.9 0.6 � 0.7 NSPRA 1.9 � 5.6 1.1 � 5.0 NSCold storage time (h) 19 � 6 21 � 7 NSD/R weight ratio 1.1 1.0 NSTime on wait list (days) 493 � 330 536 � 323 NSLength of stay (LOS) 6 � 3 11 � 6 0.005Number of rejections 0.7 � 1.0 0.8 � 1.0 NSSerum Cr (mg/dl)

1 month 1.8 � 0.6 3.3 � 2.3 0.0041 year 1.9 � 0.6 2.2 � 1.1 NS

Graft survival (%)1 year 100 92 0.055 years 91 70 0.05

TABLE—ABSTRACT 12

Female(n � 287)

Male(n � 716) P value

Intubation time (min) 702 � 685 525 � 495 �0.001POD 1 weight gain (kg) 9.2 � 3.4 8.2 � 3.7 �0.001Inotrope use in ICU (n (%)) 89 (31) 121 (17) �0.001RBCs in ICU (units) 3.3 � 2.6 1.6 � 2.7 �0.001ICU length of stay (h) 53 � 86 39 � 75 0.01

TABLE—ABSTRACT 13

Normal Overweight Obese P value

OR time (min) 115 � 42 121 � 37 137 � 55 0.0003% Complications (�IIb) 1.2 0.5 1.4 NS% Reoperation for failure 2.4 2.4 2.4 NSImprovement (mm) 93 � 11 88 � 19 94 � 12 NSSatisfaction (mm) 79 � 33 85 � 24 85 � 27 NS


2000 and regression analyses were performed. To see if there was ashift from basic science to clinical publications, we analyzed researchpublications in three general interest surgical journals from 1980 to2000. Articles were classified as clinical or basic using predefinedcriterion and ANOVA used to determine statistical differences. Re-sults. Total NIH funding and grant awards to schools of medicineincreased from 1992 to 2000. As a percentage of total funding tomedical schools, NIH funding declined and the number of researchawards to departments of surgery remained constant. Total fundingto departments of medicine increased significantly. The averageresearch award to faculty in surgery did npt change from 1992 to2000 ($267K to $276K), but increased in medicine ($21K to $138K).The number of yearly publications in basic science journals chosen toassess basic research productivity trended up equally for surgery(m � 7.4, R2 � 0.94, P � 0.0001) and medicine (m � 7.9, R2 � 0.4, P �0.03). There was no significant change in the yearly ratio of clinicalto basic science publications in the surgery journals. The ratio re-mained 3:1. Conclusion. Support for research in departments ofsurgery is static, but increased significantly for departments of med-icine. Despite this static research funding, basic surgical researchproductivity has increased. Basic surgical research remains an inte-gral part of an academic surgery department activity.

15. The Implications of the Leapfrog Initiative on Surgery.J. H. Liu, M.D., D. A. Etzioni, M.D., M. A. Maggard, M.D., andC. Y. Ko, M.D., MSHS Department of Surgery, UCLA, Los An-geles, California.

Purposes. (1) To determine the percent of hospitals in Californiathat meet the Leapfrog volume criteria and (2) to investigate effectsof volume criteria on academic and nonacademic hospitals. Back-ground. Patient safety has taken center stage in the quality im-provement arena. The Leapfrog Group, a consortium of companiesproviding health benefits to 20 million Americans, has attempted touse employer purchasing power to promote quality and safety. Oneinitiative by the Leapfrog Group has stipulated a yearly hospitalvolume requirement for five index procedures: coronary bypass (500),angioplasty (400), aortic aneurysm repair (30), carotid endarterec-tomy (100), and esophageal cancer surgery (7). The impact of thisinitiative is unknown. Methods. Using the California inpatient da-tabase from 2000, we determined the number of index proceduresperformed at all nonfederal urban acute care hospitals. We identifiedhospitals that met the volume criterion for each index procedure.Subanalyses were performed on university academic centers. Re-sults. Of 384 California hospitals, 285 (74.2%) performed one ormore of the index procedures, and 76 (26.7%) performed all five.However, no hospital met all five Leapfrog volume criteria, five(1.8%) hospitals met four of the five volume requirements, and 212(74.3%) met none. Major academic hospitals met 1.8 � 1.68 of thevolume criteria, while other hospitals met 0.41 � 0.83 (P � 0.02). Ifregionalization occurred according to the Leapfrog Initiative, approx-imately 50% of all current hospitals would stop performing at leastone of the five index procedures. Conclusions. A total of 75% ofhospitals performing index procedures did not meet any of the Leap-frog volume criteria. Although the data supporting these volumerequirements are controversial, this initiative seems to be gainingmomentum. As a major purchaser of health insurance, the LeapfrogGroup has the potential to affect both community and academicsurgeons. Therefore, we need to rigorously examine the evidencesupporting this initiative before adopting a policy with enormousimplications for hospitals, surgeons, and patients.

16. Provider Volume and Surgeon Specialty Are Related toOutcomes of Abdominal Aortic Aneurysm Repair in theUnited States. J. B. Dimick, M.D., J. A. Cowan, Jr., M.D., P. K.Henke, M.D., J. C. Stanley, M.D., and G. R. Upchurch, Jr., M.D.University of Michigan Medical Center, Ann Arbor, Michigan.

Objective. The objective of this study was to determine the rela-tive importance of hospital volume, surgeon volume, and surgeonspecialty on outcomes after abdominal aortic aneurysm (AAA) repairin a representative sample of United States hospitals. Background.Recent health policy initiatives have focused on regionalization ofAAA repair to high-volume hospitals (HVH) to improve the quality ofcare for this common procedure. Little is known about the perfor-mance of individual high-volume surgeons (HVS) or the impact ofsurgical specialty on outcomes for AAA repair. Methods. Patients inthe Nationwide Inpatient Sample for 1997 with a primary diagnosticcode for AAA (ICD-9-CM code 4414) and procedure code for repair(ICD-9-CM codes 3925 and 3844) who had surgeon-level informationwere included (n � 3912). High-volume surgeons (�10/year) andhigh-volume hospitals (�35/year) performed more than the mediannumber of procedures per year. Low-volume hospitals (LVH) andlow-volume surgeons (LVS) performed less than the median. Spe-cialty (vascular, cardiac, and general) was determined by analysis ofthe other procedures performed by each surgeon. Results. Overallmortality was 4.2% and was lower at HVH (3.0%) versus LVH (5.5%)(P � 0.001). Mortality rates were also lower for HVS (2.5%) versusLVS (5.6%) (P � 0.001). Among the specialties, vascular surgeonshad the lowest mortality (2.2%) versus cardiac (4.0%) and generalsurgeons (5.5%) (P � 0.001). In the risk-adjusted analysis, HVH hada 30% reduction and HVS had a 40% reduction in mortality. In thisanalysis, AAA repair by general surgeons was associated with a 76%increased risk of death compared to vascular surgeons, with nosignificant difference between cardiac and vascular surgeons. Con-clusions. High surgeon and hospital volume are both associatedwith lower mortality after AAA repair. Independent of AAA repairvolume, increased specialization in vascular surgery is also associ-ated with a marked reduction in mortality. Individual surgeon vol-ume and surgical specialty, in addition to hospital volume, may beuseful surrogates for the quality of surgical care for AAA repair.

17. Prospective Validation of Renal Dysfunction Scores afterThoracoabdominal Aortic Surgery. S. A. LeMaire, M.D.,L. D. Conklin, M.D., S. Chang, B.S., and J. S. Coselli, M.D.Baylor College of Medicine, Houston, Texas.

Purpose. The association between postoperative renal failure andmortality is well established. Although the renal dysfunction score(RDS) is used as a surrogate measure for renal injury in clinicaltrials involving thoracoabdominal aortic surgery, it has not beenvalidated in this setting. The purpose of this study was to determineif increasing RDS is associated with increased early mortality inpatients undergoing thoracoabdominal aortic aneurysm (TAAA) re-pair. Methods. Over a 16-month period, data were collected prospec-tively from 260 consecutive patients without preexisting renal fail-ure that underwent TAAA repair. Renal dysfunction scores (1–5)were assigned to each patient based on baseline and peak postoper-ative serum creatinine (Cr) levels as follows: (1) Cr elevation �50%above baseline, (2) Cr elevation 50%–100% above baseline, (3) dou-bling of Cr level but peak �3.0 mg/dL, (4) doubling of Cr and peak�3.0 mg/dL, and (5) acute renal failure requiring dialysis. All pa-tients with a RDS of 2 were considered to have renal dysfunction.Operative mortality was defined as death within 30 days of operationor during the initial hospitalization. Results. Seventy-four patients(28%) had renal dysfunction (RDS 2). Operative mortality was 16%(12/74) for patients with renal dysfunction and only 3% (6/186) forthose without (P � 0.001). Thirteen patients (5%) required hemodi-alysis (RDS 5); these patients had a 31% mortality (4/13). Themean RDS was higher in nonsurvivors (2.8 � 1.6) than in survivors(1.5 � 1.0, P � 0.002). Conclusions. Increasing RDS was associatedwith increased operative mortality following TAAA repair. Renaldysfunction—defined as elevated RDS—was substantially morecommon than overt renal failure and appears to be a suitable surro-gate measure of renal injury.


CRITICAL CARE PARALLEL SESSION

18. Ketamine/Xylazine Attenuates LPS-Induced iNOS Expres-sion in the Rat. K. S. Helmer, M.D., Y. Cui, M.D., A. Dewan, andD. W. Mercer, M.D. University of Texas–Houston Medical School,Houston, Texas.

Introduction. Ketamine and xylazine (K/X) are commonly usedin combination as an anesthetic agent in experimental animal mod-els. We previously noted that K/X attenuated lipopolysaccharide(LPS)-induced liver injury, gastric stasis, and reduced symptoms ofendotoxemia such as lethargy and diarrhea in rats. Because ket-amine attenuates expression of several proinflammatory genes, incontrast to some anesthetics that are proinflammatory, we examinedthe effects of K/X on inducible nitric oxide synthase (iNOS), whichhas been implicated in endotoxin-induced tissue injury. We hypoth-esized that K/X would alter LPS-induced expression of iNOS invarious organs in the rat. Methods. Female rats were given eitherintraperitoneal saline or ketamine (70 mg/kg) and xylazine (6 mg/kg)1 h prior to saline or LPS (20 mg/kg). Rats were euthanized 5 h laterand stomach, liver, lung, spleen, kidney, duodenum, jejunum, ileum,and colon were collected for determination of iNOS protein immuno-reactivity by Western immunoblot. Data are reported in densitomet-ric units (DU) as means � SEM (n � 5; ANOVA). Results. LPSsignificantly increased iNOS protein immunoreactivity in all tissuesexamined versus saline controls (P � 0.05, all groups). K/X signifi-cantly attenuated LPS-induced iNOS protein immunoreactivity inall the aforementioned organs (P � 0.05, all groups). Furthermore,K/X almost completely blunted LPS-induced expression of iNOS instomach, duodenum, jejunum, and colon. A representative blot isshown in the figure. Conclusion. These data indicate that K/X is

capable of diminishing LPS-induced upregulation of iNOS in a vari-ety of tissues. Furthermore, in rat models studying the in vivo effectsof endotoxin, especially those evaluating the gastrointestinal system,careful consideration needs to be given if the anesthetic combinationof K/X is used, as it alters LPS-induced expression of iNOS, animportant pathophysiologic mediator in endotoxemia.

19. Effects of Endotoxin Tolerance on Propionibacterium acnes(PA)-Primed LPS Hepatic Injury. J. A. Margenthaler, M.D.,K. Landeros, B.S., M. Eilers, B.S., and M. Flye, M.D., Ph.D.Washington University School of Medicine, St. Louis, Missouri.

Purpose. Endotoxin tolerance has been shown to prevent lethalityafter ischemia/reperfusion injuries, sepsis, and endotoxic shock.Prior administration of the gram-positive bacteria, PA, results inhypersensitivity to subsequent low-dose LPS with hepatocyte necro-sis. We investigated whether prior LPS tolerance could preventsubsequent PA priming and LPS-induced death. The attenuation ineffector cytokines possibly responsible for these changes were mea-sured. Methods. C57BL/6 mice were given heat-killed PA (0.5 mg/mouse) followed 7 days later by LPS (20 �g/mouse). In parallelexperiments, C57BL/6 mice were pretreated with a single 20 �g/mouse dose of LPS (lethal dose 800 �g/mouse) 7 days prior to PApriming. Animal survival, liver and spleen weights, and histologywere examined. Plasma cytokine levels of IFN-�, TNF-�, IL-6, andIL-12 were determined by ELISA. Results. Hepatomegaly, spleno-

megaly, and hepatocyte necrosis with death developed in all PA-primed C57BL/6 mice challenged with LPS (n � 13). However, 83%of C57BL/6 mice (n � 12) given a tolerizing dose of LPS prior to PAsurvived (P � 0.01) without any increase in liver or spleen weightsand without histologic evidence of necrosis. Markedly decreasedplasma cytokine levels corresponded with survival in the LPS-tolerant mice (see table). Conclusions. Lethal PA-primed LPS he-patic injury can be inhibited by administering a tolerizing dose ofLPS prior to PA priming. Tolerance of hepatic mononuclear cells toLPS protects the liver by preventing cellular infiltration and reducesthe production of the toxic proinflammatory cytokines.

20. Simvastatin Suppresses LPS-Induced AKT Phosphoryla-tion in the Human Monocyte Cell Line THP-1. T. R. Patel,M.D., and S. A. Corbett, M.D. Department of Surgery, RobertWood Johnson Medical School, New Brunswick, New Jersey.

Introduction. Activation of small GTPases such as Rac requiresposttranslational modification by isoprenylation. Statins interferewith this process by blocking the synthesis of isoprenoid intermedi-ates. The protein kinase AKT is a multifunctional regulator of cel-lular movement and survival that has been linked to Rac activation.We have shown that LPS stimulation leads to Rac activation inTHP-1 cells. Therefore, we hypothesized that LPS stimulation willalso activate AKT, a downstream effector of Rac, and that this maybe blocked by statin treatment. Methods. THP-1 cells were main-tained in 1% FCS with or without 20�M simvastatin for 24 h,followed by LPS stimulation for increasing time as indicated. AKTwas immunoprecipitated from total cell lysate. Activated AKT wasdetected by immunoblotting with a phospho-AKT antibody and wasquantified by image densitometry. Results. LPS-stimulated THP-1cells showed increased AKT phosphorylation when compared to thenonstimulated controls (figure A). AKT phosphorylation peaked fol-lowing 15 min of LPS stimulation. AKT activation was suppressed bypretreatment with simvastatin (figure B, p � 0.05, Student’s un-paired t test). Conclusions. These data demonstrate that LPS stim-ulation leads to increased AKT phosphorylation, which can be sup-pressed with simvastatin treatment. This suggests one possiblemechanism through which simvastatin could modulate LPS-inducedsignaling events in monocytes to improve the host response to gram-negative infections.

TABLE—ABSTRACT 19

IFN-� TNF-� IL-6 IL-12

Naıve 1 h 525 306,466 119,686 302C57BL/6 6 h 156,156 1,399 400,101 290Tolerized 1 h 114 36,758 58,625 37C57BL/6 6 h 2,248 340 73,842 25


21. Charge- and Sequence-Specific Characteristics of theEndotoxin-Binding Domain of LALF Are Critical to Bac-tericidal Activity. D. B. Leslie, M.D., V. Lazaron, M.D., Ph.D.,K. R. Wasiluk, Ph.D., and D. L. Dunn, M.D., Ph.D. University ofMinnesota, Minneapolis, Minnesota.

Introduction. Limulus anti-lipopolysaccharide (LPS) factor(LALF) is an endotoxin-binding protein from the horseshoe crabLimulus polyphemus. The LPS-binding domain of LALF (LALF31-52) forms an amphipathic loop similar to structures common toendogenous endotoxin-neutralizing proteins. Common features in-clude a paucity of acidic residues and an alternating array of basicresidues in the region thought to bind LPS. We sought to test thehypothesis that the location and number of positively charged basicresidues (arginine�1, lysine�1) within LALF31-52 were critical deter-minants of bactericidal activity. Methods. Eight positively chargedamino acid residues within LALF31-52 were sequentially replacedusing a neutral residue (alanine) “walkthough” technique. Thesepeptides, along with appropriate controls, were assayed for bacteri-cidal activity against Pseudomonas aeruginosa. Results. Alterationof single positive residues in the carboxyl-half of LALF31-52 reducedbactericidal activity against P. aeruginosa. Replacement of four pos-itive residues each with alanines obliterated activity (data notshown, P � 0.01). Certain double alanine replacements at the aminoterminal portion diminished bactericidal activity (see figure, left)while addition of a third mutation restored this activity in at leastone instance (see figure, right). Conclusions. Individual positively

charged lysine and arginine residues within the carboxyl-half ofLALF31-52 appear to be critical to bactericidal activity, although netcharge in and of itself does not dictate such activity. Therefore, weconclude that a combination of charge- and sequence-specific char-acteristics is the primary determinant of bacterial killing mediatedby LALF-derived peptides.

22. Capsaicin Attenuates the Metabolic Response to Abdom-inal Sepsis. D. P. Bryant, M.D., M. S. Shumate, Ph.D., G.Yumet, Ph.D., C. Lang, Ph.D., and R. N. Cooney, M.D. Pennsyl-vania State M. S. Hershey Medical Center, Hershey, Pennsyl-vania.

Purpose. To investigate the role of sensory afferent nerves (SANs)in regulating the metabolic response to abdominal sepsis. Back-ground. The systemic release of inflammatory mediators is thoughtto regulate the metabolic response to infection. Capsaicin (Cap)destroys sensory axons and is used to investigate the role of SANs.Our hypothesis was that SANs regulate muscle catabolism and theinsulin-like growth factor (IGF) system in abdominal sepsis. Meth-ods. Four groups of male SD rats were studied: control, control �Cap, sepsis, and sepsis � Cap. Cap rats were injected with 75 mg/kgCap (day 1) and 50 mg/kg Cap (day 2) and given buprenorphine forpain as needed. Control � sepsis rats were pair fed and injected withvehicle or buprenorphine for pain on the same schedule for 8 days.On day 10, destruction of afferents was verified using the eye wipetest to 1:10,000 Cap. Control rats underwent sham laparotomy.Sepsis rats had a fecal-agar pellet inoculated with Escherichia coliand Bacillus fragilis implanted in the peritoneal cavity. Tissues wereharvested on day 15. Plasma IGF-I and IGFBP-1 and -3 were mea-

sured by RIA and immunoblot. Results. Cap had no effect on musclemass or the IGF system in control rats. However, the catabolism ofgastrocnemius (Gast) muscle, reduction in plasma IGF-I, and in-crease in plasma IGFBP-1 observed in septic rats were attenuated byablation of SANs using Cap (see table). Conclusions. Capsaicin-sensitive afferent nerves mediate the catabolism of gastrocnemius aswell as changes in circulating IGF-I and IGFBP-1 during abdominalsepsis. The results suggest a potentially important role of SANs andthe neuroendocrine response in mediating the host response to ab-dominal infection.

23. Gamma-Guided Diagnostic Peritoneal Lavage (Gamma-DPL) for Detection of Small Bowel Perforation. S. A. Gulec,M.D., S. L. Weintraub, M.D., J. Cundiff, M.D., R. Albarado, B.S.,P. V. Moulder, M.D., J. P. OLeary, M.D., and J. P. Hunt, M.D.,M.P.H. Department of Surgery, LSU, New Orleans, Louisiana.

Purpose. To determine the diagnostic accuracy of gamma probe-guided diagnostic peritoneal lavage (DPL) using orally administeredTc-99m sulfur colloid (TcSC) in a dog small bowel perforation model.Background. The clinical and radiological detection of traumaticsmall bowel perforation in blunt or penetrating abdominal trauma isdifficult. This poses a unique challenge in the era of nonoperativemanagement of abdominal trauma patients. The sensitivity andspecificity of conventional DPL are not reliably high. We hypothe-sized that a small bowel perforation can be diagnosed by detection oforally administered TcSC in DPL effluent by a hand-held gammadetection probe. Methods. A canine intestinal injury model, consist-ing of a single 1-cm surgical perforation in the proximal jejunum,was used to test the Hypothesis. TcSC (1.5 mCi) was administered,in 500 ml of saline, via a nasogastric tube. A DPL with 500 ml ofsaline was performed at 60, 90, and 120 min after administration ofTcSC. The radioactivity in the DPL effluent was measured using agamma probe (C-Trak, Care Wise Inc., Morgan Hills, CA). A positivetest was defined as 3 SD above the background count. Blood, urine,liver, and spleen specimens were obtained to study the biodistribu-tion of TcSC. Results. Twenty animals with perforation and fivewithout perforation were studied. There were no false-positivegamma-DPL results. Sensitivity improved by time up to 90 min. Ourlowest positive count in the DPL effluent measured by the gammaprobe corresponded to 0.2% of the administered activity. No radio-activity was noted in blood, urine, liver, or spleen. The sensitivity,specificity, accuracy, and positive and negative predictive values at90 min were 95, 100, 96, 100, and 83%, respectively. Conclusion.Gamma-guided diagnostic peritoneal lavage is a highly sensitive and100% specific test in the detection of small bowel perforation. Clinicalstudies are warranted to determine the patient-specific factors af-fecting diagnostic accuracy.

24. Alteration of Intestinal Glutamine Absorption by Intraab-dominal Inflammation and Infection. C. L. Wolfgang, M.D.,Ph.D., W. W. Souba, M.D., S.C.D., Q. H. Meng, M.D., C. M. Lin,Ph.D., A. M. Karinch, Ph.D., T. C. Vary, Ph.D., and M. Pan,

TABLE—ABSTRACT 22

Group(n � 10–12)

Gast weight(g)

IGF-I(ng/ml)

IGFBP-1(relative densitometry)

Control 1.55 � 0.03* 882 � 49* 5,265 � 1,143*Control � Cap 1.56 � 0.03* 803 � 34* 5,509 � 730*Sepsis 1.15 � 0.03 648 � 47 22,302 � 3,262Sepsis � Cap 1.34 � 0.03* 892 � 70* 8,866 � 956*

Note. Data are means � SE.* P � 0.05 versus sepsis by ANOVA and Newman-Keuls test.


M.D., Ph.D. The Pennsylvania State University, College of Med-icine, Hershey, Pennsylvania.

Glutamine is required for intestinal immune function, particularlyduring catabolic states when substrate demands are increased andmucosal integrity may be compromised. The aim of this study was toinvestigate the regulation of small intestinal glutamine transport inresponse to intraabdominal sterile inflammation and abscess. Meth-ods. Male adult Sprague–Dawley rats were randomized to shamlaparotomy (control, n � 16), laparotomy � sterile fecal-pellet im-plantation (sterile, n � 16), and laparotomy � sterile fecal-pelletimplantation � Escherichia coli (0–103 CFU) and Bacillus fragilis(0–108 CFU) (septic, n � 32). Glutamine transport was measured inbrush border membrane vesicles and glutamine transporter (ASCT2)mRNA was analyzed using quantitative PCR (Q-PCR, Applied Bio-systems). Data were analyzed with ANOVA with significance of P �0.05. Results. Severity of sepsis was bacteria dose dependent. Septicrat mortality was maintained at 30% at 24 h postoperatopm byadjusting E. coli and B. fragilis dose (no mortality observed in con-trols or sterile group). Sepsis, to lesser degree sterile inflammation,stimulated glutamine transport activity up to threefold 12 and 24 hafter surgery (32.9 � 4.7 control vs. 42.8 � 2.6 sterile vs. 75.1 � 3.2septic, pmol/mg/10 s, P � 0.01). This stimulation was not observed atless than 4 h postoperation. Kinetics showed that glutamine trans-port maximal velocity was stimulated (2.12 � 0.32 control vs. 3.63 �0.43 sterile vs. 6.76 � 0.91 septic, nmol/mg/10 s, P � 0.05), while thetransporter affinity was unaffected (162 � 20 control vs. 176 � 25sterile vs. 189 � 31 septic, �M glutamine, P � NS). Relative ASCT2mRNA levels, normalized to �-actin, increased by twofold (1.0 controlvs. 2.4 � 0.6 sterile vs. 2.2 � 0.4 septic, P � 0.05) as early as 4 h aftersurgery (earlier than the increase in transport activity). Specificityand sensitivity (r � 0.98) of the gene-specific primers were tested.Conclusions. Intraabdominal abscess and sterile inflammation (to alesser degree) stimulate the rat intestinal glutamine transport activityby increasing transporter gene transcription and transporter numbers.The use of quantitative-PCR is a sensitive and useful tool for detectingand quantifying mRNA that encodes for amino acid transporters.

25. Severe Trauma Results in a Sustained Increase of BoneMarrow Hematopoietic Progenitor Cells (HPC) to the Pe-ripheral Blood. Z. C. Sifri, M.D., L. Wang, M.S., A. M. Mohr,M.D., M. Tarlowe, M.D., C. J. Hauser, M.D., P. Rameshwar,Ph.D., and D. H. Livingston, M.D. New Jersey Medical School,Newark, New Jersey.

Bone marrow (BM) failure has been documented following severeinjury. HPC have been found in the peripheral blood (PB) early aftersurgical trauma in man and hemorrhagic shock in rats. We hypoth-esized that an ongoing loss of HPC from the BM into the circulationis a sustained process and may account for the persistent BM dys-function following severe injury. Twenty-three trauma patients withan ISS of 25 were serially examined. PB was collected at four timeperiods following injury: Period 1 (0–2 days), Period 2 (3–4 days),Period 3 (5–8 days), and Period 4 (9–21 days). Control samples wereobtained from age- and sex-matched volunteers. PB mononuclearcells were obtained by Ficoll separation and 2 106 cells werecultured for granulocyte–macrophage colony forming units (CFU-GM) and erythroid burst forming units (BFU-E) growth. CFU-GMand BFU-E colonies were enumerated after 10 to 14 days of incuba-tion, respectively. Simultaneous BM aspirates were performed (n �5) during Period 3 and 4 and cultured for CFU-GM and BFU-Egrowth. PB clonogenic assays showed significant increase inCFU-GM and BFU-E colonies during Periods 2, 3 and 4 compared tocontrols (see figure). In contrast, BM CFU-GM and BFU-E weredecreased 50% during Periods 3 and 4 compared to control. Traumaresults in an early and sustained increase in the number of circulat-ing HPC. While the fate of these HPC is unknown, it is unlikely thatthey hone back to the BM as the BM CFU-GM and BFU-E are

depressed during this time period. The ongoing and sustained loss ofthese BM cells to the periphery may be involved in the observedpersistent BM dysfunction following severe injury.

GASTROINTESTINAL/NUTRITIONALPARALLEL SESSION 1

26. Identification of Common Molecular Determinants ofPancreatic Fibrosis in Chronic Pancreatitis and Pancre-atic Adenocarcinoma. C. E. Binkley, M.D., L. Zhang, M.D.,C. D. Logsdon, Ph.D., and D. M. Simeone, M.D. University ofMichigan Medical Center, Ann Arbor, Michigan.

Purpose. To determine the genetic profile of desmoplastic ele-ments common to chronic pancreatitis (CP) and pancreatic adeno-carcinoma (PA) which could elucidate mechanisms of epithelial–stromal signaling, fibrosis formation, and possible molecular targets.Background. Histologically, CP and PA are marked by atrophy ofnormal pancreatic parenchyma and an exuberant fibrotic stroma,which contributes to the morbidity of patients with these diseases.We sought to characterize the genetic profile of stromal elementsshared by CP and PA, hypothesizing that these common stromalgenes could reveal insight into the molecular basis of pancreaticfibrosis. Methods. Affymetrix microarray analysis (6800 genes) ofmicrodissected human samples of CP (n � 5), PA (n � 10), normalpancreas (n � 5), and pancreatic cancer cells lines (n � 7) wasperformed. Common stromal gene expression shared by CP and PAwas identified by statistical analysis and validated by RT-PCR. Pro-tein localization was determined by immunocytochemistry. Results.To define common stromal gene expression, we identified the set ofgenes shared by CP and PA and expressed greater than twofold (P �0.01) when compared to normal pancreas. This revealed 319 genescommon to CP and PA. To eliminate genes expressed by pancreaticneoplastic epithelium, we compared this set of 319 genes to thoseexpressed greater than twofold in pancreatic cancer cell lines com-pared to normal pancreas. We identified 114 genes shared by CP andPA, which were not overexpressed in normal pancreas or pancreaticcancer cell lines. Two genes, thrombospondin 2 and cadherin 11, notpreviously associated with either CP or PA, were studied further.RT-PCR verified expression of these two genes selectively in CP andPA tissues, and immunocytochemistry confirmed their localizationwithin the stroma of both CP and PA tissue sections. Conclusion.CP and PA share expression of many genes involved in the commondesmoplastic response. Study of these genes may better elucidateepithelial–stromal signaling, mechanisms responsible for pancreaticfibrosis and the identification of potential therapeutic targets.


27. Activation of Nociceptive Neurons at T9 and T10 in Cer-ulein Pancreatitis. A. M. Lightner, M.D., A. Godinho Coelho,Ph.D., E. Kim, M.D., T. H. Jordan, B.S., S. Hoge, B.S., E. F.Grady, Ph.D., N. W. Bunnett, Ph.D., and K. S. Kirkwood, M.D.University of California at San Francisco, San Francisco, Cali-fornia.

Background. Mechanisms of pain transduction in acute pancre-atitis are poorly understood. Increased Fos protein expression in thespinal cord is a marker of activation of nociceptive neurons. Wehypothesized that cerulein pancreatitis leads to increased Fos ex-pression at T9 and T10, which receive input from the pancreas.Methods. Rats were injected with cerulein (100 �g/kg sc) or saline(NS) carrier. Endpoints at 6 h were serum amylase, pancreaticedema, and spinal cord Fos expression (number of immunoreactivenuclei/section dorsal gray matter). Fos antibody staining at T9–T10was compared to internal controls (T6, T12). An average of 23 spinalcord histologic sections were evaluated per rat. The t test was usedfor statistical analysis. Results are means � SEM. Results. Asexpected, cerulein induced edematous pancreatitis, with a 4-foldincrease in serum amylase (cer (n � 6) 7000 � 1000 vs. NS (n � 4)1700 � 400 U/mL, P � 0.005) and a 2-fold increase in pancreaticedema (cer (n � 6) 6.9 � 0.7 vs. NS (n � 4) 3.8 � 0.5 mg pancreas/gbody wt, P � 0.05). Cerulein induced a 1.5-fold increase in Fosexpression at T9 and a 2-fold increase at T10 (see figure; n � 4 (cer)and n � 3 (NS); *P � 0.005; **P�0.05). The effects of cerulein on Fos

expression were greatest at T9/T10 with relative sparing of T6/T12.T6/T12 expression was similar in experimental and control groups.Conclusions. Cerulein-induced acute pancreatitis leads to elevatedFos expression in the rat spinal cord. Visceral nociceptive signalingwas detected at levels T9 and T10. Fos immunohistochemistry is auseful tool for studying the pathophysiology of pain in experimentalacute pancreatitis.

28. Bile Salt Exposure Causes MAPK-Mediated Proliferation inBarrett’s Esophagus. G. A. Sarosi, M.D., E. S. Herdon, M.D.,F. E. Nwariaku, M.D., T. Anthony, M.D., and R. F. Souza, M.D.University of Texas Southwestern Medical School, Dallas, Texas.

Background. The cellular mechanisms by which gastroesopha-geal reflux (GERD) may promote malignant progression in Barrett’sesophagus (BE) are poorly understood. Patients with BE have morebile reflux than patients with uncomplicated GERD. Mitogen-

activated protein kinases (MAPK) are a family of related molecules(ERK, p38, JNK) that transduce proliferative and apoptotic signalsto the cell nucleus. We hypothesized that bile salt exposure is amitogenic signal, activating proproliferative MAPK signaling cas-cades in BE. Methods. The Barrett’s adenocarcinoma cell lineSEG-1 was used as a model of BE. Proliferation was measured byCoulter cell counting. MAPK activity was measured using an immu-noblotting assay. Statistical significance was determined by ANOVA.Results. Following a 20-min exposure to the unconjugated bile saltgylcochenodeoxycholic acid (GCDA), dose-dependent increases in cellnumber at 24 h were noted (see table). Twenty-minute exposure to

200 �M GCDA produced an increase (179% control) in p38 activitywithin 5 min of GCDA exposure. Erk activity increased (151%control) in a delayed fashion, 30 min after GCDA exposure. Noincrease in JNK activity was noted. Treatment of SEG-1 cells withthe specific Erk pathway inhibitor U0126 (10 �M) completelyblocked GCDA induced proliferation. Treatment with SB203580 (5�M), a specific p38 inhibitor, produced a 54% inhibition of GCDAinduced proliferation. Conclusions. Bile salts at physiologicallyrelevant concentrations induce proliferation in a Barrett’s-derivedesophageal adenocarcinoma cell line in a MAPK-dependent fash-ion. These findings may suggest a molecular mechanism by whichduodenogastric reflux could contribute to malignant progressionin BE.

29. Ablation of Kupffer Cells Prior to Trauma and SepsisAttenuates COX-2 Protein Expression. S. A. Keller, M.S.,J. H. Ashburn, M.S., K. Korneszczuk, B.S., S. Lee, Ph.D.,M. G. Clemens, Ph.D., and T. Huynh, M.D. Carolinas Health-Care System (Carolinas Medical Center), Charlotte, NorthCarolina.

Purpose. To determine the role of Kupffer cells in the expressionof cyclooxygenase-2 (COX-2) following trauma and sepsis (induced byfemur fracture (ffx) and cecal ligation and puncture (CLP)). Back-ground. Prostaglandins synthesized by cyclooxygenase are earlymediators released following severe injury and play an importantrole in the pathophysiology of trauma. However, severe injury oftenresults in immunosuppresion resulting from maladaptive changes inmacrophages. We hypothesize that the inducible isoform of COX,COX-2, is increased following sequential stress and is responsible, atleast in part, for the Kupffer-cell-mediated mortality observed fol-lowing sequential stress. Methods. Male Sprague–Dawley rats un-derwent closed ffx followed 48 h later by CLP (control group under-went sham operations). To ablate Kupffer cells, animals were treatedwith gadolinium chloride (GdCl3) 24 h prior to the first surgery.Twenty-four hours later liver samples were obtained and homoge-nized, and protein expression was determined by Western blot. One-way analysis of variance (ANOVA) followed by Student-Newman-Keuls test was used to determine the significance of the differencesbetween groups. Results were considered significant for P � 0.05.Results. Neither ffx nor CLP alone resulted in a change in COX-2protein expression when compared to sham; however, COX-2 proteinexpression increased significantly in sequential stress animals whencompared to sham. Furthermore, this increase in COX-2 in sequen-

TABLE—ABSTRACT 28

[GCDA] �M 0 50 200Cell number (% control) 100 � 2.1 113 � 2.4* 135 � 4.3*,**

* P � 0.01 vs control.** P � 0.01 vs 50 �M GDCA.


tial stress was prevented by pretreatment with GdCl3 (see figure).Conclusions. COX-2 levels are significantly increased duringtrauma and sepsis. The observed increase is a Kupffer cell response,and may contribute to mortality following sequential stress.

30. Gallbladder Motility in Leptin-Resistant and Agouti-Yellow Mice. K. Q. Tran, M.D., D. Swartz-Basile, Ph.D., A.Nakeeb, M.D., and H. A. Pitt, M.D. Medical College of Wisconsin,Milwaukee, Wisconsin.

Purpose. To determine the gallbladder motility in obese micewith leptin resistance and with intact leptin function. Background.Obesity is a polygenic disorder which is associated with gallstonedisease. We have previously shown that leptin deficiency in obesemice correlates with decreased gallbladder motility, suggesting thatleptin plays a role in the link between gallstone disease and obesity.However, most obese humans are leptin-resistant and relatively feware leptin-deficient. To confirm that leptin dysfunction is responsiblefor impaired gallbladder motility in obese mice, we hypothesized thatleptin-resistant obese mice (Lepdb) would have abnormal gallbladdermotility while obese mice with intact leptin function (agouti yellow,Ay) would have normal gallbladder motility. Methods. Eighteenlean control mice (C57BL/6J), 12 Lepdb and 10 Ay were fasted over-night and weighed (g) and gallbladders were harvested. Gallbladdervolumes (GBV, �l) were measured, and contractile responses (N/cm2)to acetylcholine (ACh, 10�5 M), neuropeptide Y (NPY, 10�8, 10�7, 10�6

M), and cholecystokinin (CCK, 10�10, 10�9, 10�8, 10�7 M) were deter-mined. Results were analyzed with the Mann-Whitney rank sumtest. Results. The results are presented in the table. Conclusions.

These data suggest that (1) leptin-resistant obese mice (Lepdb) haveabnormal gallbladder motility and (2) obese mice with normal leptinmetabolism (Ay) have normal gallbladder response to neurotransmit-ters. We conclude that leptin represents a link between obesity,gallbladder motility, and gallstone formation.

31. Raf-1 Induced Changes in Carcinoid Cells Are Dependentupon MEK but Not MAPK. R. S. Sippel, M.D., J. E. Carpenter,B.S., M. Kunnimalaiyaan, Ph.D., and H. Chen, M.D. Depart-ment of Surgery, University of Wisconsin, Madison, Wisconsin.

Introduction. Activation of raf-1 in gastrointestinal carcinoidtumor (BON) cells results in a dramatic decrease in serotonin pro-duction as well as striking morphologic changes. Raf-1 is believed tomediate these effects by sequential activation of MEK and MAP

kinases through the classic raf-1/MEK/MAPK pathway. Methods.To determine if MEK activation is required for these raf-1-mediatedchanges, BON cells were transduced with an estrogen inducible raf-1construct (creating BON-raf cells). BON or BON-raf cells were pre-treated with the MEK inhibitors, PD98059/UO126, for 45 min andthen were treated either with control (C) or with 1 �M estradiol (E2).After 48 h, the cells were analyzed for morphologic changes, seroto-nin production, and MAPK activation. Results. Activation of raf-1by E2 in BON-raf cells led to morphologic changes, a reduction inserotonin production by ELISA, and activation of MAPK by Westernblot analysis. These changes were not seen in the control cells.Inhibition of MEK by PD98059 and/or UO126 blocked the raf-1-induced changes in morphology and hormone production in BON-rafcells. Despite MEK inhibition, activation of raf-1 in BON-raf cellsstill resulted in MAP kinase activation (see table). Conclusions.

Raf-1 activation in BON cells results in morphologic changes, adecrease in serotonin production, and MAP kinase activation. Im-portantly, raf-1-mediated morphologic and hormonal changes aredependent upon downstream activation of MEK but not MAP kinase,suggesting an alternative MEK-independent pathway for raf-1 sig-naling.

32. Tissue-Engineered Stomach from Autologous and Synge-neic Tissue. T. C. Grikscheit, M.D., and J. P. Vacanti, M.D.MGH, Boston, Massachusetts.

Summary. Microgastria and postgastrectomy morbidities aresubstantial. We hypothesized a functional living tissue-engineeredstomach could function as a replacement alternative as well as serveas a new model for the study of various gastric pathologies. Meth-ods. Stomach organoid units, mesenchymal cores surrounded byepithelia, were isolated from neonatal and adult rats and paratopi-cally transplanted on biodegradable polymer tubes, which were im-planted in syngeneic hosts, varying the inclusion of stomach regions.Four weeks later, tissue-engineered stomach (TES) was either har-vested or anastomosed. GFP labeling was performed prior to implan-tation. Histology and immunohistochemical detection of the antigensgastrin and �-actin smooth muscle was performed. Results. A totalof 98% of all animals generated TES without regard to tissue source,including TES formation from adult tissue. Immunohistochemicalstaining for �-actin smooth muscle and gastrin confirms the presenceof a smooth muscle layer and a well-developed gastric epitheliumcontaining all the elements of the native rat stomach includinggastric pits and squamous layers, varying by included regions atharvest. Gastrin is produced in the appropriate location (see figure).TES architecture was maintained in anastomosis. Architecture couldbe controlled by varying the specificity of harvest site. GFP-labeledTES maintained signal in anastomosis, proving the donor origin ofthe TES. Conclusions. TES resembles native stomach and is madefrom autologous or syngeneic tissue. It maintains robust histology in

TABLE—ABSTRACT 31

Inhibitor: NoneUO126(10 �M)

PD98059(50 �M)

Cells: BON BON-raf BON-raf BON-raf

Treatment C E2 C E2 C E2 C E2Morphologic

changes0 0 0 �� 0 0 0 0

Serotoninproduction (%)

100 105 100 47 100 104 100 98

MAPK activation 0 0 0 �� 0 �� 0 ��

TABLE—ABSTRACT 30

Group Body wt GBV 10�5 ACh 10�6 NPY 10�8 CCK

Lean 17 � 0.4 8 � 1 0.9 � 0.1 0.4 � 0.04 1.9 � 0.1Lepdb 44 � 1.1* 25 � 4* 0.3 � 0.1* 0.1 � 0.03* 0.8 � 0.2*Ay 21 � 0.4† 13 � 1† 0.9 � 0.1 0.4 � 0.05 1.9 � 0.1

* P � 0.001 vs lean control and Ay.† P � 0.003 vs lean control.


anastomosis. This represents a novel therapy as well as a novelmodel in which the cell populations could be manipulated. Fig. 1:TES, arrow marks gastrin � cell.

33. Reversal of Ileal Segment Proximal to an Ileal Pouch-Anal Anastomosis Improves Bowel Function in a SwineModel of Proctocolectomy. J. Migaly, M.D., J. I. Lieberman,M.P.T., R. Milner, B.S., C. Fisher, B.A., L. Knight, Ph.D., andR. H. Rolandelli, M.D. Temple University Health Sciences Cen-ter, Philadelphia, Pennsylvania.

Purpose. Proctocolectomy and ileal pouch-anal anastomosis (IPAA)have become the operations of choice for patients at risk for colorectalcancer. While patients prefer IPAA over a permanent ileostomy, bowelfrequency is, at best, six loose stools per day with dietary limitations.The aim of this study is to add a reversed ileal segment to the IPAA andthereby improve bowel function. Methods. Nine female Yorkshire pig-lets (20–30 kg) were randomized to receive either a proctocolectomywith IPAA (n � 4) or a proctocolectomy/IPAA with reversal of a 10-cmileal segment 10-cm proximal to the top of the ileal pouch (REV, n � 5).The pigs were then studied during an 8-week period following surgery.Weekly weights, pre-/postoperative albumin, fecal bacteriology, gastricemptying of a technetium labeled meal, mouth-to-anus transit time(min) of a charcoal labeled meal, and bowel movements per 12 h were

analyzed postoperatively for differences between groups. Results.There were no differences in weight, albumin, or fecal bacteriologybetween the groups. The REV group demonstrated slower gastric emp-tying (P � 0.05) in comparison to the IPAA cohort (see figure). Addi-tionally, REV transit times were significantly decreased with fewerresultant bowel movements (table, means � SD). Conclusion. Thereversal of an ileal segment in an omnivore mammal that closely re-sembles human gastrointestinal physiology results in improved bowelfunction. This simple operation has the potential to significantly im-prove quality of life for patients with IPAA who experience high stoolfrequency despite severe dietary restrictions.

ONCOLOGY PARALLEL SESSION 134. Viral Transduction of the Receptor-Type Protein Tyrosine

Phosphatase � (rPTP�) Inhibits both Proliferation and TumorFormation of Human Pancreatic Cancer Cell Lines. S. Yen-damuri, M.D., F. Trapasso, M.D., Ph.D., K. R. Dumon, M.D., N. N.Williams, M.D., C. M. Croce, M.D., and A. Fusco, M.D. Hospital of theUniversity of Pennsylvania, Philadelphia, Pennsylvania.

Introduction. We evaluated the effect of viral-mediated overexpres-sion of rPTP, a putative tumor suppressor gene, on the in vitro and invivo growth of pancreatic tumor cell lines deficient in the human ho-mologue DEP1/HPTP. Methods. Nine human pancreatic cancer celllines were analyzed for DEP1/HPTP expression by RT-PCR andNorthern blot. Tumor cell lines showing down-regulation of this genewere transduced with adenoviruses with rPTP and evaluated for in-duction of apoptosis by growth curves, FACS, and TUNEL assay. Tu-morigenicity was evaluated by colony formation assay and in vivotumorigenicity in nude mice. Tumors generated by subcutaneous injec-tion of cells in nude mice were injected with AAV-rPTP and theirtumor growth followed. Ad-GFP and AAV-GFP were used as controlswhere appropriate. The infected cells were evaluated for increasedexpression of proteins involved in apoptosis by Western blot. Results.Of the nine cell lines, four demonstrated reduced expression of DEP1/HPTP (BxPc3, Aspc1, PSN1, and Panc1). Aspc1 and Psn1 transducedwith Ad-rPTP demonstrated reduced ability to grow (by growthcurves) and increased apoptosis by FACS (sub G1) and TUNEL assay.Transduced cells formed significantly fewer colonies and showed mark-edly reduced or no tumorigenicity in vivo. Subcutaneous tumors in-jected by AAV-rPTP showed significantly reduced growth compared totheir normal controls and AAV-GFP-injected tumors. Transduced cellsshowed an increased expression of p-27 and Bax proteins compared touninfected cells (see table). Conclusion. Viral-mediated rPTP over-expression in DEP1/HPTP-deficient human pancreatic tumor celllines reduces their ability to grow in vitro and their tumorigenicity invivo by induction of p-27- and Bax-mediated apoptosis. This may pro-vide a therapeutic alternative to pancreatic cancer in the future.

TABLE—ABSTRACT 33

IPAA REV P value

Transit (min) 190 � 29 267 � 62 0.008BM (q12 h) 5.2 � 2.1 3.6 � 1.1 0.06

TABLE—ABSTRACT 34

Apoptosis assay Psn1Psn1 �

AdrPTP Aspc1Aspc1 �AdrPTP

FACS (% in SubG1 phase) 2.2 19.3 2.2 38.9TUNEL (% of apoptosis) 0.3 11.8 2.5 19.2


35. p21Cip1 Gene Transfer Potentiates Gemcitabine Efficacyagainst Pancreatic Cancer. J. J. Canete, M.D., M.P.H., N. M.Chandler, M.D., and M. P. Callery, M.D. Department of Surgery,University of Massachusetts, Worcester, Massachusetts; andDepartment of Surgery, Beth Israel Deaconess Medical Center,Boston, Massachusetts.

By binding cyclin-dependent kinases, p21Cip1 retards cell-cycle pro-gression. Inadequate p21Cip1 activity may contribute to cell-cycledysregulation and aggressive growth of pancreatic cancer. We exam-ined whether p21Cip1 gene transfer potentiates the efficacy of chemo-therapy by assuring adequate levels of this cell cycle regulator.Methods. Quiescent moderately differentiated BxPC-3 pancreaticcancer cells were transfected with either p21Cip1 cDNA [(�) p21-V],empty vector plasmid DNA [(�) p21-V], or no plasmid [(�) p21]. Cellswere then stimulated to proliferate (10% FCS) together with increas-ing levels of gemcitabine (0 to 100 �M). Accumulation of p21Cip1 wasconfirmed by Western blot, and cell proliferation was determined byMTT assay. Proliferation indices were analyzed by ANOVA andTukey’s HSD where appropriate. Results. Accumulation of p21Cip1

was noted as early as 24 h after transfection compared to controls.Within 72 h, cell proliferation was decreased 18% in p21-transfectedcells exposed to moderate levels of gemcitabine (50 �M) (P � 0.004).By 96 h, however, greater decreases in cell proliferation (27%) wereobserved at even lower levels of gemcitabine (10 �M) in p21-transfected cells (P � 0.001) (see figure). Conclusions. p21Cip1 gene

transfer enhances gemcitabine efficacy against proliferating pancre-atic cancer cells. This suggests that proper cell-cycle regulation isnecessary to overcome chemoresistance in human pancreatic cancer.

36. Antitumor Protection with Dendritic-Cell-Based Vaccina-tion Is Dependent on the Presence of Interferon-� andInterleukin-12. J. S. Hiramoto, M.D., G. J. Chang, M.D., K.Tsung, Ph.D., J. A. Norton, M.D., and R. Hirose, M.D. Universityof California at San Francisco, San Francisco, California.

Purpose. To determine whether bone marrow (BM)-derived den-dritic cells (DCs) pulsed with a tumor cell lysate can effectivelyvaccinate against a subsequent challenge of tumor cells and to es-tablish which cytokines are necessary for this response. Methods.The MCA207 fibrosarcoma murine tumor cell line was used in allexperiments. BM cells from C57BL/6 mice were cultured in mediasupplemented with GM-CSF for 7 days and then pulsed withMCA207 lysate for 18 h. Each wild-type mouse received two subcu-taneous immunizations (days –14 and –7) with saline, tumor lysate,106 DCs, or 106 DCs pulsed with tumor lysate. Interferon-� (IFN-�)knockout (KO) and interleukin-12 (IL-12) KO mice were also recip-ients of pulsed DCs, and DCs from IL-12 KO mice were also used inimmunizations. A tumor challenge of 2 105 MCA207 cells wasgiven on the opposite flank at day 0. Splenocytes were harvested andELISA assays for IFN-� were performed. The proportion of tumortake was compared by the Fisher’s exact test. Results. All saline-injected mice (n � 19) and all mice injected with tumor lysate alone(n � 9) developed tumors following a challenge of MCA207 tumorcells. Six of 9 mice immunized with DCs alone and 6 of 24 mice

treated with lysate-pulsed DCs developed a tumor following chal-lenge. The proportion of mice immunized with DCs pulsed withMCA207 lysate that developed tumor on challenge was significantlyless than either of the groups treated with saline (P � 0.0001) orlysate alone (P � 0.0001). Splenocytes from both the saline- and thelysate-immunized groups produced undetectable levels of IFN-�,while those from mice immunized with either DCs alone or DCspulsed with lysate produced high levels of IFN-�. Four of 5 IFN-� KOmice developed tumor after immunization with tumor lysate-pulsedDCs. None of 4 IL-12 KO mice developed tumor after immunizationwith wild-type pulsed DCs and 1/10 wild-type mice developed tumorafter immunization with IL-12 KO pulsed DCs. Three of 4 IL-12 KOmice developed tumor after immunization with IL-12 KO pulsedDCs. Conclusions. BM-derived DCs pulsed with tumor lysate caninitiate an effective antitumor immune response. The presence ofIFN-� in the host is essential for antitumor protection. In contrast,tumor protection is observed if IL-12 is present either in the host orin the DCs.

37. A Novel Mechanism of Repression of TGF-� Signaling inHuman Colon Cancers. Y. Cao, M.D., Y. Liu, Ph.D., F. Z. Li,M.D., D. Song, Ph.D., M. R. Hellmich, Ph.D., W. J. Mileski, M.D.,C. M. Townsend Jr., M.D., and T. C. Ko, M.D. University ofTexas Medical Branch, Galveston, Texas.

Purpose. Many human colon cancer cells are either partially orcompletely resistant to the antiproliferative effects of transforminggrowth factor-� (TGF-�), suggesting that inactivation of TGF-� sig-naling pathway plays an important role in colon carcinogenesis.Recently, Evi-1 (ecotropic virus integration-1), an oncoprotein inleukemia, has been found to repress TGF-� signaling. We hypothe-size that Evi-1 is expressed in human colon cancers and that Evi-1represses TGF-� signaling in colon cancer cells. The purposes of thisstudy are (1) to determine whether Evi-1 is expressed in humancolon cancers and (2) whether Evi-1 represses TGF-� signaling inhuman colon cancer cells. Methods. Twenty-seven human coloncancer tissue samples were obtained from surgical specimen usingan IRB-approved protocol. Total RNA was prepared and analyzed forEvi-1 mRNA level by quantitative real-time PCR. TGF-� signalingwas analyzed by the standard luciferase reporter assay (3TP-Luc).Evi-1 expression plasmid (0.025, 0.1, 0.5, or 1 �g) was transientlytransfected into a colon cancer cell line (MC-26) together with 3TP-Luc plasmid (0.4 �g). Sixteen hours after transfection, the cells weretreated with TGF-� (1 ng/ml) for 12 h and analyzed for luciferaseactivity. Results. Evi-1 mRNA was detected in all human coloncancer samples collected (27/27) by quantitative real-time PCR.Evi-1 inhibited TGF-�-induced luciferase activity in a dose-dependent fashion. The different doses of Evi-1 used (0.025, 0.1, 0.5,or 1 �g) inhibited 3TP-luciferase activity by 21.7% (NS), 69.9% (P �0.01), 88.9% (P � 0.001), and 97.8% (P � 0.001), respectively, com-pared with control group. Conclusions. Evi-1 is expressed in humancolon cancers and represses TGF-� signaling in human colon cancercells. These results suggest that Evi-1 expression contributes to thedevelopment of resistance to TGF-� acquired during colon carcino-genesis.

38. Thrombospondin-1 (TSP-1) Upregulates Tumor Cell Inva-sion through the Urokinase Plasminogen Activator Re-ceptor (uPAR) in Head and Neck Cancer Cells. D. Albo,M.D., Ph.D., and G. P. Tuszynski, Ph.D. Department of Surgery,Section of Surgical Oncology, Medical College of Georgia, Au-gusta, GA.

Purpose. To determine the role of TSP-1 in the regulation ofuPAR and tumor cell invasion in head and neck cancer cells. Back-ground. We have shown that TSP-1 upregulates uPAR, a key reg-ulator of plasmin activity in tumor metastasis, in pancreatic cancer.We have also shown that TSP-1 is expressed in head and neck


carcinomas and that high TSP-1 expression in these malignanciescorrelates with increased metastatic potential. Methods. KB headand neck carcinoma cells were used. The effect of TSP-1 on uPAR anduPA expression was determined by ELISA. The effect of TSP-1 on KBtumor cell invasion was investigated in a modified Boyden chambercollagen invasion assay. TSP-1-stimulated KB tumor cell invasionwas also determined in the presence of: (1) anti-uPA antibody (a-uPA); (2) anti-uPAR antibody (a-uPAR); (3) GPI-specific phospho-lipase C (PLC, an enzyme that cleaves uPAR off the cell surface); and(4) -aminocaproic acid (-ACA, a cell surface plasmin inhibitor).Statistical significance was determined by ANOVA and Student’s ttest. Results. TSP-1 upregulated KB cell uPAR expression twofoldand KB cell uPA expression fourfold (P � 0.001, Figs. 1 and 2). TSP-1upregulated KB cell invasion fourfold, and this effect was blockedwith anti-uPAR and anti-uPA antibodies, -ACA, and PLC (P � 0.01,Fig. 3). Conclusion. We conclude that TSP-1 upregulates KB tumorcell invasion through uPAR-mediated upregulation of plasmin activ-ity. Inhibition of tumor cell surface proteolytic activity inhibits TSP-1-mediated head and neck tumor cell invasion.

39. PPAR-� Stimulates Plasminogen Activator Inhibitor-1and Decreases Urokinase-Type Plasminogen ActivatorLevels in Human Pancreatic Cancer Cells. G. Eibl, M.D.,H. A. Reber, M.D., Y. Okada, M.D., Z. Liu, Ph.D., R. E. Law,Ph.D., J. P. Duffy, M.D., M. J. Delano, B.S., and O. J. Hines,M.D. David Geffen School of Medicine, UCLA, Los Angeles,California.

Introduction. We have demonstrated that the PPAR-� ligand15-deoxy-�12,14-prostaglandin J2 (15-PGJ2) reduces pancreatic cancer(PaCa) cell invasion. The plasminogen system, including the plas-minogen activator inhibitor-1 (PAI-1) and urokinase-type plasmino-gen activator (u-PA), governs tumor cell invasion. The aim of thisstudy was to determine if 15-PGJ2 modulates the expression ofPAI-1 and uPA in the PaCa cells and whether this action of 15-PGJ2is mediated by PPAR-�. Methods. MIA PaCa-2 cells were treatedwith incremental concentrations of 15-PGJ2, and the PAI-1 andu-PA levels in the supernatant were measured by ELISA. The effectof 15-PGJ2 on u-PA receptor (u-PAR) expression was determined byimmunoblotting. MIA PaCa-2 cells were infected with an adenoviruscontaining a dominant negative PPAR-� (LEA) and treated with15-PGJ2 and PAI-1, and u-PA levels in the cell culture medium wereagain measured by ELISA. Cells infected with lacZ served as con-trols. Results. Treatment with 15-PGJ2 for 24 h dose dependently

increased PAI-1 (see table) and decreased u-PA levels in the culturemedium. 15-PGJ2 had no effect on u-PAR protein expression. Infec-tion of MIA PaCa-2 cells with a dominant negative PPAR-� resultedin marked overexpression of PPAR-� as confirmed by immunoblot-ting. The dominant negative PPAR-� completely attenuated the ef-fect of 15-PGJ2 on PAI-1 (see table) and u-PA levels. Conclusion.15-PGJ2 dose dependently increased PAI-1 and decreased u-PA lev-els in PaCa cells, whereas no effect was seen in u-PAR expression.Using a dominant negative PPAR-�, we found that the effect of15-PGJ2 was mediated by PPAR-�. PPAR-� directly regulates theexpression of PAI-1 and u-PA, proteins critical for tumor cell inva-sion.

40. Control of SMAD Tumor Suppressors by Ubiquitin andUbiquitin-like Pathways. X. Lin, Ph.D., M. Liang, M.D.,Ph.D., Y. Liang, Ph.D., A. Gast, Ph.D., F. Brunicardi, M.D., F.Melchior, Ph.D., and X. Feng, Ph.D. Baylor College of Medicine,Houston, Texas.

Loss of TGF-� anticancer control is often considered as a majorstep in tumor progression. Transforming growth factor-� (TGF-�) isa secreted multifunctional protein that exhibits a diverse set ofcellular responses, including cell proliferation and differentiation.SMADs are tumor suppressors and serve as important intracellulareffectors in TGF-� signaling. Upon activation by TGF-�, receptor-phosphorylated SMADs (R-SMADs) form a complex with DPC4 andthe SMAD complex is then imported into the nucleus to control genetranscription. SMAD proteins are often inactivated in colorectal andpancreatic cancers. The objective of this study is to identify pathwaysthat control the proteolytic degradation of SMAD proteins. Meth-ods. Cytosol of human ovarian epithelial HeLa cells was incubatedwith anti-SMAD antibody to immunoprecipitate SMAD proteins.Modification of SMAD by ubiquitin or ubiquitin-like protein SUMOwere detected by western blotting of the immunoprecipitated SMADwith anti-ubiquitin or anti-SUMO antibody, respectively. Assess-ment of metabolic stability of free and modified SMAD was carriedout in pulse-chase experiment. Subcellular localization of SMAD wasdetected by anti-SMAD staining under immunofluorescence micro-scope. Gene silencing of Ubc9, an E2 enzyme for SMAD-SUMOconjugation, was performed using RNAi technology. Results. We forthe first time discovered that a SMAD protein was modified bySUMO-1. By molecular mutagenesis approach, we identified thesumoylation site on SMAD protein both in vivo and in vitro. SUMOmodification prevents SMAD from proteolytic degradation in thenucleus thus, activating TGF-� signaling. Most strikingly, a mutantof SMAD derived from cancer is defective in SUMO modification andundergoes faster degradation. Finally, gene silencing of Ubc9, theSUMO conjugation E2 enzyme, abrogates the TGF-� antiprolifera-tive action. Conclusion. We have identified the SUMO modificationon tumor suppressor SMAD proteins and provided the underlyingmechanism of how SUMO modification activates TGF-� antiprolif-erative signaling. Our study provides a conjectural advancement toour current understanding how the tumor suppressor functions ofSMAD proteins are controlled in normal and cancer cells.

FIG. 1. The effect of TSP-1 on KB cell uPA expression.FIG. 2. The effect of TSP-1 on KB cell uPAR expression.FIG. 3. The role of TSP-1 on KB tumor cell invasion. 1) Control.2) TSP-1. 3) TSP-1 � a-uPA. 4) TSP-1 � a-uPAR. 5) TSP-1 � PLC.6) TSP-1 � e-ACA.

TABLE—ABSTRACT 39

PAI-1(ng/�g protein)

15-PGJ2 (�M)

0 0.1 1.0 10

No virus 7.0 � 0.8 10.3 � 0.9 17.7 � 1.6* 25.5 � 3.1*LacZ 11.7 � 2.2 13.1 � 3.4 18.3 � 0.4* 26.2 � 0.4*LEA 14.5 � 0.2 16.0 � 0.3 16.5 � 1.1 14.3 � 0.4

* P � 0.05 vs 0 �M 15-PGJ2.


41. TGF-� Regulates NF-�B through a Smad-Dependent Path-way in Colon Cancer Cells. A. M. Grau, M.D., P. K. Datta,Ph.D., J. Zi, M.S., S. K. Halder, Ph.D., S. C. Stain, M.D., andR. D. Beauchamp, M.D. Meharry Medical College, VanderbiltUniversity, Nashville, Tennessee.

Background and purpose. Transforming growth factor-beta(TGF-�) acts through Smad-dependent and -independent pathwaysto produce tumor suppressing, as well as tumor promoting effects,respectively. Nuclear factor-�B (NF-�B) has been implicated in can-cer cell survival. TGF-� has been reported as a regulator of NF-�Bwith conflicting data in different cell systems. Our hypothesis is thatin colon cancer cell lines, TGF-� activates NF-�B in a Smad-dependent manner and involves phosphorylation of the inhibitoryprotein I�B-�. Methods. Colon cancer cell lines FET-1 and SW480were treated with and without TGF-�1 (5 ng/ml). NF-�B activationwas determined by electro mobility shift assay (EMSA) as well as bya kb-responsive luciferase reporter assay. I�B-� phosphorylationwas determined by Western analysis. For transient transfections,cells were treated 24 h after transfection with TGF-� for 24 h inserum-free medium. Results. TGF-� treatment of the TGF-�-responsive cell line FET-1, resulted in an early NF-�B activation andtranslocation into the nucleus. TGF-� activated NF-�B at 10 minwith levels decreasing to baseline at 4 h. A threefold activation of thekb-responsive reporter by TGF-� (P � 0.001 by Student’s t test) wasobserved. In an attempt to understand the mechanism of activationof NF-�B, we observed that this activation correlated with an in-crease in I�B-� phosphorylation by Western analysis that precededthe NF-�B activation. When these experiments were repeated for theSmad4-null cell line SW480, no activation of NF-�B was observed byreporter assay or EMSA, and no increase in I�B-� phosphorylationwas seen. Transient transfection of Smad4 into the SW480 cellsrestored the TGF-�-mediated kb reporter activation. To furtherstudy the role of Smads in NF-�B activation, FET-1 cells that hadbeen stably transfected with smad 7, an inhibitory smad, and emptyvector as control, were treated with TGF-�. TGF-� failed to activateNF-�B in the smad7-expressing FET-1 cells. Conclusion. Our re-sults demonstrate that in colon cancer cell lines TGF-� does result inan early phosphorylation of I�B-�, with resulting NF-�B transloca-tion into the nucleus. TGF-� activates NF-�B in colon cancer cells ina Smad-dependent manner.

RESIDENT AWARD SESSION

42. TPN Leads to Alteration in Hepatocyte Gene Expressionand Proliferation. Y. Tazuke, M.D., and D. H. Teitelbaum,M.D. University of Michigan, Ann Arbor, Michigan.

Purpose. To determine total parenteral nutrition (TPN)-relatedalternations in intrahepatic genes, especially as related to the cellcycle. Background. TPN is correlated with a progressive liver in-jury. It has been speculated that hepatocyte proliferation may bealtered with TPN. Because of this, we hypothesized that TPN ad-ministration may be associated with an alteration in cell prolifera-tion or growth. To address this, we analyzed gene expression usingan mRNA microarray, concentrating on the cell cycle. Methods.C57BL/6 male mice (8 weeks) underwent intravenous (iv) catheter-ization. Controls (n � 10) received saline and chow. TPN mice (n �10) received iv TPN. After 7 days the liver was isolated and mRNAwas extracted. Hepatocyte gene expression was examined with aUniversity-designed 5000 cDNA microarray chip. Data (mean � SD)were analyzed with unpaired t tests (*P � 0.05). Results. TPN wasassociated with genes surrounding the cyclin kinase at the Cdc25Blocation (responsible for transition to mitosis). To confirm the cellsignaling, the mRNA expression of mitotic phase inducers (Cdc25B1,Cdc2, cyclin B1) and inhibitors (Myt1, Wee1, Chk1, 14-3-3 protein)were examined by RT-PCR, compared to �-actin mRNA expression.Cdc25B1 increased with TPN (0.93 � 0.11 vs. 0.80 � 0.12). Other

significant results are shown in the table. To examine for a physio-logic correlate of these gene changes, the regeneration ratio was de-tected by liver wet weight, hepatocyte proliferation ratio by BrdU stain-ing, and apoptotic ratio by TUNEL staining. TPN resulted in bothdeclines in percentage of regeneration ratio (0.047 � 0.007* vs. 0.059 �0.010) and percentage of proliferation (1.68 � 0.38* vs. 4.51 � 1.68),as well as a rise in percentage of apoptosis (0.61 � 0.14* vs. 0.29 �0.36). Conclusions. Cell proliferation significantly decreased withTPN; this correlates with increases in the inhibitors of cyclin kinase.The observed overexpression of cyclin B1 without increased cdc2 hasbeen previously show to interrupt the cell cycle. Such changes maycontribute to TPN-induced hepatocyte injury or prevent repair.

43. The CCR4-NOT1 Transcriptional Complex Regulates theG1/S Checkpoint Response Following DNA Damage orBRCA1 Expression. T. J. Westmoreland, M.D., J. A. Olson, Jr.,M.D., Ph.D., W. Y. Saito, B.S., J. R. Marks, Ph.D., and C. B.Bennett, Ph.D. Department of Surgery, Duke University Medi-cal Center, Durham, North Carolina.

Purpose. The purpose of this research is to utilize the yeastSaccharomyces cerevisiae as a model system to identify potentialcancer gene targets that are sensitive to ionizing radiation (IR) whendefective and interact genetically with BRCA1. Methods. Using afunctional genomics approach, we have exposed an isogenic collec-tion of S. cerevisiae diploid strains individually deleted for 4746nonessential genes or ORFs to IR, doxorubicin, bleomycin, MM.S.,hydroxyurea, camptothecin, and/or UV. From genes identified in thisscreen, we focused on the CCR4-NOT1 transcriptional complex andtransformed strains deleted for each member with full-lengthBRCA1 on an inducible plasmid. Deleted members of this complexwere then followed through the cell cycle to visualize checkpointresponses to IR and BRCA1 expression. Finally, we performed epi-stasis analysis with RAD9 to determine where in the cell-cyclecheckpoint repair pathway the primary members of this complexplay a role. Results. We have identified 176 novel yeast gene dele-tions that are sensitive to IR of which 93% exhibit sensitivity to otherDNA-damaging agents, such as doxorubicin, bleomycin, MM.S., hy-droxyurea, camptothecin, and/or UV. Within these newly identifiedgenes, we have found that seven members of the highly conservedCCR4-NOT1 transcriptional complex are required for radiation re-sistance. Reduced viability following nitrogen starvation as well asradiation sensitivity among deleted members of this complex (CCR4and DHH1) appear to result from a defect in the G1 to S checkpointtransition. This G1 arrest following nitrogen starvation is partiallyrescued by DDX6 (the human ortholog to DHH1), which is a break-point oncogene in myeloid cancers. Moreover, the heterologous ex-pression of Brca1 in wild-type yeast results in prolonged G1 arrestand lethality, which were both suppressed by deletion of CCR4 orDHH1. Finally, by epistasis analysis, we have found that CCR4 andDHH1 appear downstream of RAD9, which performs a “sensor”function in the damage signaling pathway. Conclusions. Theseresults suggest that BRCA1 may promote genetic stability in humancells by interacting with orthologs of CCR4 and DHH1 and activatingG1/S checkpoint arrest following DNA damage.

44. Sphingosine 1-Phosphate Stimulates Smooth MuscleCell Migration through G�i- and PI3-Kinase-dependentp38MAPK Activation. A. J. Fegley, M.D., W. J. Tanski, M.D., E.

TABLE—ABSTRACT 42

Group Cyclin B1 Cdc2 14-3-3 Myt1

Control 0.77 � 0.19 0.36 � 0.16 0.91 � 0.23 0.68 � 0.08TPN 1.14 � 0.24* 0.27 � 0.06* 1.20 � 0.23* 1.03 � 0.20*


Roztocil, B.S., and M. G. Davies, M.D., Ph.D. University ofRochester/Strong Memorial Hospital, Rochester, New York.

Purpose. To determine the role of p38 MAP kinase (p38MAPK) insphingosine 1-phosphate (S-1-P)-induced smooth muscle cell(SMC) migration and the signaling pathways leading to p38MAPK

activation. Background. S-1-P is a bioactive sphingolipid re-leased from activated platelets that binds to G-protein-coupledEDG receptors, nd may play a role in the response of vascularSMCs to vessel injury. S-1-P has been shown to stimulate migra-tion of SMCs in vitro. p38MAPK activation can modulate cytoskel-etal reorganization and enhance migration of SMCs. We hypoth-esized that migration stimulated by S-1-P involves p38MAPK.Methods. Rat arterial SMCs were cultured in vitro. Linear woundassays of migration were performed in the presence of S-1-P (30�M) with and without SB203580 (SB, an inhibitor of activatedp38MAPK, 10 �M). Western blotting was performed for p38MAPK afterstimulation with S-1-P (100 �M), with and without inhibitors ofG�i (pertussis toxin, PTx, 100 ng/ml), ras (manumycin A, MA;10�M), PI3-kinase (wortmannin, Wn; 10�M), the EGF receptor(AG1478, 100 nM/L), and p38MAPK (SB, 10 �M). Statistics wereanalyzed by one-way ANOVA. Results. S-1-P stimulated migra-tion of SMCs in the wound assay (2-fold over control; P � 0.01)that was concentration-dependent. This response was inhibited bySB to the level of control (P � 0.01 vs. S-1-P alone). S-1-P stimu-lated a 1.8-fold increase in phosphorylated p38MAPK that peaked at5–10 min (P � 0.01 vs. control). Activation of p38MAPK was signif-icantly inhibited by PTx (100% reduction, P � 0.01), SB (80%reduction, P � 0.01), and Wn (88% reduction, P � 0.01), but not byMA or AG (P � 0.05 for both). Conclusions. SMC migrationstimulated by S-1-P is dependent on p38MAPK activation, whichappears to be mediated by G�i and PI3-kinase. Activation ofp38MAPK stimulated by S-1-P did not signal through ras or trans-activation of the EGF receptor, suggesting that the G�� G-proteinsubunit is not involved. Understanding differential activation ofcellular kinases may allow targeted molecular interventions treatthe vessel response to injury.

CARDIOTHORACIC PARALLEL SESSION

45. Met Proto-Oncogene Is Overexpressed in Esophageal Ad-enocarcinoma. L. J. Herrera, M.D., T. El-Hefnawy, M.D.,Ph.D., S. Raja, B.S., S. D. Finkelstein, M.D., J. D. Luketich,M.D., T. E. Godfrey, Ph.D., and S. J. Hughes, M.D. Departmentof Surgery, University of Pittsburgh, Pittsburgh, Pennsylvania.

Purpose. To investigate whether Met proto-oncogene expressionis altered in esophageal adenocarcinoma. Background. The hyper-activation of Met (hepatocyte growth factor receptor) signaling inseveral malignancies results in increased cell proliferation, invasion,and inhibition of apoptosis. Its role in esophageal adenocarcinoma(EA) remains unknown. We hypothesized that alterations in theHGF/Met signaling play a role in the aggressive nature of EA.Methods. We examined 24 specimens of EA with matching normalesophageal mucosa using anti-Met immunohistochemistry (IHC).Two independent pathologists graded IHC using a standard score.We also examined three EA cell lines for the expression of MetmRNA using quantitative RT-PCR and protein analysis by anti-Metimmunoblots. Results. IHC of tissue samples demonstrated highMet expression in EA cell membranes and cytoplasm (figure a, ar-row) versus minimal staining in normal esophageal epithelium (fig-ure a, arrowhead). All three EA cell lines demonstrated high levels ofMet mRNA by RT-PCR and of its proteins (140- and 170-kDa Metprecursor) as shown by immunoblots (figure b). Het-1A (squamousepithelial cell line) did not show detectable levels of Met. Conclu-sions. We demonstrate that Met proto-oncogene is overexpressed in

EA. Hyperactivation of Met signaling cascade may contribute to theaggressive phenotype of EA. Further experiments are warranted toelucidate the role of Met pathway in EA and its potential as atherapeutic target.

46. Endothelin A and B Receptors Synergistically Mediatethe Endothelin-1-Induced Cytosolic Calcium Increase inFetal Distal Pulmonary Artery Smooth Muscle Cells. C.Linden, M.D., T. J. OConnor, B.S., E. R. Resnik, Ph.D., R. Fu,B.S., and D. N. Cornfield, M.D. Department of Surgery, Univer-sity of Minnesota, Minneapolis, Minnesota.

Introduction. Perinatal pulmonary vasoreactivity remains in-completely understood. Endothelin-1 (ET-1) receptor antagonistshave variable, and dichotomous, effects on fetal pulmonary vasculartone in vivo. Developmental regulation of the ET receptor signalingpathway may underlie postnatal adaptation of the pulmonary circu-lation. We hypothesized that pulmonary artery (PA) smooth musclecell (SMC) sensitivity to ET-1 is mediated by both the endothelin Aand endothelin B (ETA and ETB) receptor signaling pathways.Methods. To test this hypothesis, PA SMC were isolated from lategestation fetal lamb distal PAs and placed in primary culture. Usingmicrofluorometry, PA SMC cytosolic calcium ([Ca2�]i) was deter-mined. PA SMC were treated with ET-1(10�8 M) in the presence ofETA blockade with 1 �M BQ-123 or ETB blockade with 1 �M BQ-788. PA SMC ETA and ETB receptor mRNA expression was deter-mined using internally controlled quantitative RT-PCR. Results.Both ETA and ETB receptor antagonism inhibits the ET-1 inducedincrease in [Ca2�]i (see table). PA SMC express both ETA and ETBreceptor mRNA, although ETB expression is 50% of ETA. Conclu-sions. Contrary to our hypothesis, ET-1 induces an increase in PASMC [Ca2�]i through activation of both ETA and ETB receptors. Wespeculate that coordinated regulation of ETA and ETB receptorsignaling pathways modulates pulmonary vascular tone.

47. Differential Effects of Opioid Proteins on MyocardialIschemic Tolerance. M. A. Romano, M.D., V. Badhwar, M.D.,E. M. Seymour, M.S., J. R. Traynor, Ph.D., S. Gupta, B.A., N.Gupta, B.S., R. J. Brooks, B.S., and S. F. Bolling, M.D. Univer-sity of Michigan, Ann Arbor, Michigan.

Purpose. Opioid proteins, which can induce mammalian hiberna-tion, may provide protection against subcellular and molecular

TABLE—ABSTRACT 46

GroupNo. of

animalsNo. ofcells

Increase in [Ca2�]i frombaseline � SEM (nM)

Control 4 25 1189 � 297*BQ-123 2 58 40 � 30*,†BQ-788 2 35 15 � 4*,†

* P � 0.05 vs baseline.† P � 0.05 vs control.


changes during hypothermic myocardial ischemia. This study exam-ined the differential effects of the three known myocyte opioid recep-tors, Mu (�), Delta (�), and Kappa (�), in augmenting myocardialischemic tolerance. Methods. Controls (CH) were compared tohearts pretreated with the pure � agonist fentanyl, the � agonistDADLE, � antagonist NTB, the � agonist U50488H (U50), or the �antagonist nor-BNI. The return of isovolemic developed pressure(LVDP), myocardial oxygen consumption (MVO2), and coronary flow(CF) following 2 h of global hypothermic cardioplegic ischemia wererecorded in isolated Langendorff perfused hearts. Histologicalchanges were also examined. Results. Functional parameters areshown below at 45 min of reperfusion (see table). � and � opioid

agonist hearts demonstrated improved ultrastructural histology versuscontrols. Conclusions. This study demonstrates that the � receptordoes not appear to confer a beneficial effect. However, selective � and �agonists provide significant myocardial protection. Moreover, heartspretreated with a � or � antagonist showed a marked decrement in bothfunctional and metabolic integrity. These results taken together wouldimply a positive and negative constitutive role of � and � opioids in theregulation of myocardial ischemic tolerance. This utilization of opioidreceptor stimulation may have profound clinical applications.

48. Warm Ischemia Lung Protection with Diazoxide, a Mito-chondrial Specific ATP-Regulated Potassium ChannelOpener. D. G. Tang, M.D., A. Vaida, M.D., R. M. Wise, M.S.,R. S. Higgins, M.D., and N. M. Cohen, M.D., Ph.D. MedicalCollege of Virginia Hospitals/Virginia Commonwealth Univer-sity, Richmond, Virginia.

Purpose. To assess the warm ischemia lung-protective effects ofdiazoxide. Background. We have previously demonstrated thatmembrane hyperpolarization with ATP-regulated potassium chan-nel openers (PCOs) are effective in protecting lungs from ischemicinjury. We have also found that the protective effects of PCOs areindependent of the sarcolemmal potassium gradient, suggesting thatthe protective site of action is intracellular. The purpose of this studyis to assess lung protection with diazoxide, a PCO specific for mito-chondrial channels. Methods. An isolated, recirculating, blood-perfused, ventilated lung model was used to study lung protectionwith diazoxide in 15 rabbits. No-ischemia control lungs underwentimmediate reperfusion for 2 h after harvest. Warm ischemia controllungs were flushed with lactated Ringers (LR), stored at 36°C for2.5 h, and then reperfused. Protected lungs were flushed with LR �100 �M diazoxide, likewise stored for 2.5 h, and reperfused. Every 30min during reperfusion, graft function was assessed with a 10-min100% FiO2 challenge to measure maximal gas exchange. Results. Amixed-models repeated-measures ANOVA demonstrated a signifi-cant difference between groups (F(3,32) � 20.0, P � 0.0001; seefigure). Tukey’s HSD multiple comparison test for intergroup com-parisons demonstrated significantly improved graft function withdiazoxide compared to the warm ischemia controls. Further, therewas no significant difference in graft function between diazoxide

protected lungs and the no ischemia controls. Conclusions. Diazox-ide is able to provide marked pulmonary protection against warmischemia reperfusion injury. This suggests that the active site ofischemic protection by PCOs is localized to the mitochondrial channels.

49. Activation of Pulmonary Mitogen-Activated Protein Ki-nases during Cardiopulmonary Bypass. T. A. Khan, M.D.,C. Bianchi, M.D., Ph.D., R. Faro, Ph.D., M. Ruel, M.D., and F. W.Sellke, M.D. Beth Israel Deaconess Medical Center, Boston,Massachusetts.

Purpose. Cardiopulmonary bypass (CPB) produces an inflammatoryresponse associated with organ dysfunction that includes the pulmo-nary system. Mitogen-activated protein kinases (MAPK) have beenshown to mediate pulmonary injury and dysfunction. We assessed thehypothesis that MAPK activation contributes to lung injury duringCPB. Methods. Pigs were placed on CPB (n � 5) for 90 min followed by180 min of reperfusion. Control animals (n � 5) underwent sternotomy,heparinization, and cannulation only. Lung samples were collected atbaseline (0 min), post-CPB (90 min), and following reperfusion (180min). Activated forms of MAPK, ERK1/2 and p38, were measured byWestern blot. Pulmonary edema was estimated by measuring tissuewater percentage. The presence of pulmonary inflammation was deter-mined by histology. Immunohistochemistry was used for tissue local-ization of activated MAPK. Values are shown as means � SEM. Sta-tistical analysis was performed using a two-tailed t test with statisticalsignificance accepted at P � 0.05. Results. Levels of activated ERK1/2and p38 were increased after CPB compared to baseline levels (5.9 �1.7- and 2.8 � 0.6-fold, respectively; both P � 0.05). Following reperfu-sion, ERK1/2 activity was increased by 10-fold compared to baselinelevels (P � 0.05), while p38 activity returned to baseline levels. Tissuewater percentage was increased after CPB (89.9 � 1.5 vs. 82.5 � 1.0%,post-CPB vs. baseline, respectively; P � 0.05). Histologic signs of lunginjury included alveolar hemorrhage and leukocyte infiltration in theCPB group. By immunohistochemistry, activated ERK1/2 and p38 inthe CPB group were localized to the nuclei of pulmonary vascularendothelial cells and type I pneumocytes, and activated ERK1/2 alsolocalized to bronchial smooth muscle cells. No significant differenceswere observed in the control group in any measured parameter com-pared to the baseline. Conclusions. The results of our study demon-strate that CPB increases pulmonary p38 activity and causes sustainedactivation of ERK1/2. MAPK activation thus may in part mediate thepulmonary inflammatory response and provide a potential site of inter-vention to prevent pulmonary dysfunction due to CPB.

50. The Highly Selective COX-2 Inhibitor Rofecoxib Demon-strates Antitumor Effects in Lewis Lung Cancer Cells andAntiangiogenic Effects in Vitro. S. S. Qadri, FRCSI, J. H.

TABLE—ABSTRACT 47

Recovery of preischemic baseline

CH Fentanyl DADLE NTB U50 nor-BNI

n 17 10 7 4 9 8LVDP 43 � 17 45 � 7 65 � 5* 23 � 5$ 64 � 11* 19 � 8$

MVO2 40 � 4 67 � 10* 73 � 5* 58 � 11 71 � 6* 36 � 13CF 70 � 6 71 � 8 80 � 5 76 � 18 78 � 7 73 � 8

* Beneficial effect, P � 0.01.$ Adverse effect, P � 0.01.


Wang, Ph.D., K. C. Redmond, AFRCSI, A. O. Donnell, FRCSI, T.Aherne, FRCSI, and H. P. Redmond, FRCSI, M.Ch. Cork Uni-versity Hospital, Cork, Ireland.

Introduction. Tumor angiogenesis promotes cancer progressionand metastasis. COX-2 is an inflammatory inducible enzyme that isoverexpressed in lung cancer. The aim was to determine the antitu-mor effects of COX-2 inhibitor on 3LL cells and antiangiogenic effectin human umbilical endothelial cells (HUVEC). Methods. 3LL cellsand HUVEC were incubated with varying doses of rofecoxib. 3LLcells proliferation and apoptosis were measured by BrdU ELISA andpropidium iodide staining by flow cytometry respectively. HUVECgrowth and tube formation were assessed by BrdU and Martigelassays. Results. The results are presented in the table. Conclu-sion. Rofecoxib suppresses growth in 3LL cells in vitro by increasingapoptosis and decreasing cell proliferation in a dose-dependent man-ner. Similarly it inhibits endothelial cell growth and capillary micro-tubular formation in vitro. The ability of rofecoxib to block angiogen-esis and suppress tumor growth suggests a potential therapeutic rolein the treatment and prevention of primary and secondary lungcancer.

51. Connective Tissue Growth Factor May Play an ImportantRole in the Development of Obliterative Bronchiolitis.M. Thanikachalam, M.D., M. Pang, M.D., R. Vazquez-Padron,Ph.D., S. Li, M.D., A. Aitouche, Ph.D., G. R. Grotendorst, Ph.D.,and S. M. Pham, M.D. Division of Cardiothoracic Surgery, Uni-versity of Miami School of Medicine, Miami, Florida.

Obliterative bronchiolitis (OB) is the major limiting factor in thelong-term survival of lung transplant recipients. Histologically OB ischaracterized by fibrosis and luminal obliteration of terminal bron-chioles. Transforming growth factor (TGF)-�1 has been implicated asone of the primary mediator of OB because of its fibroproliferativeproperties. Recently, it has been established that fibroproliferativeproperties of TGF-�1 are mediated through connective tissue growthfactor (CTGF), a cysteine-rich peptide. The current study determineswhether CTGF is expressed in a model of obstructive airway disease:the heterotopic rat tracheal transplant model. Method. Syngeneictracheas (Lewis rats; n � 6) or major histocompatibility complex(MHC)-disparate allogeneic tracheas (ACI rats; n � 6) were trans-planted in recipient’s omentum and removed for histologic analysis30 days later. The expression of CTGF mRNA and protein in thetracheal graft was determined by quantitative real-time PCR (with alight cycler) and immunostaining (with goat anti-CTGF antibody),respectively. Results. At 30 days after transplantation, allografttracheas developed exuberant luminal lesion, while the syngeneicgrafts had normal tracheal architect. The median luminal obstruc-tion grades (0 � none, 4 � complete) of syngeneic and allogeneictracheas were 0 and 4, respectively. All fibroblasts within the lumi-nal lesion of allogeneic tracheas showed intense CTGF protein ex-pression by immunostaining. The mean CTGF mRNA concentrationin allogeneic grafts was a fivefold higher than that in syngeneicgrafts (0.43 � 0.15 vs. 0.08 � 0.02 pg/�l). Conclusion. CTGF ex-

pression is significantly increased in obliterative bronchiolitis. Theinference is that CTGF plays an important role in pathogenesis ofOB and that blocking the CTGF pathway may attenuate the devel-opment of this lethal condition.

52. Genomic Profiling to Explain Prognosis in Patients withMalignant Pleural Mesothelioma and Positive PET-18FDGImaging. S. Singhal, M.D., R. Wiewrodt, M.D., M. Friscia, M.D.,K. Matzie, M.D., J. Friedberg, M.D., K. Amin, Ph.D., J. C. Ku-charczuk, M.D., S. M. Albelda, M.D., and L. R. Kaiser, M.D.Hospital of the University of Pennsylvania, Philadelphia, Penn-sylvania.

Introduction. Positron emission tomography (PET) with 2-fluoro-D-glucose (FDG) imaging is a sensitive method to image and localizemalignant mesothelioma. High FDG uptake in these tumors predictsshorter patient survival. Our goal was to screen the human genomeusing expression profiling to identify the processes responsible foraltered cellular metabolism and increased high FDG uptake. Meth-ods. RNA extracted from mesothelioma tumors (16 patients) andnonneoplastic pleura (5 patients) was hybridized to 4132 genes onResearch Genetics G211 nylon microarray filters. Bioinformatic al-gorithms predicted alterations in several energy generation path-ways. Quantitative PCR, immunohistochemistry, and serial analysisof NIH gene expression (SAGE) libraries confirmed our results. Re-sults. The most striking feature was production of large amounts oflactate despite the presence of oxygen (Warburg effect). Twenty-three genes (i.e., LDH, GAPDH) were upregulated along the glyco-lytic pathway and oxidative phosphorylation. Seven critical genes inthe protein translation mechanism were also involved in molecularalterations in malignant mesothelioma. The ChoRE promoter(CACGTG motif) controls transcription of several of the metabolicenzymes. The c-myc gene was demonstrated to be deregulated inmalignant mesothelioma and encodes a transcription factor thatheterodimerizes the ChoRE promoter. Upregulation of glycolytic en-zymes appears to be involved in oncogenesis of malignant mesothe-lioma. Conclusion. The molecular basis for the Warburg effect hasbeen demonstrated in malignant mesothelioma. Deregulation ofc-myc is involved in altered cellular metabolism that could explainhigh FDG uptake. This pathway correlates with patient prognosisand provides a target for therapeutic strategies.

CRITICAL CARE/VASCULAR COMBINEDPARALLEL SESSION

53. Protease Inhibition Prevents ARDS in Pigs. J. M. Stein-berg, D.O., J. M. Halter, M.D., H. J. Schiller, M.D., L. H. Gatto,Ph.D., S. Landas, M.D., H. Lee, Ph.D., and G. F. Nieman, B.A.SUNY Upstate Medical University, Syracuse, New York.

Introduction. Clinical trials for ARDS have failed due to lack ofa relevant model for preclinical testing. We recently developed ananimal model which closely parallels the clinical progression of sep-

TABLE—ABSTRACT 50

Rofecoxib (mM): Control 0.1 0.25 0.5 1.0 2.5

Lewis lung cell lineProliferation % 100 � 2 66.74 � 2.7? 66.42 � 5.8? 56.94 � 8? 53.27 � 4.6? 25.57 � 3.1?Apoptosis % 1.67 � 0.2 10.46 � 3.8 16.61 � 7? 27.89 � 11.3? 43.31 � 4.7? 64.41 � 5.1?

HUVECProliferation % 100 � 0.3 104.3 � 0.3 13.05 � 0.04? 10.02 � 0.04? 5.28 � 0.03? 4.44 � 0.01?Cap. microtubular formation % 100 � 3.8 94.44 � 27 55.41 � 5.9? 18.33 � 14.3? 5.19 � 1.5? 00 � 00?

Note. ANOVA, P � 0.05 significant.


sis induced ARDS and hypothesized that COL-3, a chemically modifiedtetracycline and potent inhibitor of matrix metalloproteinases (MMPs)and neutrophil elastase (NE) would prevent ARDS in our novel model.Methods. Pigs instrumented for hemodynamic monitoring were ran-domized to three groups: control (n � 3)—exploratory laparotomy only;SMA/FC (n � 7)—superior mesenteric artery occlusion with intraperi-toneal placement of a fecal blood clot; SMA/FC/COL-3 (n � 5)—ingestion of COL-3 12 h before procedure. Animals were monitored inan ICU for 48 h and treated with antibiotics/fluids, had blood taken forcultures and IL-6 levels (ELISA), and were placed on a ventilator ateuthanization to obtain pulmonary parameters. At necropsy, BAL sam-ples were analyzed for protein concentration, NE activity, and MMPactivity by gelatin zymography. Results. SMA/FC animals demon-strated septic shock (bacteremia, low MAP, reduced urine output) aswell as physiologic and pathologic evidence of lung injury compared toControl (see table). Animals pretreated with COL-3 were bacteremicbut had normal urine output and did not demonstrate pathophysiologicchanges associated with shock or lung injury (see table). MMP-2 and -9activity was increased in the SMA/FC group; COL-3 ameliorated thisresponse. Conclusion. COL-3 inhibition of MMPs, NE, and IL-6 cor-related with prevention of septic shock and ARDS in a clinically rele-vant model. Treatment with COL-3 may reduce morbidity from sepsisin patients.

54. Implications of Proteasome Inhbition: Enhanced Anti-inflammatory Macrophage Activity. J. Cuschieri, M.D., D.Gourlay, M.D., I. Garcia, B.S., S. Jelacic, B.S., and R. V. Maier,M.D. Universtiy of Cincinnati, Cincinnati, Ohio; and Universityof Washington, Seattle, Washington.

The ubiquitin/proteasome pathway is thought to play a critical rolein inflammation and sepsis through the selective degradation ofvarious intracellular proteins. However, the cellular implications ofproteasome modulation during inflammatory states remain poorlyelucidated. The purpose of this study is to determine the potentialcellular effects of proteasome inhibition on LPS-induced macrophagefunction. Methods. Differentiated THP-1 cells were subjected toLPS stimulation. Selected cells were pretreated with lactacystin, aselective inhibitor of the 20S proteasome. Following stimulation,cellular and nuclear protein were extracted and analyzed by Westernblot and EMSA for components of the TLR4 pathway. Supernatantsobtained from cells under the various conditions were analyzed byELISA for the production of pro- and anti-inflammatory cytokines.Statistical analysis was performed by Student’s t tests, with a P �0.05 being significant. Results. LPS stimulation led to the phosphor-ylation and degradation of IRAK, which was followed by activation ofJNK, ERK 1⁄2, and p38. Subsequently, LPS-induced degradation ofI�B, followed by nuclear activation of NF-�B and AP-1. Activation ofthese TLR4-pathways was associated with the production of IL-6,IL-8, IL-10, and TNF. Proteasome inhibition led to reduced LPS-induced IRAK degradation (P � 0.001) with prolongation of IRAKphosphorylation (P � 0.05) and enhanced activation of JNK, ERK 1⁄2,and p38 (P � 0.05). Proteasome inhibition was also associated withincreased LPS-induced AP-1 activation (P � 0.05) and attenuatedLPS-induced I�B degradation which abolished NF-�B activation

(P � 0.001). Proteasome inhibition led to significant modulation ofLPS-induced cytokine production: increased in IL-10 (P � 0.006), nochange in IL-6 (P � 0.213), reduced in IL-8 (P � 0.001), and reducedin TNF (P � 0.001). Conclusion. This study demonstrates thatcellular proteasome activity within the macrophage is critical toregulation of LPS-induced TLR4 mediated signaling, and inhibitionof the 20S proteasome results in a conversion to an anti-inflammatory phenotype. Thus, therapeutic modulation of the cellu-lar proteasome may prove to be beneficial by limiting macrophageproinflammatory phenotypic differentiation resulting in reducedproinflammatory mediated tissue injury.

55. The HIV Protease Inhibitor Ritonavir Increases Endothe-lial Monolayer Permeability. C. Chen, M.D., Ph.D., X. Lu,Ph.D., A. Lumsden, M.D., and Q. Yao, M.D., Ph.D. Baylor Col-lege of Medicine, Houston, Texas.

Background. HIV protease inhibitors are often associated withmetabolic and cardiovascular complications although they are effec-tive anti-HIV drugs. The molecular mechanisms of such complica-tions are unknown. In this study, we determined whether the HIVprotease inhibitor ritonavir could increase endothelial permeability,one of the important mechanisms of vascular lesion formation.Methods. Human dermal microvascular endothelial cells (HMECs)were used in this study. Cell permeability was studied by using atranswell system and a fluorescence-labeled dextran tracer. Endo-thelial junction proteins occludin and pancadherin were determinedby immunoblot assay. Superoxide anion production was analyzed bylucigenin-amplified chemiluminescence assay. MAPK activity wasdetermined by Western blot analysis. Results. HMECs treated withHIV protease inhibitor ritonavir for 24 h showed a significant in-crease of endothelial permeability in a dose-dependent manner. At15 and 30 �M ritonavir treatment, the permeability was increasedby 56 � 10 and 129 � 9%, respectively, compared to controls (n � 4,P � 0.05). HMECs treated with ritonavir showed a substantialreduction of tight junction protein occludin levels, but adherencejunction protein pancadherin was not affected. HMECs treated withritonavir (7.5, 15, and 30 �M, respectively) for 24 h showed a sub-stantial increase of superoxide anion production by 10, 32, and 65%,respectively, compared to controls. Antioxidants (EGCG and SLM)significantly reduced ritonavir-induced endothelial permeability.Furthermore, ritonavir activated ERK1/2 (phospharylation), but notp38 and JNK. A specific ERK1/2 inhibitor, PB89059, significantlyabolished ritonavir-induced endothelial permeability by 80%. Con-clusions. These data demonstrated that HIV protease inhibitorritonavir increased endothelial permeability and decreased tightjunction protein occludin levels, and superoxide anion productionand ERK1/2 activation were involved in the pathways of ritonavir-induced endothelial permeability. This study suggests a new mech-anism of HIV protease inhibitor-associated cardiovascular complica-tions and a new strategy to prevent these complications.

56. Tyrosine Phosphorylation: A Mechanism Underlying inVitro Capillary Tube Disruption. M. S. Da Silva, M.D., C.

TABLE—ABSTRACT 53

GroupMAP

(mm Hg)Serum IL-6

(pg/ml)P/F ratio

(PaO2/FiO2)Compliance(cmH2O/ml)

Shunt fraction(%)

BAL protein(�g/ml)

BAL elastase activity(�M/18 h/mg protein)

Control 111 � 11 0 472 � 35 32.3 � 4.9 5 � 0.5 500 � 116 12 � 2.5SMA/FC 57 � 4* 1900 � 430* 201 � 24* 9.1 � 1.7* 27.7 � 5.2* 1353 � 291* 64 � 19.7*SMA/FC/COL-3 112 � 5.5 64 � 43 410 � 16 31.6 � 2.0 5.6 � 0.9 663 � 85 8 � 2.4

Note. Data are means � SE at end of experiment (48 h), ANOVA. MAP, mean arterial pressure; BAL, bronchoalveolar lavage fluid.* P � 0.05 vs both groups.


Wilasrusmee, M.D., M.Sc., J. Siddiqui, M.S., D. Bruch, M.S., andD. S. Kittur, M.D., Sc.D. Department of Surgery, SUNY UpstateMedical University, Syracuse, New York.

Purpose. To determine whether tyrosine phosphorylation medi-ates in vitro capillary tube disruption induced by �10integrinblockade. Background. Endothelial integrity is altered in athero-sclerosis, sepsis, and allograft endothelialitis. Integrins, adhesivereceptors to matrix proteins, are essential for the morphologicalintegrity of the endothelium. Previously, we demonstrated that a�1-integrin blocking antibody disrupts in vitro capillary tubes. Therole of tyrosine phosphorylation, which has been implicated in otherforms of endothelial dysfunction, has not been studied in this injurymodel. We hypothesized that a tyrosine kinase inhibitor would ame-liorate capillary tube disruption induced by �1 integrin blockade.Methods. In vitro capillary networks of human aortic endothelialcells were formed on Matrigel and incubated with either a tyrosinekinase inhibitor, genistein (15–50 �M), or corresponding dilutions ofDMSO (control) for 1 h. Subsequently, the �1-integrin blocking an-tibody (ab), P5D2, or an irrelevant ab at 1 �g/ml was added and theireffects on capillary tube integrity were measured after 24 h. Capil-lary tube integrity was quantified as the number of intersections/well and presented as the mean � SEM of three independent exper-iments performed in triplicate. Data were analyzed by ANOVA,followed by Bonferroni t test. Results. In accordance with our pre-vious findings, the �1-integrin ab caused capillary tube disruption.This was seen as a marked reduction in intact capillary intersectionscompared to capillaries incubated with the irrelevant ab [9.0 � 3.0(P5D2) vs. 98.4 � 9.9 (irrelevant); P � 0.001]. Pretreatment withgenistein (30 and 50 �M), but not DMSO, partially prevented capil-lary tube disruption, as indicated by the significantly greater num-ber of intact intersections than with P5D2 alone [32.8 � 4.4 (30 �M);80.0 � 5.4 (50 �M); P � 0.001]. Conclusions. We demonstrate thattyrosine phosphorylation is a novel mechanism underlying in vitrocapillary tube disruption induced by �1-integrin blockade. Agentsthat inhibit tyrosine phosphorylation may stabilize the endotheliumand prevent vascular pathology associated with atherosclerosis, sep-sis, and transplant rejection.

57. c-Jun Amino Terminal Kinase (JNK) Prevents TNF-Induced Phosphorylation of VE Cadherin. F. E. Nwariaku,M.D., Z. Liu, M.D., Ph.D., X. Zhu, M.D., M.S., G. Sarosi, M.D., T.Anthony, M.D., and L. Terada, M.D. Departments of Surgeryand Pulmonary Medicine, UT Southwestern Medical Center,Dallas VAMC, Dallas, Texas.

Introduction. We have previously demonstrated that TNF in-duces tyrosine phosphorylation of the adherens junction proteinvascular endothelial cadherin (VE cadherin) during increased endo-thelial permeability. Proximal mediators of cadherin phosphoryla-tion are undetermined. Therefore, we hypothesized that the mitogen-activated protein kinase c-Jun amino terminal kinase (JNK) is aproximal mediator of TNF-induced VE cadherin phosphorylation.Methods. Human umbilical vein endothelial cells (HUVEC) wereexposed to culture medium or TNF for up to 4 h. JNK activation wasdetermined using an IP kinase assay. In separate experimentsHUVEC were transiently transfected with a dominant-negative APFmutation of JNK (Superfect, Qiagen). A control group was separatelytransfected with the empty vector LNCX. VE cadherin phosphoryla-tion was examined by immunoprecipitating VE cadherin from thecell lysates and immunoblotting with anti-phosphotyrosine. Experi-ments were performed in duplicate and results analyzed by ANOVA.Results. TNF significantly increases JNK activation (P � 0.05).JNK activation persisted for at least 4 h after TNF exposure. Trans-fection with the JNK (APF) mutation prevented TNF-mediated ty-

rosine phosphorylation of VE cadherin, while transfection with theempty vector LNCX had no effect on cadherin phosphorylation (seefigure). Conclusion. c-Jun amino terminal kinase is a mediator ofcytokine-induced cadherin phosphorylation.

58. Amplification of the Proinflammatory Transcription Fac-tor Cascade Increases with Severity of UncontrolledHemorrhage in Swine. S. I. Brundage, M.D., M.P.H., M. A.Schreiber, M.D., J. B. Holcomb, M.D., M. Mastrangelo, M.S., X.Xu, M.D., J. M. Macaitis, B.S., and D. J. Tweardy, M.D. Depart-ment of Surgery, Baylor College of Medicine, Houston, Texas.

Introduction. Hypotension causes diffuse liver injury accompa-nied by increased local production of interleukin-6 (IL-6) in swinemodels of uncontrolled hemorrhagic shock (HS). IL-6 is transcrip-tionally upregulated by nuclear factor (NF)-�B and results in acti-vation of Signal transducer and activator of transcription-3 (Stat3) ina murine model of controlled HS. Our objective was to determine ifincreased IL-6 levels in swine models of uncontrolled hemorrhagicshock result from increased NF-�B activity and lead to increasedStat3 activity. Methods. Swine were assigned to four groups: (1)control animals (n � 6), no intervention; (2) sham operation (n � 6),celiotomy and splenectomy; (3) uncontrolled hemorrhagic shock(UHS) (n � 6), sham plus grade V vascular liver injury and resusci-tation; and (4) profound uncontrolled hemorrhagic shock (PUHS)(n � 8), UHS after dilutional hypothermia. Following euthanasia at2 h, livers were harvested, total RNA was isolated, and IL-6 mRNAlevels were quantified by Q-RT-PCR (ABI Prism 7700). Protein wasextracted for measurement of NF-�B and Stat3 activity by electro-phoretic mobility shift assay (EMSA). Results. Results are pre-sented in the table. Compared to shaM.S., IL-6 mRNA levels in-

creased 4.5-fold in UHS and 90-fold in PUHS (P � 0.001). Comparedto shaM.S., NF-�B activity increased 2-fold in UHS and 4-fold inPUHS (P � 0.05). Stat3 activity was equivalent in UHS but in-creased 4-fold in PUHS (P � 0.05). Conclusion. Increased NF-�Band Stat3 activity accompanies increased liver IL-6 mRNA produc-tion, demonstrating that regional proinflammatory cytokine produc-tion results from and perpetuates a proinflammatory transcriptionfactor cascade in swine models of uncontrolled hemorrhagic shock.These data establishes a useful large animal model for the evalua-

TABLE—ABSTRACT 58

Fold Increase Compared to Control Animals

Group IL-6 P � 0.05* NF-�B P � 0.05* Stat3 P � 0.05*

Sham 1.8 No 1.1 No 1.3 NoUHS 8.2 Yes 2.0 Yes 1.7 NoPUHS 162 Yes 4.0 Yes 5.3 Yes

* P � 0.05 versus control animals as evaluated by analysis ofvariance (ANOVA) with post hoc Student-Newman-Keuls testing.


tion of therapeutic interventions targeting dysfunctional inflamma-tion after hemorrhagic shock.

59. Inhibition of Geranylgeranyltransferase Modulates NitricOxide and Superoxide Production in Vascular Smooth Mus-cle Cells. B. S. Zuckerbraun, M.D., and E. Tzeng, M.D. Universityof Pittsburgh, Pittsburgh, Pennsylvania.

Background. Vascular smooth muscle cell (SMC) proliferationand migration are central to the development of intimal hyperplasia(IH). Reactive oxygen species (ROS) are toxic to SMC and involved inarterial injury, while nitric oxide (NO) is known to be vasoprotective.Rho GTPases, including Rac1 and RhoA, modulate intracellular gen-eration of these oxygen and nitrogen species. Specifically, activatedRhoA decreases NO production, while activated Rac1 increases su-peroxide generation. The purpose of these investigations was to testthe hypothesis that pharmacologic inhibition of Rho GTPases with aspecific geranylgeranyltransferase inhibitor (GGTI) prevents SMCproliferation, decreases ROS production, and increases NO genera-tion. Methods. Rat aortic SMC were harvested and when indicatedtreated with GGTI-286 (Calbiochem; 10 �M), angiotensin II (AT II; 1�M), tumor necrosis factor-� (TNF-�; 20 ng/ml), or a combination ofthese agents. [3H]Thymidine incorporation assays were utilized todetermine DNA synthesis and cellular proliferation. ROS productionwas measured by dichlorofluorescein (DCF) fluorescence and NOproduction by the Griess reaction. Protein levels of inducible nitricoxide synthase (iNOS) were determined by Western blot analysis.Results. GGTI-286 decreased DNA synthesis by 67.2 � 7.8 and72.1 � 9.1% compared to serum-stimulated and AT II controls at24 h (P � 0.05). At 3 h, AT II increased DCF fluorescence to 204% ofserum-stimulated controls. Twenty-four-hour pretreatment with GGTIalone had no influence on DCF fluorescence and inhibited AT II stim-ulated increases by 97% (P � 0.05). iNOS protein levels were increasedby GGTI treatment, and nitrite � nitrate levels were increased 2.7- and3.4-fold in serum-stimulated and TNF-�-stimu-lated controls. Conclusions. Specific inhibition of geranylgeranyl-transferase decreased SMC proliferation, decreased ROS generation,and increased NO production. These findings suggest that GGTIs pos-sess vasoprotective and antioxidant properties. GGTIs may prove to bea therapeutically useful adjunct in the treatment of vascular diseases.

60. Histamine Activates the mTOR Translational ControlPathway in Endothelial Cells. L. W. Kraiss, M.D., D. I.Schmid, Ph.D., J. Anderson, B.S., A. S. Weyrich, Ph.D., and G. A.Zimmerman, M.D. Departments of Surgery and Internal Medi-cine, University of Utah, Salt Lake City, Utah.

Introduction. Endothelial cells can respond quickly to humoralor biomechanical stimuli. Increased translation of preexisting mRNAoffers the cell a means of accelerating new protein expression inresponse to stimulation. We asked whether histamine (HIS), a rap-idly acting endothelial agonist, could activate the mTOR transla-tional pathway. Methods. Confluent monolayers of human umbili-cal vein endothelial cells (HUVEC) were stimulated with HIS (100�M) or PBS control (CON). Ribosomal profiling was performed usingsucrose gradient centrifugation and UV absorbance spectroscopy.Activated (phosphorylated) components of the mTOR pathway weredetected by immunoblotting using phosphospecific antibodies. DNAsynthesis was assessed by [3H]thymidine incorporation. Statisticalanalysis was performed using a paired t test with significance assumedat P � 0.05. Results. Two hours after stimulation, HIS-treatedHUVEC displayed significantly increased polysome/monosome ratiosindicating increased overall translational activity compared to CON-treated cells (1.84 � 0.17 vs. 1.42 � 0.14; P � 0.001, n � 10). Thirtyminutes after HIS stimulation, phospho-isoforms of various mTORpathway and other translational components (eukaryotic initiationfactor 4E, S6 kinase 1, ribosomal protein S6, and MAP kinase signal-integrating kinase) were present. Thrombin (2 U/ml) did not activate

the mTOR pathway despite increasing leukocyte adherence to thetreated HUVEC. Consistent with its role in regulating cell prolifer-ation, mTOR pathway activation by HIS produced modest but clearincreases in DNA synthesis compared to CON cells (fold induction,1.85 � 0.90; P � 0.05, n � 8). Rapamycin, an inhibitor of the mTORpathway, abolished this increase in DNA synthesis. Conclusion.HIS rapidly and specifically activates the mTOR translational con-trol pathway and increases the size of polysomes in stimulatedHUVEC. Separate and discrete regulation of translational controlpathways may be important in producing the activated endothelialphenotype.

EDUCATION PARALLEL SESSION

61. Academic versus Community Hospital Surgery Clerk-ship: Is There A Difference? M. Williams, M.D., M. Ambrose,B.S., A. Carlin, M.D., J. Tyburski, M.D., and C. Steffes, M.D.Wayne State University, Detroit, Michigan.

Introduction. The equivalency of surgical clerkship experiencebetween academic and community sites is an issue that is assessedwith difficulty. We examined the objective performance of 222 med-ical students after completion of the 8-week surgical clerkship. Sixconsecutive semesters were analyzed. There were two objective ex-aminations reviewed, the surgical shelf examination and the surgicalsubportion of the Objective Structured Clinical Examination (OSCE)given at the end of the third year. Methods. Medical students wereclassified into three separate groups based on the site of their sur-gical clerkship. The medical students were in academic (100), com-munity (79), or both academic and community (43) sites. Medicalstudent performance on the shelf examination and OSCE was exam-ined after completion of the general surgical clerkship. Single-factoranalysis of variance testing was performed to compare each of thethree groups with respect to shelf examination test score or OSCEscore. Significance was defined as P lt; 0.05. Results. Results arepresented in the table. Shelf examination scores did not correlate

with OSCE scores (r � 0.095). Objective measurements of surgicalshelf examination and OSCE were not statistically different betweenacademic, community, and academic and community surgical clerk-ship participants. Conclusion. Surgical clinical skills as tested byan OSCE and surgical knowledge as tested by a shelf examinationare equally attained by an academic or community surgical clerkship.

62. Robotic Surgery and Resident Training. D. A. De Ugarte,M.D., D. Etzioni, M.D., C. Gracia, M.D., and J. B. Atkinson, M.D.UCLA, Los Angeles, California.

Purpose. To compare a new generation robotic surgery device(Zeus MicroWrist, Computer Motions Inc.) with conventional instru-ments in training surgical residents to perform simple and advanced

TABLE—ABSTRACT 61

Academic CommunityAcademic and

community

Shelf exam(mean % � SD)*

71.7 � 0.09 70.9 � 0.09 73.6 � 0.07

OSCE(mean % � SD)*

77.4 � 0.14 80.7 � 0.11 78.4 � 0.11

OSCE pass rate (%)** 87 94 95

* No statistical significance exists between the three groups withregard to shelf examination (P � 0.24) or OSCE (P � 0.21).

** P � NS.


laparoscopic tasks. Methods. Twelve surgical residents with noprior experience performing intracorporeal knot tying underwentthree training sessions using an inanimate model. Exercises of in-creasing difficulty including bead drop, suturing, and intracorporealknot tying were performed using both the robotic system and theconventional laparoscopic instruments by all participants. Half ofthe participants were randomly assigned to start exercises with therobotic system; the other half started with conventional instruments.Time required to perform tasks and accuracy scores for suturingwere measured. Two-tailed Student’s t tests (paired) were performedto assess differences between robotic and conventional instruments.Results. Task times were significantly longer for the robotic systemonly for bead drop (P � 0.0001) and suturing exercises (P � 0.01).Accuracy scores were higher using the robot (P � 0.05). Traineesenjoyed training on the robotic system and likened the experience toplaying a video game. However, they noted decreased tactile sensa-tion and depth perception with the Zeus MicroWrist system. Con-clusions. The Zeus MicroWrist robotic system provides an extradegree of motion that can simplify intracorporeal knot tying. How-ever, the robot conferred no speed advantage over conventional in-struments for the exercises we tested. The primary benefits of therobot remain the elimination of tremor, the ability to downscalemotion for fine procedures, and the versatility provided by an extradegree of motion. Technological improvements are still required toimproved tactile sensation, depth perception, and video resolution.The practical role of robotic surgery in the training of novice sur-geons requires further investigation.

63. Assessment of Competence Using Laparoscopic Simula-tions: A Valid Method of Training and Evaluation. G. L.Adrales, M.D., U. B. Chu, M.D., D. B. Witzke, Ph.D., M. B.Donnelly, Ph.D., J. D. Hoskins, B.S., M. J. Mastrangelo, Jr.,M.D., A. Gandsas, M.D., and A. E. Park, M.D. University ofKentucky, Lexington, Kentucky.

Purpose. The purpose of our study was to evaluate the constructvalidity of experience and the face validity of three laparoscopicsimulations in the context of quality assessment by surgeon raters.Methods. Subjects (N � 27) of varied levels of surgical experienceperformed three laparoscopic simulations, representing appendec-tomy (LA), cholecystectomy (LC), and inguinal herniorrhaphy (LH).Five laparoscopic surgeons, blinded to the identity of the subjects,rated the subjects on procedural competence (COM) on a binary scaleand in four skills categories on a 5-point scale: clinical judgment(CJ), dexterity (D), serial/simultaneous complexity (SSC), and spa-tial orientation (SO). Using a task-specific, 17-item checklist, non-clinical staff assessed the technical errors. The level of surgicalexperience was correlated with the average expert ratings for eachsubject, the technical errors, and the time for each procedure. Subjectresponses to a survey regarding the utility of the inanimate modelswere evaluated. Results. Years of experience directly correlatedwith the average skills ratings (all P � 0.001) and with the compe-tence ratings across the three procedures (P � 0.01). Experience

inversely correlated with the technical error total for the LA and LHmodels and the time for each procedure (P � 0.01). Among the 25subjects who responded completely to the survey, nearly all agreedthat the corresponding procedures were well represented by thesimulations (LA 96%, LC 96%, LH 100%) (see table). Conclusion.The laparoscopic simulations demonstrated both face and constructvalidity. Regardless of the level of surgical experience, the subjectsfound the models to be suitable representations of actual laparo-scopic procedures. Task speed improved with surgical experience.More importantly, the quality of performance increased with expe-rience, as shown by the improvement in the skills assessments byexpert laparoscopic surgeons.

64. Hand Dominance and Performance in a LaparoscopicSkills Curriculum. T. W. Powers, B.A., D. Bentrem, M.D.,M. T. Toyama, M.D., S. A. Murphy, B.S., and K. M. Murayama,M.D. Department of Surgery, Northwestern University MedicalSchool, Chicago, Illinois.

Introduction. The laparoscopic era has introduced new emphasison spatial relationship skills and the ability to perform tasks witheither hand. We evaluated the influence of hand dominance of sur-gical residents on skill acquisition during a basic laparoscopic skillscurriculum. Methods. Twenty-seven surgical residents (5 PGY-3, 22PGY-2) participated in a 4-week laparoscopic skills curriculum. Us-ing a standardized scoring system, residents were pre- and post-tested on six laparoscopic tasks (peg board transfer, pattern cutting,clip application, vessel loop application, mesh stapling, and intra-coporeal suturing and knot tying) at weeks 1 and 4, respectively.Once each week during weeks 2 and 3, residents attended a proc-tored practice session and any additional independent practice wasrecorded. Hand dominance as assessed by writing hand preferencewas determined after completion of curriculum to eliminate investi-gator bias. Results are expressed as means � SD and data werecompared using ANOVA (significance at P � 0.05). Results. Post-test scores were significantly higher (1322 � 221) than pretestscores (761 � 272). At pretest, left-hand-dominant (LHD) surgeons(n � 4) performed significantly higher (1040 � 90) than right-hand-dominant (RHD) surgeons (n � 23) (712 � 264). Posttest analysis ofoverall performance did not reveal differences between LHD andRHD surgeons. In analysis of pretest scores for individual tasks,LHD surgeons performed significantly better on pattern cutting(141 � 27) than RHD surgeons (74 � 58) and on vessel loop appli-cation (LHD 103 � 15) than RHD surgeons (46 � 44). Conclusion.Participation in a laparoscopic skills curriculum improves overallhousetaff performance. LHD surgeons demonstrate better overallperformance on pretest and better individual task pretest scores forpattern cutting and vessel loop application than RHD surgeons.There was no significant difference in overall performance on post-test between the two groups.

65. Effective Use of Human Simulators in Surgical Educa-tion. G. B. Nackman, M.D., M. Bermann, M.D., and J. Ham-mond, M.D. UMDNJ–Robert Wood Johnson Medical School,New Brunswick, New Jersey.

Introduction. We initiated a teaching module utilizing a humansimulator midway through 2001–2002 to improve student skills spe-cific to the evaluation of patients in shock during a required clerk-ship in surgery for fourth-year medical students. This study testedthe hypothesis that student skills would improve after implementa-tion of this module and identified factors that predicted studentperformance. Methods. Students (n � 86) chose one of two hospitalsfor a clerkship that focuses on the care of acutely ill surgical patients.A case-based lecture on the diagnosis and management of cardio-genic shock was replaced by a simulator session using a computer-ized life-sized mannequin. Students were assessed at the end of theclerkship by a standardized clinical final evaluation (OSCE) that

TABLE—ABSTRACT 63

Pearson Correlations with Years of Experience

COM CJ D SSC SOTechnical

errors Time

LA 0.56� 0.69� 0.72� 0.69� 0.76� �0.51* �0.71�LC 0.58* 0.63� 0.67� 0.75� 0.76� NS �0.56*LH 0.56� 0.65� 0.70� 0.71� 0.70� �0.55* �0.81�

* P � 0.01.� P � 0.001.


required the interpretation of “flow sheet” data and managementrecommendations of patients in hypovolemic, septic, or cardiogenicshock. Variables were accessed for impact on student performance onthe OSCE: clerkship site, block (time of year), prior NBME subjectexam performance, an OSCE during the third-year clerkship, andthe simulator. Results. A total of 54 students completed the simu-lator session. Clerkship site and simulator use had a significantimpact on student performance. Stepwise multiple regression anal-ysis testing the effect of simulator module, site, block, prior NBMEsubject exam, and OSCE during the third-year clerkship identifiedthat use of the simulator was the only independent factor modelingperformance on all stations (P � 0.01, see table). Conclusions. In aclerkship that already emphasized faculty-facilitated case-basedlearning, the use of a teaching module employing a human simulatorsignificantly improved test scores. This study supports the efficacy ofhuman simulators to improve student skills related to the manage-ment of complex critically ill patients.

66. Does Robotic Assistance Enhance Surgical Precision?The Importance of Motion Scaling and Tremor Filtration.S. M. Prasad, M.D., H. S. Maniar, M.D., L. Lester, M.D., M. E.Klingensmith, M.D., and R. J. Damiano, M.D. Washington Uni-versity, St. Louis, Missouri.

Background. While robotic systems have been described to beable to enhance surgical dexterity, the mechanism has not beendefined. It has been assumed that the greatest advantage of thesesystems is their ability to filter and remove tremor. We hypothesizedthat motion scaling (MS) played a more important role and wouldallow greater precision than manual laparoscopy or tremor filtrationalone. Methods. Fifteen volunteers (mean age 23 � 2.4 years) withneither laparoscopic nor robotic experience were enrolled. The drillsimulated microsurgical suturing techniques; the participant at-tempted to drive a needle through the center of a standardized target(circle diameters 0.5, 1.5, and 2.5 mm) from a starting point 12 mmaway. Tasks were performed with each hand (n � 18) and scored (3,2, or 1 points) according to the needle’s proximity to the target center(perfect score � 108). Laparoscopic drills were performed first andlast as a control. Robotic scores were compared to the best laparo-scopic scores. Results. Robotic assistance with tremor filtration andwithout MS (1:1) improved precision, but not significantly. The ad-dition of MS (2.5:1 and 7:1) significantly improved precision (seetable). Furthermore, robotic assistance with MS significantly im-

proved precision scores in both hands (P � 0.001), and opposed tomanual laparoscopy, there was no statistical difference in handed-ness (P � 0.86).

67. Parametric Performance Analysis: Evaluating Residentsand Evaluators. S. R. Schell, M.D., Ph.D., and T. C. Flynn, M.D.Department of Surgery, University of Florida, Gainesville, Florida.

Objectives. We previously reported experience with an internet-based 360° tool for evaluating surgical resident performance (3DEI).Observed benefits include a 35.5% increase in evaluation completion,69.6% decrease in completion times, and significantly lower admin-istrative time. With a robust evaluation data set, we examined ourdata to develop provide more sophisticated methods for evaluatingresident performance and our faculty evaluators. This project de-scribes our tools for: (1) parametric evaluation of resident perfor-mance and (2) faculty evaluation grade inflation/deflation. Methods.Our existing 3DEI SQL database was utilized to generate standarddistribution statistics for ABSITE scores and items in our facultyresident evaluations. Resident performance was assessed usingparametric methods whereby performance was assessed comparingresidents against PGY-matched peers (PmP) during the same period.Results were reported highlighting evaluation items where perfor-mance fell below, or exceeded, 1 SD of the comparison mean. Similarparametric analyses were conducted for faculty evaluations to assessfor grade inflation/deflation. Results. Fifty-two residents accruedABSITE data and 691 evaluations by 41 faculty evaluators. Meantime to complete parametric evaluations was under 10 s per residentor faculty. Parametric evaluation data were used by the ProgramDirector during semiannual faculty resident evaluation; identifying132 “events” (data points greater or less than 1 SD mean scores forPmP). Subset analysis revealed 25.0% of residents with one or moreABSITE subset scores �1 SD below PmP means and 15.4% with oneor more faculty evaluation subset scores �1 SD below PmP means.Deficiencies were identified during residency review with institutionof faculty mentor or program director intervention. Faculty analysisrevealed 21.1% of faculty with one or more inflated evaluation items.Conclusions. Parametric analysis of evaluation data and evalua-tors provides: (1) immediate identification of resident knowledge andtraining deficiencies and (2) identification of faculty evaluators withinadequate evaluation skills. Identification provides educators withpreviously unavailable opportunities for prompt intervention to ad-dress knowledge deficiencies and improve evaluation skills.

68. Analysis of Situation Awareness and Team Performanceduring Operative Procedures Using a Black-Box Re-corder. J. F. Calland, M.D., S. A. Guerlain, Ph.D., F. Tur-rentine, Ph.D., R. S. Jones, M.D., and R. B. Adams, M.D.Department of Surgery, University of Virginia, Charlottesville,Virginia.

Hypothesis. Prospective analysis of multimedia data from a peri-operative recording system will yield new insights into the effect ofhuman performance on the flow of invasive procedures. Back-ground. Potentially avoidable complications and deaths are a rela-tively common feature on the landscape of surgical care in the UnitedStates, occurring in 3%–39% of surgical admissions to academicmedical centers. Indeed, the operating room is the most common sitefor fatal and nonfatal medical errors to occur in hospitalized pa-tients, yet the environment remains relatively unstudied from ahuman performance point of view. Methods. Thirty-four (n � 34)routine laparoscopic cholecystectomies were prospectively recordedand analyzed using a digital multimedia recorder for adequate com-pletion of procedure goals and human performance characteristics.Patient-specific knowledge possessed by members of the surgicalteams (anesthesiologists, nurses, surgeons, and technicians; n �118) was measured using a 21-item written query that promptedrespondents to recall key facts related to the case-specific past med-

TABLE—ABSTRACT 66

Lap 1 Robot 1:1 Robot 2.5:1 Robot 7:1 Lap 2

Time (s) 406 � 166 717 � 282 615 � 294 646 � 270 340 � 125Accuracy

(totalscore)

72 � 11 77 � 14 93 � 11 96 � 8 75 � 11

P value Control 0.06 �0.001 �0.0001 Control

TABLE—ABSTRACT 65

Hypovolemic Septic Cardiogenic Total

Sim� 39.6 � 0.9* 31.3 � 1.0* 34.4 � 0.9* 105.4 � 2.2*Sim� 34.7 � 1.2 27.2 � 1.0 29.0 � 0.9 90.8 � 2.5Site A 39.1 � 0.9 31.2 � 0.9* 34.1 � 0.9* 104.5 � 2.2*Site B 36.5 � 1.1 28.4 � 1.1 30.8 � 1.1 95.7 � 2.7

Note. Mean � SEM.* P � 0.05 by ANOVA.


ical history, indications for optional intraoperative imaging, andcompletion of procedure goals. Communication frequency, communi-cation efficacy, and technical proficiency were also analyzed, as weresubjective assessments of participant comfort and satisfaction. Re-sults. Resident physicians demonstrated significantly lower situa-tion awareness than surgical attendings in queries related to thestatus of the common bile duct (57 vs. 96%, P � 0.0001), other detailsof sonography (65 vs. 89%, P � 0.02), and the use of nasogastricintubation prior to port placement (76% vs. 96%, P � 0.02). In atleast one case, the observed gaps in situation awareness and subop-timal communication practices resulted in a major error, and were atleast partially responsible for subsequent increased level of care. Inall, 86% of cases demonstrated flawed communication practices.Conclusions. Gaps in operator situation awareness, subsequentlatent failures, and highly variable and nonstandardized communi-cation practices may be an underappreciated source of operativeadverse events in surgical patients.

PEDIATRICS/WOUND HEALINGPARALLEL SESSION

69. The �-Integrin Cytoplasmic Domain Regulates Cell Mi-gration via the Ras Signaling Pathway. K. M. Zazzali, B.S.,and S. A. Corbett, M.D. Department of Surgery, Robert WoodJohnson Medical School, New Brunswick, New Jersey

Introduction. Integrins are adhesive glycoproteins that are es-sential for cell migration. Our recent studies have shown that thecytoplasmic domain of the �-subunit regulates cell migrationthrough the ERK/MAPK pathway. As Ras is an upstream activatorof ERK, we hypothesized that the cytoplasmic domain of the�-integrin subunit would also regulate Ras activity. Methods. CHOcells expressing either wild-type �5�1-receptor (X5C5) or a chimericreceptor in which the extracellular and transmembrane portion ofthe �5-subunit is linked to the cytoplasmic domain of �2 (X5C2) weretransiently transfected with a human Ras cDNA and plated ontofibronectin (FN)-coated dishes. Active GTP-bound Ras was precipi-tated from total cell lysate using a GST fusion protein correspondingto the Ras-binding domain of RAF-1 that specifically binds GTP-Ras.Immunoblotting followed by image analysis densitometry was usedto detect active Ras from precipitates. Alternately total cell lysateswere analyzed for Ras content. Results. X5C5 cell migration on FNis significantly greater than X5C2 cells despite similar expression ofcell surface �5�1 (data not shown). Following adhesion to FN, X5C5cells displayed increased Ras activation compared to X5C2 cells. Thisdifference was significant at 5 min (figures A and B, P � 0.029).

Conclusion. Our data demonstrate that Ras activation is regulatedby the cytoplasmic domain of the �-integrin subunit, resulting indistinct ERK signaling events that modulate cell migration. Thiswork provides further insight into the mechanisms of integrin-mediated cell migration required for cellular response to injury.

70. Perflubron Emulsion Increases Subcutaneous Tissue Ox-ygen Tension in an Animal Model. N. A. Rosen, M.D., H. W.

Hopf, M.D., and T. K. Hunt, M.D. Department of Surgery, UCSF,San Francisco, California.

Background. Oxygen plays a central role in wound healing. It isrequired for collagen deposition, angiogenesis, epithelization, andbacterial killing. Perfluorocarbons have a high oxygen dissolvingcapacity. An emulsion of perfluorooctyl bromide (perflubron, Oxy-gent, Alliance Pharmaceutical Corporation, San Diego, CA) has anoxygen solubility of 19.3 vol% (at 1 atm and 37°C). Subcutaneoustissue is a low oxygen extraction tissue with large intercapillarydistances. It is highly dependent on the partial pressure of oxygen todrive oxygen diffusion. The hypothesis is that the administration ofperflubron emulsion will increase subcutaneous tissue oxygen ten-sion (PsqO2). Methods. A well-perfused animal model with minimalvariation in subcutaneous oxygen extraction and arterial oxygentension was developed. Twenty Spague–Dawley rats (250–350 g)were anesthetized with isoflorane. A polarographic oxygen electrodeand temperature thermocouple were placed subcutaneously alongthe dorsum of the rat. In each experiment FIO2 was kept constant,but was varied between experiments (FIO2 � 0.45 to 1.00). Afterbaseline equilibration of PsqO2, 4.5 mL/kg perflubron emulsion (n �12) or saline (control; n � 8) was administered intravascularly.Results. Preliminary experiments determined the subcutaneous ox-ygen extraction in this well-perfused rat model to be approximately0.3 vol%. Given this, the predicted increase in PsqO2 after perflubronadministration (FIO2 � 0.45 to 1.00) is 30 mm Hg. Following theadministration of saline, PsqO2 changed by –1.0 � 6.6 mm Hg.Following the administration of perflubron, PsqO2 increased by32.0 � 7.2 mm Hg. Conclusions. Perflubron emulsion (4.5 mL/kg)increases subcutaneous tissue oxygen tension, as predicted by theemulsion oxygen solubility of 19.3 vol% (@ 1 atm and 37°C). Subcu-taneous tissue oxygen tension is the driving force for diffusion intowounds.

71. Small Intestine Submucosa (SIS) Patch Tracheoplasty ina Rodentmodel for Tracheal Stenosis. D. A. De Ugarte,M.D., D. Puapong, M.D., J. Roostaeian, B.A., J. B. Atkinson,M.D., and J. Dunn, M.D., Ph.D. UCLA, Los Angeles, California.

Purpose. In this study, we evaluate the efficacy of small-intestinesubmucosa (SIS) (an acellular collagenous-scaffold) in the patch re-pair of a rodent tracheal defect. Background. Tracheal stenosis is achallenging surgical problem which often requires reconstructionusing biological or artificial materials. Methods. Sprague–Dawleyrats were anesthesized, and full-thickness tracheal defects involving25% of the circumference were created in tracheal rings 4 to 6. Apatch of 8-ply SIS (SurgiSIS; Cook) was sutured to the defect edgeswith interrupted 8-0 polypropylene suture. Animals were euthanizedat various time points. The trachea was harvested and prepared forhistologic evaluation using conventional techniques. Results. Theanimals tolerated the procedure well and had no evidence of respi-ratory distress (longest follow up was 2 months). Animals wereeuthanized at 1 and 2 weeks. The tracheal lumen was patent with noevidence of contracture or degradation of the SIS. At 1 week, neo-vascularization of the SIS was noted with no evidence of inflamma-tion. Complete reepithelialization of the tracheal lumen with ciliatedcolumnar epithelial cells was noted by 2 weeks (see figure). Conclu-


sions. In the rodent model, SIS appears to be a safe and efficaciousmethod for the patch repair of partial-circumference tracheal defects.The long-term use of SIS warrants further investigation.

72. Adult Stem Cells and the Healing of Cutaneous Wounds.T. Diflo, M.D., X. Borue, B.S., K. Hyman, M.D., N. D. Theise,M.D., D. S. Krause, M.D., Ph.D., NYU Medical Center, NewYork, New York; Cornell University, Ithaca, New York; and YaleUniversity Medical School, New Haven, Connecticut.

Hypothesis. Adult stem cells can contribute significantly towound healing and remodeling in a murine model of wounding.Methods. Female B6D2F1 mice were transplanted with 1 106

male whole bone marrow cells after lethal irradiation with 1200 cGy.After 21 days, the marrow recipients underwent full-thickness skinwounding with a punch biopsy. On postwounding days 1, 3, 7, 14 and21, three animals were euthanized, and wounded and nonwoundedskin, bone marrow, and spleen were harvested for histology andY-chromosome analysis by fluorescence in situ hybridization (FISH).Five control animals underwent irradiation and transplantation, butno wounding, and five male animals were wounded as Y-chromosomecontrols. Results. Nonwounded controls did not express any Y chro-mosome. Male controls had visible Y chromosome in approximately30% of cells, an artifact of the histologic slice thickness (3 �m).Experimental animals had Y-chromosome-positive keratinocytes invery small numbers in unwounded skin, but in increasing percent-ages in wounded skin as time increased after wounding. The tableshows the number of Y� keratinocytes over the total keratinocytescounted for each time point. Adjusted counts are corrected for the

percentage Y� keratinocytes counted in male control slides.Marrow-derived stem cells homed to the areas of injury and contrib-uted to formation of keratinocytes in these areas. Conclusions. (1)Adult bone marrow stem cells can differentiate into skin epithelialcells. (2) The degree of stem cell engraftment in injured tissuesincreases with time during the first 3 weeks after injury.

73. Expression of VEGF Receptors Is Altered In CoculturedNeuroblastoma Cells. E. A. Beierle, M.D., W. Dai, M.D., M. R.Langham, M.D., E. M. Copeland, M.D., and M. K. Chen, M.D.Department of Surgery, University of Florida, Gainesville,Florida.

Background/purpose. Although vascular endothelial growthfactor is best known for its angiogenic properties, it is also known toaffect apoptosis. We have shown both an increase in VEGF and adecrease in apoptosis in cocultured neuroblastoma cells and hypoth-esize that the expression of VEGF receptors may be altered. Meth-ods. Two neuroblastoma cell lines (IMR-32, SK-N-DZ) are utilized.The cells are cultured alone and in a coculture system with hepato-cytes. VEGF and the VEGF receptors KDR, Flt-1, neuropilin 1 (NRP-1), neuropilin 2 (NRP-2), and Flt-4 are measured with RT-PCR. Banddensities are expressed as a ratio to that of �-actin. Data are reportedas means � SEM, compared with Student’s t test, and considered

significant at P � 0.05. Results. The receptors KDR and Flt-1 arenot detected. VEGF and Flt-4 are significantly increased, NRP-1 ismildly decreased, and NRP-2 is unchanged in the cocultured IMR-32cells. VEGF and its receptors are unchanged in cocultured SK-N-DZcells. Data are reported in the figure (*P � 0.05). Conclusion.

Neuroblastoma cells express specific VEGF receptors that are differ-entially regulated in the different cell lines. These findings suggestthat neuroblastomas are heterogeneous and the success of targetingVEGF and its receptors for treatment will be dependent upon thespecific biology of the tumor.

74. Adenosine Receptor Agonists Promote Endothelial Pro-genitor Cell Recruitment and Wound Angiogenesis. J. P.Shaw, M.D., M. C. Montesinos, Ph.D., H. Yee, M.D., Ph.D., I. A.Ianus M.D., B. N. Cronstein, M.D., and P. Shamamian, M.D.NYU School of Medicine, New York, New York.

Background. New vessel growth in wounds results from thesprouting of pre-existing vessels and/or recruitment of circulatingendothelial progenitor cells (EPCs) to the site of injury. We havepreviously demonstrated that adenosine A2A agonists promote neo-vascularization of wounds. These experiments were designed to de-termine whether (1) EPCs are recruited to healng wounds and (2)adenosine A2A agonist-augmented wound healing is mediated byvessel sprouting or by EPC recruitment. Methods. Following lethalradiation (12Gy), FVB/N wild-type mice received bone marrow (BM)reconstitution with 2 106 BM cells harvested from donor FVB/NTie2GFP mice. The transgenic donor mice express the marker genegreen fluorescent protein (GFP) under the endothelial specific Tie2promoter. Full-thickness excisional wounds were performed 4 weeksafter BM transplant, and mice randomly received either topical A2A

receptor agonist (CGS-21680) or vehicle alone. On days 3 and 6,wounds were harvested, sectioned, and stained with an antibody toCD31, a panendothelial cell marker. Vessel density, as measured byCD31-staining, and density of EPC-derived vessels, as measured byGFP expression was quantified in a blinded fashion using two-colorfluorescence microscopy. Results are expressed as mean number ofcells/HPF � SEM and analyzed by Student’s t test. Results. Agreater than twofold increase in CD-31-positive vessels was noted in3-day adenosine A2A agonist versus vehicle-treated wounds (15.5 �3.0 vs. 6.5 � 1.2 SEM, n � 8 and 6, respectively, P � 0.05). Theincrease was not significant in 6-day wounds (27.0 � 4.7 vs. 22.0 �3.0). There was a ninefold increase in GFP cells in A2A agonist-treated 3-day wounds (0.65 � 0.20 vs. 0.07 � 0.07 SEM, n � 6 and 8,respectively, P � 0.01), but by 6 days there was no difference (1.05 �0.3 vs. 0.73 � 0.15). Conclusion. The angiogenic effect of A2A recep-tor activation is most marked in the early stages of wound repair.Activation of adenosine A2A receptors increases angiogenesis in heal-ing wounds by increasing both EPC recruitment and local vesselsprouting.

75. Impact of Helmet Utilization in Bicycle-Related PediatricHead Injuries. B. A. Gaines, M.D., L. Cassidy, Ph.D., B. Shultz,

TABLE—ABSTRACT 72

Days afterwounding

Unwounded skin Wounded skin

Count Mean Adj. Count Mean Adj.

1 0/295 0 0 7/1246 0.56 0.853 0/242 0.19 0.29 18/1917 0.94 1.425 0/365 0.15 0.23 51/2087 2.44 3.70

14 0/370 0 0 50/1296 3.86 5.8521 2/395 0.49 0.74 85/1780 4.78 7.24


B.S.N., and H. R. Ford, M.D. Division of Pediatric Surgery,University of Pittsburgh, Pittsburgh, Pennsylvania.

Purpose. Despite a documented increase in helmet utilization bychildren �16 years of age, the number of head injuries sustained bybike riders has increased over the past 10 years. To more carefullydocument the impact of helmet utilization on head injuries, weexamined the incidence of head injuries in helmeted and nonhel-meted pediatric bike riders in our state. We hypothesized that theincrease in the number of children who sustained head injuries whileriding a bike would be due to the subset of children not wearing ahelmet at the time of injury. Methods. A 5-year (1994–1999) retro-spective review of the Pennsylvania Trauma Outcome Study data-base was performed and information regarding children (�16 years)involved in a bicycle collision was abstracted (n � 1913). We exam-ined demographic variables, helmet utilization, specific injury com-plex, and outcome. Statistical analysis was performed using Stu-dent’s t test and �2 analysis where appropriate. Results. A total of1658 (87%) of the children who sustained a bike injury were notwearing a helmet. The nonhelmeted group sustained 88.6% of allconcussions (P value helmeted (H) vs. nonhelmeted (NH) � 0.03);92% of all skull fractures (P � 0.03); and 97.6% of all subduralhematomas (P � 0.04). There was no significant difference in ISS,mortality, or hospital or ICU length of stay (see table). Conclusion.Despite a reported increase in helmet utilization, the majority ofchildren injured while riding a bicycle were not wearing a helmet atthe time of injury. These children suffer the majority of bicycle-related head injuries. These data suggest that injury preventionstrategies must target behavioral change as well as providing hel-mets.

76. Human Chondrocyte–Matrix Interactions: Regulation ofContractile Behavior. B. Kinner, M.D., Ph.D., J. Zaleskas,M.D., and M. Spector, Ph.D. Department of Trauma Surgery,University of Regensburg, Regensburg, Germany.

Introduction. Recently articular chondrocytes have been shownto display contractile behavior, which is enabled by the expression of�-smooth muscle actin (SMA). The objectives were to investigate theeffects of culture conditions and growth factors on SMA expressionand contractile behavior of human articular chondrocytes. Methods.Articular cartilage was obtained form 17 patients undergoing totaljoint replacement. Cells were isolated, expanded in monolayer andseeded onto a collagen–GAG matrix. Cells were treated either with10 ng/ml PDGF-BB, 1 ng/ml TGF-�1, or without supplementationwith growth factors. SMA content was determined by Western blotanalysis and immunohistochemistry. Cell-mediated contraction wasmeasured for 3 weeks and corrected to cell number. The forcesexerted by the cells were recorded using a novel cell force monitor.Results. Western blot analysis revealed an increasing amount ofSMA in the cells in monolayer culture with passage number

(ANOVA, P � 0.0001). TGF-� significantly increased SMA expres-sion (P � 0.005), and PDGF-BB significantly decreased SMA content.SMA-containing cells were also found to contract the matrix, withthe cells containing more SMA displaying more matrix contractionthan those with a lesser amount of SMA (two-factor ANOVA P �0.0001). Discussion. These results may be helpful when consideringthe use of serially passaged chondrocytes for cell-based and tissueengineering approaches for cartilage repair. The expression of SMAand related contraction of chondrocytes may affect the shape andpore structure of the scaffolds used as well as the newly formed ECM.Regulation of SMA expression and contraction may be possible byusing selected growth factors.

GASTROINTESTINAL/NUTRITIONPARALLEL SESSION II

77. Independent Regulation of Glutamine Transport acrossBrush Border and Basolateral Membranes. Q. H. Meng,Ph.D., W. W. Souba, M.D., S.C.D., C. M. Lin, Ph.D., A. M.Karinch, Ph.D., C. L. Wolfgang, M.D., Ph.D., T. C. Vary, Ph.D.,and M. Pan, M.D., Ph.D. The Pennsylvania State University,College of Medicine, Hershey, Pennsylvania.

Glutamine, the principal fuel and a major biosynthetic precursorfor the gut mucosa, is absorbed by intestinal epithelia via the brushborder (dietary glutamine) and/or basolateral membrane (blood glu-tamine). Unlike the brush border glutamine transport systems, thebasolateral membrane glutamine transporters and their regulationare unclear. The aim of this study was to characterize basolateralglutamine transport systems of differentiated intestinal epithelialCaco-2 cells and study the regulation of this transport by proteinkinase C (PKC) activation. Methods. Caco-2 cells were grown onporous filter for 21 days at which time cells had differentiated andformed a monolayer with tight junctions. Glutamine (1 �M–10 mM)transport activity was measured in cells incubated with phorbolester (TPA, 0–1 �M), a known PKC activator. Data were analyzed byANOVA (significance set at P � 0.05). Results. The glutaminetransport rate across the Caco-2 basolateral membrane was twicethe rate across the brush border membrane. Glutamine (50 �M) waspredominantly transported via Na�-dependent transport (80%, with�20% by Na�-independent transport) with a Na�-dependent coeffi-ciency Hill number of 2, indicating that one glutamine was cotrans-ported with two sodium ions. While System B was the major brushborder glutamine transporter, System ASC was the predominantbasolateral membrane carrier (Fig. 1). TPA stimulated SystemB-mediated glutamine transport (0.41 � 0.05 control vs. 0.73 � 0.08TPA, nmol/mg/min, P � 0.05), but inhibited System ASC-mediatedglutamine transport in a time- and dose-dependent manner. UnlikeSystem B, TPA-induced inhibition of System ASC glutamine trans-port was not affected by either actinomycin-D or cycloheximide (Fig.2). Conclusions. Glutamine transport across the Caco-2 brush bor-

der and basolateral membranes occurs via two different transportsystems, B and ASC. These carriers are differentially and indepen-dently regulated by phorbol ester-induced protein kinase C activation.

TABLE—ABSTRACT 75

Helmeted(n � 255)

Nonhelmeted(n � 1658) P value

Concussion 92 718 0.0297Skull fracture 15 172 0.025Subdural 1 40 0.038ISS 12.9 11.8 NSMortality 10 42 0.2Length of stay

(LOS), days4.9 4.6 NS

ICU LOS, days 1.38 1.31 NS


78. Gut Epithelial Apoptosis Decreased in �� T-Cell ReceptorKnockout Mice after Burn. X. Wu, M.D., J. Song, M.D., K. J.Woodside, M.D., D. N. Herndon, M.D., and S. E. Wolf, M.D.Shriners Burns Hospital, Department of Surgery, University ofTexas Medical Branch, Galveston, Texas.

Introduction. �� T lymphocytes prime macrophages for TNF-�production after severe burn. We previously showed anti-TNF-�antibody reduced mucosal atrophy by decreasing gut epithelialapoptosis at 12 h after severe burn. In this study, we hypothesizethat burn induced mucosal atrophy is diminished in �� T-cell recep-tor knockout mice (TCR ��/�). Methods. Twelve C57-BL6 and TCR��/� mice were randomly assigned to burn and sham burn. The micewith burn were subjected to 20% TBSA scald burn on the back. Themice were euthanized at 12 h after burn. To assess mucosal atrophy,mucosal height and cell numbers in crypts and villi were determinedon hematoxylin and eosin-stained tissue sections. Apoptotic gut ep-ithelium was identified by TUNEL staining, and the proliferativeepithelium was detected by PCNA. Statistical analysis was per-formed with a t test. Results. Mucosal height (MH) and mucosal cellcount (MC) were decreased significantly (P � 0.001) in both burngroups compared to sham, but no difference was found betweenwild-type and knockout mice. Gut epithelial apoptosis and prolifer-ation in both wild-type and TCR ��/� mice were significantly in-creased after burn, but TCR ��/� mice had a significantly lower levelof apoptosis (P � 0.01) and proliferation (P � 0.056) index comparedto wild-type mice (see table). Conclusion. Burn induced an increase

in gut epithelial apoptosis and proliferation that was reduced in TCR��/� mice, suggesting that �� T lymphocytes play a role in the regu-lation of gut mucosal homeostasis.

79. Bombesin Potentiates Transforming Growth Factor-�(TGF-�)-Mediated Cell Death in Intestinal EpithelialCells. M. I. Slogoff, M.D., F. Z. Li, M.D., Y. Cao, M.D., Y. Guo,M.D., M. R. Hellmich, Ph.D., C. M. Townsend Jr., M.D., and T. C.Ko, M.D. University of Texas Medical Branch, Galveston, Texas.

In normal intestinal epithelial cells, TGF-� arrests cell growth andinduces apoptosis. Bombesin (BBS)-like peptides and their receptor(GRP-R) are not expressed in these cells. Conversely, in cancer cells,TGF-� signaling is often inactivated while GRP-R is aberrantlyexpressed and stimulates cell growth. Given this dichotomy, wehypothesized that ectopic expression of GRP-R inactivates TGF-�signaling. Methods. TGF-�-sensitive rat intestinal epithelial cells(RIE-1) were stably transfected with GRP-R. Cells were treated withvehicle, BBS (10�7 M), TGF-� (1 ng/ml), or bombesin plus TGF-� andanalyzed for TGF-� signaling by standard luciferase reporter assay(3TP-Luc), apoptosis by DNA fragmentation ELISA, and cell growth.Results. In RIE-1 cells expressing GRP-R, BBS and TGF-� actedsynergistically in stimulating luciferase reporter activity (data notshown), inducing DNA fragmentation (Table 1), and inhibiting cell

growth (Table 2). Conclusions. We have shown for the first timethat BBS can potentiate TGF-� signaling leading to enhancedapoptosis and inhibition of cell growth. However, these results sug-gest that ectopic expression of GRP-R in colon cancer is not respon-sible for the inactivation of TGF-� signaling.

80. Compensatory Ileal Expression of p27kip1 after MassiveSmall Bowel Resection in p21waf1-Null Mice. A. W. Knott,M.D., R. J. Juno, M.D., J. L. Williams, B.S., C. R. Erwin, Ph.D.,and B. W. Warner, M.D. Cincinnati Children’s Hospital MedicalCenter, Cincinnati, Ohio.

Background. Previously, we have shown that enterocyte prolif-eration in response to massive small bowel resection (SBR) is para-doxically abolished in mice unable to express the cyclin-dependentkinase inhibitor (CDKI) p21waf1. The mechanism for the absent in-duction of proliferation is unknown. The purpose of this study was totest the hypothesis that absent p21waf1 expression results in compen-satory expression of other CDKIs to prevent intestinal adaptationfollowing massive SBR. Methods. Male C57BL/6 (control) or p21waf1-null mice underwent a 50% proximal SBR or sham operation. Pa-rameters of adaptation (ileal weight and villus height) were recordedat 24 and 72 h. Western blotting was employed to determine theexpression of p27kip1 (another major CDKI) in the remnant bowel.Results. By 3 days, intestinal adaptation occurred after SBR in thecontrol mice as revealed by significant increases in ileal wet weightand villus height whereas there were no changes in these parame-ters after SBR in the p21waf1-null mice (data not shown). In thecontrol mice, the expression of p27kip1 was reduced at both 24 and72 h after SBR (see figures). In distinct contrast, the expression ofp27kip1 was markedly greater in the ileum of the p21waf1-null mice.Conclusions. In the absence of p21waf1, intestinal adaptation is

TABLE 2—ABSTRACT 79

Cell number (105) on Day 4

Control 4.77 � 0.12BBS 4.70 � 0.02TGF-� 2.71 � 0.03*TGF-� � BBS 0.89 � 0.05*,†

* P � 0.05 vs control.† P � 0.05 vs TGF-�.

TABLE—ABSTRACT 78

Wild-type Knockout

Sham burn Burn Sham burn Burn

MH (�m) 470.5 � 71.1 364.2 � 58.9† 453.4 � 81.9 341.6 � 81.8†MC 161.2 � 7.4 133.0 � 14.4† 152.2 � 21.5 120.7 � 17.5†PCNA (%) 9.34 � 0.4 13.2 � 2.4† 9.4 � 1.1 10.9 � 1.1TUNEL (%) 0.29 � 0.1 1.34 � 0.4† 0.34 � 0.1 0.79 � 0.2*,†

Note. Data are expressed as means � SD.* Significant difference between wild-type and knockout mice.† Significant difference between sham and burn.

TABLE 1—ABSTRACT 79

DNA fragmentation

Control 0.1330 � 0.0120BBS 0.1420 � 0.0110TGF-� 0.3510 � 0.0630*TGF-� � BBS 0.8510 � 0.0190*,†

* P � 0.05 vs control.† P � 0.05 vs TGF-�.


impaired and the expression of another major CDKI, p27kip1, is en-hanced. Reduced expression of p27kip1 after SBR and obligatory ex-pression of p21 waf1 for adaptation to occur endorses the significanceof a critical balance in the expression of both CDKIs in the generationof the proliferative, adaptation response to massive intestinal loss.

81. Hypothermia Protects against Gut Ischemia/Reperfusion(I/R)-Induced Impaired Intestinal Transit by InducingHeme Oxygenase-1 (HO-1). B. O. Attuwaybi, M.D., N. W.Weisbrodt, Ph.D., R. A. Kozar, M.D.,Ph.D., H. T. Hassoun, M.D.,L. Zou, M.D., Ph.D., and F. A. Moore, M.D. University of TexasHouston Medical School, Houston, Texas.

Gut I/R elicits an inflammatory response that impairs intestinaltransit (IT). We have previously shown that hypothermic protec-tion against gut I/R mucosal injury is associated with decreasedNF-�B and iNOS, but preserved HO-1 expression. We thereforehypothesized that intraischemic hypothermia (IH) would protectagainst gut I/R-induced impaired intestinal transit via HO-1 in-duction. Methods. Rats had duodenal catheters placed followedby sham laparotomy or gut I/R (superior mesenteric artery occlu-sion 75 min) with or without regional IH (gut 15 °C withsystemic 37 °C). At 12 and 24 h of reperfusion, IT was determinedby quantitating the percentage of tracer (FITC– dextran) in 10segments of intestine (expressed as mean geometric center ofdistribution). Ileal HO-1 expression was assessed by Westernimmunoblot at 12 and 24 of h reperfusion. A second set of rats waspretreated with the HO-1 inhibitor Sn protoporphyrin (SNP) IX,25 �mol/kg ip, followed by 75 min of gut I/R, and transit wasmeasured. Data are expressed as means � SEM (P � 0.05,ANOVA; n � 5 per group). Results. I/R impaired transit at both12 and 24 h compared to sham. Transit in IR � IH-treated ratswas not different from sham. IH induced HO-1 expression at 12and 24 h of reperfusion as well as protected against I/R-inducedimpairment in IT. SNP abrogates this hypothermic protection (seefigures). Conclusion. Hypothermic protection against I/R-induced impairment in intestinal transit is in part due to HO-1expression.

82. PKC-Dependent Activation of ERK 1/2 by Ischemic Stressin Model Intestinal Epithelia. J. M. Mammen, M.D., J. C.Song, M.S., and J. B. Matthews, M.D. Department of Surgery,University of Cincinnati, Cincinnati, Ohio.

Introduction. The intestinal epithelial response to ischemicstress is poorly understood. Background. Protein kinase C (PKC)isoenzymes, particularly the novel and � isoforM.S., are activatedby ischemia in various organs, notably the heart. The aim of thisstudy is to define the role of PKC and downstream stress kinases inan in vitro model of ATP depletion and repletion in model culturedepithelia. Methods. Confluent human T84 intestinal monolayers onpermeable supports underwent ATP depletion (1 �M oligomycin Aand 10 �M 2-deoxyglucose) followed by repletion (return to glucosebuffer). Subcellular fractionation and Western blot were used todetect translocation (activation) of PKC. ERK 1/2 activation wasdetected by anti-phospho-ERK antibody and Western blot and com-pared to total ERK 1/2. Go6850 (5 �M), which blocks conventionaland novel PKCs, and Go6976 (5 �M), which blocks conventionalisoforms only, were used to assess the role of PKC (each n � 3, *P �0.05 by Student’s t test). Results. ATP depletion was associated withselective but transient translocation of PKC to the membrane frac-tion. Transient activation (phosphorylation) of ERK 1/2 was alsoobserved without an increase in p38 MAPK or JNK phosphorylation.The PKC inhibitor Go6850 (but not the conventional PKC inhibitorGo6976) completely prevented ERK 1/2 phosphorylation during isch-emia. Following 60 min of ischemia, susequent ATP repletion re-sulted in sustained ERK1/2 phosphorylation (4.8 � 0.6-fold in-crease*) without recurrent translocation of PKC. Conclusions.Ischemic stress in model intestinal epithelia induces activation ofERK 1/2 in PKC-dependent fashion, likely due to novel PKC. Sus-tained activation of ERK 1/2 continues after ATP repletion. Theresults suggest that activation of PKC and downstream stress ki-nases may be important elements in the adaptive response to intes-tinal ischemia.

83. A Nitrergic-CGMP Pathway Mediates Serotonin-InducedChloride Secretion in Rat Colonocytes. S. M. Haque, M.D.,Ph.D., M. C. Stoner, M.D., and J. M. Kellum, M.D., FACS.Medical College of Virginia, Richmond, Virginia.

Background and purpose. The neural secretory response to5-hydroxytryptamine (5-HT) is mediated by the 5-HT3 receptor via anonadrenergic, noncholinergic (NANC) neurotransmitter. In flux ex-periments, 5-HT-induced chloride flux is inhibited by the nitric oxidesynthase antagonist L-NAME. We hypothesize that nitric oxide (NO)is the NANC neurotransmitter, acting via a cGMP-dependent path-way to induce chloride secretion in the rat distal colon. Methods.Colonocytes were harvested from adult male Sprague–Dawley rats,killed by narcosis and decapitation, and enriched by chelation–elution. In one set of experiments, isotopic chloride efflux was mea-sured in colonocytes treated either with the nitric oxide donorDEA/NO (DNO) or with the cGMP analog 8-Br-cGMP, each in theabsence and presence of the guanylyl cyclase antagonist NS 2028. Inseparate studies, cGMP production was measured in enrichedcolonocytes treated with the same nitric oxide donor. The Student ttest for paired data is employed, as appropriate. Significance isassumed for P � 0.05. Results. Both DNO and 8-Br-cGMP produceda significant rise in chloride efflux from these cells. Chloride effluxwas abolished by 2 �M NS 2028 in cells incubated with the nitricoxide donor but not in cells incubated with 8-Br-cGMP (2 � 8.1 vs.18 � 8.0% efflux, P � 0.01, n � 14) versus DNO alone (8.0 � 2.1 vs.11.0 � 2.0, P � 0.01, n � 8), versus 8-Br-cGMP alone. Cells incubatedin the presence of DNO produced 489.2 � 93.2 fmol/mg proteincGMP, which was significantly greater (P � 0.05, Student’s t test,paired data, n � 5) than 336.6 � 35.3 fmol/mg protein cGMP ob-served in matched controls cells from the same animals. This rise incGMP production was not significant when the same cells were


pretreated with NS 2028 (control, 298.56 � 57.7; vs. DNO, 313.0 �63.2 fmol/mg protein cGMP). Conclusions. Nitric oxide appears tobe the NANC neurotransmitter mediating the chloride secretoryresponse to 5-HT3 receptor activation in rat colonocytes. NO releasedfrom nitrergic enteric neurons acts via activation of the guanylylcyclase-cGMP mechanism.

84. Cytoskeletal Disruption Inhibits Capacitative CalciumEntry in Myenteric Glia. T. R. Lin, M.D., W. Zhang, M.D.,Ph.D., B. J. Segura, M.D., C. Hu, M.D., E. A. Guzman, M.D., andM. W. Mulholland, M.D., Ph.D. Department of Surgery, Univer-sity of Michigan, Ann Arbor, Michigan.

Introduction. Capacitative calcium entry (CCE) is the process bywhich intracellular calcium is replenished from the external milieuupon depletion of intracellular stores. CCE is thought to participatein chemotaxis, proliferation, and cell signaling. A physical interac-tion between calcium stores and the plasma membrane is postulatedto regulate CCE. We hypothesized that cytoskeletal disruption altersthis interaction resulting in inhibition of CCE in enteric glia. Meth-ods. Dispersed cultured glial cells from neonatal guinea pigs weretreated with cytochalasin D (10 �M), a microfilament-disruptingagent; nocodozole (20 �M), a microtubule-disrupting agent; or vehi-cle (dimethyl sulfoxide). Intracellular calcium changes were mea-sured using fura-2 microfluorometry after extracellular calcium wasreturned. To evaluate the rate of cation reentry, barium was substi-tuted for calcium because barium, unlike calcium, is not sequesteredinternally. Student’s unpaired t test determined statistical signifi-cance. P � 0.05 was considered significant. Results. Fluorescentlabeling with phalloidin and anti-�-tubulin revealed disruption ofactin and tubulin networks in treated cells (Fig. 1). CytochalasinD-treated glia had diminished CCE response (57.1 � 2.6 nM) com-pared to control (97.0 � 7.2 nM) (n � 316 cells, P � 0.01). Nocodozole-treated glia had diminished CCE response (29.8 � 2.3 nM) comparedto control (77.1 � 6.1 nM) (n � 260 cells, P � 0.01). Cytochalasintreatment diminished the rate of cation reentry (Fig. 2). Conclu-sion. Disruption of the microfilamentous and microtubular cytoskel-etal elements diminishes calcium influx essential to calcium storerepletion in guinea pig myenteric glia.

ONCOLOGY PARALLEL SESSION II

85. Somatostatin Receptor Gene Transfer Inhibits Estab-lished Pancreatic Cancer Xenografts. W. E. Fisher, M.D., S.Selenski, B.S., F. Amaya, B.S., Y. Wu, Ph.D., and Q. Yao, M.D.,Ph.D. Baylor College of Medicine, Houston, Texas.

Background. Somatostatin inhibits growth of somatostatin re-ceptor (SSR)-positive human pancreatic cancers but not the majorityof pancreatic cancers because they are SSR negative. Hypothesis.SSR gene transfer will render human pancreatic cancer xenograftssusceptible to the growth inhibitory effects of octreotide. Methods.Nude mice were randomly assigned to five groups. SSR-negativehuman pancreatic cancer xenografts (Panc-1) were established in allgroups. After palpable subcutaneous tumors were established in allanimals, two groups (n � 10/group) received SSR subtype-2 (1011

viral particles ip/animal), one group received Lac-Z, and two groupswere injected with vehicle. One of the SSR2 groups and one of thevehicle groups were treated with octreotide LAR (5 �g im). After 28days, plasma was collected for RIA, tumors were weighed, and SSR2and p27 protein was measured in tumor and host specimen byWestern blot and immunohistochemistry. Results. SSR2 gene trans-fer resulted in expression of the receptor in most tissues includingthe subcutaneous tumors. SSR2 gene expression resulted in a 53%reduction in final tumor weight compared to untreated or LacZ-transfected animals (135 � 100 vs. 275 � 145 and 332 � 217 mg; P �0.05 by Student-Newman-Keuls). SSR2 gene transfer had no effecton plasma somatostatin levels. Treatment with octreotide resulted insignificantly increased plasma octreotide levels but did not affect thegrowth of wild-type tumors (259 � 204) or enhance the inhibition inSSR2-transfected tumor growth any further (193 � 191). SSR2 ex-pression caused upregulation of the cyclin-dependent kinase p27.Conclusions. SSR2 gene transfer inhibits the growth of establishedhuman pancreatic cancer xenografts via a mechanism independentof systemic exogenous or endogenous somatostatin ligand. The mech-anism may involve upregulation of the tumor suppessor protein p27.SSR2 gene transfer may represent a useful gene therapy strategy inhuman pancreatic cancer.

86. Differential Reponses by Pancreatic Carcinoma CellLines to Prolonged Exposure to Erbitux (IMC-C225) Anti-EGFR Antibody. Z. Q. Huang, M.D., D. J. Buchsbaum, Ph.D.,K. P. Raisch, Ph.D., and S. M. Vickers, M.D. University of Ala-bama at Birmingham, Birmingham, Alabama.

Purpose. Explore the mechanisms for different responses of hu-man pancreatic carcinoma xenografts to multimodality treatmentwith IMC-C225, gemcitabine, and radiation. Background. Com-bined therapy using IMC-C225, gemcitabine, and radiation over a6-week period caused complete tumor regression of MiaPaCa-2 tu-mor xenografts in athymic nude mice, but only a delay in tumorgrowth with BxPC-3 tumor xenografts. We investigated the effect ofprolonged IMC-C225 treatment on the sensitivity of these cell linesto gemcitabine and/or radiation and the EGFR signal transductionpathway. Methods. MiaPaCa-2 and BxPC-3 cells were cultured withor without IMC-C225 for 6 weeks. Cells were then treated withgemcitabine and/or radiation, harvested 48 h after treatment, andcounted. Differences in EGFR expression after exposure to IMC-C225 were analyzed by FACS. Internalization of EGFR induced byIMC-C225 on these cell lines was determined using I-125-EGF afterremoval of IMC-C225 by acidic wash. Cell lysates were harvestedafter cells were stimulated with EGF, and EGFR was immunopre-cipitated using IMC-C225. Samples were separated using SDS–PAGE and transferred to PVDF membranes. The membranes wereprobed with antibody against human growth factor receptor bindingprotein (Grb2) to detect the association of this Ras-MAPK upstreamprotein to EGFR. Results. Proliferation assays indicated that pro-longed exposure to IMC-C225 increased the sensitivity of MiaPaCa-2


cells to gemcitabine and radiation compared to non-IMC-C225-treated cells (41 � 10 vs. 30 � 3% inhibition of proliferation forradiation, 78 � 4 vs. 56 � 5% for gemcitabine, and 80 � 7 vs. 68 �5% for the combination) (P � 0.05), but not for BxPC-3 cells. FACSanalysis showed that the expression level of EGFR decreased byabout 50% on MiaPaCa-2 cells whereas no loss was seen on BxPC-3cells. Immunoblots showed that Grb2 was coimmunoprecipitatedwith EGFR after EGF stimulation. Incubation with IMC-C225blocked Grb2 binding to MiaPaCa-2 but not BxPC-3 cells. Internal-ization of EGFR induced by IMC-C225 did not differ betweenMiaPaCa-2 and BxPC-3 cells. Conclusions. (1) The association ofGrb2 to EGFR in BxPC-3 cells in the presence of IMC-C225 indicatesa different pathway of Ras-MAPK activation, which may be relatedwith the resistance to treatment; and (2) down-regulation of EGFRmay contribute to the response to therapy.

87. �5�1-Integrin-Mediated Cohesivity Requires a Fibronec-tin Dimer. E. E. Robinson, B.A., R. A. Foty, Ph.D., and S. A.Corbett, M.D. Department of Surgery, Robert Wood JohnsonMedical School, New Brunswick, New Jersey.

Introduction. �5�1-Integrin is a heterodimeric, transmembranereceptor that binds fibronectin (FN) and has a well-defined role incell adhesion, migration, and matrix formation. We have previouslyshown that �5�1 integrin confers cohesivity to 3-D CHO cell aggre-gates and that this process is FN dependent. We hypothesize that�5�1-integrin-mediated cohesivity requires a FN dimer and that FNmatrix assembly is involved in this process. Methods. A functionalrecombinant FN monomer was synthesized using the baculovirusexpression system and purified using gelatin-agarose affinity chro-matography. CHO-�5 (�5�1�) cell aggregates were formed usingeither the FN monomer or the purified dimeric plasma FN. CHO-�5cell aggregates were also formed in the presence or absence of III1C,a peptide that blocks FN matrix assembly. Aggregates were imaged,and compaction was quantified by measuring area in pixels usingIPLabs software. Results. Aggregates generated using dimeric FNformed tight round spheroids. Aggregates generated using FN mono-mers, however, only loosely associated, as evidenced by their largesurface area (figure A; P � 0.001). In addition, aggregate formationusing dimeric FN was significantly diminished in the presence ofIII1C (figure B; P � 0.05). Conclusions. We show that dimeric FN is

a prerequisite for �5�1-integrin-mediated aggregate formation andcompaction in CHO cells. We also show that this process is dimin-ished in the presence of III1C thus, suggesting that FN matrixassembly plays a role in this process. These data suggest a possiblemechanism by which �5�1-integrin, in conjunction with FN, may actto promote tissue cohesion.

88. Tyrosine Kinase Inhibitors Decrease Pancreatic CancerCell Growth. R. S. Farivar, M.D., Ph.D., J. Gardner-Thorpe,MRCS, S. W. Ashley, M.D., M. J. Zinner, M.D., and E. E. Whang,M.D. Brigham and Women’s Hospital, Boston, Massachusetts.

Purpose. We hypothesized that a systematic examination of tran-scripts relevant to signal transduction pathways in human pancre-atic adenocarcinoma cell lines might suggest novel therapeutic tar-gets. Methods. We extracted total RNA from MIAPaCa-2, Capan-2,and BxPc3 human pancreatic cancer cell lines and created cDNAlibraries using human gene-specific primers for 847 genes in signaltransduction pathways. These cDNA libraries were hybridized witha microarray imprinted with complementary PCR sequences forcoding regions. Housekeeping genes were used as a positive controland as a way to normalize results between cell types. Since variousmembers of the tyrosine kinases were highly expressed at the mRNAlevel, we then tested the ability of various kinase inhibitors on cellline proliferation using the MTT assay. Inhibitors were chosen torepresent various subclasses of kinase inhibitors: genistein (generalinhibitor of tyrosine kinase), staurosporine (inhibitor of protein ki-nases A and C), herbimycin (inhibitor of EGF-R, PDGF-R, c-src, andc-abl), lavendustin (cell-permeable inhibitor, no effect on PKA), andGleevec (Novartis, inhibitor of c-abl, PDGF-R, and c-kit). All exper-iments were performed three times, each time in triplicate. Signifi-cance was accepted for P � 0.01 (*) by ANOVA. Results. Of the 847genes screened, 18 genes were commonly expressed in all three celllines, and the most abundant common transcript was the EphB3tyrosine kinase receptor (Unigene cluster Hs.2913). Furthermore,5/18 (28%) commonly expressed genes were related to tyrosine ki-nase pathways. Lavendustin or gleevec was not able to inhibit thegrowth of MiaPaCa-2, Panc-1 or BxPc3, while genistein (*), stauro-sporine (*), or herbimycin (*) consistently inhibited the growth ofthese three cell lines. The most potent agent was herbimycin with anIC50 of 0.1 �M on the MIAPaCa-2 cell line (drugs were tested from100 nM–10 �M). Conclusions. These results indicate that there areconsistent transcript expression profiles in human pancreatic cancercell lines. Furthermore, these targets lend themselves to exploitationas potential therapeutic targets.

89. Identification and Characterization of Adult Bone Mar-row Stem Scells That Contribute to Tumor Angiogenesis.J. P. Shaw, M.D., I. A. Ianus, M.D., G. Plitas, M.D., B. Muhs,M.D., N. Theise, M.D., R. Basch, M.D., and P. Shamamian, M.D.NYU School of Medicine, New York, New York.

Background. Early theories of tumor angiogenesis implicated thein-growth of preexisting vessels surrounding the tumor. Recent evi-dence has shown that uncharacterized endothelial precursor cells(EPCs) originating in the bone marrow (BM) migrate to tumors anddifferentiate into endothelium. Using a murine bone marrow trans-plantation (BMT) model, we sought to define the cell(s) within adultBM that home to tumor neovasculature by selecting for candidatepopulations of cells using the stem cell marker sca-1 and/or theendothelial lineage marker, Tie-2. Methods. BM cells were har-vested from transgenic FVB/NTie2GFP-182-SATO mice (GFPTie2)that express green fluorescent protein (GFP) under the control of theTie-2 promoter. Donor BM was first enriched for sca-1� cells bypositive immunoselection; these were then sorted by GFP/Tie2 ex-pression using FACS. Wild-type FVB/N mice were lethally irradiated(12 Gy) and reconstituted using donor GFPTie2 mice with: (1) wholeBM, (2) Sca-1-enriched BM, (3) Tie2�Sca-1� BM, (4) Tie2�Sca-1�

BM, and 5) Sca-1-depleted BM. Four weeks post-BMT, mice receivedsubcutaneous injections of single-cell suspensions of tumor cells(TgAC). Tumors were harvested 3 weeks later and counterstainedwith fluorescent antibody to the endothelial cell marker, PECAM.Results. Tie2� cells represented 1%–2% of Sca-1-enriched BM cells.PECAM expression was detected in tumor sections from all groups.GFP expression was detected in tumors grown in animals that re-ceived whole, Sca-1-enriched, and Tie2�Sca-1� cells, but was absentfrom the Tie2� Sca-1� and Sca-1-depleted groups. Conclusions.Tie2� Sca-1�BM cells are EPCs that migrate to the site of tumorgrowth and participate in angiogenesis. This subset of BM stem cells


provides a model for the study of tumor vascularization and mayserve as a potential vehicle for antitumor strategies.

90. Timing of Oral Glutamine on DMBA-Induced Tumorigen-esis. Y. Kaufmann, M.D., A. T. Johnson, M.D., S. Luo, M.D., K.Babb, M.S., and V. S. Klimberg, M.D. University of Arkansas forMedical Sciences, Little Rock, Arkansas.

A single dose of oral 7,12-dimethylbenz[a]anthracene (DMBA) inpubertal rats causes breast tumors by 11 weeks and is associatedwith ablation of the normal gut GSH production for up to 4 weeks.We hypothesized that glutamine (GLN), known to restore the gutglutathione (GSH) production inhibited by DMBA, given only duringthis 4-week period, would prevent breast cancer initiation. Method.A total of 160 female Sprague–Dawley rats were divided to 10 groups(long-term (LT), DMBA � GLN, DMBA � FA, DMBA � H2O, oil �GLN, oil � FA, oil � H2O; and short-term (ST), DMBA � GLN,DMBA � FA, oil � GLN, oil � FA). At age 50 days old, rats receivedDMBA (100 mg/kg) or sesame oil. LT rats were gavaged daily withisonitrogenous GLN or FA or H2O the entire study. ST rats weregavaged with GLN, FA, or H2O the first 4 weeks and then H2O theremaining 7 weeks. All rats were pair fed defined chow. Rats wereeuthanized at 11 weeks and observed for tumors, and blood wasassayed for GLN, GSH, gut GLN, and GSH uptake or production(labeled C-14-PAH). Results. ST and LT GLN were equally effectivein preventing tumor formation. GLN doubled gut GSH production inLT animals compared to all other groups (P � 0.05). Control ratsdeveloped no tumors and had superior gut GSH production com-pared to tumor-bearing rats (see figures). Conclusion. Oral GLN

when given only during the 4 weeks of known gut GSH ablation hadthe same tumor prevention efficacy as prolonged GLN administra-tion. Not previously reported, GLN appears to affect the initiation oftumor formation in this model.

91. Neu Recombinant Virus Enhances Host Antigenic Re-sponse in a Murine Model of Breast Cancer. E. A. Em-paynado, M.D., A. S. Yang, B.A., E. H. Amjad, M.D., and E. C.Lattime, Ph.D. UMDNJ–Robert Wood Johnson University Hos-pital, New Brunswick, New Jersey.

Purpose. Develop adjuvant immunotherapy targeting the Her2/c-erb-2 (neu) antigen to enhance immunologic response to breastcancer. Background. A transgenic model of neu-dependent tumorgrowth was previously developed where mice developed tumorsspontaneously. We developed and characterized a transplantableneu-antigen-bearing cell line (NBT-1) from the transgenic which istumorgenic in FVB parental mice. We also cloned the rat neu geneinto a vaccinia virus (vvNeu) vector for use as a potential vaccine. Wehypothesize that NBT-1 tumor growth occurs as a result of tumorescape mechanisms, of which include the ability to inhibit properrecognition of the neu antigen and prevent the activation of adequateimmunosurvellience. The following experiments investigate the effi-cacy of vvNeu murine vaccinations to overcome these tumor escapemechanisms by introducing a neu antigen that can be properly

recognized and processed by the host immune system. Proper anti-gen presentation results in an enhanced cell mediated immunologicresponse against neu-antigen-bearing tumors. Method. In vivo ex-periments were performed in a group of white female FVB mice thatwere vaccinated subcutaneously (sc) with vvNeu and then chal-lenged with an NBT-1 tumor load through a sc injection at the samesite of vaccination. After several weeks of periodic examinations,where evidence of NBT-1 tumor growth was measured and recorded,whole spleen and serum blood samples were obtained. Splenic lym-phocytes were restimulated with NBT-1 cells and analyzed forinterferon-� (IFN-�) and IL-10 cytokine production by ELISA.Tumor-reactive serum IgG1 and IgG2A antibody isotype populationswere determined by BioELISA analysis. Results. vvNeu-vaccinatedmice did not grow any NBT-1 tumor when compared to control mice.vvNeu primed mice had an increased IFN-� production and producedpredominantly IgG2A antibody to tumor. Conclusion. We haveshown the efficacy of vvNeu vaccination to protect from NBT-1 breastcancer tumor growth. The increased IFN-� and IgG2A antibodyproduction, when compared to control and naıve mice, suggest anenhanced neu-specific Th1-cell-mediated antigenic response that leadto tumor growth prophylaxis.

92. Breast Cancer Supresses Systemic T-Cell Function. M. R.Kell, FRCS, MBCHB, J. Connelly, M.B., D. C. Winter, FRCSI,M.D., D. Beddy, FRCSI, C. Canning, M.B., W. Watson, Ph.D.,J. M. Fitzpatrick, FRCSI, MCH, and M. Kerin, FRCSI, M.D.Department of Surgery, University College Dublin, Mater Mi-sericordae Hospital, Dublin, Ireland.

Half of all patients with breast cancer will develop lymph node andsystemic metastatic disease. T cells play a central role in immunesurveillance for tumor cells and tumor-specific antigen, although it issuggested that malignant cells can subvert the immune response toavoid detection. Here in we examine the systemic T-cell response inbreast cancer patients. Forty patients undergoing surgical treatmentfor breast cancer or benign breast disease were prospectively re-cruited and preoperative blood samples were obtained. Mononuclearcells were separated using density gradient technique and activatedusing T-cell mitogens anti-CD3 or staphylococcal enterotoxin B(SEB). Following culture, interleukin 2 (IL2) and interleukin 12(IL12) ELISAs were performed to assess T-cell phenotype and in-flammatory profile. Malignancy was confirmed histologically andsystemic disease was staged radiologically. Multivariate patientcharacteristic analysis revealed no differences between patientgroups. IL2 levels were significantly depressed in cancer patient Tcells in response to SEB (1782.27 vs. 1257.08 pg/ml, P � 0.05).However, anti-CD3 and SEB IL12 levels between groups showed nosignificant difference (anti-CD3, 5.97 (�0.62) vs.7.34 (�0.86); SEB,15.8 (�2.6) vs. 15.38 (�2.8); benign vs. malignant (�SEM) pg/ml,P � 0.05). Breast cancer patients demonstrate a depressed T-cellresponse, which appears to be independent of IL12. These results notonly support the tumor “counterattack” concept but also suggest anovel systemic T-cell suppression may occur in breast cancer. Thismay be a mechanism whereby malignant cells can escape systemicimmune detection.

TRANSPLANT/IMMUNOLOGYPARALLEL SESSION

93. Local and Remote Ischemia–Reperfusion Injury Is StronglyMitigated in Transgenic Mice Overexpressing Human C-1Inhibitor. D. Inderbitzin, M.D., I. Avital, M.D., J. Burkhart, M.D.,T. Hui, M.D., and D. Candinas, M.D. Cedars-Sinai Medical Center,Los Angeles, California.

Ischemia-reperfusion injury (IRI) leads to both organ specific andremote tissue damage and is critically mediated by the activation of


the complement system. C1 inhibitor (C1-I) is the major controlelement of activation of the classical pathway of complement and animportant inhibitor of several serine proteases. The aim of this studywas to investigate the protective effects of superphysiologic intratis-sue levels of C1-I against ischemia-reperfusion injury. Adult SPFC57B/6 and C57B/6xDAB/2 transgenic human C1-I overexpressingmice were used in two series of experiments. First, lower torsoischemia (for 2 h) and reperfusion (for 3 h) was induced by clampingthe inferior vena cava and the infra-renal aorta in human C1-Itransgenic mice (n � 6) and wild type mice (n � 6). Second, liverischemia was induced by clamping the hepatoduodenal ligament for30 min in C1-I transgenic mice (n � 4) and wild-type mice (n � 4)followed by reperfusion for 2 h. 125I-labeled albumin (1.0 �Ci) wasinjected at reperfusion. Sham-operated controls (n � 10) did notundergo ischemia. To measure endothelial integrity, the permeabil-ity index (PI) was determined (CPM/mg dry tissue)/(CPM/mg blood).Results analyzed by ANOVA are expressed as means � SD. C1-Ioverexpression was confirmed by immunohistochemistry and west-ern blots. In the lower torso model, the overexpression of C1-I sig-nificantly protected against remote lung and local muscle injury, PI0.53 � 0.18 and 0.08 � 0.02, versus the wild-type, PI 0.92 � 0.29 and0.10 � 0.02, respectively (P � 0.0000397; P � 0.00359). In theischemic liver series, C1-I protected both the liver locally and theremote tissues (lung and gut). The corresponding PIs in the liver,lung, and gut were transgenic group 0.26 � 0.01, 0.46 � 0.10, and0.09 � 0.03 versus wild type 0.28 � 0.04, 0.78 � 0.07, and 0.15 � 0.07(P � 0.000071, P � 0.000046, and P � 0.00609), respectively. In bothseries, there was no significant difference between the transgenicanimals and the sham controls (P � 0.05). Our study clearly dem-onstrates that overexpression of C1-I strongly protects against localand remote IRI. This may be clinically important in the light ofrecently available recombinant C1-I.

94. Initial Angiogenic Response in Reduced Renal Mass afterTransplantation. C. Wilasrusmee, M.D., M.S.C., M. Da Silva,M.D., G. Shah, M.D., D. Bruch, M.S., J. Siddiqui, M.S., S. Kittur,M.D., S. Wilasrusmee, M.D., D. S. Kittur, M.D., S.C.D. SUNYUpstate Medical University, Syracuse, New York.

Introduction. Two major problems in transplantation are short-age of organs and chronic rejection. To reduce the shortage of kid-neys, we have proposed transplantation of two halves of one kidneyinto two recipients (hemirenal transplantation-HRT) and haveshown its feasibility in pigs and human. However, reduced renalmass can affect angiogenesis and lead to progressive renal failure asdemonstrated in a rat models. Since the renal physiology of rat isdifferent from that of large animals, we determined if reduced renalmass after transplants in large animal also affects angiogenesis.Methods. Kidney autotransplanatation was performed in domesticoutbred swine. To reduce renal mass, heminephrectomy of the trans-plant kidney and contralateral nephrectomy were performed 1 weekafter transplantation. Four weeks after transplantation, the pig waseuthanized. The hemirenal and control nephrectomy specimens wereprocessed for histologic analysis and soluble extraction. Glomerularcapillary density was measured by modified planimetric point count-ing method in four glomerular cross-sections at 20 magnification.The in vitro model of capillary tube formation utilizing culturedporcine aortic endothelial cells (PAE) on laminin-rich matrix (Matri-gel) was used to demonstrate the effect of soluble autografts extractfrom reduced renal mass on angiogenesis. Means � SEM of glomer-ular capillary density in the hemirenal specimens and controlnephrectomy specimens were analyzed by t test, with P � 0.05considered significant. Results. Glomerular capillary density wassignificantly increased in reduced renal mass after transplantation.Glomerular capillary density of reduced renal mass and controlspecimens were 33.46 � 1.61 and 20.68 � 3.13, respectively

(means � SEM, P � 0.011). Soluble extracts from reduced renalmass specimens increased capillary tube formation in the in vitrocapillary tube assay (see figure). Conclusion. This is the first studyto demonstrate the angiogenic effect of reduced renal mass aftertransplantation in a large animal model. Increased angiogenesis wasfound in this model earlier than reported in small animal models (2.5vs. 6 weeks).

95. Immunomodulation of Hepatic Ischemic Injury via In-creased Bcl-XL and Decreased Bcl-XS. K. J. Woodside, M.D.,W. Song, M.D., M. Hu, M.D., T. Meng, M.D., C. Luo, M.D., G. C.Hunter, M.D., and J. A. Daller, M.D., Ph.D. Department ofSurgery, UTMB, Galveston, Texas.

While classical ischemia–reperfusion injury is mediated by reac-tive oxygen intermediates, increasing evidence implicates T-cell-mediated apoptosis during ischemic injury in transplantation.Herein, we report the effects of polyclonal rabbit anti-thymocyteglobulin (rATG) on hepatic apoptotic mediators. Methods. Three-month-old male Lewis rats were placed under halothane anesthesiaand the portal vein cannulated. University of Wisconsin (UW) solu-tion (35 mL) with (n � 5) and without (n � 5) 20 mg/kg anti-rat rATGwas infused prior to hepatectomy. The liver was stored in UW solu-tion � rATG (143 ng/ml) at 4 °C for various times up to 24 h. Tissuelysates were analyzed by Western blotting and densitometry. Re-sults (means � SEM) were compared using the unpaired t test (*P �0.05). Results. There were early and sustained significant increasesin Bcl-XL and decreases in Bcl-XS with rATG (see figure). There was

an initial, but not sustained, significant decrease in Bax with rATG.However, there was a significant one-third decrease in caspase 9production with rATG at 0, 6, 12, and 18 h. Conclusions. Decreasedproapoptotic Bcl-XS and increased antiapoptotic Bcl-XL, as well asdecreased downstream proapoptotic caspase 9 expression, duringliver ischemia following treatment with rATG all favor cell survival.Since apoptotic ischemic injury results in allograft dysfunction, pres-ervation strategies that ameliorate such immunological effects mayimprove organ function.

96. �-2 Opioid Agonists Protect the Rodent Liver from ColdStorage, Ischemia/Reperfusion Injury. W. Chang, M.D.,M.S., J. D. Arenas, M.D., P. R. Oeltgen, Ph.D., and S. M. Rudich,


M.D., Ph.D. University of Michigan Health System, AnnArbor, MI.

Purpose. To determine if synthetic hibernation induction factors,in the form of the �-2-specific peptide DPDPE (d-phenylalanine,d-phenylalanine enkephalin) can protect the rodent liver from coldstorage/reperfusion injury. Methods. Sprague–Dawley rats weregiven a single intravenous injection of either saline (control) orDPDPE at various times prior to surgery. In other experiments, the�-2 opioid-specific inhibitor BNTX was injected 30 min prior toDPDPE. After 30 min of global warm hepatic ischemia, the liver wasmoved, perfused, and cold stored in University of Wisconsin solutionfor 6 h. Upon removal, the liver was placed onto an ex vivo liverperfusion circuit, perfused with Krebs–Henseleit buffer at 37°C, for3 h. Variables monitored included quantity and length of time of bileflow, perfusate liver function enzymes, wet-to-dry liver weight ratio,oxygen consumption, intraparenchymal resistance, perfusate cyto-kines (TNF-�, IL-1, and IL-6), and histology, including TUNELstaining for apoptosis. Comparisons were performed using Student’st test, with significance at the P � 0.05 level. Results. Rats treatedwith DPDPE prior to global hepatic ischemia, followed by cold stor-age and reperfusion, exhibited significantly prolonged bile produc-tion compared to control animals. The ability of DPDPE to protectthe stressed liver from injury was also noted by a significant decreasein hepatic enzyme release; potassium, lactate, and inflammatorycytokines in the perfusate; decreased wet-to-dry liver weight ratio;and a significant decrease in the degree of apoptosis versus animalstreated with saline alone. The specific inhibitor BNTX abolishedthese protective effects, yielding results comparable to that observedwith saline injection. Conclusions. The �-2-specific opioid agonistDPDPE, in a receptor-specific fashion, was able to manifest sig-nificant protection upon the rodent liver following a cold storage/reperfusion insult. Protection was demonstrated histologically, bio-chemically, and mechanically. These agents may find use in devel-oping new strategies to further enhance organ donor supply andtransplant outcomes.

97. Interleukin-6 Protects Ischemia/Reperfusion Injury ofSmall Bowel Transplant. K. Kimizuka, M.D., A. Nakao, M.D.,M. A. Nalesnik, M.D., A. J. Demetris, M.D., B. S. Zuckerbraun,M.D., and N. Murase, M.D. Thomas E. Starzl TransplantationInstitute, University of Pittsburgh, Pittsburgh, Pennsylvania.

Background. IL-6 is known to be an acute reactant cytokine withanti-inflammatory properties. It has been shown in a hemorrhagicshock model that IL-6 restores the intestinal barrier function. Sinceischemia/reperfusion (I/R) injury of the intestine involves destruc-tion of epithelial barrier function, we hypothesized that IL-6 wouldprotect the intestine from I/R injury and examined the efficacy ofIL-6 mutein (IL6m), a recombinant molecular variant of human IL-6,in the rat small bowel transplant (SBTx) model. Method. Syngenicorthotopic SBTx was performed in male Lewis (LEW) rats after 6 hof cold preservation in UW. IL6m (�g/kg) was given either to donors2 h before harvesting by sc injection (IL6mD) or to excised graft byluminar infusion (IL6mG). Recipients were euthanized 1–48 h afterreperfusion. Blood and grafts were obtained for IL-6 and IL-1�mRNA levels (RNase protection assay), iNOS mRNA (real-timePCR), serum IL-6 and NO levels (ELISA), and histopathology. Poly-morphonuclear neutrophilic infiltrates (PMNs) were detected byMPO stain. In addition, the efficacy of IL6m on animal survival wasstudied. Results. In the untreated control group, IL-6 and IL-1�mRNA levels rapidly increased in intestine grafts and peaked at 3 h,followed by an increase of serum IL-6, serum NO, and PMN infil-trates in intestinal grafts. IL6m treatment effectively downregulatedI/R induced cascade and significantly decreased mRNA levels forIL-6, IL-1�, and iNOS and PMN infiltrates. Histological studyshowed that the extent of erosion was significantly decreased in bothIL6m-treated groups, although there were no differences in degrees

of reepithelialization and villous congestion, when compared to con-trols. Ex vivo IL6m infusion to intestinal grafts seems to be moreeffective, and animal survival after transplantation of 6 h preservedintestinal grafts improved to 83.3% with IL6m (n � 6) from 50% incontrol (n � 8) (see table). Conclusion. IL6m is effective in protect-ing intestine grafts from I/R injury after prolonged preservation andtransplantation. The mechanisms of this treatment may involvedownregulation of IL-1� and IL-6 during I/R injury. Additionally,IL6m may function in preserving the intestinal mucosal integrity.

98. Inhibitory Regulation of Hepatic Progenitor Cells byTGF-�. J. B. Clark, M.D., J. Wang, D.V.M., L. Song, M.D., E. L.Brittain, B.S., J. H. Fair, M.D., and D. A. Gerber, M.D. Univer-sity of North Carolina, Chapel Hill, North Carolina.

Objective. We propose that TGF-�, a proapoptotic factor, inhibitshepatic progenitor cell (HPC) colony formation and survival by reg-ulating HPC proliferation and through the initiation of apoptosis.Background. Cell transplant is an emerging therapy for liver dis-ease. We have previously isolated and characterized a HPC popula-tion for cell therapy. We hypothesized that liver-related cytokinesthat are known to be present after transplantation, specificallyTGF-�, would negatively impact HPC engraftment and function.Therefore, in these experiments we investigated the regulatory ef-fects of TGF-� treatment on HPCs. Methods. HPCs were isolatedfrom adult mice using previously described separation techniquesand plated in a modified growth medium. TGF-� levels were mea-sured by routine ELISA. HPCs were analyzed using phase-contrastmicroscopy. HPCs were treated with 5 ng/ml TGF-� for 48 h andwere evaluated for cell proliferation using anti-BrdU and for apopto-sis using annexin V. Results. Control dishes demonstrated peakTGF-� expression of 110 pg/ml at day 7 with a subsequent decreaseto 24 pg/ml by day 42. Morphologic changes in the TGF-� treatedHPCs included colony contraction, cell death, and an associatedinflammatory response involving the surrounding cells. TGF-�-treated colonies demonstrated decreased DNA synthesis (13.8%) ver-sus controls (3.3%) (P � 0.05). This treatment also caused an in-crease in the number of cells undergoing apoptosis (8.6%) comparedto controls (1.8%) (P � 0.005). Conclusions. (1) The basal produc-tion of TGF-� in our routine culture conditions allows for baselineHPC proliferation and colony formation. (2) Treatment with higherlevels of TGF-� inhibits cellular proliferation compared with con-trols. (3) TGF-� treatment induces HPC death, which is partly me-diated via an apoptotic pathway. (4) Strategies for preventing theinhibitory effects of TGF-� may contribute to increased cell survivalfollowing transplant, which could result in improved engraftmentand efficacy of cell therapy for patients with liver disease.

99. Cold Ischemia Effects on ATP-Dependent MitochondrialCa2� Uptake Can Be Attenuated by Ruthenium Red. A. E.Belous, M.D., Ph.D., J. Pierce, B.S., I. Nicoud, B.S., C. W. Pinson,

TABLE—ABSTRACT 97

mRNAIL-6

mRNAIL-1�

mRNAiNOS

S-IL-6(ng/ml)

PMNs/0.09 mm2

IL6mG 6.1 � 1.6* 1.8 � 0.5* 31.2 � 22.7* 1.9 � 0.2 25.8 � 2.7*IL6mD 30.0 � 19.7 3.71 � 2.7* 128.2 � 52.6 2.7 � 1.8 25.0 � 2.0*Control 36.5 � 5.3 6.9 � 1.0 131.8 � 19.4 2.7 � 1.5 39.5 � 4.6

Note. mRNA levels expressed as %GAPDH.* P � 0.05 vs control.


M.D., M.B.A., and R. S. Chari, M.D. Vanderbilt University Med-ical Center, Nashville, Tennessee.

Purpose. Primary graft nonfunction remains a major clinicalproblem in liver transplantation. This may in part be related toaccumulation of mitochondrial calcium which has been linked toactivation of proapoptotic factors. We hypothesized that cold isch-emia increases mitochondrial Ca2� uptake via ATP utilization in aconcentration dependent fashion and that ruthenium red (RR) willattenuate these changes by inhibiting the mitochondrial Ca2�

uniporter. Methods. Rat livers perfused with 4°C UW with orwithout RR (10 �M) via the portal vein (n � 3 per group) wereprocessed immediately (no ischemia) or after 24 h of cold storage(24 h cold ischemia). Mitochondria were separated by differentialcentrifugation. ATP-dependent Ca2� uptake was determined by inthe presence of ATP (5 mM), variable [45Ca2�]. All measurementswere performed in triplicate. Student’s t test, with P � 0.05 wastaken as significant. Results. (1) ATP-dependent Ca2� uptake inmitochondria separated from livers subjected to 24 h of cold isch-emia in plain UW was higher then in mitochondria from nonisch-emic livers concentration-dependent fashion. (2) There was nodifference in ATP-dependent Ca2� uptake between nonischemicmitochondria and those separated from livers stored in UW-RR for24 hours. (3) Ca2� uptake in mitochondria from livers subjected to24 h of cold ischemia in UW-RR was significantly lower than inthose stored in plane UW Ca2� concentrations �1 �M (see figure).Conclusion. (1) Cold ischemia affects mitochondrial Ca2� han-dling especially when it is challenged by high extramitochondrialCa2� concentrations. (2) Addition of RR in preservation solutionattenuates the effects of cold ischemia on mitochondrial Ca2� handling.(3) Inhibition of mitochondrial Ca uniporter with RR protects mitochon-dria from Ca2� overload at high Ca2� concentrations. These findingsmay offer a potentially effective strategy for prevention of ischemia–reperfusion injury in liver transplantation.

100. Tissue-Engineered Juvenile Spleen Protects againstPneumococcal Sepsis. T. C. Grikscheit, M.D., J. B. Ogilvie,M.D., K. Bower, BA, E. Alsberg, M.S.E., D. Mooney, Ph.D., andJ. P. Vacanti, M.D., M.G.H. Boston, Massachusetts.

Purpose. Major necrosis of autotransplanted spleen occurs beforeregeneration in omental pouch implantation. We proposed to supplya biodegradable reticular framework and provide splenic units sizedto survive prior to vascular ingrowth in order to avoid necrotic lossand to generate a tissue-engineered spleen (TES). We challengedLewis rats with TES, splenectomy, and standard omental implant

with Streptococcus pneumoniae to compre the protective effects.Methods. A cohort of 150 g Lewis rats was divided into four groups:sham laparotomy, splenectomy, spleen slice from 6-day-old rats ac-cording to the technique of Patel et al.1 with splenectomy, and TESwith splenectomy. To create TES, spleens of 6-day-old Lewis ratswere dissected, digested, and triturated into uniform multicellularsplenic units that were implanted on the omentum on a reticularpolymer framework. After 3 months, 2 107 CFU of S. pneumoniaetype 25 was injected ip and survival curves constructed. Histologywas performed. Results. At 3 months, all animals generated visibledeep purple TES. Histology revealed organized spleen parenchymawith white pulp lacking germinal centers organized around arteriesthat stain for VWF and red pulp with venous sinuses. Survivalcurves were significantly different by log rank test (P � 0.0004; seefigure). Conclusions. TES from juvenile spleen is functional andprotects against pneumococcal sepsis. (1. J. Patel, J. S. Williams,J. O. Naim, and J. R. Hinshaw, Surgery 91, 638–641, 1982.)

VASCULAR PARALLEL SESSION

101. Graft Infectivity of Rifampin and Silver-Bonded PolyesterGrafts to MRSA Contamination. D. Schmacht, M.D., D. F.Bandyk, M.D., M. Back, M.D., D. Cuthbertson, M.S., and B. L.Johnson, M.D. University of South Florida, Tampa, Florida.

Purpose. Vascular graft infection caused by methicillin-resistantStaphylococcus aureus (MRSA) has increased in frequency and hasprompted some vascular groups to use vancomycin in their antibioticprophylaxis regimen. This experimental canine study was under-taken to evaluate the ability of polyester grafts with bactericidalproperties to resist MRSA colonization. Methods. Twenty-four adultpathogen free male dogs underwent replacement of the infrarenalaorta with either a rifampin-soaked (30 mg/ml, Gelsoft, Vascutek,Ltd.) or silver-impregnated (Ag-acetate, Intergard Silver, InterVas-cular Corp.) woven polyester graft. Following implantation, the ex-ternal graft surface was inoculated with 2 ml of 107 colony-formingunits (cfu)/ml of MRSA. Preoperative antibiotic prophylaxis con-sisted of a single intravenous dose of 500 mg of sodium cefazolin.Four grafts of each type were explanted at 3, 7, and 14 days afterimplantation. Quantitative cultures (cfu/specimen) of perigraft fluid(1 ml), graft material (1 cm segment), and adjacent aorta (1 cmsegment) were performed. Differences between graft types are ex-pressed as percentage mean log reduction in recoverable cfu com-pared to the inoculation solution concentration of 107 cfu. Results.At 3 days, explanted rifampin-soaked grafts exhibited no MRSAgrowth (4 of 4 grafts) and a �97% mean log reduction of MRSA cfufrom the adjacent aorta and perigraft fluid (PGF). At 3 days, allsilver-bonded grafts exhibited signs of infection and a mean log cfureduction of MRSA ranging from 68% (absolute range 101–103 recov-erable cfu) for the graft, 79% (absolute range 101–103 recoverable cfu)for the aorta, and 86% (absolute range 101–104 recoverable cfu) for


PGF. The 7-day rifampin group had an average log reduction inMRSA cfu of 72% (graft), 58% (PGF), and 75% (aorta). Quantita-tive cultures of 14-day rifampin grafted demonstrated continuedbacterial growth suppression with mean MRSA cfu log reductionsof 82% graft,72% PGF, and 89% aorta. Silver-bonded grafts dem-onstrated �50% mean cfu reduction in MRSA growth at 7 days(absolute range 105–107 recoverable cfu) and 14 days (absoluterange 103–107 recoverable cfu). No animal died from sepsis oranastomotic hemorrhage. Conclusions. Neither rifampin- orsilver-bonded grafts demonstrated prolonged resistance to MRSAcontamination. A rifampin-soaked graft produced a marked butshort-lived inhibition to MRSA colonization likely reflecting highconcentrations of rifampin in the perigraft space. In this caninemodel, use of a vascular graft with antibacterial properties did notprevent MRSA graft infection with quantitative cultures highestat 7 days compared to 14-day specimens. The infectivity of thesilver-impregnated grafts was high with this level of MRSA con-tamination.

102. The Temporal Impact of Flow on Vein Graft Remodeling.Z. Jiang, M.D., Ph.D., C. D. Frase, B.S., Z. S. Abouhamze, B.S.,L. Wu, B.S., C. K. Ozaki, M.D., and S. A. Berceli, M.D., Ph.D.Department of Surgery and the Malcom Randall VAMC, Uni-versity of Florida, Gainesville, FL.

Shear stress modulates vein graft (VG) remodeling throughunclear mechanisms. Using novel cuff anastomotic techniques, wetested the hypothesis that the timing of flow modulation impactsthe development and regression of VG neointima. Methods. Mul-tiple constructions were performed in the rabbit carotid/jugularsystem (n � 48). For example, bilateral VGs were placed in thefollowing low and high flow environments: (1) immediate partialdistal branch ligation (BL); (2) delayed BL at 4 weeks; and (3)delayed fistula (F) at 4 weeks. Grafts were harvested 4 weeks afterflow modulation. VG morphology, BrdU, TUNEL, and �-actinstaining were evaluated. Results. Branch ligation, independentof the temporal proximity to VG creation, resulted in 70%– 85%reduction in mean flow. Ipsilateral fistula caused �50% flow aug-mentation. In response to flow reduction, VGs exhibited a 2.5- to3-fold increase in neointimal thickening, which was temporallyindependent of graft placement. Conversely, increases in VG flowrate had no significant impact on remodeling of the mature intima(see table). Conclusions. The significant reduction in flow ob-served with BL results in a dramatic augmentation in the devel-opment of VG neointima. This impact of reduced flow is compara-ble in both freshly implanted VGs and grafts with an establishedneointima. Interestingly, however, exposure of the neointima toelevated flows does not significantly impact the remodeling pro-cess. This suggests that the established neointima may be moresusceptible to constrictive (inward) versus positive (outward) re-modeling. This model offers a powerful tool for the dissection ofhemodynamic mediated mechanisms of VG remodeling.

103. Inhibition of Endothelial Monocyte Chemotactic Protein-1Production by Ethanol. S. Sayeed, M.D., J. P. Cullen, Ph.D.,J. V. Sitzmann, M.D., and E. M. Redmond, Ph.D. University ofRochester Medical Center, Rochester, New York.

Epidemiologic studies demonstrate a protective effect of moderatealcohol consumption on the incidence of cardiovascular disease al-though the precise mechanisms involved are unclear. Monocyte che-motactic protein-1 (MCP-1) is believed to play a key role in thepathogenesis of atherosclerosis by recruiting monocytes to the sub-endothelial space. The aim of our study was to determine the effectof ethanol (EtOH) on the production of MCP-1 by endothelial cells.Methods. Human umbilical vein endothelial cells (HUVEC), pas-sages 3–5, were used in all experiments. HUVEC were pretreatedwith or without EtOH (1.0–100 mM) for 2 hr before being stimulatedwith interleukin 1-� (IL-1�, 1 ng/ml), in the absence or presence ofEtOH, for various periods of time (0.5–24 h). MCP-1 levels in culturesupernatant were determined by ELISA, and MCP-1 mRNA wasmeasured by Northern blot. Results. IL-1� significantly increasedthe production of MCP-1 by HUVEC in a time-dependent mannerfrom an undetectable level to approximately 800 pg/ml plateauingwithin 2–4 h. EtOH dose-dependently inhibited IL-1 �-stimulatedMCP-1 secretion; 25 � 1, 35 � 7, and 65 � 5% inhibition for 1, 10,and 100 mM EtOH, respectively (2 h, n � 3, P � 0.05 vs. control).Northern blot analysis revealed that IL-1� induced MCP-1 mRNAexpression above basal levels within 2 h. EtOH dose-dependentlyinhibited IL-1�-stimulated MCP-1 mRNA expression; 37 � 8 and45 � 1% inhibition for 20 and 100 mM EtOH, respectively (n � 3, P �0.05 vs. control). The inhibitory effect of EtOH (100 mM) on MCP-1mRNA expression was quantitatively similar to that of SIN-1(0.3 mM), a known nitric oxide donor that is known to inhibitMCP-1. In conclusion, ethanol inhibited IL-1�-induced MCP-1mRNA expression and protein secretion by endothelial cells. Thesedata suggest that ethanol could inhibit atherogenesis by de-creasing MCP-1 production and in turn, the crucial early stepsof monocyte adhesion and recruitment to the subendothelial spaceof the vessel wall. Whether these actions of ethanol mediate, inpart, its cardiovascular protective effects in vivo merits furtherinvestigation.

104. �5�1 Regulates �v�3-Mediated Cell Migration via theERK/MAPK Signaling Pathway. D. P. Ly, M.D., K. M.Zazzali, B.S., and S. A. Corbett, M.D. Department of Surgery,Robert Wood Johnson Medical School, New Brunswick, NewJersey.

Introduction. Integrin-mediated cell migration is essential forwound repair, angiogenesis, and neoplastic invasion. Our recentstudies have shown that expression of the integrin �5�1 inhibits cellmigration mediated by the integrin �v�3. Both the FAK and theERK/MAPK signaling pathways are required for cell migration. Wehypothesized that �5�1 may regulate cell migration by modulatingthese �v�3-mediated intracellular signaling events. Methods. CHOB3 cells (�v�3�) were transfected with a cDNA encoding the integrin�5 subunit creating CHO B3/A5 cells (�v�3�/�5�1�). Cell surfaceexpression of �v�3 and �5�1 was monitored by flow cytometry. Cellswere allowed to migrate on fibrinogen (FBG)-coated transwells for

TABLE—ABSTRACT 102

Ipsilateral Contralateral Student’s t test

Flow (ml/min) Intimal area (mm2) Flow (ml/min) Intimal area (mm2) Flow Intimal area

Immediate BL 9 � 3 1.16 � 0.28 72 � 12 0.30 � 0.10 P � 0.037 P � 0.015Delayed BL 20 � 12 0.86 � 0.03 65 � 6 0.32 � 0.06 P � 0.0001 P � 0.019Delayed F 116 � 5 0.35 � 0.11 80 � 8 0.28 � 0.03 P � 0.01 P � 0.05


5 h, with or without PD98059, an inhibitor of the ERK activator,MEK. Fixation, staining, and cell counting of three random high-power fields were used to quantify cell migration. Cells adherent toFBG for increasing times were lysed and analyzed for FAK andERK/MAPK activation by immunoblotting followed by image analy-sis densitometry. All experiments were repeated in triplicate. Re-sults. Treatment with PD98059 significantly decreased �v�3-mediated cell migration on FBG (P � 0.0001) to a level comparableto untreated B3A5 cells (figure A). Following adhesion to FBG, B3cells demonstrated a marked increase in ERK/MAPK activation com-pared to B3A5 cells. However, no significant difference was detectedin FAK activation (figure B). Conclusion. Signaling through theERK/MAPK pathway is required for efficient �v�3-mediated migra-tion on FBG. Inhibition of �v�3-mediated migration by the integrin�5�1 correlates with altered intensity and duration of ERK/MAPKactivation, but not FAK activation, in response to adhesion. Thissuggests a mechanism for the regulatory effect of �5�1 on �v�3-mediated cell migration.

105. VEGF Inhibits Mitogen-Induced Vascular Smooth Mus-cle Cell Proliferation. A. H. Dorafshar, M.D., N. Angle, M.D.,M. M. Farooq, M.D., H. A. Gelabert, M.D., and J. A. Freischlag,M.D. Division of Vascular Surgery, UCLA, Los Angeles, Cali-fornia.

Introduction. Delivery of vascular endothelial growth factor(VEGF) protein or gene transfer has been shown to accelerate reen-dothelialization and attenuate neointimal hyperplasia in variousmodels including balloon injury, stent implantation, and vein grafts.VEGF has been shown to stimulate vascular smooth muscle cell(VSMC) migration and to have no effect on VSMC proliferation.However, the effect of VEGF on mitogen induced VSMC proliferationis unknown. Methods. Human aortic smooth muscle cells wereseeded on a 96-well plate at 1 105 and serum starved for 24 h. Thecells were then stimulated with a mitogen, recombinant humanplatelet-derived growth factor (PDGF) at 10 ng/ml, and with 0, 1, 10,and 50 ng/ml recombinant human VEGF 165. A proliferation assaywas used to quantitate BrDU uptake into newly synthesized DNA.Results. PDGF induced VSMC proliferation is attenuated by VEGF165 at a concentration of 1 ng/ml (*P � 0.006), 10 ng/ml (**P �

0.009), 50 ng/ml (***P � 0.004) versus serum-starved � PDGF (n �4) (see figure). Conclusion. In addition to stimulating reendotheli-alization, VEGF appears to have a vascular protective function byinhibiting VSMC proliferation directly. This effect is present in theabsence of endothelial cells. VEGF may serve as an important mod-ulator of mitogen induced VSMC proliferation following vascularinjury.

106. Carotid Stenting Using Heparin-Coated Balloon-Expand-able Stent Reduces Intimal Hyperplasia in a BaboonModel. P. H. Lin, M.D., C. Chen, M.D., Ph.D., B. Conklin,Ph.D., N. A. Chronos, M.D., A. B. Lumsden, M.D., and S.Hanson, Ph.D. Baylor College of Medicine, Houston, Texas.

Purpose. Intimal hyperplasia remains a common mode of failurefollowing endovascular intervention. The effect of heparin on reduc-ing thrombogenicity and intimal hyperplasia following vascular re-construction has been recognized. In this study, we examined theeffect of heparin-coated balloon-expandable stent on intimal hyper-plasia following carotid stenting in a baboon model. Materials andMethods. Balloon-expandable (Palmaz-Schatz) stents were placedin bilateral common carotid arteries in 20 male baboons (meanweight 9.3 kg). In each animal, a heparin-coated (HC) carotid stentwas placed on one side while the contralateral carotid artery receivedan uncoated stent that served as a control. The carotid stents wereharvested at 1 month (n � 10) and 3 months (n � 10). Arteriographywas performed to assess the carotid patency, and intravascular ul-trasound (IVUS) was used to determine neointimal and luminalareas. Histologic and morphometric analysis and scanning electronmicroscopy were performed in the stented carotid arteries. Results.One animal was excluded in the 1-month group due to prematuredeath. All remaining stented carotid arteries remained patent at thetime of harvest. Morphometric analysis of the 1-month data showedthe HC stented carotid arteries had larger luminal areas (6%, P �0.02), less neointimal areas (25%, P � 0.01), less neointimal/mediaratios (20%, P � 0.02), and equivalent medial areas (P � 0.18) whencompared to the control group. In contrast, all control and HC stentswere patent (100%) in the 3-month group. In that group, the heparin-coated stent group had less neointimal areas (22%, P � 0.05), lessneointimal/media ratios (37%, P � 0.05), and equivalent medialareas (P � 0.92) and luminal area (P � 0.07) when compared to thecontrol group. Conclusions. Carotid stenting using heparin-coatedballoon-expandable stents reduces early intimal hyperplasia in ababoon model. This approach may represent a useful strategy forimproving luminal patency in endovascular carotid intervention.

107. Elevated Matrix Metalloproteinases Are Linked to In-creased Postinjury Intimal Hyperplasia in Hyperhomo-cyst(e)inemic Rats. J. W. Cook, M.D., R. Kenagy, Ph.D., A.Clowes, M.D., L. M. Taylor, M.D., G. L. Moneta, M.D., and S. L.Orloff, M.D. Oregon Health and Sciences University, Portland,Oregon.

Purpose. To investigate matrix metalloproteineases (MMP-2 andMMP-9) production following CCA injury in rats with hyperhomo-cyst(e)inemia (hH(e)). Background. Elevated postinjury MMP-2and MMP-9 levels have been characterized in the rat common carotidartery (CCA) balloon injury model. We have previously demon-strated a 2-4-fold increase in IH following CCA injury in rats withdiet induced hH(e). Methods. Rats fed either a hH(e)-inducing (2fo-late, 1methionine) or normal (nl) diet for 2 weeks underwent rightCCA balloon injury (left CCA—ninjured). MMP-2 and MMP-9 pro-duction were assessed in injured and uninjured CCAs by zymogra-phy (n � 6/group/time point). Results. Postinjury MMP-2 andMMP-9 levels in the nl diet injured and uninjured CCAs (controls)were consistent with those seen by others. Uninjured (baseline)hH(e) and nl diet CCA MMP-2 and MMP-9 levels were not signifi-cantly different. Peak MMP-9 production was significantly higher in


hH(e) diet CCAs compared to nl diet injured CCAs (day 1, 104 vs.20 ng, P � 0.0001) with significantly higher levels up to day 7(figure A). MMP-2 production in all injured CCAs decreased im-mediately postinjury (as expected); however, hH(e) CCA levelsreturned to baseline more rapidly than the nl diet CCAs (day 4 vs.day 14, figure B). Conclusions. In rats, hyperhomocyst(e)inemiais associated with increased MMP-2 and MMP-9 production fol-lowing CCA injury. Locally elevated MMP levels are a potentialmechanism for increased postinjury IH associated with hyperho-mocyst(e)inemia.

108. Decellularized Venous Allografts: An Immunogenic Ques-tion. P. J. Schaner, M.D., J. S. Jenoff, M.D., D. A. Popowich, B.S.,J. W. Fox, IV, M.D., J. H. Moore, Jr., M.D., S. E. Copit, M.D., andP. J. DiMuzio, M.D. Thomas Jefferson University, Philadelphia,Pennsylvania.

Purpose. Venous allografts have a high failure rate and causehost allosensitization. We hypothesize that decellularization ofvenous allografts, with proven preserved matrix strength andsuturability, decreases host allosensitization. Methods. Acceler-ated rejection of discordant Lewis (Lew) rat skin grafts placed onBrown Norway (BN) rats was used to determine host allosensiti-zation following subcutaneous implantation of venous allografts.Donor vena cava were incised longitudinally and placed into BNrecipients. Three groups were tested (n � 4) for allosensitization:(1) fresh Lew cava (discordant control), (2) fresh BN cava (concor-dant control), and (3) decellularized Lew cava (experimental).Sodium dodecyl sulfate (0.075%) was used to decellularize thecava (37°C 15 h) in the experimental group (morphometricanalysis confirmed acellularity). Following sensitization (average18 days), Lew skin grafts were then placed on each BN recipientand observed daily for rejection (re; hair loss, tissue necrosis, andeschar). ANOVA compared skin graft rejection in days. Results.Sensitization with fresh Lew venous allograft (Group 1) resultedin accelerated Lew skin graft rejection compared with those sen-sitized with fresh BN venous allograft (Group 2) (7.0 � 1.0 vs.13.8 � 3.6 days; P � 0.045), confirming allosensitization. In con-trast, those sensitized with decellularized Lew venous allograft(Group 3) displayed prolonged Lew skin graft survival comparedwith fresh Lew venous allograft recipients (10.5 � 0.5 vs 7.0 � 1.0days; P � 0.001), suggesting decreased allosensitization. In sup-port, no statistical difference was noted comparing the rejectionpatterns of the decellularized discordant (Group 3) and freshconcordant (Group 2) venous allografts (10.5 � 0.5 vs. 13.8 � 3.6days; P � 0.21). Conclusions. These results suggest that decel-lularized venous allografts limit host allosensitization. Thistissue-engineering strategy may ultimately be used to improve theclinical results of venous allograft transplantation.

POSTER SESSION

ORAL POSTERS I: EDUCATION/CLINICALTRIALS/PEDIATRICS

P1. Skill Training with Robotic Systems. H. S. Maniar, M.D.,S. M. Prasad, M.D., C. M. Chu, B.S., J. Villard, M.S., M. E.Klingensmith, M.D., and R. J. Damiano, M.D. CardiothoracicSurgery, St. Louis, Missouri.

Purpose. To compare the learning curve for a robotic surgicalsystem with traditional endoscopy in the performance of two stan-dardized skill drills. Background. Robotic systems are being usedby an increasing number of surgeons. This environment is markedlydifferent from traditional surgery and involves videoscopic guidance,remote surgical control, and the loss of haptic feedback. Defining howsurgeons learn with these systems is necessary to establish trainingprotocols for this new technology. The purpose of this study was tocompare the learning curve for a robotic surgical system with tradi-tional endoscopy in the performance of two standardized skill drills.Methods. Twenty participants (average age 27 � 4 years; six fe-males) repeated two standardized endoscopic drills for 15 repetitionswith the ZEUS robotic surgical system and manual endoscopic in-struments (MAN). Drills were designed to focus on dexterity anddepth perception. A score combining time and precision was given foreach repetition. The learning curves as well as overall performancewith and without robotic assistance were compared. Results. Forboth MAN and ZEUS, improvements in performance were signifi-cantly greatest during the first five repetitions (P � 0.01, for both).Participants reached the training curve plateau faster with ZEUSversus conventional instruments (8th vs. 10th for both drills). Usingrobotic assistance, dominant and nondominant hand performancewere statistically similar. The number of errors committed withZEUS were significantly fewer for drill two (0.09 errors/repetitionversus 0.24 errors/repetition, P � 0.002). Conclusions. This studydemonstrated that the training curves for conventional and roboticassisted systems are remarkably similar and this should prove use-ful in the training and education of this new technology. This studyfurther suggests that robotics may increase ambidexterity by im-proving nondominant hand performance and surgical precision.

P2. Lifestyle and Workload Influence Student Interest in Sur-gical Careers. S. Melby, M.D., A. Cochran, M.D., and L. A.Neumayer, M.D. Department of Surgery, University of Utah,Salt Lake City, Utah.

Purpose. The aim of this descriptive study is to investigate factorsinfluencing the specialty choices of graduating medical students. Wespecifically address characteristics of general surgery residency andpractice and their influence on student interest in surgical careers.Methods. We created an Internet-based survey for fourth-year med-ical students. Administrators at 70 LCME-accredited medicalschools received notification of the survey via electronic mail. Thesurvey used a 5-point Likert scale (1 � strongly negative influence,5 � strongly positive influence) to describe the impact of variouscharacteristics of general surgery residency and practice on medicalstudent specialty selection. We evaluated the same characteristics oftheir chosen nonsurgical careers for those students who selectedother residencies. Mean responses for each scaled question werecompared to the neutral value of 3 using Student’s t test. Results arereported as means � SD. Results. A voluntary convenience sampleof 408 students from 16 medical schools completed the survey. De-mographics and specialty choices of participating students were con-sistent with published AAMC data. A total of 37 students (9% ofrespondents) selected general surgery as their specialty. Studentsselecting surgical careers (surgery) and those selecting nonsurgicalcareers (nonsurgery) viewed the lifestyles of surgical residents (LSR)


and surgical attendings (LSA) as negative influences on specialtyselection (LSR surgery 2.11 � 0.84; LSR nonsurgery 1.50 � 0.78;LSA surgery 2.54 � 0.87; LSA nonsurgery 1.95 � 0.94; all P values �0.005). All respondents indicated that workload during surgicalresidency (WSR) was a negative influence on their interest in asurgical career (WSR surgery 2.51 � 0.93; WSR nonsurgery 1.71 �0.86; P for both � 0.001). Students entering nonsurgical careersperceived the lifestyle (LNR) and workload (WNR) of residents andthe lifestyle (LNA) and workload of practicing physicians (WNA) intheir chosen specialty as positive influences (LNR 3.96 � 0.95; WNR3.68 � 0.89; LNA 4.18 � 0.91; WNA 3.95 � 0.90; all P values �0.001). Conclusions. Lifestyle and workload considerations arestrongly associated with contemporary medical student specialtyselection.

P3. Do the Best Students Go into General Surgery? R.Callcut, M.D., M. Snow, Ph.D., B. Lewis, R.N., and H. Chen,M.D. University of Wisconsin Medical School, Madison, Wis-consin.

Background. Recent match trends by U.S. medical graduateshave revealed a declining interest in general surgery residencies.Thus, recruitment of the highest quality students continues topresent challenges to all programs. Our study evaluates the aca-demic strength and residency selection of recent graduates todetermine the quality of those matching to general surgery resi-dencies. Methods. All third year students rotating through thesurgical clerkship from July 1998 to June 2000 (n � 291) werefollowed at a public midwestern medical school. Each studentcompleted a 4-week general surgery rotation and a 4-week surgi-cal subspecialty rotation. Operative case logs for each studentwere recorded. Residency selection was obtained from match dataand divided into: general surgery (GS) (n � 13), surgical subspe-cialty (SS) (n � 33), and nonsurgical (NS) residencies (n � 214).Student performance was based upon NBME surgery exam, classrank, and AOA status. Results. Students at our institution scoredat the national mean on the NBME exam. GS team, session, andtiming of GS rotation had no statistically significant relationshipwith exam score. Total number of operative cases observed wasinversely related to exam performance (� mean, 30 � 1.3, � mean35 � 1.7; P � 0.02). Overall, 15.8% matched into a surgicalposition with 4.5% in a categorical GS position. Of those studentsentering a GS career, 53.8% scored below the mean, 46.2% grad-uated in the bottom two-thirds of the class, and 23.1% were AOAmembers. Most students scoring above the mean or in the topthird of the class choose NS residencies. Only 6.4% of AOA mem-bers entered a GS residency (see table). Conclusion. Many of thestrongest students do not choose GS careers. Of those entering aGS residency, most score below average on the NBME exam, alarge number graduate in the bottom two-thirds of the class, andonly a small percentage are AOA members.

P4. Graduated Competency Assessment: An Internet-BasedTool for Measuring Surgical Resident Competency. S. R.Schell, M.D., Ph.D., D. S. Lind, M.D., and T. C. Flynn, M.D.Department of Surgery, Gainesville, Florida.

Objectives. Surgical residents have historically increased clinicaland operative responsibilities during successive training years. How-ever, surgical educators have not yet implemented consistent meth-odologies for assessing competency with each level of responsibility.ACGME regulations dictate resident evaluations based upon six“competencies,” and anticipating further limitation of surgery resi-dent work hours, we felt an urgent need for tools to systematicallyassess clinical and technical competencies for our residents. Thisproject describes development of: (1) graduated competency assess-ments (GCA) for each PGY level; (2) Internet-based tools for facultyassessment and “sign-off ” of resident GCA proficiencies; and (3)models for comparing resident perception of their competency withfaculty GCA assessments. Methods. Building upon the ACS’s re-port, “Prerequisite Objectives for Graduate Surgical Education,” wedeveloped a three-category model for assessing surgical residentcompetencies including: (1) patient assessment and management; (2)organ-specific topics; and (3) professionalism and communication.Each category contains multiple knowledge and proficiency assess-ments at each PGY level, and our model has residents approachsupervising faculty for “sign-off ” when they that feel they haveachieved proficiency for a GCA item. Our previously implementedinternet-based 360° resident evaluation provided verified tools, easeof use, and data integrity as a platform for integrating the GCA.Resident and faculty perceptions of competency were compared, anduser satisfaction was surveyed. Results. Subjective resident percep-tions of implementing GCA were “strongly positive,” as they per-ceived clear educational goals and objectives defined for each PGY.Faculty perceptions were likewise positive, as GCA would providedefined criteria to assist in rotation-end resident evaluations. Thesecure Internet-based model provided an ideal method for proficiencytracking, authentication, and analysis. Conclusions. This projectdefines a global methodology for assessing surgical resident compe-tency. ABMS and other accrediting bodies have a stated desire for“maintenance of competency” tools, and we view the GCA as apotential “first step” in longitudinal competency assessment andmaintenance throughout surgeons’ career.

P5. Bioactive Skin Substitutes for Pediatric Burn Manage-ment: A Cost-Effective Treatment That Reduces Pain.J. R. Lukish, M.D., K. D. Newman, M.D., M. Pao, M.D., G.Pratch, R.N., C. Sutter, R.N., P. Johnson, R.N., and M. R. Eich-elberger, M.D. Children’s National Medical Center and The Na-tional Naval Medical Center, Bethesda, Maryland.

Purpose. Pediatric burn care is resource-intensive. The currenttrends in health care financing have created a heightened need foreffective and cost-efficient treatment modalities. We introduced aprotocol using a bioactive skin substitute, Transcyte, that decreasedthe inpatient length of stay in pediatric burns. The purpose of thisstudy was to determine if this protocol was cost-effective and reduced

TABLE—ABSTRACT P3

Field

NBME scoreClass rank Residency choice

% � mean % � mean% in topone-third

% in middleone-third

% in bottomone-third % � mean

% in topone-third AOA

GS 46.2 53.8 53.8 38.5 7.7 4.8 6.2 6.4SS 66.7 33.3 71.9 25.0 3.1 17.5 20.4 23.4NS 42.5 57.5 38.2 43.9 17.9 77.7 73.5 70.2

P � 0.035 P � 0.01 P � 0.01 P � 0.01 P � 0.01


pain when compared to children treated with standard burn woundmanagement. Methods. As part of a institutionally approved proto-col, all children admitted over a 12-month period with a partialthickness burn underwent Transcyte application (n � 125). Thisgroup was compared to children who were treated with standardburn wound management (standard) over the preceding year (n �188). Age, percentage of total body surface area of burn (% TBSA),length of hospitalization (LOS), hospital charge per case (charge),and narcotic use per case data was analyzed. Results. There was nosignificant difference between the age and percentage of TBSA burnbetween the children who received standard care and those receivingTranscyte (3.2 years and 8.0% vs. 3.6 years and 9.2%). The LOS wasreduced from 10.7 to 3.4 days in the standard care versus Transcytegroup, respectively. The charge was significantly reduced from$26,267 in the standard care group to $16,865 in the Transcyte group(P � 0.05). The narcotic use per case was reduced from 13.9 units percase to 2.2 units per case in the Transcyte group (P � 0.05). Con-clusion. The use of Transcyte to treat pediatric burns reduces thelength of hospitalization resulting in a 36% reduction in hospitalcharges per child. Transcyte application minimizes pain and signif-icantly reduces narcotic use in burned children by 84%. This studysupports the use of Transcyte as a cost effective treatment thatreduces the pain associated with pediatric burns.

P6. Surgical Resection for Gastric Cancer in Older Patients:Is There a Difference in Outcome? R. F. Saidi, M.D., J. L.Bell, M.D., and P. S. Dudrick, M.D. University of Tennessee,Knoxville, Tennessee.

Early and long-term outcome of gastrectomy for gastric cancer inelderly patients has been a subject of controversy. The aim of thisstudy was to compare outcome and survival after gastric resection inpatients older and younger than 70 years of age. Methods. A retro-spective review of clinical data was carried out for patients un-dergoing gastrectomy for gastric cancer during an 11-year period(1990–2001). Patient demographics, tumor characteristics, operativemorbidity and mortality, length of stay, and readmission were iden-tified. Statistical comparisons were made with �2, Student’s t test,and one-way ANOVA. Results. A total of 48 patients underwentgastrectomy for gastric cancer, 24 in each group. There was nodifference in tumor location, size, grade, histologic type, lymph nodeinvolvement, lymphovascular invasion, or stage. In the older group,18 patients (75%) underwent subtotal gastrectomy and 6 (25%) hadtotal gastrectomy versus 66.7 and 33%, respectively, in the youngergroup (P � 0.5). Five-year survival was 12.5% in the older groupversus 20.8% in the younger group (P � 0.45). Overall survival forolder (21.1 months) versus younger (28.6 months) patients was sim-ilar (P � 0.4). Comorbidities were present in 50% of older and 39% ofyounger patients (P � 0.45). Postoperative mortality and morbiditywere 8.3 and 33.3% in older patients versus 4.2 and 33.3% in theyounger group (P � 0.4 and 1.0). The most common causes of mor-bidity in both groups were wound infection and pneumonia. Themedian postoperative length of stay was 15 days (95% CI 11–19days) in older patients versus 18 days (13–22 days) in youngerpatients (P � 0.3). Readmission rates were 41% in both groups. Atotal of 66.7% of readmissions were due to posoperative complica-tions and 33.3% were for cancer recurrence for both groups. Con-clusions. Gastrectomy can be done safely in elderly patients withgastric cancer. Early and long-term outcomes in elderly patients arecomparable with younger patients.

P7. Current Opinion Regarding the Use of Computed Tomog-raphy (CT) for the Diagnosis of Acute Appendicitis (AA).I. Sarkaria, M.D., S. R. Eachempati, M.D., M. J. Weyant, M.D.,L. J. Hydo, R.N., M.B.A., C. A. Barie, D. J. Boffa, M.D., and P. S.Barie, M.D. New York Presbyterian Hospital, Weill MedicalCollege of Cornell, New York City, New York.

Objective. CT for the diagnosis of AA (CTA) has become popular,in part because of studies that suggest that adherence to a specificimaging protocol may yield 98% accuracy. However, several studiesindicate that the true accuracy of CTA is lower, especially if thewhite blood cell count is normal, rectal contrast is not used, or thereader is inexperienced. We determined the current knowledge ofand attitudes regarding CTA among practicing surgeons. Methods.A total of 2000 questionnaires were sent randomly to general sur-geon Fellows of the American College of Surgeons. Questions de-tailed the surgeon’s practice, experience, and hospital characteris-tics, as well as the methodology and interpretation of CTA at theirinstitution. The existence of a formal CTA protocol, its characteris-tics, and radiologist availability for CT interpretation were deter-mined (mean � SEM, �2, ANOVA, P � 0.05). Results. Response ratewas 27%. Age was 51 � 1 years, 60% were “general surgeons,” and9% were “laparoscopic surgeons”; all but four surgeons performed26 � 1 appendectomies (appy) in the past year. A total of 77%perform laparoscopic appy, but only 42% for more than one-half ofcases. A total of 62% believe that CTA is overutilized; 43% obtainCTA in �25% of patients and 62% in fewer than 50% of patients.CTA is most often ordered by an emergency medicine attendingphysician (63%) and most often interpreted by an attending radiol-ogist (69%). A total of 74% of respondents believe that the accuracyrate of CTA is less than the claimed 98%; those who disbelieve areless likely to utilize CTA (P � 0.0001). Only 36% had access to CTAby protocol; those surgeons were more likely (P � 0.0001) to knowprotocol details (e.g., slice thickness 3 mm). Conclusions. Practicingsurgeons are skeptical of the role of CTA for the diagnosis of AA.Incorporation of CTA into practice is not widespread, perhaps be-cause CTA by protocol is unavailable to most surgeons.

P8. Relationship of Gelsolin Levels to Outcomes in CriticallyIll Patients. S. O. Rogers, M.D., M.P.H., E. Kelly, M.D., S.Hashmi, M.D., L. Drager, R.N., P. Lee, M.D., T. Stossel, M.D.,and F. D. Moore, M.D. Brigham and Women’s Hospital, Boston,Massachusetts.

Purpose. Measurement of gelsolin level depletion may be a prom-ising candidate for the early assessment of the severity of criticalillness. Background. Following trauma or critical illness, secondary


organ injury, especially to the lung, is a frequent complication. Wepropose to determine the predictive value of reductions in thelevel of a blood protein called plasma gelsolin. Since plasma gel-solin depletion may precede secondary organ injury, measurementof plasma gelsolin might be a biologic marker for increased like-lihood of prolonged ventilatory support and/or mortality. Meth-ods. We have studied 12 human subjects who are adult patients18 years of age or older. Inclusion criteria included patients whosuffered trauma and have injury severity scores � 15 and patientswho have undergone major surgery requiring ICU admission.Demographic and clinical variables were collected. Gelsolin levelswere measured upon ICU admission and daily for 5 days. Thestudy endpoints included the clinical outcomes of number of dayson the ventilator and 30-day mortality. Mean gelsolin levels � SDwere compared using t test with unequal variances. Results.Gelsolin levels in healthy volunteers average 232 � 40 ng/ml. Theaverage age of the subjects was 44.5 years. Sixty-seven percentwere male. As shown in the figure, all subjects studied have lowgelsolin levels compared to normal (P � 0.002), but variably low.Most importantly, the values remain fairly constant over a 6-dayperiod, suggesting that plasma gelsolin measurements do notfluctuate over time. Survivors averaged gelsolin levels of 75 � 26.4ng/dl, while nonsurvivors had the lowest sustained gelsolin levels,32.7 � 6.4 (P � 0.001). Conclusions. Low gelsolin levels maypredict at risk patients who require novel therapies, for example,activated protein C, to lower mortality.

P9. Using A Human Factors Approach to Improve Quality ofCare and Outcomes In Surgery. C. K. Christian, M.D.,M.P.H., M. M. Dierks, M.D., E. M. Roth, Ph.D., T. B. Sheridan,S.C.D., K. Dwyer, M.S., T. K. Gandhi, M.D., M.P.H., S. W.Ashley, M.D., M. J. Zinner, M.D., and M. L. Gustafson, M.D.,M.B.A. Brigham and Women’s Hospital, Boston, Massachusetts.

Introduction. Human factors analysis, which has been used toidentify potential vulnerabilities in other complex work environ-ments such as the airline and nuclear reactor industries, can beextended to the operating room (OR). The purpose of this studywas to test the feasibility of these previously validated techniquesas an innovative approach to identifying factors that place asurgical patient at increased risk for adverse events. Methods. Ina pilot series of 10 cases, a surgeon and a human factors engineerrecorded the activities, communications, information flow, andtask execution of the surgical team from the preoperative periodthrough the recovery room. A set of potential contributing factorswas developed to code each observation. Time, frequency, dura-tion, and consequences were documented for each event to enablecase reconstruction. A software application was developed to en-code the qualitative observations and contributing factors into astandardized format so that quantitative analysis could be per-formed. Results. A delay during the preoperative phase of thecase typically became compounded, leading to longer operativetimes and more handoffs of care when compared with nondelayedcases. Other factors that appear to influence performance includetime of day, number of shift changes, specific room assignment,and familiarity of staff with the procedure, other team members,and equipment. Communication factors, primarily as related to ashared operative plan and handoffs, were particularly important.A number of compensatory strategies were noted that mitigatedthe effect of potentially negative contributing factors. Conclu-sions. Using a novel approach, we have identified factors thatinfluence surgical team performance and may increase the risk ofadverse events. In response to these system vulnerabilities, ORstaff members typically compensate, and the potential adverse

event is averted. Our methods of analyzing contributing factorsand compensatory actions reveal that patient safety often dependson individual provider defenses. The techniques described in thisstudy can be used to further identify and improve contributingsystems factors so that the burden of patient safety no longer fallsso heavily on individual providers in a vulnerable environment.

P10. Intraoperative Total Serum Calcium Levels, Unlike Pre-operative Intact PTH Levels, Do Not Correlate withCure of Hyperparathyroidism. R. Quiros, M.D., C. Valen-tine, M.D., and R. A. Prinz, M.D. Rush Presbyterian St. Luke’sMedical Center, Chicago, Illinois.

Introduction. Intraoperative intact parathyroid hormone (iPTH)monitoring is useful in the operative management of hyperparathy-roidism. Recent studies suggest that measurement of intraoperativetotal serum calcium (TSC) levels may be a less expensive and moreavailable method of intraoperative guidance during neck dissectionthan iPTH levels, the gold standard. We compared the accuracy ofTSC to iPTH in predicting surgical cure during parathyroidectomy.Patients and methods. From September 1, 2001, to May 31, 2002,a total of 60 parathyroidectomies were performed. iPTH and TSCwere measured at the start of the operation and 5 and 10 min aftergland removal. Data were compared, and statistical analysis wasperformed using �2 analysis to determine if the decrease in TSC wassignificant. Results. The mean baseline iPTH level (367 � 463pg/ml) dropped by 69% 5 min after removal of the abnormal glands(91 � 102 pg/ml) and by 86% at 10 min (38 � 37 pg/ml). The meanbaseline TSC level (10.1 � 0.9 mg/dl) dropped by 4% at 5 min afterremoval of the abnormal glands (9.6 � 0.9 mg/dl) and by 5% at 10min (9.6 � 0.9 mg/dl). iPTH dropped by �50% in 50 patients at 5 minand in all 60 patients at 10 min after gland resection. In 2 patients,TSC increased above baseline at 5 min and then decreased belowbaseline at 10 min. In 6 patients, TSC increased above baseline at 5min and remained above baseline at 10 min. In 2 patients, TSCremained the same at baseline and at 5 min and then decreased at 10min. In 1 patient, TSC remained the same at baseline and at 5 minand then increased at 10 min. In 14 patients, TSC decreased belowbaseline at 5 min and then remained the same at 10 min. In 2patients, TSC decreased below baseline and then increased abovebaseline at 10 min. Finally, in the remaining 33 patients, TSCdecreased below baseline at 5 min and remained below baseline at 10min. Conclusion. The decrease in TSC during parathyroidectomy, ifpresent, is minimal. In addition, unlike iPTH levels, TSC levels aftergland resection do not consistently decrease at 5 and 10 min. Whileattractive in terms of cost and availability, intraoperative TSC levelsare not clinically reliable in confirming removal of abnormal para-thyroid tissue.

P11. Why Do Young Breast Cancer Patients Have Worse Out-comes? M. A. Maggard, M.D., K. E. Todd, M.D., J. H. Liu,M.D., and K. Y. Clifford, M.D., MSHS. UCLA Medical Center,Los Angeles, California.

Background. Although younger breast cancer patients tend to havepoorer survival, it remains unclear whether this is due to more ad-vanced stage or more aggressive disease. Due to the low prevalence ofbreast cancer in young patients, prior studies have had limited samplesizes. This study uses a population-based cancer registry to investigatewhy young breast cancer patients have worse outcomes. Methods.Using SEER breast cancer data (1992–1997), young patients (�35years old, n � 3,919) were compared to a group of postmenopausalpatients (50–55 years, n � 16,654). Survival analysis was performed


using patient demographics and tumor characteristics. Results. Stage-specific survival was worse for young patients compared to older pa-tients (Stage I, 86.1 vs. 91.8%; Stage II, 73.0 vs. 81.3%; Stage III, 58.3vs. 66.8%; P � 0.002 for all stages). Younger patients present with moreadvanced disease than older patients (Stage I, 27.1 vs. 44.7%; Stage II,48.1 vs. 36.3%; Stage III, 9.7 vs. 6.9%; P � 0.001 for all stages).Additionally, younger patients had more aggressive tumor char-acteristics per stage; that is, higher grade tumors and more es-trogen and progesterone receptor negative tumors (P � 0.001 forboth findings). A multivariate analysis showed that receptor sta-tus was the most important predictor of survival for patients withStage II disease. Conclusions. Our findings show that youngerbreast cancer patients have poor outcomes because they presentwith later stage disease and stage per stage have more aggressivetumors. To address these issues, physicians need to have height-ened awareness when evaluating breast abnormalities in thispopulation, and increasingly efficacious adjuvant therapies needto be developed.

P12. Does Higher Volume Predict Important Outcomes OtherThan Mortality? C. Y. Ko, M.D., M.S., MSHS, M. Maggard,M.D., and D. Zingmond, M.D., Ph.D. UCLA School of Medicine,Los Angeles, California.

Introduction. Most volume-outcome studies use mortality(usually inpatient) as the outcome variable; however, many sur-gical procedures have low death rates. The objective of this studywas to determine the relationship between hospital volume andother clinically relevant discharge-related outcomes, for example,length of stay (LOS), and discharge facility type, like skillednursing facility (SNF). Methods. Using the California StateHospital Discharge Database, all cases of colorectal cancer(CRC) resections from 1995 to 1999 were collected. Hospital vol-ume was divided into four groups: �20, 21– 40, 41–75, and �75CRC resections per year. Statistical analyses were performed toidentify the effect of volume on LOS (days), discharge facility(home, SNF, rehabilitation facility), and death. Comorbidity wasadjusted for using a modified Charlson comorbidity index. Subse-quent multivariate analyses were used to assess how good apredictor hospital volume is— compared to other clinically rele-vant variables. Results. A total of 56,704 CRC resections wereincluded in the analyses. Using bivariate analyses, LOS, dis-charge facility type, and mortality differed statistically by hospi-tal volume (see table). However, it should be noted that whenanalyzed with an adjusted model (i.e., multivariate regressionanalyses), comorbidities, surgical acuity, and age were all betterpredictors than hospital volume of LOS, discharge facility type,and death. Conclusions. While we found that higher volumes arestatistically associated with improved discharge-related results,the relative importance of volume was small compared to comor-bidities, surgical acuity, and age. While the implications of theseresults are controversial, high volume is still likely a proxy forgood process of care.

P13. The Prevalence of Sphincter-Sparing Procedures in Pa-tients with Rectal Cancer: We Can Do Better. C. Y. Ko,M.D., M.S., MSHS, J. Liu, M.D., D. Etzioni, M.D., and M.Maggard, M.D. UCLA School of Medicine, Los Angeles, Cali-fornia.

Introduction. Sphincter-sparing procedures (SSP) for rectal can-cer are preferred because of the avoidance of a colostomy and betterquality of life. In fact, the performance of an SSP is now being usedan outcome measure and an indicator of surgical “quality.” Since nopopulation-based study has been performed regarding SSPs, we ex-amined national rates of SSP versus abdominal–perineal resection(APR) over the past 15 years. Areas for improvement were identified.Methods. All patients with rectal cancer undergoing either SSP orAPR from 1983 to 1998 were identified in the SEER database. Ratesof both procedures were compared over three time periods (1985–1989 vs. 1990–1994 vs. 1995–1998), controlling for age, sex, race,and other variables. Predictors of SSP performance (or lack thereof)and survival were analyzed. Results. In 13,484 rectal cancer pa-tients, average age was 67 years; 58% were male. Over the three timeperiods, SSP use increased (47% to 53% to 60%, P � 0.001). Whilefemales had more SSPs (57 vs. 49%, P � 0.0001), younger patients(�60 years) were less likely to have SSPs (P � 0.01). Racial dispar-ities were also observed. For example, the use of SSP for stage 3rectal cancer in Whites, Blacks, and Hispanics was 56, 44, and 45%,respectively (P � 0.02 vs. Whites). Noteworthy, stage-specific, 5-yearsurvival was better for SSP versus APR (P � 0.01). Conclusions. Inthe United States, while the use of sphincter-sparing procedures forrectal cancer is increasing, areas of disparity are seen. Improvedquality of life, and possibly improved survivals, may be achieved byfurther increasing the use of SSPs and by recognizing and address-ing the areas where improvements may be made. This study hasidentified some of these areas.

P14. RNA Interference of FAK in Primary Dermal Fibro-blasts. M. A. Carlson, M.D., R. E. Lewis, Ph.D., M. T.Longaker, M.D., and J. S. Thompson, M.D. University of Ne-braska Medical Center, Omaha, Nebraska.

Introduction. Inhibition of gene expression with short interfer-ing RNA (siRNA) duplexes, known as RNA interference (RNAi), hasbeen described in established cell lines. We hypothesized that wecould inhibit focal adhesion kinase (FAK) expression with RNAi inprimary dermal fibroblasts. Methods. Subconfluent monolayer hu-man fibroblasts (neonatal foreskin) were treated with transfec-tion vehicle (OligofectAMINE; 0.5% in 300 �l; 24-well plate) or ve-hicle � 200 nM RNA duplex (AAUGGAGCGAGUAUUAAAGGU,corresponding to bp 328–348 of the human FAK gene) for 4 h.Relative FAK expression was calculated from densiometry of FAKand tubulin immunoblots. The experiment was performed twice withsimilar results. Results. Transfection of the FAK-specific RNA du-plex resulted in virtually complete suppression of FAK expression

TABLE—ABSTRACT P12

Variable �20 21–40 41–75 �75 P value

LOS-colon 9.8 9.7 9.1 8.8 �0.001LOS-rectal 9.2 8.8 8.6 8.0 �0.001D/C home (%) 62.6 66.7 70.0 72.1 �0.001D/C SNF (%) 18.4 15.9 14.3 12.6 �0.001D/C rehab (%) 1.05 0.98 0.71 0.41 �0.001Hospital death (%) 4.70 3.55 2.70 2.41 �0.001Comorbid index 0.93 � 1.2 0.96 � 1.3 0.91 � 1.2 0.90 � 1.2 �0.06


5–6 days after transfection (see figure). Tubulin expression wascomparable between the control and siRNA-treated cells. Lysate(protein) of the treated cells was within 20% of the control value onany given day (data not shown). Conclusions. Treatment of humandermal fibroblasts in monolayer with siRNA specific for FAK re-sulted in specific knock-down of FAK expression. RNA interference isa novel technique which has great potential in the field of genesilencing; we have demonstrated its feasibility in primary human cells.

P15. A Role for the Connective Tissue Enzyme, Semicar-bazide-Sensitive Amine Oxidase (SSAO), in Wound Heal-ing. P. J. Boor, M.D., H. J. Hawkins, M.D., Ph.D., M. B. Trent,B.S., Y. Yang, M.D., and D. N. Herndon, M.D. University ofTexas Medical Branch, Galveston, Texas.

Semicarbazide-sensitive amine oxidase (SSAO) is a connective tis-sue and serum enzyme that has been littlestudied. Serum SSAOlevels are markedly depressed in patients with severe burns, andrising serum SSAO activity correlates with improved recovery. Ourrecent studies have shown that SSAO is essential for the develop-ment of elastin/collagen in connective tissues. Furthermore, aging-related decreases in SSAO activity may in part be responsible fordefective ability to form mature connective tissue in aging patients.Methods. We examined SSAO alterations in human skin biopsies (1week to 1 year) by immunohistochemistry, biochemical measure-ment of SSAO activity, and Western immunoblot analysis usinghighly specific antibodies to SSAO. Specimens included normallyresolving cutaneous burns, hypertrophic scars, and keloids. Results.In normal skin or acutely following a burn (1 week) little or no SSAOstaining was seen. However, at 3 weeks postburn, diffuse staining ofboth fibrovascular cells and interstitial tissues in the granulationtissue of healing burns became evident. At 3 months postburn, therewas diffuse staining for SSAO in fibroelastic scar tissue. Keloidsexamined up to 1.5 years postburn showed the most prominentSSAO expression of any tissue by Western blot. The highly cellular,proliferative areas of keloids showed intense intracellular SSAOstaining, suggesting that increased, persistent SSAO plays a role information of abnormal keloid connective tissues. Conclusions.These preliminary findings are consistent with our hypothesis thatSSAO plays a major role in the formation and maturation of connec-tive tissue components following burn injury of the skin. Most im-portantly, hyperexpression of SSAO is associated with the abnormalconnective tissue formed in keloids. It is our hope that such studiesmay eventually lead to therapeutic manipulation of SSAO to improveoutcome, enhance wound healing, and—potentially—prevent keloidformation in the burn patient.

P16. L-Arginine Induces Wound Healing through MultiplePathways in the Diabetic Wound Model. R. P. Hanson, N.Sharifi, A. M. Byrne, D. C. Winter, and D. Bouchier-Hayes.

Introduction. It is well known that arginine, a unique substratefor inducible nitric oxide synthase (iNOS), improves wound healingin the normal and streptozotocin induced diabetic Sprague–Dawleyrats. Aim. To investigate the effect of arginine on the expression ofdifferent proteins, cytokines, over time in the wound microenviron-ment over time, post-surgical insult. Methods. A total of 85 male

Sprague–Dawley rats were used in this study. Sixty rats were ren-dered diabetic 7 days prior to surgery by a single intraperitonealinjection with streptozotocin (70 mg/kg). Twenty-five rats served ascontrols. All animals under went a 7-cm dorsal incision and insertionof polyvinyl-alcohol sponges. Thirty of the diabetic rats received 1g/kg/day L-arginine in three divided doses by intraperitoneal injec-tion. The remaining diabetic rats received an identical volume ofnormal saline also by intraperitoneal injection. Animals were eutha-nized on Days 1, 3, 5, 7, and 10. Results. We could demonstrateincreased wound healing in the arginine supplemental group usinghydroxyproline content as a parameter. The iNOS protein content inboth diabetic groups was elevated at Day 1 compared to the controlgroup (P � 0.05). The arginine-supplemented group maintained anelevated iNOS protein concentration that matched the control groupthroughout the experiment. The diabetic group failed to maintainthis level and iNOS protein content decreased over time, reaching asignificant difference at Day 7 compared to both the diabetic plusL-arginine group (P � 0.05) and the control group (P � 0.05). Thelevel of transforming growth factor-�1 (TGF-�1) increases slowlyover time in all groups. At Day 10, TGF-�1 in the diabetic plusarginine group is elevated toward the normal with significant differ-ence compared to the diabetic group, (P � 0.05). Conclusion. Therole of arginine in wound healing is multiple, while providing asubstrate for the iNOS/arginase pathway it also induces transform-ing growth factor-�1 late in wound healing.

P17. Effect of Vacuum-Assisted Closure Device on RectusMuscle Pedicle Flap Venous Outflow. A. M. Conquest,M.D., J. H. Garofalo, M.D., D. M. Maziarz, M.D., Y. Sun, M.D.,K. Salleng, D.V.M., W. A. Wooden, M.D., FACS, W. M. Mead-ows, M.D., L. W. Nifong, M.D., and W. R. Chitwood, M.D.,FACS. Department of Surgery, Brody School of Medicine, EastCarolina University, Greenview, North Carolina.

Introduction. The vacuum-assisted closure device (VAC) hasbeen shown to accelerate granulation tissue formation. We hypoth-esized that VAC-negative pressure adversely effects pedicle flapvenous return and would preclude use of a VAC with a muscle flap.Methods. After institutional approval was obtained, 12 anesthe-tized pigs were divided into three groups. A rectus muscle pedicleflap was rotated over an open sternotomy wound. A laser flowmeterwas placed on the superior epigastric vein and the VAC was appliedto the wound. The pressures for Groups 1, 2, and 3 were 50 mm Hgconstant, 125 mm Hg constant, and 125 mm Hg intermittent, respec-tively. Venous flow from the rectus muscle pedicle flap was moni-tored for 1 h during this acute study. Significance was determined byt test. The flap and control (contralateral rectus muscle) were har-vested and histologic analysis was obtained. Results. The averagevenous outflow for the 12 animals was 13.8 � 3.1 (ml/min/100 gtissue) (mean � SD) prior to negative pressure application and15.5 � 5.4 (ml/min/100 g tissue) after 60 min of negative pressure(P � 0.165). No group experienced a decline in venous outflow duringVAC function. On histologic examination, both flaps and controlsshowed comparable degrees of minimal to mild focal myocyte degen-eration. Conclusions. Placement of a VAC over a rectus musclepedicle flap does not significantly impair venous outflow from theflap and does not result in histologically significant ischemic injuryor venous infarct to the flap.

P18. Slit-3 Null Mouse Is a Model For Pulmonary Hyperten-sion Secondary to CDH. S. E. McLean, M.D., W. Yuan,Ph.D., R. Knutsen, B.S., D. M. Ornitz, M.D., Ph.D., and R. P.Mecham, Ph.D. Departments of Cell Biology, Molecular Biol-ogy, and Surgery, Washington University School of Medicine,St. Louis, Missouri.

Introduction. Pulmonary hypertension contributes to the mor-bidity and mortality associated with congenital diaphragmatic her-


nias (CDH) in neonates. Changes in the extracellular matrix pro-teins play a prominent role in the development of persistentpulmonary hypertension. Slit-3 is an extracellular matrix proteinthat serves as a ligand for the receptor protein roundabout. Targetedmutagenesis of the murine Slit-3 gene leads to the development ofCDH in the Slit-3 null mouse. The hernia develops in late gestation,and the null mice are viable into adulthood. Our aim is to evaluatethe pulmonary vasculature of the Slit-3 null mouse for the presenceof mechanical characteristics consistent with pulmonary hyperten-sion in the context of CDH. Methods. Vessel mechanical studieswere performed with the use of a pressure arteriograph (DanishMyotechnology). The pulmonary arteries of 2-month-old mice (2 wtand 2 slit-3 �/�) were excised, placed in physiologic buffer, andmounted on the pressure arteriograph. Vessel diameter was mea-sured while increasing intravascular pressure in a stepwise fashionfrom 0 to 60 mm Hg. Results. Our data reveal that the slit-3-nullmouse has decreased compliance in the pulmonary artery in com-parison to wild-type controls (see figure). The decreased compliancein the Slit-3-null mouse begins at 30 mm Hg and is maximal at 50mm Hg where the difference between the averages is 394 mm Hg.Conclusion. We have demonstrated that the Slit-3-null mouse hasdecreased distensibility of the pulmonary artery compared to thewild-type controls. Decreased compliance is a physiologic indicator ofimpaired vessel wall mechanics indicative of hypertension. Our datamay indicate the presence of pulmonary hypertension in the Slit-3KO mouse. Further studies of the Slit-3 KO mouse will elucidate themechanisms and establish a model for the study of pulmonary hy-pertension secondary to CDH.

ORAL POSTER II: TRANSPLANTATION/CARDIOTHORACIC

P19. Absence of Graft-versus-Host Disease in Recipients of anIsolated Vascularized Bone Marrow Transplant. C. Y.Tai, M.D., L. F. Strande, M.S., R. Eydelman, B.S., X. Sheng,M.D., M. Matthews, M.D., and C. W. Hewitt, Ph.D. UMDNJ/RWJMS-Cooper Health System, Camden, New Jersey.

Purpose. Study the immune contribution of the vascularized bonemarrow compartment in a composite tissue allograft (CTA). Back-ground. Controversy exists whether the bone marrow in a CTA cancause graft-versus-host disease (GVHD) in recipients. Prior rat hind-limb transplant models used to study the vascularized bone marrowcompartment contained multiple immunogenic tissue types that

complicated the picture. An extraperitoneal isolated vascularizedbone marrow transplant (iVBMT) model was developed in the rat tospecifically examine this issue. We hypothesized that the iVBMTwould be functional and cause GVHD in a fraction of the semiallo-geneic recipients. Methods. Group A was Lewis donors transplantedto a Lewis-Brown-Norway (LBN) rats (n � 25). The hybrid recipientcannot reject the graft while allowing the possibility of GVHD fromthe donor Lewis cells against the host’s Brown-Norway antigens.Group B was syngeneic controls, LBN to LBN (n � 10). The iVBMTmodel consisted of a left donor femur that was harvested with itsnutrient vessels. The graft was microsurgically anastomosed to theright femoral vessels of the recipient and placed subcutaneously inthe abdominal wall. Animals were euthanized at various time pointsbetween 1 and 14 weeks. Results. All animals regained weightpostoperatively, and no animals exhibited signs of GVHD at eutha-nization. The graft vessels were grossly patent with a pulsatile graftartery and flow across the venous anastomosis. Histology of the graftbones showed viable marrow compartments with a normal mix ofhematopoietic and fatty elements and appeared to be functional.Tissues that are known to be affected by GVHD—the tongue, ear,and gut—also showed no microscopic evidence of GVHD. Conclu-sions. The iVBMT did not cause GVHD in the semiallogeneic ratmodel as hypothesized. This suggests that the vascularized bonemarrow within a CTA is not the component that causes GVHD;rather, it may serve an immunomodulatory function for toleranceinduction.

P20. Embryonic Stem Cells Inhibit Hepatic Progenitors, Pos-sibly via IL-6 and TGF-�1. J. Wang, D.V.M., B. A. Cairns,M.D., D. A. Gerber, M.D., B. Clark, M.D., X. Zeng, M.D., S.Hatada, Ph.D., and J. H. Fair, M.D. University of North Caro-lina School of Medicine, Chapel Hill, North Carolina.

Introduction. Embryonic stem (ES) cells hold great promise fororgan regeneration and transplantation; however, little is knownabout the interactions between ES cells and organ specific progeni-tors. In this study, we investigated the effect of ES cells on hepaticprogenitor cell (HPC) proliferation and cytokine generation utiliza-tion a unique hepatic coculture system. Methods. Hepatic progeni-tor cells (HPC) were isolated from 6- to 8-week-old, male C57BL/6mice using modifications of the two-stage liver perfusion technique ofSeglen followed by selection of cells from the supernatant afterlow-speed centrifugation spins. Small hepatic cell fractions werethen cultured and hepatic progenitor colonies subsequently demon-strated peak expression of the hepatic specific oval cell marker A6 atday 14 and increasing albumin expression that peaked at day 21.Green fluorescent protein (GFP) ES cells derived from A129 micewere cocultured at different densities of 10, 102, 103, 104, and 105 EScells per 8 105 cells small hepatocyte fraction. HPC colonies wereassessed on days 10 and 21 and culture media from ES � HPC disheswere collected and analyzed for cytokines by ELISA at days 0, 4, 7,10, and 14. Results. Coculture of ES with HPC demonstrated aprogressive inhibition of HPC proliferation that was ES cell densitydependent. While 10 ES cells did not inhibit HPC colony growth,coculturing HPC with 102 and 103 ES cells delayed colony formationby approximately 3 days and decreased colony size and number.Coculturing HPC with 104 and 105 ES cells completely blocked colonyformation. Media from HPC cocultured with 104 ES cells demon-strated an increase in TGF-�1 at day 7 that slowly decreased at day10. In addition, IL-6 levels were low up to day 10, and then there wasa dramatic 10- to 17-fold increase in IL-6 levels by day 14. TNF-�levels were unchanged. Conclusion. These data demonstrate for thefirst time the inhibitory effect of ES cells on an organ specific pro-genitor that appears to be mediated via IL-6 and TGF-�1. Theseresults have important implications on the therapeutic use of EScells for organ regeneration.

P21. Massive Liver Growth in Mice Induced by SystemicInterleukin-6 Administration. T. A. Zimmers, Ph.D., I. H.


McKillop, Ph.D., R. H. Pierce, Ph.D., J. Yoo, Ph.D., P. Murtha-Riel, Ph.D., and L. G. Koniaris, M.D. University of RochesterSchool of Medicine, Rochester, New York.

The multifunctional cytokine interleukin-6 (IL-6) is expressed in awide variety of disease states and pathological processes. Mice defi-cient in IL-6 display abnormal and delayed liver regeneration andrepair. Currently IL-6 is thought to influence liver growth indirectlyby priming hepatocytes to respond to growth factors such as hepa-tocyte growth factor (HGF), by inducing expression of HGF, and byinhibiting hepatocyte apoptosis, as distinct from the direct mitoticeffects of IL-6 on myeloid and other cell types. Here we show thatsystemic administration of IL-6 using CHO cell tumors in nude miceresults in dramatic hepatomegaly and hepatocyte hyperplasia in theabsence of liver injury. Liver mass and liver to body mass ratiosincreased to 2 to 3 times that of normal due to proliferation ofhepatocytes. Liver growth was associated with high levels of serumIL-6 and with activation of the IL-6 signaling pathway, includingincreased expression of IL-6 receptor-�/gp80, activation of the signaltransducer and activator of transcription-3 (STAT-3) and mitogen-activated protein kinase (MAPK/ERK) signaling pathways and in-duction of downstream target genes, including c-myc. HGF receptorand transforming growth factor-� (TGF-�)/epidermal growth factor(EGF) receptor activation were decreased in hypertrophied livers,suggesting that IL-6-induced liver growth was independent of theseknown hepatocyte mitotic pathways. These results suggest that IL-6can function as a direct hepatic mitogen in vivo and further that IL-6warrants closer examination as a potent liver growth factor withpotential clinical utility for increasing liver mass following injury.

P22. Modeling Human Brain Death in the Swine: DetrimentalEffect of Spinal Cord Blood Flow on Renal Function. L.Chen, M.D., Ph.D., J. D. Arenas, M.D., R. H. Bartlett, M.D.,and S. M. Rudich, M.D., Ph.D. University of Michigan HealthSystem, Ann Arbor, Michigan.

Background/purpose. No standard large animal model exists inwhich to study how brain death effects organ function before trans-plantation. We developed several BD models in the swine in eitherthe presence or absence of spinal function and compared their he-modynamics and renal function. Methods. Juvenile farm pigs wereventilated and instrumented under isoflurane anesthesia. Animalswere made BD by: (1) An 18 Fr. Foley balloon placed subdurally for2 cm. Upon inflation (3 min), BD ensued by raising the intracranialpressure (ICP) 50 mm Hg higher than systolic blood pressure andmaintained during 10-h follow-up (Group A, n � 6). (2) Heparinizedblood was infused into the brain (Group B, n � 5), and similarcriteria to (1) were used to create and verify BD. Controls (n � 6)underwent identical instrumentation without ICP manipulation.Systemic hemodynamics, renal artery blood flow, urine Na� concen-tration, and total blood flow measurements (TBF) were made andcompared using either Tukey’s test or repeat measures (RM)ANOVA. Results. Groups A and B developed BD confirmed byclinical criteria, EEG, apnea test, and medulla TBF. Spinal functionwas noted in all animals from Group A; however, none from Group B,as determined by spinal motor reflexes and TBF [at 6 h, 70 vs. 10%of baseline (BASE), Groups A and B, respectively, P � 0.01]. Bothgroups had similar systemic hemodynamic changes, including aMAP which decreased 35% at 6 h (P � 0.05 for both). However, RMANOVA revealed that compared with Group A, Group B showed asignificantly higher renal arterial blood flow (P � 0.05; at 6 h, 45 vs.60% of BASE, respectively, P � 0.05 for both compared to BASE) andurine Na� concentration (P � 0.05; at 6 h, 16 vs. 28% of BASE, P �0.001). Renal cortex TBF decreased 73% (P � 0.05) at 6 h from BASEin Group A but only by 28% (P � 0.05) in Group B. Control group hadinsignificant changes in any parameters. Conclusion. BD occurs byelimination of intracranial circulation with either rapid intracranial

balloon inflation or blood infusion. BD animals with spinal functiondemonstrate better renal function.

P23. PDTC Inhibits TNF-Induced Upregulation of HCMV Ma-jor Immediate Early Promoter. T. K. Varghese, M.D., S.Kim, M.S., M. Hummel, Ph.D., G. Thomas, B.S., F. P. Stuart,M.D., and M. Abecassis, M.D. Northwestern University Medi-cal School, Chicago, Illinois.

Purpose. To study the effect of pyrrolidine dithiocarbamate(PDTC) on TNF-induced upregulation of human cytomegalovirus(HCMV) major immediate early promoter (MIEP) in vivo. Back-ground. Reactivation of latent HCMV results in both morbidity andmortality in immunosuppressed patients. We have previously dem-onstrated that TNF plays a major role in inducing immediate early(IE) gene expression as a result of both soluble TNF and allotrans-plantation by causing nuclear translocation of NF�B. Since induc-tion of IE gene expression is an essential first step in CMV reacti-vation, the abrogation of IE gene expression would be important inpreventing CMV reactivation. The MIEP of HCMV controls the ex-pression of IE genes. Transgenic mice with the lacZ gene regulatedby the HCMV MIEP are ideal for analysis of factors that regulatepromoter activity and hence the reactivation process. Reactive oxy-gen intermediates have been proposed to mediate NF�B activation.PDTC is an antioxidant that has been reported to inhibit NF�B inseveral in vitro systems. Methods. MIEP-lacZ transgenic mice weredivided into four groups (n � 4 per group): Group I, PBS; Group II,10 �g TNF; Group III, PDTC (120 mg/kg); and Group IV, PDTC (120mg/kg) � 10 �g TNF. Organs were harvested 24 h postinjection.�-Galactosidase activity in tissues was measured by chemilumines-cence, protein was quantitated by Bio-Rad protein assay, and theratio of �-galactosidase per nanogram of protein was determined intriplicate. Statistical analysis was performed by means of a Student’st test for unrelated samples. Results. TNF induces 2- to 3-foldinduction of transgene expression in the kidneys and 25- to 30-foldinduction in the spleen. PDTC inhibits the TNF-induced upregula-tion of HCMV MIEP in both the kidney and the spleen (P � 0.01 andP � 0.001, respectively). Conclusions. PDTC abrogates TNF-induced induction of the CMV IE gene promoter in vivo and suggeststhat PDTC inhibits TNF-induced NF�B activation. Further studiesare needed to evaluate the mechanism of PDTC abrogation of CMVreactivation from latency.

P24. In Situ IL-2 Receptor Expression on Osteocytes Associ-ated with Graft-versus-Host Disease and Tolerance inComposite Tissue Allograft Recipients. J. L. Tran, B.S., C.Tai, M.D., P. Vemulapalli, M.D., X. Sheng, M.D., L. Strande,M.S., and C. W. Hewitt, Ph.D. UMDNJ/RWJMS-Cooper HealthSystem, Camden, New Jersey.

Background. The developmental linkage between the bone, mar-row, and the immune systems suggest persistent interactions amongsuch in the mature organism. IL-2R expression has been well-described as a part of the T-cell repertoire of responses to transplan-tation. However, IL-2R expression has not been described in theosteocytes within a CTA. We previously hypothesized that increasedIL-2R are present on tolerant bone marrow cells within the CTAlimb. We now report on the expression of IL-2R on osteocytes in theseanimals. Methods. Lewis donor hindlimbs were transplanted toLewis-Brown-Norway recipients (n � 12). Two clinical results wereobserved: In the TOL group, the animals experienced a self-limitedcourse of graft-versus-host disease (GVHD), followed by indefinitegraft tolerance (n � 9). In the GVHD group, the animals experiencedlethal GVHD (n � 3). Nonoperated Lewis and Brown Norway limbsserved as controls. Paraffin-embedded bone sections of the grafts andthe contralateral host limbs (HOST) were stained for IL-2R andquantified using digital analysis. An intensity stain index (ISI) mea-suring area and intensity of stain/total cellular area was determined.


Data were analyzed using Student’s t test. Results. IL-2R were seenon osteocytes/osteoblasts from experimental animals and not in thecontrols. The ISI values were compared between groups with expres-sion and showed significant differences between the graft and con-tralateral limb, as well as difference between the TOL and GVHDgroups (see table). Conclusions. The osteocyte/osteoblasts within aCTA expressed high levels of IL-2R in both GVHD and tolerantanimals, while no expression was observed in normal controls. Thepresence of IL-2R on osteocytes suggests a role in the development oftolerance and GVHD in CTA and highlights the interactions betweenthe skeletal and immune systems.

P25. Differentiation of Embryonic Stem Cells by Coculturewith Hepatic Progenitor Cells. J. H. Fair, M.D., B. A.Cairns, M.D., D. A. Gerber, M.D., R. Maile, Ph.D., B. Clark,M.D., A. Neilsen, M.A., S. Hatada, Ph.D., and J. Wang, D.V.M.University of North Carolina School of Medicine, Chapel Hill,North Carolina.

Introduction. There is a significant need for alternative strate-gies in the management of end stage liver disease. In mice, embry-onic stem cells have been directed in vitro toward multiple cell typesderived from the definitive endoderm, mesoderm, and ectoderm, butdevelopmental correlates of potential biologic activity are not avail-able. Our hypothesis is that hepatic progenitors signal ES cells toundergo differentiation towards early hepatocyte lineage in vitro asdetermined by MHC I and II antigen expression and ES cell mor-phology. Methods. Hepatic progenitor cells (HPC) were isolatedfrom 6- to 8-week-old, male C57BL/6 mice. Small hepatic cell frac-tions were then cultured and hepatic progenitor colonies subse-

quently demonstrated peak expression of the hepatic-specific ovalcell marker A6 at day 14 and increasing albumin expression thatpeaked at day 21. Green fluorescent protein (GFP) ES cells derivedfrom A129 mice were cocultured with 8 105 cells from the smallhepatocyte fraction. Cell morphology was determined at various timepoints and MHC class I and II antigen expression were determinedusing flow cytometry. Results. ES cells alone express a minimalamount of MHC class I and no MHC class II. ES cells cocultured withHPC, however, rapidly express large amounts of MHC class I andMHC class II, and dramatically increase in size (fivefold) (see figure).Conclusion. These data demonstrate that ES cells cocultured withHPC display MHC antigen expression and morphology similar tocells in the immature hepatocyte lineage. These findings represent aunique and successful strategy for organ specific ES cell differenti-ation.

P26. Vitamin E Inhibits Cyclosporin A and H2O2-PromotedEpstein–Barr Virus Oncogene LMP1 Expression. C.Chen, Ph.D., S. Reddy, M.D., T. D. Johnston, M.D., T. T. Khan,M.D., and D. Ranjan, M.D. University of Kentucky, Lexington,Kentucky.

Purpose. To determine whether dietary antioxidant vitamin Ecan inhibit H2O2- and cyclosporine A (CsA)-enhanced Epstein–Barrvirus (EBV) oncogene LMP1 expression in human B cells. Back-ground. We have previously shown that oxidative stress induced byH2O2 or CsA directly promotes EBV transformation of human Bcells. In this report, we used EBV oncogene LMP1 to analyze pro-motion of EBV transformation of human B cells by H2O2 and CsAand to test the effect of antioxidant vitamin E on LMP1 expression.Methods. Human splenocytes were purified by centrifugation andplating technique to provide a greater than 80% preparation of Bcells and were used for EBV infection as previously described by us.The EBV-infected cells were treated with H2O2 (0.1 mM, 10 min) orwith CsA (500 ng/ml) with or without vitamin E (40 �M). DMSO(0.2%) was the vehicle for both vitamin E and CsA and was used asa control. The cells were cultured for up to 4 weeks. Samples weretaken every week and were stained with phycoerythrin-conjugatedmouse anti-LMP1 monoclonal antibody to assay LMP1-positive pop-ulation by flow cytometry. Results. In EBV-infected B cells, LMP1-positive cell population reached 14% after 4 weeks of culture whichwas promoted to 43 and 41%, respectively, with CsA and H2O2

treatment. Vitamin E (40 �M) completely blocked LMP1 expressionin EBV-infected cells and in CsA- or H2O2-treated cells (see figure).Conclusion. CsA and H2O2 directly promote EBV transformation ofB cells as assayed by LMP1 expression, and this effect is blocked by


Host TOL(ISI � 0.257)

Host GVHD(ISI � 0.537)

TOL (ISI � 6.78) P � 0.014 P � 0.013GVHD (ISI � 10.37) P � 0.021 P � 0.011

TOL vs. GVHD P � �0.001


the antioxidant vitamin E. This is in agreement with our previousfindings and provides further evidence that oxidative stress plays asignificant role in CsA-induced EBV transformation.

P27. The Presence of Hepatic Stem Cells in RegeneratingAdult Rat Liver. S. S. Awad, M.D., A. Hernandez, M.D.,Ph.D., N. S. Belaguli, Ph.D., D.V.M., M. A. Goodell, Ph.D.,and D. H. Berger, M.D. Baylor College of Medicine, Houston,Texas.

Background. Adult pluripotential “stem cells” have been isolatedfrom many tissues including bone marrow, skeletal muscle, centralnervous system, the gut, and the liver and exist to replenish maturecells lost through attrition or injury. We have previously shown that aside population (SP) of hematopoetic cells, which are stem cells, have ahigh capacity for effluxing xenobiotics such as Hoechst dyes. Using flowcytometery to exploit this characteristic, our objective was to determineif a side population (SP) of hepatic cells could be identified in adult ratlivers. We hypothesized that partial hepatectomy would increase thenumber of hepatic stem cells. Methods. Livers lobes from adult maleSprague–Dawley rats were harvested 1 week after 70% partial hepa-tectomy (PH) and after sham operation (SO). After digestion with Pro-nase, single-cell solutions were obtained, stained with Hoechst 33342 (5�g/ml), and then stained with proprium iodide to exclude dead cells. A350-nm argon laser was used to excite Hoechst 33342 and analysis wasperformed in dual color mode on a triple-laser instrument at 405/30 and670/30 nm. The SP cells were identified by selective gating on thesmall-cell population of the hepatic cell suspension which effluxes theHoechst dye and by their characteristic emission fluorescence profile.The percentage of SP cells was calculated by dividing the number of SPcells by the total cells analyzed after 200,000 cell count. Results. SPcells were identified in the PH and SO groups. Additionally, there wasa significant increase in the SP cells in the PH group when compared tothe SO group (PH, 0.21 � 0.05%; SO, 0.05 � 0.01%; P � 0.04; seefigure). Conclusion. Hepatic stem cells exist in adult rat livers and areincreased after partial hepatectomy in the regenerating residual lobes.Hepatic stem cells may play an important role in hepatic regeneration.

P28. Changes in Plasma Aldosterone and Myocardial Collag-ens with Pulsatile versus Continuous-Flow Left Ventric-ular Assist Devices (LVADs). I. Wang, M.D., Ph.D., A. Na-talio, B.S., K. N. Litwak, D.V.M., Ph.D., Q. Wang, B.S., C. F.McTiernan, Ph.D., A. M. Feldman, M.D., Ph.D., and R. L.Kormos, M.D. University of Pittsburgh Medical Center, Pitts-burgh, Pennsylvania.

Purpose. Determine the effects of pulsatile (P-) and continuous-flow (CF-) LVAD support on myocardial collagens and aldosterone, aknown mediator of cardiac fibrosis. Methods. Healthy male calvesunderwent LVAD implantation or sham thoracotomy with identicalpostoperative care. Calves were supported for 30–180 days with

partial ventricular unloading of 40%–60%. Quantitative immunohis-tochemistry and picrosirius collagen assay were performed. Plasmarenin activity (PRA) and aldosterone levels were measured by com-mercial RIA kits. Results. At 30 days of LVAD support, collagen Iand III of left ventricle (LV), right ventricle (RV), and interventric-ular septum (IS) were not different from sham. By 180 days, LV andIS of CF-LVAD calves had significant (P � 0.01) increases in collagenI and III versus sham. Picrosirius assay results, a measure of solubleundenatured collagen (intact triple helix), are below. At 30 days andlonger, LV of both LVAD groups had lower undenatured collagenversus sham (P � 0.005). Moreover, CF-LVAD calves had lowerundenatured collagen in their LV, RV, and IS versus P-LVAD. PRAwas not different among the calves. Aldosterone levels in P-LVADcalves were same as control. By contrast, levels in CF-LVAD calveswere substantially elevated (see figure). Conclusions. LVAD sup-port at 30 days and longer alters myocardial collagen matrix. Resultssuggest that fibrosis is more pronounced with continuous than pul-satile flow, a difference that is explained in part by increased levelsof aldosterone, a potent mediator of myocardial fibrosis.

P29. Pretreatment of Canine Skeletal Muscle Ventricles(SMVS) with Clenbuterol Improves Pressure GenerationCapability for Cardiac Assistance. Z. A. Sharif, M.D., R. L.Hammond, Ph.D., P.J. McDonald, and L. W. Stephenson, M.D.Wayne State Unversity School of Medicine, Detroit, Michigan.

We tested the hypothesis that the �-2 agonist clenbuterol wouldimprove the tension development of the canine SMV created fromlatissmus dorsi muscle. SMVs were constructed in eight dogs, di-


vided into two groups of four, a control group, and a treatment groupthat was given 16 �g/kg/day clenbuterol. After a 3-week period ofvascular delay and a 7-week electrical training period, the SMVswere tested against a mock circulation device at preloads of 0–80mm Hg and an afterload of 80 mm Hg. At the chronic stimulationfrequency of 33 Hz, clenbuterol significantly improved (P � 0.05)mean pressure (see figure) and stroke volume, as well as tension-time index and rate of pressure development (dP/dT) at every mea-sured preload. We conclude that clenbuterol treatment improveshemodynamic performance of skeletal muscle ventricles.

P30. Inflammation and Atrial Fibrillation: Arachidonic AcidDepresses Conduction in a Directionally DependentManner. A. E. Saltman, M.D., Ph.D., E. V. Tselentakis, B.S.,G. R. Gaudette, Ph.D., and I. B. Krukenkamp, M.D. Universityof Massachusetts, Worcester, Massachusetts; and SUNY StonyBrook, Stony Brook, New York.

Purpose. To determine if inflammation alters conduction in atrialtissue and predisposes it to fibrillation. Background. Atrial fibril-lation (AF) is the most common complication of heart surgery. Cur-rently available strategies are not successful at preventing it becauseits mechanism is not yet understood. Methods. Isolated pieces ofnormal right canine atrial free wall were bathed in normal Tyrode’ssolution for 30 min at 37°C (n � 6). They were then subjected to 80�M arachidonic acid (AA) for 15 min, after which the AA was washedout. Conduction velocities (CV) were measured continuously alongthe atrial tissue long axis and transverse to the long axis before,during, and after exposure. Results. The data are shown in thetable. Baseline CV along the fiber axis was not significantly de-

pressed by exposure to AA. Transverse to the long axis, however, CVwas depressed by approximately 42% in a reversible fashion. Con-clusions. The inflammatory mediator AA depresses CV in normalcanine atrial muscle in a reversible fashion, but only transverse tothe fiber long axis. This alteration in conduction may set the stage formicroreentry and support the appearance of postoperative AF.

P31. Regulation of the Chemokine Response to Hypoxia andReoxygenation in Pulmonary Artery Endothelial Cells.B. Naidu, M.D., K. Byrne, B.S.C., and M. Mulligan, M.D. Uni-versity of Washington, Seattle, Washington.

Purpose. This present studies were performed to determinewhether RPAECs subjected to hypoxia and reoxygenation couldexpress chemokines and if is so to then define the regulatorymechanisms involved. Background. Chemokines are inflamma-tory mediators that activate and recruit leukocytes. We haverecently demonstrated a role for certain chemokines in a model oflung ischemia reperfusion injury. After hypoxic stress, the ratpulmonary arterial endothelial cell (RPAEC) potentiates and di-rects neutrophil sequestration and therefore ultimately regulatestissue injury. One of RPAECs may influence these effects isthrough the expression of chemokines. Methods. RPAECs were

rendered hypoxic (pO2 0.5%) for 2 h and allowed to reoygenate for6 h. The secreted chemokine content in the collected media wasquantified with ELISA. mRNA and nuclear protein were analyzedafter gel electrophoresis. Results. RPAECs demonstrated amarked increase in the secretion of the chemokines, CINC, andMCP-1 in response to hypoxia and reoxygenation. This increasewas dependant on mRNA transcription and de novo protein syn-thesis. Furthermore, there was an association with nuclear trans-location of NF-�B and EGR-1, both of which are proinflammatorytranscription factors (see table). Conclusion. The chemokine re-

sponse of RPAECs to hypoxia and reoxygenation is dependant onde novo mRNA transcription which may be regulated by NF-�Band EGR-1 activation.

P32. Mediators of Systemic Inflammatory Response Are De-creased in Port Incisions. D. M. Maziarz, M.D., V. F. Chu,M.D., A. M. Conquest, M.D., J. H. Garofalo, M.D., Y. S. Sun,M.D., P. J. Robinson, M.D., L. W. Nifong, M.D., and W. R.Chitwood, Jr., M.D., FACS. Brody School of Medicine at EastCarolina University, Greenville, North Carolina.

Introduction. Minimally invasive surgery has led to renewedinterest in blunting the systemic inflammatory response (SIR).High IL-6 levels correlate with increased complications followingsurgery. We hypothesize that port incisions cause less SIR whencompared with thoracotomy or sternotomy. Methods. After insti-tutional approval, 15 anesthetized, ventilated pigs were dividedevenly into three groups. Hemodynamic parameters and serumcytokine levels (IL-6, IL-8, IL-10, and TNF-�) were measuredpreincision and at four time points including 10 min after woundclosure. Group (GP) 1 had a 15-cm sternotomy; GP2, a 5-cm leftthoracotomy plus port incisions totaling 15 cm; and GP3, portincisions totaling 15 cm. Wilcoxon rank tests were used for sta-tistical analysis. Cytokine analysis utilized species-specific ELISAtests. Results. In GP1 and GP2, IL-6 increased significantly fromundetectable levels preincision to 178.51 � 110.29 pg/ml (mean �SEM) and 241.25 � 138.58 pg/ml (P � 0.04) postclosure, respec-tively. From preincision to postclosure, GP3 increased insignifi-cantly from undetectable levels to 26.91 � 21.79 pg/ml (P �0.345). Arterial pH decreased significantly from 7.44 � 0.01 to7.36 � 0.04 (P � 0.04) in GP1 while decreasing insignificantlyfrom 7.44 � 0.01 to 7.43 � 0.02 (P � 0.08) in GP3. Oxygen deliveryremained highest in GP3, although they did not reach statisticalsignificance compared to GP1 (P � 0.16) or GP2 (0.23). Oxygenconsumption also remained lowest for GP3 compared to GP1 (P �0.26) and GP2 (P � 0.14), but did not reach statistical significance.Conclusions. IL-6 increased significantly with increasing size ofopen incision, while port incisions caused an insignificant in-crease. The finding of IL-6 levels and oxygen consumption anddelivery trends are consistent with our hypothesis that port inci-sions may decrease SIR.


Direction Control AA Washout

Longitudinal 64 � 4 63 � 5 (P � 0.99) 58 � 8 (P � 0.78)Transverse 36 � 2 21 � 1 (P � 0.01) 31 � 6 (P � 0.41)

Note. Values are means � SEM; AA, 80 �M arachidonic acid.P values compared to control.


RPAEC (pg/ml) CINC P value MCP-1 P value

Oxidant stressed 4 � 3 to 74 � 19 0.03 0 to 31 � 8 0.02Actinomycin D 298.8% 0.02 299.9% 0.02Cycloheximide 299.9% 0.008 298.6% 0.02


P33. PI3 Kinase Inhibition Overcomes Resistance to Apopto-sis in Mesothelioma via BCL-XL-Independent Inhibitionof NF-�B. S. D. Miller, M.D., X. X. Cao, M.D., M. K. Ozvaran,M.D., and W. R. Smythe, M.D. University of Texas M. D.Anderson Cancer Center, Houston, Texas.

Purpose. To determine the effect of PI3 kinase inhibition onmesothelioma cells and its ability to overcome known BCL-XL-mediated resistance to apoptosis. Background. Mesothelioma isa neoplasm that is clinically and experimentally refractory toapoptosis. We have demonstrated that BCL-XL, a member of theBCL-2 protein family, is overexpressed and confers resistance toapoptosis in human mesothelioma cells. NF-�B is a known posi-tive transcriptional regulator of bcl-xl transcription. PI3 kinase isan upstream effector of a survival promoting signaling pathwaythat functions via a positive effect on NF-�B nuclear translo-cation. We evaluated the role of inhibition of this pathway onapoptosis and its effects on NF-�B translocation and BCL-XLexpression in human mesothelioma cells. Methods. The mesothe-lioma cell lines MSTO, HAY, I-45, and REN, as well as I-45xl, abcl-xl hyperexpressing clone, were maintained in culture. Normallung and pleural tissue were used as controls. LY294002, a PI3kinase inhibitor, was used to treat cells in a dose–response fashion(0.1 to 100 �M). The colorimetric XTT assay was used to assesscellular viability 72 h after treatment. Results were comparedusing Student’s t test. Western blots were then performed onlysates obtained from cells treated with 50 �M LY294002, un-treated cells, and normal tissue with a monoclonal antibody to theBCL-XL protein. An electrophoretic mobility shift assay (EMSA)using an NF-�B probe was performed on I-45 and REN following50 �M LY294002 treatment, as well as Hoescht staining for apop-totic morphology. Results. High-level baseline BCL-XL proteinexpression was noted in all mesothelioma cell lines while normallung and pleura tissue demonstrated no BCL-XL expression. Sig-nificant reduction in viability was noted on XTT at an LY294002concentration of 50 �M (MSTO 46% vs. control, P � 0.05; HAY44% vs. control, P � 0.05; I-45 28% vs. control, P � 0.05; REN 24%vs control, P � 0.05). Despite hyperexpression of BCL-XL, theviability of I-45xl with LY294002 (21% vs. control) was similar tothe parent line, I-45. Following LY2944002 treatment, BCL-XLprotein expression was unchanged from control when evaluatedby Western blot at 24, 48, and 72 h in all cell lines. NF-�B nuclearactivity was markedly diminished by 24 h following LY294002 byEMSA. Hoescht staining revealed LY294002-treated cells exhib-iting large segmented nuclei and fragmentation, consistent withapoptosis. Conclusion. PI3 kinase inhibition engenders apoptoticcell death in mesothelioma cell lines with high-level baselineBCL-XL expression in a dose-dependent fashion. Although thiseffect results in diminished NF-�B activity, it appears to be inde-pendent of and unrelated to bcl-xl gene expression. The ability ofPI3 kinase inhibition to overcome the known ability of bcl-xloverexpression to confer resistance to apoptosis in this malig-nancy may have clinical application.

P34. Cytoprotective Mechanisms of Opioids. M. A. Romano,M.D., M. A. Kovach, B.S., E. M. Seymour, M.S., S. Gupta, B.A.,and S. F. Bolling, M.D. University of Michigan, Ann Arbor,Michigan.

Purpose. Opioids are thought to protect the ischemic myocyteby decreasing cellular death and enhancing mitochondrial activ-ity. We examined the effect of a delta (�) opioid receptor agonist,DADLE, on cellular viability and cytoplasmic lactate dehydroge-

nase (LDH) as a measure of cell injury. Furthermore, integrity ofthe mitochondrial electron transport chain was determined byMTS assay. Methods. HL-1 cells, an immortalized murine atrialmyocyte line, were used. Cells were either maintained at nor-moxia or underwent 1 h of ischemia followed by 2 h of reperfusion.Viability was determined by trypan blue exclusion. Control (CM)myocytes were compared to myocytes pretreated with DADLE ornaltrindole, a � opioid antagonist. Results. Normoxic maintainedcells retained 89 � 2% viability. However, following 1 h of isch-emia viability of CM fell to 60 � 2% (P � 0.001), while DADLE-treated cells remained viable at 82 � 2% (P � NS), and conversely,naltrindole-treated cells were only minimally viable. Results ofLDH and MTS assays are shown below. DADLE-treated cells hadsignificantly lower LDH and significantly higher mitochondrialactivity in both normoxic (P � 0.006, P � 0.004) and ischemic-reperfusion protocols (P �0.03, P � 0.02). Furthermore, cellstreated with naltrindole showed significantly increased LDH (P �0.03) and worsened mitochondrial activity (P � 0.008) versuscontrols. Conclusions. These data demonstrate that � opioidagonists decrease cellular injury and death, while maintainingmitochondrial metabolic activity. Additionally, the adverse effectsof delta opioid antagonists indicate a constitutive endogenousanti-ischemic regulatory activity. These findings may assist indeveloping future clinical applications.

P35. Tissue Flaps Reduce Negative Effects of Vacuum-Assisted Closure on Sternal Wounds. A. M. Conquest,M.D., J. G. Garofalo, M.D., D. M. Maziarz, M.D., K. G.Mendelson, M.D., Y. S. Sun, M.D., W. A. Wooden, M.D.,W. M. Meadows, M.D., L. W. Nifong, M.D., and W. R. Chit-wood, M.D. East Carolina University, Greenville, NorthCarolina.

Introduction. Application of the vacuum-assisted closure de-vice (VAC) to open sternal wounds has negative hemodynamiceffects. We hypothesized that the interposition of a muscle flapattenuates these negative hemodynamic effects. Methods. Afterinstitutional approval, monitoring lines were placed in anesthe-tized, ventilated pigs. Through a median sternotomy, sonometriccrystals were strategically positioned around the left ventricle. Arectus flap was rotated over the mediastinal wound, and the VACwas placed over the flap. After baseline measurements, a vacuumof 125 mm Hg (Group (GP) 1, n � 5) or 50 mm Hg (GP2, n � 6) wasinitiated. Hemodynamics were recorded every 15 min for 1.5 h and15 min after cessation of the vacuum therapy. GP3 (n � 6) under-went intermittent VAC cycling (on 5 min/off 2 min). Significancewas determined by t test. Results. While nonflapped animals hadsignificant detriment in both left ventricular filling volume andcardiac output, flapped animals had insignificant depression ofboth parameters (see table). Conclusion. Application of muscle


flaps to sternal wounds prior to VAC therapy significantly atten-uates the negative hemodynamic effects seen when the VAC isused alone.

ORAL POSTER III: VASCULAR

P36. Inhibitory Effect of Brachytherapy on Intimal Hyper-plasia in Arteriovenous Fistula. S. Sun, M.D., J. Beitler,M.D., T. Ohki, M.D., T. Claderon, Ph.D., R. Schechner, M.D., R.Yaparpalvi, M.S., J. Berman, Ph.D., V. Tellis, M.D., and S. M.Greenstein, M.D. Montefiore Medical Center, Bronx, NewYork.

Purpose. To determine whether endovascular radiation can in-hibit intimal hyperplasia in a swine model of hemodialysis access.Background. Patients undergoing chronic hemodialysis relyheavily on their vascular access. Unfortunately, recurrent venousstenosis commonly occurs as a result of intimal hyperplasia. Radia-tion may be effective in preventing venous stenosis in hemodialysisaccess grafts. Methods. Polytetrafluoroethylene arteriovenousgrafts (6 mm in diameter) were placed between the common carotidartery and the external jugular vein bilaterally in eight pigs. Twodays after the surgery, fistulography was performed. Gamma radia-tion (12 Gy) was delivered endovascularly to one of the grafts at thevenous anastomosis by using an iridium-192 source. Thus, one graftof each pair served as an untreated control. Fistulas were evaluatedwith fistulography or venography 6 weeks after radiation. All graftswere then harvested for histologic and immunohistochemical exam-ination. Results. Seven radiated grafts and five control grafts re-mained patent for at least 6 weeks. Angiography demonstrated thatthe percentage stenosis at the venous anastomosis was reduced 51%for the treated group (15.9 � 14.1 vs. 32.6 � 16.7%, P � 0.045).Histopathologic analyses revealed that radiation treatment resultedin a 36% reduction in the cross-sectional area of neointima and a 31%reduction in maximal neointimal thickness compared with the con-trol group (0.68 � 0.30 mm2 vs. 1.06 � 0.29 mm2, P � 0.017; and0.18 � 0.08 mm vs. 0.26 � 0.07 mm, P � 0.004, respectively). Thisreduction correlated with decreased smooth muscle cell proliferationwithin the neointima in the treated group. The residual lumen at thevenous anastomosis was increased 50% for the treated group (1.59 �0.42 vs. 1.06 � 0.37 mm2, P � 0.031). Conclusions. In an animalmodel of hemodialysis access, brachytherapy with iridium-192 deliv-ered 2 days after graft implantation reduces intimal hyperplasia andstenosis at the venous anastomosis. The reduced smooth muscle cellsfound in the radiated veins suggests that brachytherapy may exertits effect on neointimal formation by inhibition of smooth muscle cellproliferation.

P37. TNF-� Receptors Modulate Local and Remote Hypoper-fusion Following Murine Hindlimb Ischemia. J. A. Bon-heur, M.D., H. Albadawi, M.D., G. M. Patton, Ph.D., and M. T.Watkins, M.D. Massachusetts General Hospital, Boston, Mas-sachusetts.

Aim. Tumor necrosis factor-� (TNF) has been implicated in thepathogenesis of tissue injury following reperfusion. These studieswere performed to determine whether TNF receptors influence local(ischemic limb, IL) and remote (contralateral limb, CL) flow follow-ing murine hindlimb ischemia. Methods. Wild-type (WT, n � 7) andTNF receptors 1 and 2 (�/�) double knockout mice (KO, n � 12) weresubjected to 6 h of unilateral tourniquet ischemia and 4 h of reper-fusion. WT mice were also subjected to 10 h of sham ischemia/reperfusion (anesthesia only, n � 7). Perfusion in both the IL and theCL limbs was assessed using noninvasive laser Doppler imaging(LDI) at baseline (30 min after anesthesia), during ischemia, and at1, 2, 3, and 4 h of reperfusion. Blood flow (flux units) in each leg wasexpressed as percentage of baseline flow. Results. The flow in WTand KO mice after 6 h of ischemia was below the level of detection bythe LDI. Upon reperfusion, flow in the IL of WT mice fell to 27% ofbaseline at 1 h and 19% by 4 h. In contrast, flow in the IL of KO micewas approximately 44% throughout reperfusion. Flow in the con-tralateral limbs of both WT and KO animals decreased after 6 h ofischemia. WT CL flow decreased to 53% by 4 h of reperfusionwhereas KO CL decreased to only 73% (see table). Conclusion. TNF


Time (h):

% Basal flux units � SE

Ischemia Reperfusion

6 1 2 3 4

Sham 105 � 9 106 � 12 101 � 11 110 � 10 110 � 9IL

WT — 27 � 6 20 � 5 18 � 3 19 � 4KO — 49 � 5* 41 � 5* 41 � 6* 38 � 6*

CLWT 74 � 8 66 � 7 54 � 6 52 � 6 53 � 7KO 88 � 5 84 � 6 84 � 7** 80 � 8** 73 � 6**

* P � 0.05 vs WT (IL).** P � 0.05 vs WT (CL).


GP

Mean change (%) � SE

LVV SV CO SBP

1No flap �20.6 � 2.7* �30.8 � 3.1* �31.2 � 2.8* �17.0 � 3.0*Flap �11.6 � 2.5*** �18.4 � 1.2* �10.8 � 0.20*** �8.29 � 1.9***

2No flap 16.5 � 1.2* �22.5 � 1.5* �24.5 � 1.6* �10.0 � 1.5*Flap �10.8 � 3.4*** �18.6 � 1.4* �16.0 � 0.10*** 6.28 � 1.2***

3No flap 17.8 � 1.9** �26.3 � 2.2* �24.5 � 2.5** �15.1 � 2.8*Flap �7.6 � 3.7*** �13.2 � 2.4*** �10.7 � 0.34*** �4.03 � 0.97***

* P � 0.01.** P � 0.001.

*** NS.


receptors 1 and 2 alter local and systemic tissue flow during reper-fusion. Pharmacologic interventions aimed at TNF receptors willimprove, but not completely reverse, decreased flow during reperfu-sion after 6 h of ischemia.

P38. Nicotine Induces Mononuclear Leukocyte Adhesion andExpression of Integrins, VCAM and ICAM, in Endothe-lial Cells in Vitro. G. Albaugh, D.O., B. Kann, M.D., L.Strande, M.S., S. Heimburger, B.S., C. Hewitt, Ph.D., and J. B.Alexander, M.D. UMDNJ/RWJMS-Cooper Health System,Camden, New Jersey.

Purpose. The pathology of peripheral arterial disease (PAD) in-volves mononuclear leukocyte (MNL) attachment and infiltrationinto the vessel wall. Leukocyte adhesion involves integrin expres-sion. VCAM and ICAM have the ability to attach leukocytes to theendothelium, which is an initial event in the inflammatory responsein the vessel wall. Methods. HUVEC were plated in endothelialgrowth medium (EGM) on plastic coverslips and grown until cellswere 75% confluent. Free base nicotine (FBN) was diluted in EGM toa concentration of 10�8 M and added to experimental cells. At 3 h,coverslips were removed and fixed. Immunohistochemical staining(IHCS) was performed using a monoclonal antibody to human ICAMand VCAM. Digital image analysis (DIA) was performed to quantifyexpression of ICAM and VCAM. An intensity stain index (ISI) mea-suring area and intensity of stain/total cellular area was determinedfor each time point (n � 5). Separate HUVEC were also exposed 10�8

M FBN for 4 h and then were exposed to MNL suspension for 10 min.Coverslips were removed, rinsed, and fixed. HE staining was per-formed and cells were examined under light microscopy. Leukocytenumbers per high-power field (HPF) were counted and compared tocontrols. Data were analyzed using ANOVA, with a 95% confidenceinterval. Results. ICAM and VCAM expression was absent in con-trol cells. Nicotine exposure at 3 h induced expression of VCAM(30.85 � 0.77) and to a lesser extent ICAM (16.69 � 1.39) (P � 0.01).MNL adhesion was markedly increased in cells exposed to nicotine(79.4 � 16.9/HPF) when compared to control cells (1.8 � 0.91/HPF)exposed to MNL (P � 0.01). Conclusion. These data shows nico-tine’s ability to induce ICAM and VCAM expression in HUVEC invitro. The biologic effects of these integrins are demonstrated by amarked increase in MNL adhesion to HUVECs in our study. Thesefindings may be a vital step in the pathogenesis of PAD associatedwith nicotine exposure.

P39. Cellular Interkeukin-10 (IL-10) Is More Effective ThanViral IL-10 in Decreasing Venous Thrombosis (VT) in aRodent Model. D. D. Myers, D.V.M., A. E. Hawley, M.S.,D. M. Farris, L.V.T., A. M. Chapman, B.S., S. K. Wrobleski,B.S., P. K. Henke, M.D., and T. W. Wakefield, M.D. Universityof Michigan, Ann Arbor, Michigan.

Purpose. To determine if cellular interleukin-10 (cIL-10) andviral interleukin-10 (vIL-10) have different effects on vein wall in-flammation and thrombosis in a mouse model of VT. Background.Systemic administration of cIL-10 and gene transfection of vIL-10 atthe time of thrombus induction decreases vein wall inflammation.Only cIL-10, despite sharing an 84% amino acid sequence homologywith vIL-10, decreases thrombosis through mechanisms yet to bedetermined. Methods. C57BL/6 mice (Mus musculus, n99) werestudied. Inferior vena caval (IVC) thrombosis was produced by stan-dardized IVC ligation and mice were euthanized and evaluated atdays 2 and 6 after ligation. At thrombus induction groups receivedintravenous saline control, 0.25 �g cIL-10, or 0.25 �g vIL-10. Eval-uations included thrombus mass and vein wall leukocyte counts,protein levels, and mRNA levels of P- and E-selectin, MCP-1, andIL-10. Groups were compared by ANOVA and t tests. Results. Lessthrombus was noted at both day 2 and day 6 in animals treated withcIL-10. At day 2, cIL-10 animals showed 11% decrease in thrombus

(n12) compared to controls (n11), while vIL-10 showed 18% increasein thrombus (n10). On day 6, cIL-10-treated animals showed a 19%decrease in thrombus (n11) compared to controls (n8), while vIL-10animals showed a 30% increase in thrombus (n10). Vein wall leuko-cyte counts revealed a significant decrease in neutrophils in cIL-10animals versus controls at day 2 only [28 � 5 (n5) vs. 70 � 23 (n3),P � 0.05], with no differences in vIL-10 animals [59 � 8 (n5)] versuscontrols. P-selectin protein levels, but not mRNA, were decreased incIL-10-treated animals (n6) versuss controls (n6) at day 6 (36 � 5 vs.85 � 20 ng/mg TP, P � 0.05) without significant differences inE-selectin, MCP-1, or IL-10 protein levels. E-selectin mRNA wasincreased in vIL-10-treated animals (n6) compared to controls (n6) atthe later day 6 time point [14 � 2 vs. 30 � 6% (of 18s), P � 0.05].Conclusions. cIL-10 is more antithrombotic/anti-inflammatorythan vIL-10. This may be due in part to cIL-10 decreasing P-selectinprotein expression and vIL-10 increasing E-selectin mRNA levels.

P40. Regional Hypothermia Reduces Mucosal NF-�B andPMN Priming via Gut Lymph during Mesenteric Isch-emia/Reperfusion. H. T. Hassoun, M.D., U. Fischer, M.D.,B. O. Attuwaybi, M.D., F. A. Moore, M.D., H. J. Safi, M.D., S. J.Allen, M.D., C. S. Cox, M.D., and C. S. Cox, M.D. UT-Houston,Houston, Texas.

Mesenteric ischemia/reperfusion (I/R) activates proinflammatorymediators that exacerbate gut reperfusion injury and activate circu-lating neutrophils (PMNs) that cause remote organ injury. We haveshown that intraischemic hypothermia (IH) protects the intestinalmucosa during I/R in rats. In this study, we examined the effects ofIH on I/R-induced microvascular permeability, NF-�B activity, andPMN priming via gut lymph in a canine mesenteric lymphatic fistulamodel. Methods. Conditioned dogs underwent 60 min of mesentericischemia (SMA � celiac occlusion) and 180 min of reperfusion with(n � 6) or without (n � 5) IH, induced topically (15°C). Systemicnormothermia (37°C) was maintained, and regional rewarming oc-curred just prior to reperfusion. Mesenteric lymph flow, transvascu-lar protein flux, and ileal tissue water were used to determine per-meability. Biopsies of distal ileum mucosa were obtained at baselineand at 0 and 180 min of reperfusion for NF-�B activity using gel shiftassay. Gels were analyzed using image analysis software and ex-pressed in arbitrary units as percentage of baseline. A kinetic spec-trophotometric assay was used to determine fMLP (1 �M) stimulatedPMN superoxide production (nmol/min/3.75 105 cells) after prim-ing by gut lymph obtained at 180 min of reperfusion. Data arepresented as mean � SEM (*P � 0.05, ANOVA). Results. Microvas-cular permeability increased during reperfusion compared to base-line, and IH had no significant effect on this I/R-induced permeabil-ity. NF-�B activity increased at the end of ischemia and IHprevented this early activation (300 � 75 vs. 128 � 57*). PMNsuperoxide production increased 19-fold during I/R (0.06 � 0.04 vs.1.14 � 0.50*), but only 2.5-fold during I/R-IH (0.28 � 0.09 vs. 0.70 �0.32, P � 0.2) compared to baseline. Conclusions. Regional IHprevented early NF-�B activation and partially abrogated PMNpriming via mesenteric lymph, but had no effect on increased micro-vascular permeability during mesenteric I/R in dogs. The effects ofregional intraischemic hypothermia on both local and systemic in-flammation and injury merit further study.

P41. Distinct Signal Transduction Mechanisms of Peroxyni-trite and Nitric Oxide in Vascular Smooth Muscle CellProliferation. J. Huang, M.D., and R. Sarkar, M.D. Univer-sity of California at San Francisco, San Francisco, California.

Introduction. Peroxynitrite (ONOO), the reaction product of ni-tric oxide (NO) and superoxide, is present in human vascular lesions.The purpose of this study is to determine the effects of ONOO onSMC proliferation and the intracellular mechanisms involved.Methods. Cultured rat SMCs were treated with either ONOO or the


NO-donor S-nitrosoacetylpenicillamine (SNAP) for 16 h. DNA syn-thesis, apoptosis, and cytotoxicity were measured by BrdU incorpo-ration, DNA fragmentation, and LDH release, respectively Results.ONOO (135 �M) and SNAP (0.2 mM) inhibited DNA synthesis. Theantioxidant ascorbate (0.5 mM) reversed SNAP but not ONOO, andthe poly(ADP-ribose) polymerase (PARP) inhibitor 3-aminobenz-amide (0.5 mM) reversed ONOO but not SNAP (see table). ONOO

induced DNA fragmentation and LDH release in a dose-dependentfashion, whereas SNAP, even at high doses, did not (DNA, 270 �MONOO 84 � 17% vs. 2 mM SNAP 16 � 3%, P � 0.01; LDH, 270 �MONOO 64 � 4% vs. 2 mM SNAP 3 � 4%, P � 0.02). Conclusions.The antiproliferative effect of NO is redox-sensitive and does notinduce apoptosis or cytotoxicity. In contrast, ONOO inhibits growththrough a redox-independent mechanism which involves PARP andinduces apoptosis and cytotoxicity. The antiproliferative effects ofNO and ONOO appear to work through distinct signaling pathwaysin SMCs.

P42. Low Shear Stress Increases Permeability and DecreasesOccludin Expression in Porcine Artery EndothelialCells. B. S. Conklin, Ph.D., W. Fu, M.D., P. H. Lin, M.D., A. B.Lumsden, M.D., and C. Chen, M.D., Ph.D. Baylor College ofMedicine, Houston, Texas.

Background. Alteration of endothelial permeability is an impor-tant mechanism of atherogenesis. Tight junction molecule occludin isa key regulator of endothelial permeability. However, the effects ofshear stress on endothelial permeability and occludin expression arenot clear. In this study, we determined whether low shear stresscould impair endothelial permeability and change occludin expres-sion. Methods. Porcine common carotid arteries were cultured for24 h with low (1.5 dyn/cm2) or physiologic (15 dyn/cm2) shear stress.Endothelial occludin mRNA and protein levels were determined withRT-PCR and Western blot, respectively. Vessels were also used todetermine changes in endothelial permeability for LDL-sized goldparticles (20 nm diameter) by image analysis and mass transportmodeling. Differences between groups were considered significantwith P � 0.05 using Student’s t test. Results. RT-PCR and Westernblot results showed a 26% reduction (P � 0.01) in the occludin/GAPDH ratio and a 50% reduction (P � 0.02) in occludin proteinexpression, respectively, in endothelial cells from vessels culturedunder low shear stress relative to vessels cultured with physiologicshear stress. Furthermore, there was approximately a 2.8-fold in-crease (P � 0.0001) in the apparent permeability in low stressvessels compared to physiologic shear stress vessels. Conclusions.These results indicate that low shear stress increases endothelialpermeability to LDL-size particles. The increase in permeability maybe due to a decrease in tight junction protein occludin expression.This study suggests a new molecular mechanism of vascular lesionformation.

P43. Genome-wide Expression Profiling of the DevelopingMouse Aorta. S. E. McLean, M.D., B. Mecham, B.S., S. Corry,B.S., and R. P. Mecham, Ph.D. Departments of Cell Biology andSurgery, Washington University School of Medicine, St. Louis,Missouri.

Introduction. By revealing the molecular mechanisms that con-trol normal blood vessel development, our understanding of angio-genesis, vasculogenesis, aneurysmal disease, and hypertension willbe improved. Our laboratory has had a longstanding interest in thecellular components of the vascular wall and their interaction withelastic extracellular matrix proteins. Our aim is to define the molec-ular mechanisms that play a role in the normal development of theaorta. To perform this task we have performed a large-scale geneexpression analysis of the murine aorta using oligonucleotide mi-croarrays. Methods. Aortae were extracted from mice by manualdissection. The time points studied were e12, e14, e16, and e18;postnatal day (p) 0, p4, p7, p10, p14, p21, p30, and p60; and 5.5 and6 months postnatal. RNA was isolated from pooled aortae usingmodified guanidinium:phenol extraction Method. RNA was reversetranscribed, labeled, and hybridized to the Affymetrix MU74-A2gene chip. All chips intensities were scaled to an average of 1500units for comparison. The data for each probe set were normalizedindependently. Results. The number of probe sets labeled as presentby the Affymetrix software was at an average of 5405 probe setsacross the time course. Preliminary hierarchical clustering showedthe most similarity between “early” (e12 to p7) and “Late” (p10 to 6months postnatal) time points. Within the early time points, theembryonic points e12, e14, e16, and e18 showed the highest degree ofsimilarity for the entire data set. Preliminary analysis has shownsignificant expression levels and expected temporal changes for avariety of extracellular matrix proteins, smooth muscle cell markers,proteoglycans, and growth factors. In addition, a variety of genesthat have not been linked to aortic development have been eluci-dated. Conclusion. Our data set provides a template for gene ex-pression in the developing aorta. The validity of the data set is shownin the preliminary hierarchical clustering of early and late timepoints. The data set not only reveals the expression profile of indi-vidual genes, but it also provides information for the temporal rela-tionships between genes and classes of genes in the developingmurine aorta. Knowledge gained from our data set can be applied tostudy mouse models for vascular disease states.

P44. Arterial Injury in a Mouse Model of Accelerated Athero-sclerosis. K. G. Raman, M.D., M.P.H., D. Gallo, B.S., T. R.Billiar, M.D., and E. Tzeng, M.D. Department of Surgery, Uni-versity of Pittsburgh, Pittsburgh, Pennsylvania.

Background. Multiple preclinical studies have been performed toreduce intimal hyperplasia following vascular injury; however, thesehave been conducted in animals with healthy vasculature. No animalmodels exist to investigate the influence of preexisting atherosclero-sis on the arterial injury response. We sought to create a model ofvascular injury in an atherosclerotic background to more closelyresemble human disease and interventions on diseased vessels. Wehypothesized that the hyperlipidemic apolipoprotein E-deficient (apoE �/�) mice, known to develop accelerated atherosclerosis on ahigh-fat diet, would develop a physiologically relevant injury re-sponse. Methods. We fed age-matched male apo E �/� mice (n � 4)a high-fat Western-type diet (WTD) and control C57BL6 (C57) mice(n � 4) a normal chow diet for 12 weeks. Carotid artery injury wasperformed by passing a 0.014-in. guidewire through a left externalcarotid arteriotomy and rotating it three times through the commoncarotid artery. Flow was reestablished via the internal carotid ar-tery; animals were euthanized 6 weeks after injury and carotidarteries were harvested for analysis. Statistical analysis was per-formed using ANOVA and P values �0.05 were considered statisti-cally significant. Results. Morphometric analysis (MetaMorph)


BrdU uptake (% of control) P value

ONOO 48.3 � 0.19ONOO � ascorbate 40.4 � 0.03 NSONOO 31.1 � 0.03ONOO � 3AB 57.0 � 0.05 0.03SNAP 17.8 � 0.01SNAP � ascorbate 48.2 � 0.10 0.04SNAP 17.8 � 0.01SNAP � 3AB 17.9 � 0.01 NS


revealed significant intimal and medial hyperplasia (�m2) in the apoE �/� versus C57 mice. Intimal area increased 117-fold (P �0.0003); medial area increased fourfold (P � 0.006). Polarized lightmicroscopy and immunohistochemisty with phalloidin staining re-vealed organized lipid and increased smooth muscle cell depositionwithin the medial wall and neointima of apo E �/�, but not C57mice. Conclusions. This is the first reproducible mouse model ofarterial injury in an atherosclerotic background; arterial injury inapo E �/� mice on a high-fat diet resulted in increased intimal andmedial hyperplasia compared with controls. This is clearly distinctfrom the arterial injury response seen in normal rodent vesselswhere intimal hyperplasia predominates. Future experiments willutilize arterial injury in apo E �/� mice fed a WTD to investigate theimpact of oxidative stress and atherosclerosis on the efficacy oftherapeutic interventions directed at the prevention of intimal andmedial hyperplasia.

P45. In Vitro and in Vivo Assessment of Novel Bifunctional-ized Dacron Surfaces. E. R. Deutsch, M.D., M. D. Phaneuf,B.S., D. J. Willis, M.D., M. J. Bide, Ph.D., F. W. LoGerfo, M.D.,and W. C. Quist, M.D., Ph.D. Beth Israel Deaconess MedicalCenter, Boston, Massachusetts.

Introduction. Prosthetic arterial graft failure is, in part, a con-sequence of incomplete healing at the blood/biomaterial interface.Polyester (Dacron) fails to provide conditions suitable for endothelialcell migration, adhesion, and confluence. The purpose of this studywas to evaluate endothelial cell proliferation on Dacron surfacesmodified with the bifunctional amine ethylenediamine (EDA) in vitroand to assess the wound healing response to the modifications invivo. Methods. Mylar, a flattened form of Dacron, was used for invitro experiments. Disks (1.5 cm diameter) were treated with 15%NaOH for 30 min at 100°C (HYDRO), EDA for 80 min at 25°C(C-EDA), or a combination of NaOH and EDA (H-EDA) to createfunctional groups. Human umbilical vein endothelial cells (HUVEC)were then cultured with either complete medium or serum-starvedmedium on our modified Mylar surfaces. Untreated Mylar surfacesserved as the control (CTRL). HUVECs added to tissue culture wellswithout Mylar monitored cell viability. HUVEC growth was moni-tored at 1, 2, 3, and 4 days using an Alamar blue assay. In vivo,woven Dacron patches (1 cm2) were treated using the same methodsas employed for the Mylar disks. The patches were then implanted ina subcutaneous rat model for 14 days and explanted and woundhealing was assessed using histologic techniques. Results. HUVECproliferation occurred on all of our modified surfaces throughout the4-day time interval. H-EDA surfaces demonstrated significantlygreater HUVEC growth with complete medium compared to theCTRL surfaces (64.05 � 4.38 vs. 38.25 � 10.68, P � 0.03). C-EDAsurfaces demonstrated significantly prolonged HUVEC life withserum-starved medium compared to the CTRL surfaces (3.30 � 0.51vs. 1.57 � 0.28, P � 0.005). Histologic evaluation of our explantedpatches revealed no impairment or overall difference in wound heal-ing between the modified Dacron patches and CTRL. Conclusions.This study serves as the foundation for covalent attachment ofbiologically active agents such as growth factors to the accessiblefunctional groups on this novel Dacron surface. Potentially, thesemodifications may promote endothelial cell recruitment followingprosthetic arterial grafting.

P46. Expression of a Ferritin-like mRNA by Abdominal Aor-tic Aneurysm (AAA) Adventitial Fibroblasts. T. P. Jordan,M.D., X. Li, Ph.D., A. F. Bhatti, M.D., J. C. Obunike, Ph.D., andM. D. Tilson, M.D. St. Luke’s Roosevelt Hospital, New York,New York.

Background. A probe of a cDNA library derived from fibroblastscultured from a AAA specimen has shown that the cells are express-ing the mRNA of a ferritin-like protein; the reasons for the upregu-

lation of this potentially protective protein are at present unclear. Ingeneral, the cellular concentration of ferritin is directly related to thephysiologic requirement for its ability to decrease the cytolytic effectsof oxidative stresses like inflammation. Studies of AAA tissue showthe presence of numerous inflammatory cells. Another possibility isthat a ferritin-like sequence has been co-opted by aortic fibroblasts toexpress a novel protein. Methods. Total RNA from cultured AAAfibroblast was purified and size-fractionated. A cDNA library wasconstructed by synthesis based on long-distance PCR. The cDNAexpression library was immunoscreened using the antibody againstAAAP-40, a candidate MatCAM. Positive clones were identified andthe cDNAs were sequenced. Results. The described method resultedin the isolation of a 900-bp sequence that has a 98% homology to themRNA for human ferritin light polypeptide. When the sequence wastranslated, the calculated similarity of the putative expressed pro-tein decreased to 93% (e � 10�84). Conclusions. Previous studieshave shown that AAA adventitial fibroblasts are exposed to oxidativestresses from inflammation. The present finding that these fibro-blasts express a ferritin-like protein may simply reflect a upregula-tion of this potentially protective protein. Nevertheless, the cells maybe using a ferritin-like gene to produce a novel protein which has afunction which is yet to be discovered. Further investigation will berequired to resolve these possibilities.

P47. The Role of a Putative Microfibrillar Protein (80 kDa) inAbdominal Aortic Aneurysm Disease. D. K. Chew, MBBS,J. Knoetgen III, M.D., and M. D. Tilson, M.D. Division ofVascular Surgery, Brigham and Women’s Hospital, HarvardMedical School, Boston, Massachusetts; and St. Luke’s-Roosevelt Hospital Center, Columbia University, New York,New York.

Purpose. To examine the hypothesis that an immune responsedirected at microfibrillar proteins exists in abdominal aortic aneu-rysm (AAA) disease. Methods. An extraction procedure using highconcentrations of guanidinium hydrochloride (GuHCl) under reduc-ing conditions was performed on AAA tissue and normal aorta. Theextracts were probed with IgG isolated with protein A from PBSextracts of 10 AAA specimens and 6 atherosclerotic, nonaneurysmalaortas. Immunoblotting was also performed with serum IgG from 9AAA patients and 9 normal control patients. Immunohistochemistryusing IgG from AAA wall was also performed. Results. Eight of 10AAA wall IgGs reacted with an 80-kDa protein from the AAA micro-fibrillar extract, compared to 0 of 6 atherosclerotic wall IgGs (P �0.0035, Fisher’s exact test). The amount of IgG extracted from AAAtissue was 18 times higher than atherosclerotic aortas. The amountof the 80-kDa protein extracted increased with progressive additionsof GuHCl. When serum IgG was used, none of the 9 AAA patients ornormal control sera demonstrated the reactive band. The same ex-periments using a microfibrillar extract from a normal aorta did notreveal any reactive proteins. Immunohistochemistry using IgG fromAAA wall showed the localization of the antibodies to the adventitialconnective tissue matrix, mainly collagen fibers. Conclusions.These observations suggest that a collagen-associated protein, ex-tractable by a microfibrillar extraction protocol from AAA, may beamong the targets of an autoimmune response in AAA disease.

P48. Red Wine Prevents Homocysteine-Induced EndothelialDysfunction in Porcine Coronary Arteries. W. Fu, M.D.,B. S. Conklin, Ph.D., P. H. Lin, M.D., A. B. Lumsden, M.D., Q.Yao, M.D., Ph.D., and C. Chen, M.D., Ph.D. Baylor College ofMedicine, Houston, Texas.

Background. Hyperhomocysteinemia is an independent risk fac-tor of coronary artery disease. Clinical studies have indicated thatmoderate red wine consumption is associated with a reduction ofincidence of coronary artery disease. In this study, we determinedthe effect of red wine on homocysteine-induced endothelial dysfunc-


tion in porcine coronary arteries. Methods. Porcine coronary arter-ies were dissected from six pig hearts and cut into 5-mm ring seg-ments, which were assigned into four groups (nine rings/group):blank control, homocyteine-treated (50 and 100 �M), red wine-treated (0.08%), and homocysteine plus red wine-treated. The ringswere cultured in cell culture medium with or without treatment for20 h. Myograph analysis was performed with U46619 (10�7 M) forcontraction and accumulative bradykinin (10�9 to 10�5 M) forendothelium-dependent relaxation. The endothelial nitric oxide syn-thase (eNOS) levels were analyzed by immunohistochemistry. Re-sults. In response to 10�5 M bradykinin, porcine coronary arteryrings treated with homocysteine (50 or 100 �M) significantly reducedendothelium-dependent vasorelaxation by 36.69 and 42.63%, respec-tively, compared to controls (P � 0.05). However, the rings treatedwith red wine plus homocysteine (50 or 100 �M) showed no signifi-cant difference as compared to controls. Endothelium-dependent va-sorelaxation was not different between control and red wine-treatedgroups. Furthermore, eNOS immunoreactivity of the vessel ringswas substantially decreased after homocysteine treatment while itremained at relatively normal levels after treatment of homocysteineplus red wine. Conclusions. Homocysteine significantly reducedendothelium-dependent vasorelaxation and eNOS levels in porcinecoronary arteries, and red wine effectively prevented homocysteine-induced endothelial dysfunction. This study suggests that protectingcoronary endothelial cells from homocysteine damage may be animportant mechanism of red wine preventing coronary heart disease.

P49. Fibrin Is Not Necessary for the Recruitment of Leukocytesto Biomaterial Implants. S. J. Busuttil, M.D., V. A. Ploplis,Ph.D., F. J. Castellino, Ph.D., E. D. Rosen, Ph.D., and E. F. Plow,Ph.D. Louis Stokes Cleveland VAMC, Cleveland, Ohio.

Purpose. Recent evidence speculates that fibrinogen and the plas-minogen (Plg) system may play a profound role in mediating cellularrecruitment during the inflammatory response. Immediately afterimplantation fibrin(ogen) adheres to vascular prostheses, like Da-cron grafts, followed by attraction and adherence of leukocytes. Plas-minogen deficiency results in an attenuated recruitment of bothmacrophages and neutrophils without effect on the proportion ofadherent cells in a murine polyethylene terephthalate (PET) implantmodel. These experiments were performed to examine the role offibrinogen in the recruitment of leukocytes to biomaterial implantsin fibrinogen-deficient mice. Methods. This model involves surgicalplacement of PET disks into the peritoneum of mice. Leukocytesrecovered from peritoneal lavage and adherent to the disks after18 h, and macrophages and neutrophils populations are distin-guished by enzyme activity assays. Results. Following peritonealimplant in wild-type and fibrinogen-deficient mice (Fgn (�/�)), therewas a 65% reduction in the number of adherent macrophages onimplant disks and a 64% reduction in the number of neutrophilsadherent to the implants. Total recruited cells (adherent � free inthe lavage) were quantified; there was no difference in the totalnumber of neutrophils recruited, but there was a decrease in thetotal number of recruited macrophages due to the high percentage ofthese cells adherent to the disk (45%). These results are consis-tent with experiments in which albumin was applied to the im-plants prior to implantation. In those experiments, the total cellrecruitment was not affected, but the proportion of adherentmacrophages was significantly decreased. Conclusion. The lackof fibrinogen resulted in a decreased leukocyte adherence tothe biomaterials implants, but fibrinogen or fibrin degradationproducts are not required to recruit leukocytes into the perito-neum, suggesting a primarily adhesive role of fibrinogen in implantresponses.

P50. Comparative Study of Transabdominal Ultrasonogra-phy and Video Microscopy Measurements of Aortic Di-ameters in Rat and Mouse Models of Aneurysm Disease.

B. S. Knipp, M.S., G. Ailawadi, M.D., V. V. Sullivan, M.D., K. J.Roelofs, D.V.M., P. K. Henke, M.D., J. C. Stanley, M.D., andG. R. Upchurch, Jr., M.D. Vascular Surgery Section, Universityof Michigan, Ann Arbor, Michigan.

Objective. This study compared transabdominal ultrasound (US)measurements of aortic diameters in rats and mice to measurementsobtained by video microscopy (VM), the latter being the currentstandard for assessing rodent aortic dimensions. Methods. Mea-surements of outer vessel diameters were undertaken in 64 rats (n �132 sets) and 12 mice (n � 36 sets) following experimental inductionof aortic aneurysms. Measurement sets included diameters at therenal vein, midinfrarenal aorta, and aortic bifurcation. Results. Inthe rat, US measurements correlated highly with VM measure-ments: transverse US measurement correlation coefficients rangedfrom 0.6625 to 0.7734 (P � 0.0001), and anterior–posterior US mea-surement correlation values ranged from 0.5831 to 0.6339 (P �0.0001) when compared to VM. In the mouse, correlation coefficientswere 0.5735 near the renal vein VM (P � 0.0003), 0.4400 at themidinfrarenal aorta (P � 0.0072), and 0.2482 at the aortic bifurca-tion (P � 0.1444). Importantly, vessel diameter increased signifi-cantly with increasing animal weight (r � 0.4010, P � 0.0029 renalvein; r � 0.2855, P � 0.0383 infrarenal aorta; and r � 0.3899, P �0.0039 aortic bifurcation), suggesting that weight-matched rodentsshould be used to define aortic dimensions in treatment groups asopposed to repeated comparisons with baseline measurements in agrowing animal. Conclusion. US provides noninvasive vascularmeasurements throughout the course of a given study and offers anaccurate alternative to VM for the assessment of aortic diameters inrodent models.

P51. Influence of an Endovascular Program on SurgicalTraining. L. S. Brevetti, M.D., G. B. Nackman, M.D., L. E.Shindelman, M.D., R. G. Ciocca, M.D., J. G. Crowley, M.D., andA. M. Graham, M.D. Robert Wood Johnson Medical School,New Brunswick, New Jersey.

Purpose. As endovascular procedures develop, there is a risk ofdiminished training of residents and fellows in traditional opensurgery. We evaluated the effect of our endovascular program, initi-ated in 2000 coincident with the FDA approval of endoluminal vas-cular aortic grafts (EVAG), on the number of endovascular proce-dures and open AAA repairs performed with comparison to nationaltrends. Methods. The experience of vascular fellows and chief resi-dents at completion of training (1994–2002) was reviewed and com-pared with the national mean case numbers before and after initia-tion of our endovascular program. Results. After 2000 our fellowsperformed more endovascular cases, EVAG, and open AAA repairsthan during the prior time period and than the national average (P �0.05). Resident open AAA repairs were less than the national meanof 9. Regression analysis identified the endovascular program as anindependent variable that affected the total number of endovascularand EVAG cases performed by fellows (see table). Time indepen-dently affected the open AAA and total AAA repairs performed by


Trainee:

Years:

Fellow (local) Resident (local)

1994–1999 2000–2002 1994–1999 2000–2002

All Endo cases 16 � 3 187 � 140* 8 � 10 9 � 0EVAG 1 � 1 25 � 18* 0 0Open AAA 36 � 13 56 � 6* 9 � 2 8 � 1All AAA 37 � 14 81 � 13* 9 � 2 8 � 1

Note. Mean � SD.* P � 0.05 vs fellows, 1994–1999, by ANOVA.


fellows. During 1994–1999, open AAA repairs performed by fellowsincreased (P � 0.05). However during 2000–2002, increasing timewas inversely associated with the number of open AAA repairs (P �0.05). Conclusion. An endovascular program led by vascular sur-geons can increase the total number of AAA repairs performed byvascular fellows, but has decreased the number of open repairs. Thismay present a training challenge for future residents and fellows,since the AAAs not amenable to EVAG will be more complex andtrainees may have decreased experience with open aortic surgery.This may suggest the need to concentrate open AAA repairs to thetrainees acquiring advanced training in vascular surgery.

ORAL POSTER IV: CRITICAL CARE

P52. The Effect of Hypertonic Saline on Permeability in theActivated Endothelium. G. P. Victorino, M.D., C. R. Newton,M.D., and B. Curran, B.S. UCSF–East Bay, Oakland, Cali-fornia.

Introduction. The effect of hypertonic saline on microvascularpermeability during inflammation is unclear. We hypothesized thathypertonic saline would decrease microvascular permeability afteractivation of the endothelium. Methods. Hydraulic permeability(Lp) is a measure of water flow across the endothelial barrier. Lp wasmeasured in cannulated rat mesenteric venules using the modifiedLandis microocclusion technique. Transmural water flux per unitarea (Jv/S) was calculated from marker cell velocity during vesselocclusion at several perfusion pressures (Pc). Lp was estimated bylinear regression analysis as Lp � (Jv/S)(1/Pc) derived from theStarling equation. ATP (10 �M) is used to induce an activated stateand increases Lp fourfold. The effect of 185 mM hypertonic saline(HTS) was tested by measuring Lp at baseline (BL), after perfusionwith ATP, and again after HTS (n � 6). Additional venules were usedto test the effect of adding dextran to the HTS. After Lp measure-ments at BL, measures of Lp were obtained after perfusion with ATPand again after HTS plus 2% dextran (HSD) (n � 6). Repeatedmeasures ANOVA was used to determine significance. Units for Lp

are 10�7 cm sec�1 cm H2O�1. Results. Both HTS (P � 0.01) (Fig. 1)and HSD (P � 0.001) (Fig. 2) significantly decreased Lp after endo-thelial activation (*,**statistical significance compared to BL andATP, respectively). Conclusions. In addition to increasing plasmavolume, hypertonic solutions may also decrease microvascular fluidloss during states of elevated microvascular permeability andthereby have an additional beneficial mechanism that acts to main-taining intravascular volume.

P53. Intracellular Survival of Staphylococcus aureus in Caco-2Enterocytes. D. J. Hess, M.D., M. J. Henry-Stanley, Ph.D., E. A.Erickson, B.S., and C. L. Wells, Ph.D. Department of Surgery,University of Minnesota, Minneapolis, Minnesota.

Purpose. To determine the ability of Staphylococcus aureus tosurvive within nonprofessional phagocytes, specifically cultured en-terocytes. Background. S. aureus often causes complicating infec-tions in high-risk postsurgical, shock, trauma, and immunocompro-mized patients. S. aureus can be difficult to eradicate despite longcourses of antibiotic therapy. This observation, combined with the

fact that S. aureus can be internalized by phagocytic cells (includingleukocytes, fibroblasts, endothelial cells, and several types of epithe-lial cells), has led to speculation about the ability of S. aureus tosurvive in host cells. Methods. S. aureus 502A (prototypic avirulentstrain) and S. aureus RN6390 (prototypic virulent strain) were in-cubated for 1 h with Caco-2 enterocytes (100:1 bacteria:enterocyteratio). Enterocytes were washed, and residual extracellular staphy-lococci were eliminated by 1.5 h of incubation in 50 �g/ml gentami-cin. Enterocytes were then washed, lysed, and cultured for viableintracellular staphylococci. This was considered time zero. Separateenterocyte cultures remained in the antibiotic for an additional 2, 4,and 22 h. Numbers of intracellular bacteria were converted to log10

prior to statistical analysis (ANOVA within a given strain and un-paired Student’s t test between strains). Results. S. aureus wasinternalized by Caco-2 enterocytes. Numbers of intracellularRN6390 were consistently greater than the relatively avirulent502A, although this difference was significant (*P � 0.01) only at the4-h time point. Within a given strain, there were no differences innumbers of intracellular S. aureus at 0, 2, 4, and 22 h (see table).

Conclusions. S. aureus can be internalized by Caco-2 enterocyteswhere the organism can survive intracellularly for at least 22 h.Survival within host cells may contribute to the virulence of S.aureus.

P54. NADPH Oxidase Subunits Translocate to the Membraneof Neutrophils Following Priming by Platelet-ActivatingFactor. F. R. Sheppard, M.D., E. E. Moore, M.D., A. Banerjee,Ph.D.,* F. Gamboni-Robertson,* J. L. Johnson, M.D., C. C.Silliman, M.D., Ph.D.† Departments of Surgery, DHMC, and*University of Colorado Health Sciences Center, Denver, Col-orado; and †Bonfils Blood Center, Denver, Colorado.

Purpose. We hypothesize that neutrophil (PMN) priming by acommon postinjury lipid mediator (PAF) results in the translocationof NADPH oxidase subunits to the plasma membrane. Background.PMN priming is a well-recognized physiologic response. Heretofore,the standard test to identify PMN priming has been its physiologicresponse (i.e., oxidative burst) to an activating agent in vitro. ThePMN oxidative burst is the result of activated NADPH oxidase (amulticomponent enzyme including the phox proteins: gp91, p47, andp67). The oxidase is dormant in resting cells and is only activatedfollowing subunit translocation to and subsequent assembly at thePMN plasma membrane. Digital microscopy and immunohistochem-istry techniques now make it possible to study NADPH oxidasesubunits in whole PMNs. Methods. Human PMNs were isolated andprimed with PAF (2 �M) for 3 min and then fixed in 4% paraformal-dehyde. The phox proteins p47, p67, and p91 were immunohisto-chemically labeled and translocation of the respective proteins wasdetermined by digital microscopy. All data were analyzed by ANOVA(P � 0.05 significant). Results. PMN priming by PAF resulted in a


Numbers of Viable Intracellular S. aureus

Incubation time (h)

S. aureus strain

502A RN6390

0 2.4 � 0.1** 3.0 � 0.22 2.5 � 0.1 3.0 � 0.44 2.3 � 0.1 3.6 � 0.2*

22 2.6 � 0.2 2.7 � 0.4

Note. Average � SE log10 of three assays, each assay representingthe average of triplicate determinations.


significant increase in the percentage of cellular p67 and p91 locatedwithin the plasma membrane (18.2% to 20.5%, P � 0.04; and 21.8%to 25.3%, P � 0.004, respectively); there was no significant change inp47. Normalized data are shown in the figure. Conclusions. The

phox proteins gp91 and p67 translocate to the PMN membrane inresponse to PAF priming. The identification of NADPH oxidase sub-unit translocation represents a novel way to identify PMN priming.Further investigation of NADPH subunit translocation may facili-tate investigation of the fundamental mechanisms responsible forthe primed state.

P55. Superior Mesenteric Artery Occlusion (SMAO) ModelsShock-Induced Gut Ichemia/Reperfusion. R. A. Kozar,M.D., Ph.D., J. B. Holcomb, M.D., J. M. Macaitis, B.S., R. C.DeSoignie, M.S., and F. A. Moore, M.D. University of Texas atHouston, Houston, Texas.

SMAO is a simple and reproducible model of shock-induced gutishemia/reperfusion (I/R), but some argue that it is not clinicallyrelevant. Our purpose, therefore, was to compare SMAO to a stan-dard model of controlled hemorrhage (CH) and the more clinicallyrelevant but inherently variable model of uncontrolled hemorrhage(UH). Methods. Rats had femoral lines and a jejunal mucosal laserDoppler placed followed by SMAO (60 min ischemia (I), no resusci-tation), CH (40 mm Hg 60 min, 2:1 resuscitation), or UH (liverinjury, 3:1 resuscitation). Base deficit (BD), lactate and jejunal mu-cosal blood flow (MBF, as a percentage of baseline) were recordedduring ischemia and for 120 min postreperfusion (R). Comparisonbetween groups was performed using one-way analysis of variancefollowed by Tukey’s test. Significance was set at P � 0.05, and dataare reported as mean � SEM. Results. MBF was similar betweengroups at the onset of R and during the initial 90 min of R. There-after, BF in CH was higher than in either UH or SMAO. Base deficitwas significantly higher in CH at the onset of R (�24 � 2a,b vs. UH�10 � 3 and SMA �6 � 3) but comparable by the end of 120 min of

R (�17 � 4 vs. UH �16 � 3 and SMA �17 � 4). Lactate showedsimilar results (onset of R, CH 7 � 1a,b vs. UH 3 � 0.4 and SMAO 2 �0.3; end of 120 min of R, CH 6 � 4, UH 4 � 1, and SMAO 6 � 2) (seefigure). Conclusion. SMAO is a clinically relevant model of shock-induced gut I/R.

P56. LPS Inhibits Candida albicans Interaction with Intesti-nal Epithelium. M. J. Henry-Stanley, Ph.D., D. J. Hess, M.D.,R. M. Garni, B.S., E. A. Erickson, B.S., and C. L. Wells, Ph.D.,Department of Laboratory Medicine and Pathology, Universityof Minnesota, Minneapolis, Minnesota.

Purpose. Using wild-type Candida albicans CAF2 (produces bothyeast and filamentous forms) and mutant HLC54 (defective in fila-ment formation), the effect of bacterial LPS on the interactions of C.albicans with the intestinal epithelium in vivo and in vitro wasdetermined. Background. Systemic C. albicans infections are com-mon in postsurgical and trauma patients. Mortality remains 38% to75% and risk factors include prolonged antibiotic therapy. Becausethe GI tract is believed to be the source of most systemic infection, weassessed the effect of LPS on C. albicans translocation across themouse intestinal tract and on C. albicans adherence to culturedenterocytes. Methods. Antibiotic-treated mice were orally inocu-lated with 107 C. albicans CAF2 or HLC54 and euthanized 3 dayslater; Escherichia coli 0111:B4 LPS (100 �g) was given intraperito-neally 16 h before euthanization and C. albicans was quantified inthe cecum and in the draining mesenteric lymph nodes (MLN).Mature, confluent Caco-2 and HT-29 enterocytes (with and withoutpretreatment in calcium-free medium to open tight junctions) wereincubated for 30 min with yeast forms of C. albicans CAF2 or HLC54,and adherence was measured by ELISA. Results. Although paren-teral LPS increased the numbers of cecal C. albicans 10-fold (to106.5–7.7/g) in mice, translocation to the MLN was not detected (12mice/group). This was unexpected because LPS-induced cecal bacte-rial overgrowth has been repeatedly associated with increased trans-location of enteric bacteria to MLN. In vitro, LPS was associated withdecreased adherence of C. albicans to both HT-29 (not shown) andCaco-2 enterocytes [see figure; † ,*decreased P � 0.05 and 0.01, re-spectively. compared to corresponding enterocytes without LPS(ANOVA and Fisher’s post hoc)]. Conclusions. Increased levels of

circulating LPS and/or increased levels of LPS in the intestinallumen may play a role in controlling C. albicans adherence to andpenetration of the intestinal epithelium.

P57. Identification of a Unique Population of T Cells afterBurn Injury Using Flow Cytometry. D. M. Pilati, M.D.,


B. A. Cairns, M.D., R. Maile, Ph.D., J. A. Frelinger, Ph.D., andA. A. Meyer, M.D., Ph.D. UNC–Chapel Hill, Durham, NorthCarolina.

Introduction. Previous studies demonstrating T-cell dysfunctionfollowing burn injury have required T-cell activation with mitogen orantigen to detect differences. We hypothesize that burn injury in-duces phenotypic changes in unactivated T that are identifiableusing recent advances in flow cytometry. Methods. Female HY TCRrag�/� transgenic mice underwent 20% scald burn followed bysplenocyte harvest at 72 h. Cells were labeled with CFSE for 10 min,washed, and then analyzed with flow cytometry within 2 h of spleno-cyte harvest without activation. Results. T cells from the burn miceshift toward a larger and more granular morphology as demon-strated in the figure. Histograms from cells prior to labeling with

CFSE show no difference between sham and burn mice. Labelingsham T cells with CFSE demonstrates no change in the histogram.CFSE labeling of T cells from burn mice, however, causes a fourfoldincrease in percentage of cells in R2 (6.7 vs. 25.7%; P � 0.05), whereR1 represents the size and granularity typical of resting lympho-cytes, while region R2 represents larger and more granular cells.Conclusion. These histograms demonstrate, for the first time, thata unique population of T cells can be identified after burn injury priorto in vitro stimulation. This population may represent cells with aunique activation profile or apoptosis and may partially explainaltered T-cell function after burn injury.

P58. LBP Catalyzes the Inflammatory Response to Endotoxinvia Distinct Domains within the LBP-Carboxyl Domain.V. Lazaron, M.D., Ph.D., D. B. Leslie, M.D., K. R. Wasiluk,Ph.D., and D. L. Dunn, M.D., Ph.D. Department of Surgery,University of Minnesota, Minneapolis, Minnesota.

Background. Lipopolysaccharide-binding protein (LBP) is anacute-phase serum protein that amplifies the inflammatory responseto and clearance of bacterial endotoxin (LPS). The LPS-binding do-main of LBP is in the amino-terminal half of the protein, and thecarboxyl-terminal domain of LBP is thought to mediate interactionsthat deliver LPS to the cell surface LPS–receptor complex. Thepresent study tests that hypothesis by antagonism of LBP-mediatedTNF-� production in RAW 264.7 cells by peptides derived from thecarboxyl-terminus of LBP. Methods. Peptides were synthesizedbased on selected domains of the carboxyl domain of LBP. These wereincubated along with Pseudomonas aeruginosa LPS, LBP, and RAW264.7 cells. TNF-� production was assayed by WEHI cell bioassay.Results. Two peptides, LBP345-357 and LBP407-420, produced dose-dependent reduction in TNF-� production by RAW264.7 cells respond-ing to LPS and LBP (P � 0.01). These peptides had no effect on LPSstimulation of TNF-� production in the absence of LBP, nor did anypeptide stimulate TNF-� production in the absence of LPS. Conclu-sions. Peptides derived from the carboxyl-terminus of LBP antagonizedthe LPS stimulation of TNF-� production by RAW264.7 cells only in the

presence of LBP. These data suggest a role for distinct domains withinthe carboxyl terminus of LBP mediating protein–protein interactionsthat catalyze the inflammatory response to endotoxin.

P59. GMCSF and IFN� Prime Monocyte Inflammatory Signal-ing Pathways. D. M. Gourlay, M.D., J. Cuschieri, M.D., I.Gacia, B.S., S. Jelacic, B.S., and R. V. Maier, M.D. Departmentof Surgery, University of Washington, Seattle, Washington.

Priming of monocytes to infectious stimuli leads to an excessiveinflammatory response that can be detrimental to the patient.GMCSF and IFN�, but not GCSF, have been demonstrated to primemonocytes for increased production of proinflammatory mediators,such as TNF�, following endotoxin (LPS) stimulation. Both the LPSreceptor TLR4 and the mitogen activated protein kinase (MAPK)intracellular signaling pathway are known to be important to mono-cyte production of inflammatory mediators, but the effect of theseendogenous priming agents on both TLR4 expression and MAPKactivation remain unclear. Methods. Nonadherent THP-1 mononu-clear cells were pretreated with GCSF, GMCSF, or IFN� for 0–24 hprior to stimulation with LPS. TNF� production was measured fromsupernatants by ELISA. TLR4 and CD14 cell surface expression wasassessed by flow cytometry. Activation of the MAPK, p38, andERK1/2, was quantified by Western blot. Statistical analysis wasperformed by unpaired t tests on a minimum of three similar exper-iments. Results. LPS stimulation of monocytes led to activation ofp38 and ERK1/2 as well as TNF� production. Monocytes wereprimed for increased TNF� production by both GMCSF and IFN�,but not GCSF, and occurred as early as 2 h following pretreatment.Six hours of pretreatment with either priming agent led to a twofoldincrease in TNF� production (P � 0.05). Twenty-four hours of pre-treatment led to further priming for TNF� production by IFN�(threefold increase, P � 0.05), but not by GMCSF (twofold increase,P � 0.05). The priming effect for both GMCSF and IFN� was asso-ciated with increased LPS-stimulated p38 and ERK1/2 activationfollowing 6 h of pretreatment compared to LPS alone. Consistentwith the lack of priming for TNF� production, GCSF had no effect onLPS stimulated MAPK activity. Despite the priming effect byGMCSF and IFN�, no significant effect on cell surface expression ofTLR4 or CD14 was demonstrated. Conclusion. GMCSF and IFN�prime monocytes for increased inflammatory mediator productionand activation of the MAPK signaling pathway, independent of up-regulation of TLR4 expression.

P60. Transient Down-Regulation of Two Novel Transcripts ofMurine Endogenous Retroviruses in the Thymus afterInjury. K. Cho, Ph.D., T. N. Pham, M.D., and D. G. Green-halgh, M.D. Shriners Hospitals for Children Northern Califor-nia, Sacramento, California.

Background. Burn injury alters molecular profiles as well asphenotypes of immune organs, which often contribute to systemicpathogenesis. We recently reported the induction of murine endoge-nous retroviruses [murine AIDS (MAIDS)-related] in several distantorgans of mice after burn injury. The regulation of endogenousretroviruses following burn injury was further investigated in thethymus, an organ associated with retrovirus replication/activation.Methods. Female C57BLKS/J mice (five mice in each group) were


subjected to 18% total body surface area flame burn injury. Thymustissues collected at several time points (3 h to 7 days) were analyzedfor the regulation of subgenomic transcripts of murine endogenousretroviruses by RT-PCR using a primer set capable of amplifyingfull-length viral transcripts. Results. Interestingly, two novel sub-genomic transcripts, approximately 1.7 and 1.1 kb, were transientlydown-regulated in the thymus at day 1 after injury compared to noburn controls and other time points examined (see figure). The 1.7-kb

transcript encodes an envelope protein with a deletion of 418 aminoacids near the C-terminus of the predicted protein. In contrast, thesecond transcript of 1.1 kb has a coding potential for p15 gag proteinfollowed by a premature termination of p12 protein. Conclusions.These data suggest that the modulation of endogenous retroviralsequences, in conjunction with the potential ecotropic viral replica-tion, may alter the cellular profile and function of the thymus afterinjury.

P61. Modulation of Interleukin-6 in Cardiac Myoblasts dur-ing Endotoxemia. L. C. Vona-Davis, Ph.D., Z. Xiaocheng,M.D., A. K. Yu, M.D., and D. W. McFadden, M.D., FACS.Department of Surgery, West Virginia University, Morgan-town, West Virginia.

Introduction. Interleukin-6 (IL-6) is the cytokine best correlatedwith sepsis severity. Recent studies demonstrate that IL-6 is inducedin the heart during endotoxic stress. In this study, we investigatedendotoxin-induced IL-6 in vitro, as well as its modulation by IL-1�and TNF-�, two cytokines characteristically produced by activatedmacrophages. Methods. H9c2 cardiac myoblasts were grown in cul-ture using standard techniques. IL-6 levels were determined byELISA (1–24 h) post-LPS (10 �g/ml) administration and in thepresence of TNF-� (10 ng/ml) or IL-1� (10 ng/ml). IL-6 mRNA wasamplified using RT-PCR and relative amounts of RNA were deter-mined by densitometry normalized to the 18S RNA signal. Statisticalanalysis was performed by ANOVA. Results. LPS stimulated IL-6secretion in a time-dependent manner (P � 0.05) between 3 and 24 hafter administration. IL-6 mRNA expression was also significantlyincreased during the first 6 h with LPS. In endotoxin-naive myo-blasts, IL-1� alone increased IL-6 and augmented production abovecontrols when combined with TNF-� (P � 0.05). However, 4 h afterLPS exposure, exogenous TNF-� reduced IL-6 production, which wasfurther reduced upon addition of IL-1�. These data are shown in thefigure. Conclusions. We have shown for the first time that cardiacmyoblasts discriminate between inflammatory and septic stimuli.

The production of myocardial IL-6 is either enhanced or reduced de-pending on interactions between TNF-�, IL-1�, and LPS challenge.

P62. S-Nitrosoglutathione Infusion Produces Relaxation ofSmall Resistance Vessels, No Change in Large Compli-ance Vessels, and Alteration of Cardiac Function. R. K.Goldman, M.D., and A. A. Vlessis, M.D., Ph.D. Oregon Healthand Science University, Portland, Oregon.

Background. In vitro, under physiologic conditions, the reactionof nitric oxide and reduced sulfhydryl moieties generates nitrosothi-ols, which relax vascular smooth muscle and weaken myocardialcontraction. We hypothesized that, in vivo, S-nitrosoglutathionewould produce comparable effects on the arterial and cardiac sys-tems. Methods. In four instrumented, anesthetized pigs, an intra-venous continuous infusion of S-nitrosoglutathione (0–50 nmol/kg/min) was administered. At steady state, cardiac output (CO), systolicand diastolic pressure, heart rate (HR), central venous and pulmo-nary artery occlusion pressure, and plasma nitrosothiol concentra-tion were measured. Systemic vascular resistance index (SVRI),stroke volume (SV), and pulse pressure (PP) were calculated. Sys-temic arterial compliance (C) was calculated as the ratio of SV toPP. Results. S-Nitrosoglutathione produced a significant dose-dependent reduction in mean arterial pressure* and increase in CO*and HR.* Calculated SVRI was significantly reduced*, while C re-mained constant (P � NS). Plasma nitrosothiol concentration in-creased as infusion dose increased (r2 � 0.97, P � 0.001, linearregression) (see figure). Conclusion. S-Nitrosoglutathione produces

arterial small vessel relaxation. The constancy of arterial compliancewith reduced blood pressure suggests impaired left ventricular func-tion or reduced preload. Nitrosothiols may contribute to the systemiccardiovascular alterations observed in disease states involving in-creased nitric oxide production.

P63. Carbon Dioxide Enhances the Virulence of Pseudomonasaeruginosa. D. Pelham, B.S., L. Wu, M.D., Ph.D., Z. Olga, Ph.D.,and J. C. Alverdy, M.D. University of Chicago, Chicago, Illinois.

We have successfully modeled lethal gut-derived sepsis by intro-duction of live Pseudomonas aeruginosa (Pseud) into the intestinaltract of surgically stressed mice. In this model, in vivo expression ofa key virulence determinant, the PA-I lectin, results in a defect inepithelial permselectivity to several lethal cytotoxins of Pseud re-sulting in mortality of mice in 48 h. The purpose of this study was todetermine whether carbon dioxide (CO2), known to be released by theintestinal mucosa in response to stress and ischemia, could inducePA-I expression in Pseud thereby explaining the enhance virulenceof this organism in the intestinal tract of a stressed host. Methods.A clinical strain of Pseud (ATCC 27853) was used for all studies. PA-Ifusion constructs were generated with green fluorescent protein(GFP) to fluoresce in response to the induction of PA-I. GFP-taggedand nontagged strains of Pseud were then exposed to varyingamounts of ambient CO2 and PA-I expression assessed by fluorescentmicroscopy and by Northern blot. Results. Results are shown in the


figure. Conclusion. Carbon dioxide alone can induce the expressionof a key virulence determinant in P. aeruginosa and therefore mayenhance the pathogenicity of this organism in the intestinal tract ofa stressed host. We speculate that intestinal epithelial end-productsof ischemia such as CO2 may act as bacterial pheromones or “auto-inducer” molecules affording certain pathogens unique opportunismduring periods of host vulnerability.

P64. Alveolar TNF� Is Increased and MIP-2 Is Decreased in aRat Model of Large-Volume Ventilation. P. B. Rich, M.D.,C. D. Douillet, Ph.D., S. A. Mahler, M.D., and R. C. Boucher,M.D. University of North Carolina at Chapel Hill, Chapel Hill,North Carolina.

Introduction. Several experimental lung injury models havedemonstrated inflammatory mediator alterations in bronchoalveolarlavage (BAL) fluid, but it is controversial whether large-volumemechanical ventilation (mv) alone can alter alveolar inflammatorymediators. We hypothesized that in vivo, alveolar stress causedsolely by large-volume mv would produce measurable changes inproinflammatory BAL cytokine levels. Methods. Thirty-two maleSprague–Dawley rats (weight 410 � 47 g) were anesthetized, para-lyzed, and randomized to: (1) control (CTL, n � 6, no ventilation,immediate sampling), (2) low-volume mv (LV, n � 13, Vt � 7 ml/kg),or (3) high-volume mv (HV, n � 13, Vt � 40 ml/kg). All mv animalswere ventilated with room air, 40 bpm, and ZEEP. At 60 min, BALwas performed. Centrifuged lavages were analyzed for TNF� andMIP-2 with ELISA (R&D Systems and Biosource International, re-spectively). Data (means � SD) were analyzed by two-way ANOVAand post hoc testing. Results. Neither control nor LV animals haddetectable levels of TNF� in the BAL fluid, while significant in-creases were observed with HV mv (P � 0.0001 vs. CTL and LV).BAL MIP-2 levels did not differ between CTL and LV groups(P � 0.21 CTL vs. LV), but were significantly decreased following1 h of HV mv (P � 0.02 vs. CTL, P � 0.0001 vs. LV; see figure).

Conclusion. Contrary to recent reports, we observed that 1 h ofpositive-pressure mechanical ventilation with large tidal volumesresulted in increased TNF� levels and decreased MIP-2 levels in ratBAL fluid.

P65. Internalization of Lipoprotein-Bound LPS Induces Tol-erance to Cytokines in Rat Hepatocytes. F. B. Kasravi,M.D., Ph.D., and H. W. Harris, M.D., M.P.H. UCSF, San Fran-cisco, California.

Purpose. To demonstrate the correlation between the induction ofcytokine tolerance and the amount of chylomicron-bound endotoxin(CM-LPS) internalized by primary rat hepatocytes. Background.We have previously shown that hepatocytes are rendered unrespon-sive to stimulation by proinflammatory cytokines following pretreat-ment with CM-LPS complexes, a process which requires functionalLDL receptors (LDLR). We questioned whether the degree of toler-ance following pretreatment correlates with the actual amount ofinternalized CM-LPS. Thus, we compared the kinetics of CM-LPSinternalization to the kinetics of cytokine tolerance induction. Meth-ods. Primary rat hepatocytes were pretreated with radiolabeledCM-LPS complexes for 0–8 h, and the rate of internalization wasmeasured via gamma counter. Hepatocytes similarly pretreated withCM-LPS were stimulated by proinflammatory cytokines (TNF-?, IL-1?, INF-?) and NO production determined as a measure of hepato-cellular activation. Results. The magnitude of the hepatocellularresponse to cytokines inversely correlated with the amount of CM-LPS internalized (r2 � –0.994 Pearson correlation test, see figure).

The degree of cytokine tolerance plateaued in a manner identical tothe saturation kinetics observed for CM-LPS internalization. Con-clusion. Induction of cytokine tolerance in hepatocytes is directlydependent on the internalization of lipoprotein-bound LPS. The stoi-chiometric relationship between internalized CM-LPS and the atten-uated cytokine response suggests that lipoprotein-bound LPS some-how directly interferes with intracellular cytokine signaling.

P66. The Effect of Myocardial Infarction (MI) on Outcomes inCritically Ill Surgical Patients (CSP). S. R. Eachempati,M.D., L. J. Hydo, M.B.A., and P. S. Barie, M.D. New YorkPresbyterian Hospital, Weill Medical College of Cornell, NewYork City, New York.

Introduction. MI remains the leading cause of death in the generalpopulation. We wanted to determine the effects of MI on the outcomesin CSP. We hypothesized that age and illness severity would predict MIin CSP and that MI would have a significant effect on mortality in CSP.Methods. Patients admitted to the SICU of a tertiary medical centerfrom 1992–2002 were studied. Patients with standard enzyme criteriafor MI were identified. Demographic data such as age, sex, APACHE III


(A3), cumulative MOD score (MMOD), case mix and mortality werecollected. The presence of comorbidities (cardiac, renal, pulmonary, DM,and CHF) were noted. A cohort of patients with matched acuity, age,and length of stay was identified for comparison by MANOVA (depen-dent variable, expired; independent variables, age, A3, sex, cardiachistory, case mix, and MI). Data are reported as �SEM (P � 0.05).Results. A total of 262 patients of 7485 admitted during the studyperiod were diagnosed with MI (3.5%). For patients with MI, only A3and MMOD differed between survivors and nonsurvivors (see table). In

all patients in the general population the mortality was 9.7%, whereaspatients with an MI had a 44.6% mortality (P � 0.0001). By MANOVA,A3 and MI predicted mortality in the cohort analysis of CSP while sex,age, case mix, and the presence of cardiac history did not influenceoutcome. In analyzing the comorbidities most present in the MI pa-tients, 128 had a cardiac history (48.9%), 12.6% had diabetes, 13.3% hadrenal failure, 9.5% had COPD, and 4.6% had CHF. Conclusions. MI isuncommon but confers significant mortality in CSP. MI and illnessseverity predict poor outcome in CSP whereas age and sex have lessinfluence. Many patients who experience MI in the SICU have noprevious cardiac history, highlighting the need to maintain surveillanceand �-blockade in all CSP.

P67. Inhibition of 5-Lipoxygenase Decreases Survival in Ei-cosapentaenoic and �-Linolenic Acid-Treated HL-60Cells. R. C. Gillis, M.S., B. J. Daley, M.D., B. L. Enderson,M.D., and M. D. Karlstad, Ph.D. University of Tennessee Med-ical Center, Knoxville, Tennessee.

Enteral nutrition containing eicosapentaenoic acid (EPA; 20:5n-3)and �-linolenic acid (GLA; 18:4n-6) decreases leukotriene B4 levelsand the number of neutrophils in the bronchoalveolar lavage fluid ofpatients with acute respiratory distress syndrome (ARDS). Reduc-tion in pulmonary inflammation may be due to decreased neutrophilmigration and/or survival. Strategies to increase neutrophil apopto-sis may lead to enhanced resolution of pulmonary inflammation inARDS. We recently showed that apoptosis increases in EPA/GLA-treated HL-60 cells. However, it is not known if EPA/GLA-inducedapoptosis involves downstream metabolic products of the lipoxygen-

ase (LO) and cyclooxygenase (COX) enzymes. This study determinedthe effect of inhibitors of LO and COX enzymes on EPA/GLA-treatedHL-60 cells. Cells were incubated with 50 �M EPA/20 �M GLA in thepresence of an enzyme inhibitor (1–10 �M) for 12 h. Compounds wereused to inhibit COX (ibuprofen), 12-LO (baicalein), or 5-LO (AA861).Flow cytometry using annexin V–FITC and propidium iodide stain-ing assessed viability, apoptosis, and necrosis in HL-60 cells (seetable). 5-LO inhibition reduced viability and increased secondarynecrosis in EPA/GLA-treated HL-60 cells. Inhibition of COX 1 and 2and 12-LO had no significant effect on viability, apoptosis, and ne-crosis in EPA/GLA-treated HL-60 cells. These data suggest that thedisruption of the processing of EPA and GLA by 5-LO is critical tocell survival. Additionally, the inhibition of 5-LO may shunt themetabolism of EPA and GLA to other pathways involved in theregulation of cell survival. Thus, the 5-lipoxygenase pathway playsan important role in the regulation of cell survival in EPA/GLA-treated HL-60 cells.

P68. Pentoxifylline Reduces Acute Lung Injury in ChronicEndotoxemia by Modulating Neutrophil–EndothelialCell Interaction. C. Michetti, M.D., R. Coimbra, M.D., Ph.D.,W. Loomis, B.S., P. Wolf, M.D., W. Junger, Ph.D., and D. B.Hoyt, M.D. Division of Trauma, Department of Surgery, Uni-versity of California at San Diego, San Diego, California.

Background. Pentoxifylline (PTX) attenuates end-organ injury inmodels of sepsis and hemorrhage. PTX is thought to act by inhibitingphosphodiesterase (increasing cAMP) and TNF-�. The effects of PTXon neutrophil L-selectin, adhesion molecules, and ultimately, organinjury in a chronic endotoxemia model have not been studied. Pur-pose. We hypothesized that continuous infusion of PTX reducesacute lung injury (ALI) caused by chronic LPS exposure. Methods.Male Sprague–Dawley rats were given continuous infusion of LPS,PTX � LPS combined, or saline (sham) by implantable pumps.Neutrophil L-selectin expression (L-sel), CD11b expression, lung his-topathology, and ICAM-1 expression assessed by immune stainingwere evaluated at 4 h. Lung injury was graded in a blinded fashionfrom 0 (normal) to 4 (severe) for interstitial inflammation, neutrophilinfiltration, congestion, and edema. Total lung injury score (TLIS)was calculated by adding listed categories. Results. Rats receivingPTX � LPS showed significant reduction in lung injury score andmarked decrease in ICAM-1 expression when compared to LPS alone(see table). Conclusions. Continuous infusion of PTX reduces ALIbecause of chronic endotoxemia. The effect seems to be due to de-creased expression of endothelial and epithelial ICAM-1.

P69. Differential Macrophage Response to Sodium Arsenite-Induced HSP72 Expression. Y. M. Carter, M.D., G. Liu,M.D., J. Yang, M.D., and C. Mendez, M.D. James A. Haley VAHospital/University of South Florida, Tampa, Florida.

Background. Peritoneal and alveolar m� from rats made tolerantby SLH behave differently in vitro. This study investigated if in vitrosodium arsenite (NaArs) HSP72 induction in m� cell lines alteredintracellular signals and cytokine production, similar to SLH, and if


Effects of Inhibitors (I) on EPA/GLA-TreatedHL-60 Cells at 12 h

Treatment % Viability % Apoptosis % Necrosis

Control (�I) 77.3 � 0.7 10.1 � 1.0 12.2 � 0.7Ibuprofen (10 �M) 78.0 � 3.4 9.5 � 1.9 11.9 � 1.8Baicalein (10 �M) 77.1 � 3.6 11.6 � 2.2 10.9 � 1.4AA861 (10 �M) 53.8 � 5.5* 16.1 � 2.9 28.7 � 2.8*

Note. Means � SE (n � 4).* P � 0.01 vs control; ANOVA.


Group TLIS L-sel (%) CD11b (%) ICAM-1

LPS 6 13.1 94.7 � 3.2 ��/��PTX � LPS 2.5 11.8 93.0 � 5.2 �/��SHAM 1 96 94.2 � 4.3 �/�


S (n � 145) NS (n � 117) Univariate P

A3 65.1 � 0.7 114.1 � 4.6 �0.0001Age (years) 70.8 � 1.0 73.1 � 1.4 0.1766MMOD 5.4 � 0.4 13.7 � 0.5 �0.0001Sex (%) 40.6 41.0 �0.9999Cardiac history (%) 53.1 43.6 0.1370


there was a difference between alveolar (NR8383) and peritoneal(RAW264.7) m�. Methods. M� (1 107 cells) were treated with10�g/ml LPS, 50 �M NaArsx12h � 10 �g/ml LPS, or 10 �MSB203580 � 50 �M NaArs � 10 �g/ml LPS (n � 4–6/set). Cellularprotein was harvested for MAPK and HSP72 expression by Westernblot (mean densitometry � SEM). Supernatant was harvested forTNF� ELISA (mean � SEM; Student’s t test). Results. NaArs andLPS increased MAPK activation and HSP72 expression and signifi-cantly attenuated the TNF� response to LPS. SB203580 inhibition ofp38 activity reduced RAW 264.7 m� HSP72 and SAPK expression,but increased ERK phosphorylation. NR8383 m� MAPK activation,HSP72 expression, and TNF� activity were unaffected by SB203580.Conclusion. Sodium arsenite induces MAP kinase activation andHSP72 expression in alveolar and peritoneal m�. These changes arelinked to p38 activation in peritoneal but not alveolar m�. NaArsattenuates the TNF� response independent of p38 activity in bothm� cell lines.

ORAL POSTER V: ONCOLOGY

P70. The Role of Smad3 in TGF-�-Mediated AntiproliferativeEffects in Colon Epithelial Cells. S. K. Mithani, B.S., G. C.Balch, M.D., P. K. Datta, Ph.D., J. Franklin, Ph.D., R. J. Coffey,Ph.D., R. H. Whitehead, Ph.D., and R. D. Beauchamp, M.D.Vanderbilt University School of Medicine, Nashville, Tennessee.

Purpose. Demonstrating colonic epithelial cells which lackSmad3 are deficient in TGF-�-mediated growth inhibition and in-duction of apoptosis. Background. Smad proteins play a key role inTGF-� signaling that regulates cell proliferation, differentiation, andapoptosis. Mice deficient in Smad3 have been shown to developcolonic adenocarcinoma. Methods. To assess the role of Smad3 incolon carcinogenesis, we have developed a Smad3-null murinecolonocyte cell line. We compared the response of these cells toTGF-�-mediated growth inhibition and induction of apoptosis toYAMC (young adult mouse colonocyte) control cells. Growth inhibi-tion was assessed by cell count and [3H]thymidine incorporationassay. Apoptosis was assessed using ELISA and Hoechst staining forcondensed chromatin. Levels of various mediators of cell cycle arrestand apoptosis were assayed by Western blot for responsiveness toTGF-�. Results. Smad3�/� cells were resistant to TGF-�-mediatedgrowth inhibition compared to control cells, with 98% cell count

growth inhibition observed in YAMC control cells, while only 34%inhibition was observed in Smad3�/� cells after TGF-� treatment.Accordingly, [3H]thymidine incorporation was inhibited by 61% inYAMC cells, while Smad3�/� cells showed only 25% inhibition inresponse to TGF-�. TGF-�-induced apoptosis eightfold in YAMCcells, but had no effect on apoptosis in Smad3�/� cells. We alsoobserved p21, a cyclin-dependent kinase inhibitor is induced inYAMC cells by TGF-�, whereas in Smad3�/� cells the levels areunchanged by TGF-� treatment. Conclusion. These findings sug-gest that loss of Smad3 signaling contributes to resistance toTGF-� growth inhibition and apoptosis in colonic epithelium. Thismay represent a mechanism by which cells are able to escapeantiproliferative controls and embark on a pathway toward neo-plasia.

P71. Colorectal Cancer Cell Adhesion to Basement Mem-brane Attenuates Ad-E2F-1-Mediated Apoptosis. C. Chao,M.D., A. J. Parsian, M.S., W. W. Wang, B.S., and K. M. Mc-Masters, M.D. Surgical Oncology, University of Louisville, Lou-isville, Kentucky.

Purpose. The complex interplay of cell adhesion molecules, intra-cellular signaling, and tumor growth behavior is paramount to un-derstanding the reasons for current gene therapy and chemotherapyfailure. We want to study how therapies may be defeated by thenatural physiologic state of substrate adhesion. Cell adhesion tobasement membrane promotes survival, but this has not been stud-ied in conjunction with gene therapy targeted at killing cancer cells.Here, we explore the effect of Matrigel, an extracellular substratesimilar to basement membrane, on the survival of colorectal cancercells targeted for apoptosis by gene therapy. In doing so, we will beable to rationally design therapeutic applications in order to promotetumor cell death. Methods. RKO colorectal cancer cells were in-fected with adenovirus vector containing the transgene E2F-1 (Ad-E2F1) under the control of the CMV promoter. Ad-LacZ is a controlvector that expresses nuclear-localized �-galactosidase under thecontrol of the same promoter. Overexpression of E2F-1 has beenshown previously. Apoptotic response to E2F-1 is dose- and time-dependent. RKO cells were plated on tissue culture plastic versusMatrigel-coated plates for 24 h and then infected with 50 and 100MOI (multiplicity of infection) of Ad-E2F1 or Ad-LacZ. At 48, 120,and 168 h, cell proliferation is assessed using the XTT reagent.


P38 ERK SAPK HSP72 TNF�

NR CTL 105 � 32 332 � 17 138 � 22 80 � 18 25 � 6LPS 505 � 156* 949 � 84* 1068 � 309* 78 � 44 2697 � 344*Ars 564 � 102* 1144 � 147* 1069 � 169* 332 � 51* 80 � 21Ars � LPS 561 � 135 1187 � 245 1231 � 188 381 � 76*,** 381 � 170**SB � Ars 514 � 227 1007 � 116 857 � 46 253 � 99 142 � 110RAW CTL 127 � 24 314 � 44 73 � 34 26 � 5 428 � 189LPS 417 � 114* 720 � 89* 110 � 47* 51 � 51* 1407 � 216*NaArs 663 � 56* 633 � 42* 880* 605 � 27* 779 � 18NaArs � LPS 907 � 21 904 � 42*** 489*,** 43 � 3 68 � 33**SB � NaArs 731 968 � 14 289 � 13*** 335 � 11***

* P � 0.01 vs control.** P � 0.01 vs LPS.

*** P � 0.01 vs NaArs.


Results. Results are presented in the table. Conclusion. InfectedRKO cells on Matrigel have over 50%–60% increased cellular prolif-eration compared to control cells plated on plastic. Substrate adhe-sion of colorectal cancer cells attenuates Ad-E2F1-mediated apopto-sis. Resistant cells escape drug-induced apoptosis by acquiringapoptotic-deficient pathways. Further study is necessary to elucidatethese pathways.

P72. The Role of NF�B Signaling in Pancreatic Cancer Inva-siveness and MMP-2 Activity. H. Ito, M.D., J. Gardner-Thorpe, MRCS, R. S. Fariver, M.D., Ph.D., A. Perez, M.D., M. J.Zinner, M.D., S. W. Ashley, M.D., and E. E. Whang, M.D.Brigham and Women’s Hospital, Harvard Medical School, Bos-ton, Massachusetts.

Background. Constitutive activation of the DNA binding proteinnuclear factor �B (NF�B) has been reported to occur in most pan-creatic cancers; yet, the significance of this finding is unclear. In thisstudy, we tested the hypothesis that pancreatic cancer cellular inva-siveness and matrix metalloproteinase (MMP) activity are NF�B-dependent. Methods. A superinvasive subclone (PANC-1INV) wasderived from the PANC-1 human pancreatic cancer cell line by serialpassages through transwell filters. Cellular invasiveness, MMP-2activity, and NF�B activity were assayed using Boyden chambers,zymography, and electrophoretic mobility shift assays (EMSA), re-spectively. Results. PANC-1INV cells were 2.1-fold (P � 0.05) moreinvasive and demonstrated 1.3-fold (P � 0.05) greater MMP-2 activ-ity than native PANC-1 cells. EMSA revealed greater NF�B activityin PANC-1INV cells than native PANC-1 cells. PDTC (a NF�B inhib-itor, administered at concentrations ranging from 10 to 1000 �M)induced dose-dependent reductions in NF�B activation, invasive-

ness, and MMP-2 activity for both PANC-1 and PANC-1INV cells.Conclusions. Pancreatic cancer cellular invasiveness and MMP-2activity are NF�B-dependent. Blockade of NF�B signaling may be apromising strategy for inhibiting pancreatic cancer invasiveness.

P73. Vitronectin Stimulates P44/42 Mitogen-Activated Pro-tein Kinase in Human Pancreatic Cancer Cells. J. P.Duffy, M.D., H. A. Reber, M.D., G. Eibl, M.D., M. N. Wente,M.D., Y. Okada, M.D., M. J. Delano, B.S., and O. J. Hines, M.D.Department of Surgery, UCLA Medical Center, The DavidGeffen School of Medicine at UCLA, Los Angeles, California.

Introduction. Cell–extracellular matrix (ECM) interactions playcritical roles in cancer cell growth, invasion, and metastasis. Vitro-nectin (VN) is a unique ECM protein that binds to cell surface �v

integrins, inducing remodeling of the cytoskeleton and cellular mi-gration. The aim of this study was to determine the expression of aspecific VN receptor (integrin �v�3) on human PaCa cells and toinvestigate VN stimulated cell signaling in these cells. Methods.Integrin �v�3 expression was determined in six human PaCa celllines (AsPC-1, BxPC-3, Capan-2, HPAF-II, MIAPaca-2, and PANC-1)by RT-PCR and FACS using FITC-labeled anti-�v�3 monoclonal an-tibody (LM 609). Cells expressing the intact integrin �v�3 werecultured under standard conditions, serum-starved for 24 h, andexposed to incremental concentrations (0, 10, 100, 1000, and 10,000ng/ml) of either purified soluble human VN or control suspensionvehicle. After 10 min of exposure, total cell protein was harvestedand assayed for phosphorylated p44/42 MAPK by Western blot.Phorbol 12-myristate 13-acetate (PMA) served as positive control forMAPK activation. Equal protein loading was assayed by nonphos-phorylated MAPK p44/42 Western. Results. RNA expression of in-tegrin �v and �3 subunits was observed in all six PaCa cell lines whileFACS analysis demonstrated cell surface expression of integrin �v�3

in only three cell lines (AsPC-1, BxPC-3, and PANC-1). Western blotanalysis of �v�3-positive cells stimulated with soluble VN showed adose-dependent increase in p44/42 MAPK activation after 10 min ofexposure. VN suspension vehicle failed to stimulate p44/42 MAPK ina dose-dependent fashion. Conclusions. Human PaCa cells expressthe cell-surface VN receptor integrin �v�3 at the RNA and the proteinlevels. In integrin �v�3-positive cells, soluble VN activates the p44/42MAPK pathway in a dose-dependent manner. These results indicatethat PaCa cells can bind the ECM protein VN, and this cell stimu-lation may have significant implications for PaCa tumorigenesis andinvasion.

P74. Inhibition of Pancreatic Carcinoid Tumor Cell Growthby Notch Signaling. E. K. Nakakura, M.D., Ph.D., V. Sri-uranpong, M.D., Ph.D., M. W. Borges, M.S., B. D. Nelkin,Ph.D., D. W. Ball, M.D., and H. Chen, M.D. Johns HopkinsMedical Institutions, Baltimore, Maryland; and University ofWisconsin Medical School, Madison, Wisconsin.

Introduction. Gastrointestinal carcinoid tumors exhibit promi-nent neuroendocrine features through secretion of various autocrinegrowth factors and vasoactive substances, which contribute to clin-ical manifestations of the carcinoid syndrome and tumor growth. Wehave previously shown that triggering a developmental signalingpathway by overexpression of an activated form of the Notch receptorreduces serotonin production in BON pancreatic carcinoid tumorcells. However, the effect of activated Notch on carcinoid cell growthis unknown. Methods. To determine if Notch activation affectscarcinoid tumor growth, we utilized recominant adenoviruses tooverexpress Notch or �-galactosidase (control) in BON cells. BONcell growth was assessed using the colorimetric MTT assay. For cellcycle analysis, BON cells were harvested at days 3, 5, and 7 postin-fection and stained with propidium iodide. Fluorescent DAPI stain-


Proliferation Normalized to Ad-LacZ (490 nm)

Hours afterinfection MOI

Plastic (% cellproliferation � SEM)

Matrigel(% � SEM)

P value(t test)

48 50 89.43 (10.34) 95.03 (3.41) 0.32100 69.02 (10.66) 92.09 (1.81) 0.08

120 50 77.03 (3.21) 92.54 (0.58) 0.42100 29.19 (1.05) 82.17 (3.30) 0.004

168 50 86.50 (4.53) 90.06 (0.45) 0.51100 30.67 (2.08) 93.60 (5.61) 0.009


ing was used to detect apoptosis as evidenced by chromatin conden-sation. Results. In the control groups, mock- and �-galactosidase-infected BON cells exhibited logarithmic growth over the course of 7days. In contrast, overexpression of Notch caused a dramatic inhibi-tion of BON cell growth. At days 5 and 7 postinfection, overexpres-sion of Notch resulted in a 60 and 40% reduction in growth, respec-tively, compared to mock- or �-galactosidase-infected cells. However,no significant differences in cell cycle distribution, apoptosis, orcytotoxicity were apparent among the three treatment groups. Con-clusions. Notch activation appears to inhibit BON carcinoid cellproliferation through a mechanism independent of cell cycle inhibi-tion or changes in apoptosis. Strategies that activate Notch signalingcould serve as therapeutic targets in the treatment and palliation ofgastrointestinal carcinoid tumors.

P75. Intracellular Introduction of Cyclooxygenase AntisenseOligonucleotide Enhances Chemotherapy-Induced Apop-tosis and Prevents Chemoresistance In Breast Cancer.T. L. Barry, M.D., R. W. Watson, Ph.D., D. OHanlon, M.D.,T. F. Gorey, M.D., J. M. Fitzpatrick, M.D., and M. J. Kerin,M.D. Department of Surgery, University College Dublin MaterHospital, Dublin, Ireland.

Purpose. We postulate that COX-2 expression may have a role inchemoresistance in breast carcinoma. Background. Chemoresis-tance develops in 70% of breast cancers that are initially sensitive,and this has a major impact on patient management. Cyclo-oxygenase-2 (COX-2) expression is associated with multidrug andapoptotic resistance. Methods. MCF-7 and MDA-MB-231 (MDA)breast cancer cell lines were treated with PMA to induce COX-2 andNS-398, a selective COX-2 inhibitor, or a COX-2-specific antisenseoligonucleotide (AO). COX-2 expression was measured by westernblotting. Apoptosis was measured in response to etoposide (Etop) andquantified using propidium iodide DNA staining and flow cytometry.Prostaglandin E2, a marker of COX-2 activity was measured usingELISA. Results. MCF-7 cells did not express COX-2. Constitutiveand inducible expression of COX-2 was evident in MDA cells, whichwas PMA-dose-dependent. COX-2 expression protected the cells frometoposide-induced apoptosis. However NS-398, which blocked COX-2activity (decreased PGE2 production), failed to reverse the PMA-protective effect. In contrast the AO significantly blocked the expres-sion of COX-2 protein and reversed the PMA effect (see table).Conclusion. COX-2 expression is significantly associated with re-sistance to drug-induced apoptosis and this effect is reversed byCOX-2 antisense oligonucleotide. NS-398 did not enhance apoptoticsusceptibility or reverse the COX-2-induced resistance to apoptosis.This has future therapeutic implications.

P76. Visualization of Tumor-Antigen-Specific, CD8� T-CellTolerance. K. F. Staveley-OCarroll, M.D., Ph.D., T. Schell,Ph.D., M. Jimenez, M.D., L. Mylin, Ph.D., J. Tevethia, Ph.D.,and S. Tevethia, Ph.D. Pennsylvania State College of Medicine,Hershey, Pennsylvania.

Introduction. To examine the fate of tumor-antigen-specific CD8�T cells after exposure to endogenous tumor antigen, we transferrednaıve, CD8� T cells specific for epitope I of the SV40 virus T antigeninto transgenic mice (501), which spontaneously develop T-antigen-expressing osteosarcomas. Methods. T antigen epitope I-specific CD8�T cells from T-cell-receptor-transgenic mice were transferred into 501mice or syngeneic C57BL/6 mice that do not express tumor antigen.Nineteen days after transfer, half the mice were vaccinated withepitope I-expressing vaccinia virus. Fluorescent staining was used toquantitate epitope I-specific T cells, activation markers CD44 andCD69, and epitope I-specific interferon-� production in T cells isolatedfrom spleen and draining lymph nodes. Results. In 501 mice, epitopeI-specific CD8� T cells proliferate 5-fold and up-regulate CD44 andCD69 in lymph nodes draining areas of T antigen expression; however,these cells do not produce interferon-� after peptide stimulation in vitro.In vivo vaccination neither stimulates these cells to expand further norinduces interferon-� expression. In C57BL/6 mice, epitope I-specific Tcells remain at baseline until in vivo vaccination and then expand15-fold in spleen and lymph nodes with a corresponding increase ininterferon-� production. Conclusion. Tumor-antigen-specific, CD8� Tcells undergo a transient clonal expansion with phenotypic changes ofantigen recognition; nevertheless, these cells do not respond to subse-quent antigen stimulation.

P77. Suppression of Human Achaete-Scute Homolog-1 in Raf-1-Activated Carcinoid Cells. M. Kunnimalaiyaan, Ph.D.,R. S. Sippel, M.D., J. E. Carpenter, B.S., and H. Chen, M.D.University of Wisconsin Medical School, Madison, Wisconsin.

Introduction. Human achaete-scute homolog-1 (hASH1), a neu-roendocrine (NE) transcription factor, is highly expressed in gastroin-testinal carcinoid cells and is critical for the endocrine phenotype inthese NE tumors. We have shown that raf-1 activation in carcinoid cellsleads to a reduction in hormone production. Therefore, we hypothesizedthat raf-1-mediated hormone reduction in carcinoid cells could be due tosuppression of hASH1, possibly through upregulation of HES1, aknown hASH1 transcriptional repressor. Methods. Human gastroin-testinal carcinoid (BON) cells were stably transduced with an estrogeninducible raf-1 construct to create BON-raf cells. BON and BON-rafcells were treated with either control (C) or with 1 �M estradiol (E2).After 48 h, cell lysates were analyzed using Western blot for the expres-sion of hASH1, the NE marker chromogranin A, and HES1. Proteinlevels were standardized to GAPDH. Results. As we have shown pre-viously, raf-1 activation by estradiol treatment of BON-raf cells resultedin a 71% reduction in the level of chromogranin A. Importantly, activa-tion of raf-1 also led to a substantial decrease in hASH1 protein after


MDA

(�) PMA (�) PMA

Con NS-398 AO Etop Etop NS-398 Etop AO Con NS-398 AO Etop Etop NS-398 Etop AO

COX-2 �� Protein �� Apop (%) 2.9 � 1.0 4.7 � 1.4 7.5 � 2.0 18.4 � 1.9* 10.7 � 2.9 24.2 � 1.6 3.7 � 1.3 4.8 � 1.8 6.5 � 0.9 11.0 � 2.2** 12.1 � 4.4** 18.1 � 0.6***

Note. Data are means � SD. PMA, phorbol 12-myristate 13-acetate; (�) absent; (�) present; Con, control; Stats, ANOVA. Apop, apoptosis.Protein as determined by Western blot expression.

* P � 0.001 vs Con.** P � 0.001 vs Etop (�) PMA.

*** P � 0.001 vs Etop (�) PMA.


48 h. Surprisingly, there was no significant increase in the levels ofHES1 (see table). Conclusions. Raf-1-mediated inhibition of hormoneproduction in BON carcinoid cells is associated with significant sup-pression of hASH1. Therefore, hASH1 may be the critical downstreamtarget of raf-1. Furthermore, the mechanism of hASH1 suppression byraf-1 appears to be independent of HES1, suggesting an alternativepathway for hASH1 gene regulation.

P78. Microdialysis: A Novel Approach for the Optimal Mea-surement of Tissue Drug Concentrations during Re-gional Infusional Therapy for Melanoma. E. G. Grubbs,M.D., R. Fehdrau, B.S., and D. S. Tyler, M.D. Duke UniversityMedical Center, Durham, North Carolina.

Hypothesis. Microdialysis (Md) will provide a minimally invasivemethod for extracellular (EC) tissue drug monitoring that will aid in theefficacious use of cytotoxic agents in regional infusional therapy. Meth-ods. Athymic nude rats xenoplanted with the human melanoma cellline DM400 in their hindlimb underwent 60-min isolated limb infusionswith 100 �g/ml melphalan (LPAM). Md probes implanted in the af-fected limb’s tumor (T) and muscle (M) as well as in muscle of theunaffected limb (O) allowed measurement of the [LPAM] in the ECspace of these tissues at 10-min intervals during the infusion. Thedialysate samples’ [LPAM] were determined using high-performanceliquid chromatography (HPLC). Following the perfusion, the rats wereeuthanized and tissue sample analysis (TSA) of the three regions (T, M,O) was performed by HPLC. TSA represents the summation of intra-cellular (IC) and EC [drug]; therefore TSA minus Md results gives anestimate of intracellular LPAM concentration [(IC � EC) – EC � IC]Results. [LPAM] determined by Md varies among tissue types with theEC [drug] higher in muscle than in tumor and other (see figure). TheTSA for these same tissues are 32 (M), 49 (T), and 0.09 �g/ml (O). TheT [LPAM] TSA is 50% higher than its Md counterpart at 1 h comparedto the M [LPAM] which is only 22% higher, demonstrating preferentialdrug uptake into the IC space of T. Conclusions. Md catheters not onlyallow easy and continuous measurements of extracellular drug concen-

tration but also for the first time demonstrate a preferential intracel-lular uptake of LPAM by tumor over muscle. Continuous monitoring ofdrug concentration in tissue using Md provides a novel methodfor evaluating drug delivery, toxicity, and response in regionaltherapies.

P79. Induction of a Novel Kinase by eIF4E in Breast Carcinoma.K. S. Norton, M.D., H. Yu, M.D., C. Meschonat, M.S., M. Gauthier,M.S., A. DeBenedetti, Ph.D., and B. D. Li, M.D. Louisiana StateUniversity Health Science Center, Shreveport, Louisiana.

Introduction. The overexpression of eukaryotic initiation factor 4E(eIF4E), a critical component of the “RNA helicase” necessaryfor the initiation of protein synthesis of mRNAs with long 5-untranslated regions (5 UTRs), can result in malignant transforma-tion. In a prospective study on breast cancer outcome of women withstage I to III disease, eIF4E overexpression was an independent pre-dictor of cancer recurrence (RR 7.3, CI 1.58–33.9). Dysregulation ofTousled-like kinase 1B (TLK1B), a threonine kinase with a highlyconserved gene sequence, has been linked to defects in cell division andDNA replication. In cell lines, TLK1B overexpression has been recentlyassociated with resistance to radiation. The 5 UTR of TLK1B is long(1088 nt) and the structure is complex. Our hypothesis is that TLK1Belevation is correlated with the overexpression of eIF4E in humanbreast carcinoma. Methods. Eighty-three patients with invasive breastcancer and 11 patients with benign breast disease were accrued pro-spectively. Clinical data collected include age, race, stage, grade oftumor, and ER and PR status. TLK1B and eIF4E levels were quantifiedby Western blot analysis. Statistical analysis was performed usingSpearman correlation, paired and unpaired t test, and multivariateanalysis. Results. In the 81 cancer specimens from patient with breastcarcinoma, eIF4E level was elevated by a mean of 10.7-fold (range1.8–43.7), and TLK1B was elevated by a mean of 6.0-fold (range 1.0–67.0) when compared to the 11 specimens from noncancer patients.Multivariate analysis performed demonstrates that the degree of eIF4Eoverexpression is independent of age, race, tumor grade, and ER or PRstatus of the tumor. Similarly, the degree of TLK1B elevation is inde-pendent of age, tumor grade, and ER or PR status of the tumor. Usingthe Spearman correlation, the degree of TLK1B elevation was stronglycorrelated with the degree of eIF4E overexpression (R � 0.39, P �0.001). Conclusions. Both eIF4E and TLK1B are elevated in breastcancer specimens but not in benign breast specimens from noncancerpatients. The degree of TLK1B elevation is correlated with the degree ofIF4E overexpression. eIF4E overexpression is independent of tumorgrade, tumor stage, and ER and PR status.

P80. The Anti-Tumor Effects of Chemo-/Radiotherapy Are Po-tentiated by COX-2 Inhibition. G. M. Roche-Nagle, M.D., J.Harmey, Ph.D., E. Connolly, M.D., and D. Boucher-Hayes,M.D. Royal College of Surgeons Education and Research Build-ing, Beaumont Hospital, Dublin 9, Ireland.

Introduction. Many chemo/radiotherapy regimes induce vascularendothelial growth factor (VEGF). This induced VEGF may contributeto tumor resistance to apoptosis-inducing therapy. Anti-VEGF thera-pies in combination with chemo-/radiotherapy may result in greaterthan additive tumour regression. The antitumor effects of a cyclooxy-genase (COX)-2 inhibitor in combination with chemo-/radiotherapywere investigated. Methods. A total of 50,000 4T1 mammary carci-noma cells were injected into the left mammary fat pad of 10-week-oldfemale BALB/c mice. When the mean tumour diameter reached 6 � 0.7mm, the mice were randomized into four groups (n � 7/group). The firstgroup received chemotherapy (5 mg/kg cisplatin, 40 mg/kg methotrex-ate, 50 mg/kg 5FU) and radiation (10 Gy) in combination with dailyintraperitoneal (ip) injections of the selective COX-2 inhibitor tenoxi-cam (6 mg kg–1) for 9 days, the second received chemo-/radiotherapy withip injections of drug vehicle, the third received COX-2 inhibitor alone, andthe fourth received drug vehicle. Animals were euthanized 7 dayspostchemo-/radiotherapy. Results. Results are presented in the table.


Protein:

Relative protein levels

BON C BON E2 BON-raf C BON-raf E2

Chromogranin A 1.0 1.0 1.2 0.39hASH1 1.0 1.0 0.99 0.35HES1 1.0 0.98 1.0 1.0


Conclusions. Selective COX-2 inhibitors enhance the effects of chemo-/radiotherapy and may overcome therapy-induced tumor cell resistance.

P81. The Anti-Tumor Effects of Interferon-� Are Maintained ina Murine Melanoma Lacking STAT1. B. D. Badgwell, M.D.,G. P. Lesinski, Ph.D., G. Abood, B.S., A. Skaf, B.S., and W. E.Carson, M.D. The Ohio State University, Columbus, Ohio.

Introduction. Interferon-� (IFN-�) is currently being used in meta-static malignant melanoma and following surgery of those at risk forrecurrence. Signal transducer and activator of transcription 1 (STAT1) is atranscription factor that is activated by IFN-� and thought to mediate themajority of its antitumor effects. Loss of STAT1 has been found in IFN-resistant melanoma cells. We developed a STAT1�/� melanoma cell line toexamine whether this cytokine acts via a direct effect on tumor cells or viaits ability to stimulate host tissues. Methods. A melanoma tumor wasinduced in STAT1-deficient mice via the application of DMBA (tumorinitiator) followed by croton oil (tumor promoter). Immunohistochemicalanalysis confirmed that this was a malignant melanoma. Immunoblotanalysis, intracellular flow cytometry, and gel-shift analysis were used toconfirm the lack of STAT1 in the derivative cell line. The effects of IFN-� onthis cell line were studied in vitro and in vivo. Results. STAT1 was notexpressed in this murine melanoma cell line nor did treatment with IFN-�lead to activation of STAT1. Cell viability assays revealed that while IFN-�had lost its antiproliferative effect on this cell line, it was capable ofprolonging the survival of mice bearing 1 106 tumor cells in the intra-peritoneal position (n � 20, P � 0.05; see figure). Conclusions. These datasuggest that the antitumor effects of IFN-� on a murine STAT1�/� mela-noma tumor were maintained in a host with intact STAT1 signaling.

P82. Differential Responses of Leptin on Cancer in Vitro. P.Somasundar, M.D., A. K. Yu, M.D., L. Vona-Davis, Ph.D., and

D. W. McFadden, M.D., FACS. Department of Surgery, WestVirginia University, Morgantown, West Virginia.

Introduction. Leptin, a protein produced by adipocytes, is an im-portant signaling molecule in energy regulation and food intake. Manyobese patients have leptin resistance associated with increased circu-lating leptin. Leptin receptor activation down-regulates many regula-tory genes, including STAT-3 and PAP 1. Certain cancers are associatedwith obesity, including breast, prostate, and colon. Recent studies haveshown that leptin stimulates proliferation of human colon cancer invitro. We hypothesized that leptin would have stimulatory effects onother human cancers. Methods. Human cancer cell lines from esoph-agus (KYSE410), breast (ZR75-1), prostate (DU145), and pancreas(PANC-1, Mia-PaCa) were cultured using standard techniques. Leptin(0.4 and 4.0 ng/ml) was added for 24 and 48h. Cell growth was deter-mined by MTT assay. Statistical analysis was performed usingANOVA. Results. All cancer cell lines demonstrated dose- and time-related responses to treatment. Leptin caused growth potentiation inbreast, esophagus, and prostate cancer (P � 0.05). However, in bothMia-PaCa and PANC-1 pancreatic cancer cells, leptin inhibited growth(P � 0.05). This inhibitory effect peaked in PANC-1 at 48 h (78%).Conclusions. We have shown for the first time that human cancer cellsexhibit differential responses to treatment with leptin, depending uponorgan of derivation. Both leptin and leptin antagonism have potentialefficacy in cancer therapy, based on cellular origin. Further studies arewarranted and ongoing.

P83. Response to COX-2 Inhibition Independent of Cox-2 Ex-pression in Pancreatic Cancer. M. Bloomston, M.D., A. E.Shafii, M.D., A. Durkin, M.D., A. S. Rosemurgy, M.D., T. J.Yeatman, M.D., and E. E. Zervos, M.D. University of SouthFlorida, Tampa, Florida.

Background. Cyclooxygenase (COX)-2 inhibition has been pro-posed as a potential therapeutic strategy in pancreatic cancer. Thepurpose of this study was to determine the importance of COX-2expression in predicting response to COX-2 inhibition in pancreaticcancer. Methods. Six pancreatic cancer cell lines (poor to well dif-ferentiated) were grown in monolayer cell culture in quintuplicate tonear confluency. Cells were treated daily with the COX-2 inhibitorcelecoxib (50 or 100 �M) or vehicle control and proliferation wasdetermined by MTT assay after 72 h. COX-2 mRNA expression wasthen determined by RT-PCR for each cell line. Results. Moderateand well-differentiated cell lines expressed COX-2 while poorly dif-ferentiated ones did not. Significant cytotoxic response to celecoxib(*P � 0.05, Student’s t test) was observed in a dose-dependent fashionin two cell lines expressing COX-2 (HPAC, HPAF) and one that did not(PANC) (see figure). A cytostatic response was observed at the higherdose in the remaining cell lines (see figure). Conclusions. COX-2expression increases with the degree of differentiation in pancreaticcancer cell lines but does not uniformly predict response to COX-2


Group Primary tumor weight (g) Mean tumor diameter Tumor burden

1. Control 0.92 � 0.15 9.6 � 0.67 1.1 � 0.092. COX-2 0.60 � 0.09*** 6.8 � 0.29*** 0.69 � 0.08***3. Chemo-/radiotherapy 0.41 � 0.05** 4.7 � 0.93** 0.43 � 0.07**4. Chemo-/radiotherapy and COX-2 0.22 � 0.04* 3.6 � 0.65* 0.25 � 0.04*

Note. Data are expressed as median (�SEM). Data were analyzed using one-way ANOVA with Tukey-Kramer post hoc test.* P � 0.05, Group 4 vs Groups 3, 2, and 1.

** P � 0.05, Group 3 vs Groups 1 and 2.*** P � 0.05, Group 2 vs Group 1.


inhibition. These findings suggest that celecoxib may inhibit pancreaticcancer cell growth through more than one mechanism.

P84. Increased Expression of NF-�B Subunits in Human Pan-creatic Cancer. N. M. Chandler, M.D., J. J. Canete, M.D.,M.P.H., and M. P. Callery, M.D. University of MassachusettsMedical School, Worcester, Massachusetts.

Activation of NF-�B-dependent antiapoptotic genes may factor in thechemoresistance of pancreatic cancer. It is not known whether NF-�Bsubunit composition changes during oncogenesis and regulates overallNF-�B activation. We compared the relative expression of NF-�B sub-units with nuclear activation of p65 between variably differentiatedpancreatic cancer cells. Methods. Proliferating human pancreatic can-cer cells (PANC-1, BxPC-3) and nonmalignant intestinal cells (FHS 74Int) were harvested. Baseline expression of NF-�B subunits (p65, p52,p50, c-Rel) and its inhibitor I�B-� were determined by Western blotwith densitometry. Nuclear NF-�B p65 activity was measured byELISA. Results were analyzed by ANOVA (P � 0.05) and Tukey’s HSDfor pairwise comparisons when appropriate (P � 0.05). Results. Con-stitutive expression of NF-�B subunits was detected in proliferating,intestinal cells (FHS 74 Int). Both cytoplasmic (I�B-�, p50, p52, p65)and nuclear (p50, p52, p65, c-Rel) NF-�B subunits were significantlyincreased in both PANC-1 and BxPC-3 cells compared to FHS 74 Int.While nuclear p65 subunit levels were similarly elevated (Fig. 1), actualp65 activity (Fig. 2) was only significantly greater in PANC-1 cellscompared to either BxPC-3 or FHS 74 Int (P � 0.05). Conclusions.Compared to nonmalignant intestinal cells, these pancreatic cancer celllines have increased levels of NF-�B subunits. Actual nuclear NF-�Bactivity, however, appears to correlate more with degree of tumor dif-ferentiation than with NF-�B subunit expression.

P85. Combination Therapy in Pancreatic Carcinoma CellLines. V. M. Bondar, M.D., and D. J. McConkey, Ph.D. City ofHope Cancer Center, Duarte, California.

To date, there is no effective chemotherapy available for the treat-ment of pancreatic cancer. Understanding the biologic and molecular

mechanisms of pancreatic cancer progression is critical to the devel-opment of effective therapeutic regimens. Previous work from ourlaboratory, as well as by others, has established importance of con-stitutively active PI3-kinase-AKT and NF�B survival pathways inpancreatic cancer progression and resistance to chemotherapy. Thisstudy was undertaken to further investigate the optimal cytotoxiccombination therapy in pancreatic carcinoma cell lines. We treatedColo-357-L3.6pl, Panc1, MiaPaCa2, AsPc1, Hs766T, and HPAF pan-creatic carcinoma cells with gemcitabine, paclitaxel, doxorubicin,cyclophosphamide, and actinomycin D. With exception of Colo-357-L3.6pl, the cell lines were resistant to all of the drugs. Treatmentwith PI3-kinase inhibitors wortmannin and LY294002 resulted in asignificant dose-dependent apoptotic cell death in Colo-357- L3.6pland Panc1, was less effective in HPAF and MiaPaCa2, and wasineffective in AsPc1 and Hs766T pancreatic carcinoma cells. Protea-some inhibition can reverse NF�B activation via stabilization of theNF�B inhibitor I�B. Proteasome inhibitor PS-341 induced apoptoticcell death in Colo-357-L3.6pl, HPAF, and Panc1 cells, but not inMiaPaCa2, AsPc1, or Hs766T cells. The cellular effects of LY294002and PS-341 were confirmed by monitoring phosphorylation of theirrespective targets AKT and I�B. LY294002 and PS-341 were com-bined in the sensitive Panc1 and resistant AsPc1 cells and producedsynergistic response in both cell lines. Addition of gemcitabine orpaclitaxel to the regimen did not increase apoptotic death rate ineither cell line. We concluded that simultaneous inhibition of consti-tutively active PI3-kinase-AKT and NF�B survival pathways canovercome drug resistance in pancreatic cancer cells.

P86. Expression of Multiple Trefoil Proteins in Proximal Gas-tric Cancers. H. Schmidt, M.D., Ph.D., T. Baxter, M.D., H.Yamaguchi, M.D., J. R. Lee, M.D., and J. R. Goldenring, M.D.,Ph.D. Medical College of Georgia, Augusta, Georgia.

Introduction. Investigations over the past decade have noted anincreased frequency worldwide in proximal gastric cancer. However,few investigations have studied the cellular markers of proximalgastric cancers. Trefoil proteins are expressed in specific mucoussecreting cell lineages. We have previously identified a novel spas-molytic peptide expressing metaplastic cell lineage (SPEM) associ-ated with gastric adenocarcinoma and the surrounding dysplasticmucosa in patients from the United States and Japan. SP-expressingmetaplasia has also been identified in rodent models of oxynticatrophy including Hemobartonella felis-infected C57BL/6 mice. Wehave hypothesized that SPEM and intestinal metaplasia (IM) repre-sent candidate preneoplastic lineages. No previous studies have ex-amined the association of SPEM or trefoil proteins with proximalgastric cancer. We have now sought to examine the expression oftrefoil proteins in proximal gastric cancers and associated metapla-sias. Methods. Proximal gastric adenocarcinomas were identifiedfrom the tumor registry at a university-affiliated tertiary care hos-pital. Histologic sections were cut from archival paraffin blocks.H&E and PAS/Alcian blue staining was performed in addition toimmunostaining with antibodies against the three trefoil peptidespS2 (TFF1), spasmolytic peptide (TFF2), and intestinal trefoil factor(ITF,TFF3). Sections were graded for cancer type, presence of IM,degree of atrophy, and trefoil peptide immunoreactivity. Results.Seventeen gastrectomy specimens for proximal gastric cancer wereidentified for this study, comprising 24% diffuse and 76% intestinaltype lesions. Twenty-nine percent demonstrated intestinal metapla-sia, and over half of the cases displayed moderate to severe degreesof atrophy. SPEM was noted in 59% of specimens. pS2 and SP wereexpressed in 29 and 24% of the cancers, respectively. However, ITFstaining was found in 53% of the cancers. Notably, multiple trefoilproteins were observed within the cancer cells in at least three of thespecimens. No correlation was observed between the presence ofintestinal metaplasia and the expression of ITF in cancer cells.Conclusions. All three trefoil proteins are expressed in proximalgastric cancer, with prominent upregulation of ITF, a trefoil notusually expressed in the gastric mucosa. While previous studies have


observed SPEM in association with over 90% of fundic cancers,SPEM is less often observed in apposition with proximal gastriccancers. The results suggest a spectrum of mucous cell lineage der-ivation in the evolution of proximal gastric cancers.

P87. Expression Profiles in Malignant Mesothelioma. C. D.Hoang, M.D., J. D’cunha, M.D., Ph.D., M. A. Maddaus, M.D.,and R. A. Kratzke, M.D. University of Minnesota, Minneapolis,Minnesota.

Introduction. Gene expression profiles of malignant mesothe-lioma (MM) cells were investigated to better understand the molec-ular mechanisms controlling the oncogenic transformation of humanpleural cells. Methods. Total RNA was isolated from five establishedMM cell lines. The mesothelial-derived cell line MET-5A was thenormal control. Transcriptional profiling studies were performedusing 5000 gene cDNA microarrays. Data filtering using GeneSpringsoftware identified genes with threefold overexpression and 30%underexpression as significant. Hierarchical clustering classifiedMM tumors lines according to histologic subtype. Results. Clusteranalysis discriminated between MM subtypes, correctly differentiat-ing between epithelial and sarcomatoid variants. Expression profil-ing identified upregulated (N � 82) or downregulated (N � 64) genesin MM (see table). Notably, matriptase (AF118224) mRNA was 991-fold upregulated in MM, especially in the epithelial subtypes. Thisrecently characterized trypsin-like serine protease is implicated intumor invasion and metastasis of epithelial-derived cancers, but hasnot been described in MM to date. Conclusions. Large-scale profil-ing of MM may elucidate potential molecular mechanisms by iden-tifying novel genes involved in malignant transformation. Also,molecular profile classification may reveal new subclasses with po-tential therapeutic and prognostic implications as these studies areextended to primary MM tumors.

ORAL POSTER VI: GASTROINTESTINAL

P88. Gallbladder Contractility Correlates with Biliary and Se-rum Cholesterol Levels. K. Q. Tran, M.D., M. Goldblatt, M.D.,D. Swartz-Basile, Ph.D., A. Nakeeb, M.D., and P. A. Henry, M.D.Medical College of Wisconsin, Milwaukee, Wisconsin.

Purpose. To correlate gallbladder responses to neurotransmitterswith biliary and serum cholesterol levels. Background. Obesity is amajor risk factor for gallstone formation. Obesity is often associatedwith hypercholesterolemia and with increased biliary cholesterolsaturation. Elevated biliary cholesterol also has been shown to altergallbladder muscle function. Therefore, we hypothesized that gall-bladder contractility would correlate with biliary cholesterol leveland saturation index (CSI) and with serum cholesterol levels. Meth-

ods. Lean control (C57BL/6J, n � 31) and obese (C57BL/6J Lepob,n � 27) mice were fed chow or a high-cholesterol diet for 4 weeks andheterozygous animals (C57BL/6J Lephet, n � 10) were fed chow dietfor 4 weeks. The animals were fasted overnight and underwentcholecystectomy. Gallbladder responses to acetylcholine (Ach, 10�5

M), neuropeptide Y (NPY, 10�6 M), and cholecystokinin (CCK, 10�8

M) were measured (N/cm2). Results. Gallbladder contractility wascorrelated with biliary cholesterol and CSI as well as serum choles-terol, HLD, and LDL fractions from lean (n � 283), obese (n � 99),and heterozygous (n � 120) mice using Pearson’s correlation (seetable). Conclusions. These data suggest that in vitro gallbladderresponses to acetylcholine, neuropeptide Y, and cholecystokinin areinversely correlated with biliary cholesterol, cholesterol saturationindex, and serum cholesterol in lean and obese mice. We concludethat abnormal cholesterol metabolism results in poor gallbladdercontractility that contributes to the association between obesity andgallstone formation.

P89. Tumor Necrosis Factor-� (TNF�) Disrupts Tight Junc-tion (TJ) Assembly. L. S. Poritz, M.D., K. I. Garver, Ph.D.,A. F. Tilberg, M.S., and W. A. Koltun, M.D. The Milton S.Hershey Medical Center, Hershey, Pennsylvania.

We have previously shown an increase in intestinal permeabilityand a corresponding decrease in the expression of TJ proteins in theintestines of patients with Crohn’s disease (CD). TNF� has beenimplicated in the inflammatory process of CD and its suppressionhas therapeutic benefit. ZO-1 is one of the key proteins in the TJ.Hypothesis. TNF� disrupts the tight junction complex. Methods.MDCK cells (canine kidney tubule cells known to form good TJs)were incubated in cell culture medium with varying concentrationsof TNF� (0–5.0 ng/ml) for 4 days. Qualitative evaluation of the TJwas carried out with monoclonal antibody (MoAb) to ZO-1 detected byan immunofluorescent secondary antibody. Duplicate cells were lysedand ZO-1 concentration was determined by Western blot using MoAb toZO-1 and chemiluminescence detection. To correct for inter gel varia-tion ZO-1 amount was expressed as a ratio of TNF�-treated cells tountreated cells. Additional MDCK cells grown in medium and TNF�were counted for viability. Cell count and ZO-1 quantitation were com-pared by ANOVA. Results. Immunofluorescent staining of MDCK cells


Selected List of Relative Gene Expression Data(Fold or Fraction Changes)

Bi Epi Epi Sarco Sarco Mean

Matriptase 21.5 1108.7 3812.6 6.3 9.5 991.7Matrix

metalloproteaseMMP-27

3.0 3.0 47.7 12.1 8.2 14.8

�-Actinin 0.08 0.11 0.13 0.33 0.19 0.17Fibrillin-2 0.02 0.03 0.04 0.31 0.09 0.01

Note. Bi, biphasic; Epi, epithelial; and Sarco, sarcomatoid.


Pearson Correlation Coefficients

Biliarycholesterol

BiliaryCSI

Serumcholesterol

SerumHDL

SerumLDL

ACh �0.26* �0.24* �0.34** �0.33** �0.31**NPY �0.27* �0.27* �0.30* �0.28* �0.35**CCK �0.22*** �0.23*** �0.32** �0.31** �0.33**

* P � 0.05.** P � 0.01.

*** P � 0.09.


[TNF�] (ng/ml)

0 0.05 0.5 5

Cell count 106 26.3 � 1.6 21.1 � 2.4 21.7 � 5.2 19.65 � 2.3ZO-1 ratio 1 � 0 1.09 � 0.1 1.17 � 0.02 1.19 � 0.11TJ disruption None None Small Large


for ZO-1 showed increasing severity of TJ structural disruption withincreasing amount of TNF� characterized by patchy intermittent stain-ing of ZO-1. At all concentrations of TNF� the MDCK monolayersappear to be confluent with nonfluorescent microscopy. There were nosignificant differences in either number of viable MDCK cells or quan-titation of ZO-1 in the MDCK cells for all TNF� concentrations (mean �SE; see table). Conclusions. (1) MDCK TJs are disrupted when incu-bated with TNF�. (2) This disruption of TJ is not due to a decrease incell number, lack of cell layer confluency, or a decrease in the amount ofZO-1. (3) The disruption of the TJ likely represents a rearrangement ofZO-1, and possibly an alteration in the structure of the TJ which mayplay a role in the increased intestinal permeability seen in CD.

P90. Corticotropin-Releasing Factor (CRF) Stimulates RatPancreatic Exocrine Secretion. E. A. Guzman, M.D.,W.Zhang, M.D., Ph.D., T. R. Lin, M.D., B. J. Segura, B.S., C.Hu, M.D., and M. W. Mulholland, M.D., Ph.D. University ofMichigan, Ann Arbor, Michigan.

Introduction. CRF is a 41-amino-acid hypothalamic neuropep-tide and a major regulator of the stress response. CRF has re-ported effects in the rat GI tract, decreasing gastric emptying,and stimulating colonic motility. The effects of CRF on rat pan-creatic exocrine secretion have not been reported. We hypothesizedthat CRF stimulates pancreatic exocrine secretion in the rat. Meth-ods. In vivo, pancreatic fluid was assayed for protein concentra-tion in anesthetized rats fashioned with bile-pancreatic duct can-nulae while CRF or 0.9% NaCl was infused intravenously. Sixty-minute integrated protein secretion was calculated. In vitro, purifiedpancreatic acini were incubated with varying concentrations of CRFor CCK (10�10 M) as a positive control. Amylase release was quanti-fied as percentage of cellular content. Intracellular cAMP in responseto CRF or forskolin (10�5 M) (positive control) was quantified byimmunoassay after cell lysis. Comparison was made by ANOVA(*P � 0.05). Results. CRF induced significant increases in pancre-atic protein output (Table 1) (n � 4). In purified acini, CRF (10�10 to10�7 M) did not stimulate amylase release (Table 2) (n � 6) nor didit increase cAMP (Table 3) (n � 5). Conclusion. CRF stimulatespancreatic exocrine secretion in the rat through indirect mecha-nisms.

P91. Classification and Regulation of IL-6-Mediated Glu-tamine Transport in Transformed Hepatocytes. C. M.Lin, Ph.D., M. Pan, M.D., Ph.D., A. M. Karinch, Ph.D., Q. H.Meng, M.D., W. W. Souba, M.D., S.C.D. Department of Sur-gery, The Pennsylvania State University College of Medicine,Hershey, Pennsylvania.

Hepatic glutamine metabolism is central to nitrogen homeostasis.However, our understanding of cellular regulation of hepatic glu-tamine transport is limited. CWSV-1, a SV-40 transformed immor-

talized rat hepatocyte cell line, displays many normal hepatocytecharacteristics including a stable in vitro model for the study ofhepatic amino acid transport. In this study, we characterized glu-

TABLE 1—ABSTRACT P90

CRF (nmol/kg/h)

0 1 2 4

Integrated amylase release (mg/kg/h) 0 � 3* 34 � 12* 22 � 2* 21 � 4*


CRF (M)

Control 10�10 10�9 10�8 10�7 CCK

Amylase release (% total content) 4.4 � 0.3 5.3 � 0.6 4.9 � 0.5 5.5 � 0.5 5.0 � 0.7 17.8 � 1.8*


CRF (M)

Control 10�10 10�9 10�8 10�7 Forskolin

CAMP (pmol/mg) 3.3 � 0.7 4.8 � 1.3 3.6 � 0.4 3.8 � 0.9 3.7 � 0.9 14.11 � 2.5*


tamine transport in CWSV-1 cells and examined the regulatory roleof the cytokine IL-6. Methods. CWSV-1 cells were grown to conflu-ence in defined growth medium. Glutamine (1.0 �M–10 mM) trans-port activity and glutamine transporter SN1 mRNA levels weremeasured in cells treated with interleukin 6 (IL-6, 0–0.1 �g/ml) forvarious periods of time. Results. Glutamine (50 �M) uptake inCWSV-1 cells occurred largely via a saturable Na�-dependent (70%)transport system (70%) but also via Na�-independent (�30%) trans-port and passive diffusion (�1%). Transport activity was pH-sensitive. Na� dependency showed a coefficient Hill number of 2,suggesting that two molecules of Na� were cotransported with onemolecule of glutamine. Competitive inhibition profiles were consis-tent with Na�-dependent System N (Fig. 1) and Na�-independentSystem L. IL-6 stimulated glutamine transport in a dose- and time-dependent fashion. By 6 h, IL-6 (0.1 �g/ml) induced glutamine trans-port by 60%; stimulation was first observed at 1 h and lasted for atleast 24 h. The glutamine transporter System N SN1 mRNA wasstimulated 2.88-fold by IL-6 (Fig. 2). Conclusion. Glutamine trans-port systems in CWSV-1 are similar to those present in normalhepatocytes, suggesting that CWSV-1 cells are a useful in vitromodel for the study of hepatic amino acid transport. Interleukin-6stimulates glutamine transport via a mechanism that involves astimulation of glutamine transporter SN1 mRNA levels.

P92. GATA4 and Cdx-2 Synergistically Activate the IntestinalAlkaline Phosphatase Promoter. N. S. Belaguli, Ph.D., H.Lu, B.S., B. Hinnebusch, M.D., R. A. Hodin, M.D., and D. H.Berger, M.D. Baylor College of Medicine, Houston, Texas.

The GATA4/5/6 subfamily of transcription factors is expressedduring embryonic gut development. Furthermore, in adults there isdifferential expression of GATA4/5/6 along the intestinal crypt-villous axis. We have previously reported that the transcriptionfactor GATA4 is upregulated during butyrate induced differentiationof colonic epithelial cells. Additionally we have demonstrated thatGATA4 activates the promoter of the enterocyte specific differentia-tion marker intestinal alkaline phosphatase (IAP). To further inves-tigate the role of GATA transcription factors in gut differentiation wesought to determine the interaction of GATA4 with Cdx2, a gut-specific transcription factor, on the activation of IAP. Methods.Subconfluent Caco2 (human gut epithelium) or CV1(monkey fibro-blasts) cells were transfected with 0.2 �g of IAP-luciferase reporterplasmid alone (pCGN) or in combination with GATA4 and Cdx-2expression vectors. Cells were lysed 36 h posttransfection and theluciferase activity was measured. Experiments were performed intriplicate and repeated three times. Results. Consistent with ourprevious results, overexpression of GATA4 activated IAP promoteractivity in both Caco2 cells (5-fold) and CV1 cells (12-fold). Cdx-2alone did not activate the IAP promoter. The combination of GATA4and Cdx-2 cooperated with each other and synergistically activatedthe IAP promoter (figure illustrates data for CV1 cells). Conclusion.

Our results indicate that IAP is a target for GATA4. It appears Cdx-2activation of IAP is achieved through cooperative interaction withGATA4. This data further supports a role for GATA4in gut epithelialdifferentiation.

P93. Multisystem Injury Following Hepatic Cryoablation:Pulmonary NF-�B Activation and Chemokine Expres-sion Are Mediated by Proximal Cytokines. L. J. Wudel,M.D., T. M. Allos, M.D., D. Cheng, M.D., T. S. Blackwell, M.D.,and W. C. Chapman, M.D. Vanderbilt University Medical Cen-ter, Nashville, Tennessee.

Introduction. We have previously shown that hepatic cryoabla-tion (cryo) is associated with NF-�B activation in the liver and lung,cytokinemia (TNF-�, Il-1, MIP-2), and lung inflammation in rodentmodels. We hypothesized that NF-�B activation in the liver anddistant sites are mediated, at least in part, by the release of proximalcytokines. To test this hypothesis, we performed hepatic cryo inTNF-� receptor type 1 (TNFR-I) and IL-1 receptor type 1 (IL-1RI)combined receptor knockout mice (DKO, background C57BL/6).Methods. DKO mice (n � 31) and C57BL/6 wild-type (WT) mice (n �40) were subjected to 35% cryo liver injury and euthanized at 1, 2,and 4 h. Serum and organs were freeze-snapped for NF-�B assess-ment via a NF-�B p65 activation assay and cytokine analysis wasperformed by the ELISA Method. Control animals underwent shamsurgery, and no treatment. Statistical analysis, performed with un-paired t test, is reported as mean � standard error. Results. Therewas no difference in activated NF-�B in either the liver or the lungin sham-operated WT mice compared to untreated controls. Therewas also no difference in the NF-�B-dependent chemokine KC (IL-8analog) levels in cytoplasmic extracts from lung. However, 2 h aftercryo, NF-�B activation increased 66% in the liver (P � 0.001) and42% in the lungs (P � 0.016) compared with baseline values. Thiselevation persisted in the lung at 4 h with a 47% (P � 0.01) increaseover baseline, whereas the liver returned to baseline (15% increase,P � 0.49). Lung cytoplasmic KC levels were significantly increased inWT animals at 2 h (1.34 � 0.29 vs. 0.93 � 0.11 �g, P � 0.03) and 4 h(2.07 � 0.16 vs. 0.42 � 0.11 �g, P � 0.001) compared with DKOanimals. Conclusions. This study suggests that proximal cytokines(TNF-�, IL-1) are at least partially responsible for distant NF-�Bactivation following cryo liver injury. In addition, these data impli-cate proximal cytokines in local NF-�B activation in the liver follow-ing direct injury, possibly via positive feedback mechanisms.

P94. Engraftment of Mucosal Stem Cells in the Jejunum IsDependent on Optimal Dose of Cells. J. R. Avansino, M.D.,V. D. Hoagland, B.S., J. Woolman, B.A., and M. Stelzner, M.D.University of Washington, VA Puget Sound HCS, Seattle,Washington.

Background. Successful transplantation of mucosal stem cellsinto denuded jejunal segments was first reported by us (J. Surg. Res.,2000, 93, 337). It is an important step in the development of cell-based intestinal gene therapy. We hypothesized that size of engraft-ment areas would increase proportionally with increasing doses ofseeded mucosal stem cells in denuded jejunum. Methods. Mucosalstem cell clusters were harvested from neonatal mice carrying agreen fluorescent protein transgene (GFP(�)) and transplanted intoadult GFP(�) recipients. Using a novel technique, 1.5-cm jejunalsegments were prepared with their blood circulation left intact andpartially stripped of their enterocytes using luminal high-velocityperfusions with 3 mM EDTA solutions. Continuity was restored byanastomosing more proximal and distal gut. Segments were ran-domly seeded with 5,000, 10,000, or 25,000 clusters (n � 5, 6, and 6segments, respectively) or vehicle only (n � 3). Three weeks later,serial representative cross-sections of the seeded segments wereevaluated for the presence of neomucosa using fluorescence micros-copy. Results. Controls showed only nonfluorescent mucosa in res-


titution. Mucosal engraftment fields for the 5K, 10K, and 25K groupsvaried from single crypts to larger areas comprising maximally 7,14, and 8% of the cross-sectional surfaces, respectively. The 10Kgroup showed significantly higher average engraftment of mucosaas well as of subepithelial connective tissues (CT) (see table).Conclusions. The sizes of mucosal and nonmucosal engraftmentareas do not increase proportionally with increasing doses ofseeded stem cell clusters. There seems to be an optimal dose ofstem cells for best engraftment success in the jejunum. Meanengraftment rates and engraftment consistency will have to befurther improved.

P95. Salicylate Exacerbates Lipopolysaccharide (LPS)-InducedGastric Injury. S. D. West, M.D., K. S. Helmer, M.D., A. Kwan,BS, L. K. Chang, B.S., Y. Cui, M.D., and D. W. Mercer, M.D.UT–Houston Medical School, Houston, Texas.

Purpose. To evaluate the effect of salicylate on gastric iNOS andgastric injury from a luminal irritant. Introduction. LPS-inducedgastric injury is associated with changes in iNOS expression. Be-cause salicylate enhances LPS-induced iNOS expression in sometissues, we examined its effects on gastric iNOS expression andgastric injury from bile in the presence and absence of LPS. Meth-ods. Rats were given salicylate (100 mg/kg ip) or saline. One hourlater, rats were given LPS (20 mg/kg ip) or saline. After 5 h, rats wereanesthetized and gastric contents were aspirated. Three milliliters ofthe bile acid 5 mM acidified taurocholate (ATC) was introduced intothe gastric lumen for 10 min. Rats were killed, and the total area ofgastric injury was quantified using computerized planimetry. Inaddition, iNOS expression was assessed using quantitative real-timeRT-PCR and Western immunoblot. Data are means � SE (n �6/group; ANOVA). Results. As shown in Figs. 1 and 2, salicylateenhanced LPS-induced changes in iNOS mRNA and protein. In theabsence of LPS, salicylate had no effect on iNOS. Figure 3 demon-strates that salicylate exacerbated gastric injury from bile in thepresence and absence of LPS. Conclusion. These data indicate thatsalicylate augments LPS-induced upregulation of gastric iNOS. Theability of LPS to exacerbate gastric injury may be related to thesechanges in iNOS expression. However, in the absence of endotox-emia, the deleterious effects of salicylate do not appear secondary tochanges in iNOS expression.

P96. Serum Response Factor (SRF) Is Upregulated inRegenerating Hepatocytes Following Partial Hepa-tectomy. S. S. Awad, M.D., A. Hernandez, M.D., Ph.D.,P. Anaya-Manzanares, B.S., N. S. Belaguli, Ph.D., D.V.M.,and D. H. Berger, M.D. Baylor College of Medicine, Houston,Texas.

Background. Serum response factor (SRF) is a key transcriptionfactor that in knockout animals is embryonic lethal. Targets of SRFinclude the immediate early genes C-Fos and early growth gene 1(EGR-1), previously shown to be necessary initiators of regenerationafter partial hepatectomy (PH). To date the role of SRF duringhepatic regeneration has not been reported. We sought to determineif SRF is expressed in adult rat liver and to determine if there is anychange in SRF expression following partial hepatectomy. Methods.Seventy percent PH was performed in adult male Sprague–Dawleyrats. The residual liver lobes were harvested at 6, 24, and 48 h. Liverlobes from normal rats served as control. Liver samples were pre-served for RNA extraction and immunohistochemistry. Histologicsections were stained for SRF using a polyclonal SRF antibody. Thepresence of nuclear staining of vascular smooth muscle was used asan internal control. Total RNA was isolated. mRNA levels wereanalyzed by RT-PCR using SRF primers. Ribosomal S15 primerswere used as internal controls. Data are reported means � SEM.Results. SRF immunoreactivity increased in the nuclei of hepato-cytes beginning at 6 h and peaked at 48 h when compared to normalhepatocytes. Additionally, there was intracytoplasmic staining ofhepatocytes at 48 h. RT-PCR revealed that SRF mRNA was up-regulated in the regenerating residual liver lobes as early as 6 h,peaking at 48 h, and returning to baseline at 48 h when compared tonormal rat liver (ratio SRF/S15 density, 0 h 0.1 � 0.01, 6 h 0.31 �0.11, 24 h 0.32 � 0.2*, 48 h 0.11 � 0.1; *P � 0.05 compared to 0 h, seefigure). Conclusion. SRF is up-regulated in regenerating hepato-

cytes after partial hepatectomy and may be involved in regulatinghepatocyte cell growth and division.

P97. Stem Cell Factor May Play a Role in Hepatocyte Prolif-eration and Liver Regeneration Following Partial Hep-atectomy. A. Carpenter, M.S., X. Ren, M.D., C. Hogaboam,Ph.D., and L. M. Colletti, M.D. University of Michigan MedicalSchool, Ann Arbor, Michigan.

Stem cell factor (SCF) is a leukocyte hematopoietic factor, inducingproliferation and maturation of multiple leukocyte subsets. SCF hasalso been shown to be important for normal development of other celltypes, including hepatocytes, and may play a role in liver regenera-tion after partial hepatectomy. To investigate this hypothesis, SCF’seffects on liver regeneration after 70% hepatectomy was investigatedin partial SCF knockout mice (Sl/Sld mice), which have low SCFlevels, as well as in wild-type mice. Wild-type mice underwent 70%hepatectomy (hep) or sham laparotomy and were sacrificed at 4, 8,16, 24, 48, 72, and 96 h postoperatively, and hepatic SCF levels were


Seededclusters

Mucosa(%; mean � SEM)

CT(%; mean � SEM)

0 (control) 0 05K 0.53 � 0.18 1.0 � 0.310K 1.37 � 0.24** 2.96 � 0.64*25K 0.75 � 0.15 1.8 � 0.68

* P � 0.05 vs 5K and ** P � 0.05 vs 5K and vs 25K, by ANOVA,t test.


measured by ELISA. Baseline hepatic SCF levels run in the range of2000–3000 ng/mg total protein. Following partial hepatectomy, he-patic SCF levels initially significantly drop (331 � 21 vs. 2559 � 174ng/mg total protein at 16 h, P � 0.05) and then rebound to supranor-mal levels 48 h postoperatively (3934 � 129 vs. 2052 � 229, P �0.05). Next, Sl/Sld mice and wild-type mice underwent 70% hepatec-tomy or sham laparotomy and were sacrificed on postoperativeday 7, and liver weight/total body weight ratios were measured:wild-type sham 5.64 � 0.53%, wild-type hep 5.63 � 0.01%, Sl/Sldsham 5.02 � 0.02%, and Sl/Sld hep 4.77 � 0.05%* (*P � 0.05 vs.Sl/Sld sham, wild-type sham, and wild-type hep). SCF adminis-tration to Sl/Sld mice undergoing hepatectomy restored liverweight/body weight ratios to normal, suggesting that SCF is im-portant for hepatic regrowth after hepatectomy. To further inves-tigate SCF’s proliferative effects on hepatocytes, primary mousehepatocytes were isolated by pronase/collagenase perfusion andwere exposed to increasing doses of SCF from 0 to 100 ng/ml andcellular proliferation measured at 24 and 48 h using a colorimetricassay. This demonstrated increased hepatocyte proliferation withSCF exposure, with the largest increases seen at 48 h at an SCFdose of 25 ng/ml (1.36 � 0.57 SCF vs. 0.64 � 0.03 medium alone).These data suggest that SCF levels are altered by partial hepa-tectomy and that SCF may play a role in hepatocyte proliferationfollowing partial hepatectomy.

P98. Gastric Matrix Metalloproteinases (MMPs): Implica-tions in Gastric Mucosal Defense. E. K. Robinson, M.D.,A. G. Garay, B.S., S. D. West, M.D., K. S. Helmer, M.D., L. K.Chang, B.S., X. Zhang, Ph.D., and D. W. Mercer, M.D. TheUniversity of Texas at Houston, Houston, Texas.

Purpose. The purpose of this study was to examine gastricMMP activity following COX inhibition with salicylate and NOSinhibition with NG-nitro-L-arginine methyl ester (L-NAME). In-troduction. Increased MMP activity is associated with tissueinjury in some organs. The role of MMPs in gut injury remains tobe fully elucidated. We recently demonstrated that increasedMMP activity may participate in lipopolysaccharide-induced gas-tric injury. Thus, we hypothesized that MMPs may play a role inother models of gastric injury. Methods. Conscious rats weregiven saline, salicylate (100 mg/kg ip), or L-NAME (10 mg/kg ip).Six hours after the above treatments, rats were anesthetized,their stomachs were aspirated, and 3 ml of 20% ethanol (EtOH)introduced into the gastric lumen. The rats were euthanized after10 min and gastric was injury evaluated by computerized planim-etry. In a separate experiment using similar treatment groups,rats were euthanized after 6 h and gastric mucosa was harvested.Gelatin zymography was performed to determine MMP activity(n � 4/group; ANOVA). Results. Both L-NAME and salicylatesignificantly increased gastric injury from 20% ETOH when com-pared to saline controls (Fig. 1). Salicylate treatment significantlyincreased MMP-2 activity in the gastric mucosa but had no sig-nificant effect on MMP-9 activity (Fig. 2). L-NAME had no effect on

either MMP-2 or MMP-9 activity (data not shown). Conclusions.This is the first study to report that MMP activity increases in thestomach following salicylate treatment. These data suggest thatMMPs may play a role in the ability of salicylate to exacerbate

gastric injury from ethanol, but likely do not play a role in medi-ating the deleterious effects of L-NAME.

P99. Safety and Efficacy of Bioprosthetic Repair of Para-esophageal Hernia (PEH): A Chronic Animal Study. K. M.Desai, M.D., V. Halpin, M.D., E. Winslow, M.D., S. Diaz, M.D.,and N. J. Soper, M.D. Department of Surgery, WashingtonUniversity School of Medicine, St. Louis, Missouri.

Introduction. The use of prosthetic materials for the repair ofPEH may lead to esophageal stricture and perforation. However,high recurrence rates following primary repair have led surgeonsto explore other options. This study assessed the safety and effi-cacy of PEH repair using different configurations of small intes-tine submucosa mesh (SIS, Cook Surgical Inc.) in a canine model.Methods. Four weeks following thoracoscopic creation of PEH, 22dogs underwent laparoscopic PEH repair with SIS mesh. A key-hole shaped patch was used in 9 (41%) dogs (Group 1), while 13(59%) underwent repair with a U-shaped mesh (Group 2). BariumX-rays and endoscopy were performed following repair. At eutha-nization 2 months later, biopsies of the esophagus and crura wereobtained. A P value of �0.05 was considered significant using theFisher’s exact and Student’s t test. Results. In Group 1, 5 (56%)dogs had dysphagia, 5 (56%) had evidence of esophageal stricture,and 2 (22%) reherniated. While 1 (8%) dog had dysphagia in Group2 (P � 0.05 vs. Group 1), none had evidence of stricture (P � 0.05vs. Group 1) or reherniation at sacrifice. Biopsies of the hiatalregion revealed that fibrosis and esophageal in growth to the meshdid not occur. Conclusions. Using this reproducible canine modelof PEH repair, SIS mesh does not erode into the esophagus.However, mesh configuration is a major determinant of outcome,with the U-shaped prosthesis leading to superior results over akeyhole configuration.

P100. Afferent Stimuli via Vagus Nerve Caused by Lapa-rotomy-Enhanced Nitrogen Excretion in the Urine Dueto an Increase in TNF-� mRNA Levels in the Rat Brain.K. Tanaka, M.D., K. Shirouzu, M.D., T. Muraoka, M.D., K.Momosaki, M.D., N. Iwakuma, M.D., A. Kaibara, M.D., N.Ishibashi, M.D., and S. Yoshida, M.D. Surgery, Kurume Uni-versity, Kurume, Fukuoka, Japan.

The aim of this study was to determine whether vagus nervewas involved in an increase in TNF-� mRNA synthesis in thebrain after laparotomy, resulting in greater nitrogen excretionthan the rats receiving vagotomy. Male SD rats (n � 80, body wt220 –240 g) were randomly assigned into four groups: (1) control;(2) laparotomy by 1 cm of the short vertical incision (Short); (3)laparotomy by 4 6 cm of vertical and horizontal incision (Long);and (4) subdiaphragmatic vagotomy plus laparotomy by the longincision (Long V.). In the Long V. group, the vagus nerves were cutafter laparotomy by the short incision, and subsequently the ver-tical and horizontal incisions were added (4 6 cm). The abdom-inal cavity was closed by continuous suture using 5-0 nylon.Exactly 3 h after the lapaprotomy, the first set of animals weredecapitated, and the hypothalamus, cortex of the brain, and liverwere harvested. The second set of rats was decapitated at 24 hafter the surgery and urine was collected for 24 h. Total RNA ofthe brain was extracted and mRNA levels of TNF-� were deter-mined by RT-PCR. Corticosterone (�g/day), catecholamine (�g/day), and nitrogen (mg/day) levels in the urine were measured byRIA, HPLC, and total nitrogen analyzer, accordingly. Data aremeans � SEM (by ANOVA, different superscripts indicate signif-icant differences, P � 0.05; see table). In conclusion, the afferentstimuli via vagus nerve caused by lapatomy was involved inTNF-� mRNA synthesis in the brain, resulting in up-regulation of


HPA axis and greater nitrogen excretion in the urine than the ratsreceiving vagotomy.

P101. Prospective Analysis of Quality of Life and ComorbidConditions Following Roux-en-Y Gastric Bypass. S.Huerta, M.D., J. R. Arteaga, M.D., M. Generoso, B.S., andE. H. Livingston, M.D. Department of Surgery, UCLA, LosAngeles, California.

Background. In the present study, we prospectively analyzedQOL and improvement of comorbid conditions in a cohort of patients

following Roux-en-Y gastric bypass (RYGB). Methods. Question-naires widely used to assess quality of life were given to patients[BECK inventory for depression, General Well-Being Questionnaire,and a Health Status Survey (Modified SF-30)] before surgical inter-vention (baseline) and at 3 months, 6 months, and 1 year followingRYGB. Preoperative and postoperative weight and five obesity-related comorbid conditions were also assessed. Results. A total of140 patients (116 female and 24 male, mean age 47 � 2 years) wereenrolled in the study. There was no difference in their initial BMI(52 � 3 vs. 52 � 2 kg/m2), respectively. The BMI in males andfemales was 40 � 2 and 40 � 3 kg/m2, respectively. There was animprovement on all comorbid conditions evaluated: HTN 77%, DM

79%, osteoarthritis 13%, sleep apnea 57%, and GERD 65% at 1-yearfollow-up. Improvement on QOL parameters is depicted in the table.Conclusions. There was a significant improvement for all measuredphysical and psychosocial QOL variables and all comorbid conditionsanalyzed. Notably, both male and female patients lost weight at thesame rate. In both groups, surgical intervention resulted in a 12-unitdrop in BMI.

P102. Esophageal Manometry and Impedance Further De-fine the Pathophysiology of Dysphagia. L. Khaitan,M.D., M.P.H., M. Holzman, M.D., and W. O. Richards,M.D. Vanderbilt University Medical Center, Nashville,Tennessee.

Introduction. Multichannel intraluminal impedance (MII) is anew technology measuring movement of bolus volumes(as opposed topressures measured by manometry) through the esophagus. An im-proved understanding of swallowing function can improve treatmentof patients with dysphagia following fundoplication. Methods. Aspart of an IRB-approved protocol, five patients with dysphagia post-fundoplication(Group I) and three patients without symptoms fol-lowing fundoplication (Group II) were studied with simultaneousesophageal MII and manometry. The distal MII channel sat 5 cmabove the LES and the manometry catheter was in the standardposition. Measurements were made with five standardized liquidand five semisolid swallows in the mid and distal esophagus. Re-sults. All parameters reported as means � SEM (see table). Swal-lows with symptoms of dysphagia revealed low impedance at thepoint where the patient felt discomfort indicating that the esophaguswas distended with the bolus and was associated with an aperistal-tic, incompletely transmitted, or ineffective(amplitude �50 mm/Hgcontraction). MII returned to baseline with passage of the bolus andresolution of patient symptoms. Abnormal contractions were associ-ated with longer bolus transit times than normal contractions [24 �8 vs. 10 � 1 s with liquids and 31 � 5 vs. 10 � 2 s in semisolids ingroup I (P � 0.02), 37 � 7 vs. 18 � 4 with liquids and 63 � 8 vs. 14 �2 with semisolids in group II (P � 0.01)]. LES pressures and re-laxation were similar between groups(31 � 4 vs. 24 � 1 and 63 � 6vs. 88 � 11%, P � 0.05). Conclusion. Changes in impedanceseen with symptoms of dysphagia can be correlated with delayed orineffective peristalsis with this technique and differences in bolustransit times are evident. The ability to view volume traversalthrough the esophagus provides further insight into the pathophys-iology of dysphagia.


Parameter (questionnaire)

% Improvement from baseline

3 months 6 months 1 year

Mean depression score (BECK) 65 72 75General well-being 22 20 25Concern about health 46 50 51Stress level 41 41 40Energy level 52 58 60Modified SF-30 56 42 66Role limitation

Physical 68 65 70Emotional 43 45 40

General health perception 54 60 72Mental health 32 30 34


Liquid swallows Semisolid swallows

MII bolustime (s)

MII bolusvelocity (cm/s)

Manometric contractionvelocity (cm/s)

MII bolustime (s)

MII bolusvelocity (cm/s)

Manometric contractionvelocity (cm/s)

Group I 15 � 3 0.7 � 0.1 4.9 � 2.6 26 � 5 0.5 � 0.05 3.1 � 1.3Group II 25 � 6 0.5 � 0.05 2.3 � 0.5 48 � 24 0.3 � 0.06 1.9 � 0.7


Control (N � 10) Short (N � 10) Long (N � 10) Long V. (N � 10)

Hypot. mRNA 0.42 � 0.02a 0.43 � 0.02ab 0.82 � 0.05c 0.58 � 0.02b

Brain cortex mRNA 0.57 � 0.06a 0.62 � 0.07ab 0.91 � 0.05c 0.69 � 0.06b

Liver mRNA 0.27 � 0.02a 0.41 � 0.03b 0.80 � 0.07c 0.73 � 0.08c

Corticoserone 950.5 � 92.8a 1082.8 � 62.3a 1345.5 � 67.2b 957.2 � 106.0a

Catecholamine 16.1 � 1.5a 18.1 � 1.6a 27.0 � 3.0b 18.8 � 1.4a

Nitrogen Ex. 549.4 � 20.0a 628.7 � 34.7a 1037.0 � 122.3b 691.6 � 15.7a


P103. Diminished Laminin Expression in the Adaptive Re-sponse to Massive Small Bowel Resection in the Rat.D. A. Swartz-Basile, Ph.D., and H. A. Pitt, M.D. MedicalCollege of Wisconsin, Milwaukee, Wisconsin.

Purpose. To determine if laminin protein expression is regulatedduring intestinal adaptation. Background. Intestinal adaptation, fol-lowing loss of functional small bowel surface area, is characterized bycellular hyperplasia and increased absorptive function. Changes in cellproliferation, loss, and migration as well as the degree of enterocytedifferentiation all contribute to this response. Laminin, the major non-collagenous component of the basement membrane, induces enterocytedifferentiation and inhibits proliferation. We therefore hypothesizedthat laminin would be altered during the adaptive response to smallbowel resection. Methods. Male Sprague–Dawley rats (n � 64) weresubjected to 70% proximal small bowel resections (n � 4–8) or shamresections (n � 4–8). Rats were euthanized at 24, 48, 72, and 168 hpostoperation, and the remnant intestine was harvested. Laminin pro-tein levels were determined by Western blot analysis. Data were ana-lyzed using two-way ANOVA and Student’s t test. Results. Whencompared to sham controls, resected groups at 24 and 48 h postopera-tion demonstrated significantly lower laminin protein levels. By 72 hpostoperation laminin levels were the same in sham and resected ani-mals (see table). Conclusions. Small bowel resection resulted in a

time-dependent, transient decrease in laminin protein expression.These findings suggest that after small bowel resection, laminin may bedegraded to facilitate the increase in villus height and crypt depthcharacteristic of the adaptive response. Thus, compositional changes inthe epithelial basement membrane may be important in facilitating theadaptive response.

P104. Acute Bile Duct Ligation Impairs Hepatic Clearance ofBacteria by Induction of Maladaptive Cytokines. D. R.Jeyarajah, M.D., M. L. Kielar, M.D., N. Frantz, B.A., Y.Zhang, M.D., V. Woodward, B.A., and C. Y. Lu, M.D. South-western Medical School, Dallas, Texas.

Introduction. Acute ascending cholangitis has a high mortalityand morbidity. Such infections are associated with biliary obstruc-tion. We studied the impact of biliary obstruction on the ability of theliver to respond to infection, to determine whether or not hepaticcytokines, produced in response to biliary obstruction, convert thenormally innocuous entry of bacteria (via the portal venous route)

into a deadly event. Methods. Using C57Bl/6 mice, we ligated thebile duct on day –1 and injected various doses of Escherichia coli viathe portal vein on day 0 (Group BDL/PV E. coli), or we performedsham surgery on day –1 and then injected E. coli on day 0 (Groupsham/PV E. coli). Survival was monitored. Using a dose of 5 105 cfuE. coli hepatic bacterial counts, histology, and cytokine mRNA pro-files (RNase protection assay) were measured in livers 24 h after PVinjection. Results. The LD50 for [BDL/PV E. coli] was 4 orders ofmagnitude less than [sham/PV E. coli]. The former had significantlygreater hepatic cfu of bacteria. By histology, the former had lobularcollapse and necrosis; in contrast, the latter retained its structuralintegrity. By RNase protection assay, the former had significantlygreater hepatic abundance of IL10 and IL1RA mRNA. Conclusion.We have found that portal venous pathogen is not handled efficientlyin the face of acute biliary obstruction. This may be related to amaladaptive hepatic production of IL10 and IL1RA in response tobiliary obstruction. These cytokines are known to be detrimental toclearing of pathogen in other models.

P105. Starvation-Induced Proximal Intestinal Epithelial Ap-optosis Increased with Aging. J. Song, M.D., X. Wu, M.D.,and S. E. Wolf, M.D. Shriners Hospitals for Children and De-partment of Surgery, University of Texas Medical Branch,Galveston, Texas.

Background. Gut epithelial cell turnover is maintained by abalance between cell proliferation and cell death by apoptosis. Star-vation induces small bowel atrophy, which is related to increasedintestinal epithelial apoptosis and decreased proliferation. In thisstudy we examined gut mucosal epithelium homeostasis with agingin response to starvation. Methods. Sixty-four 2- and 26-month-oldC57BL/6 mice were randomly divided into ad libitum feeding groupsand fasted groups. Small bowel was harvested at 12, 48, and 72 hafter starvation. Mucosal height and epithelial cells villus werecounted after hematoxylin/eosin staining. Intestinal epithelial cellapoptosis was identified by terminal deoxyuridine nick-end labeling(TUNEL) staining, and cell proliferation was determined by im-munohistochemical staining for proliferating cell nuclear antigen(PCNA). Counting was performed by a blinded observer. Statisticalanalysis was performed with one-way ANOVA with Tukey’s test andunpaired t test. Significance was accepted at P � 0.05. Data areexpressed as means � SEM. Results. Aged mice had more proximalgut weight, mucosal height, and cell number at baseline comparedwith young groups (P � 0.05). Apoptosis was lower in aged groups(P � 0.05) while proliferation was not different between groups.After starvation, proximal gut mucosal height and mucosal cell num-ber decreased in both groups (P � 0.05), which were related toincreased apoptosis in both groups and decreased proliferation in theyoung group. Relative changes in the groups after fasting were notdifferent except apoptosis increased in the aged group at the earlytime point (P � 0.05). Conclusion. Aged mice have decreased rate ofapoptosis compared to the young mice in the small bowel epithelium.Starvation-induced changes are similar in the young and aged. How-ever, the relative change for apoptosis index in aged fasted micestays higher, probably suggesting a relationship between starvation-induced cell apoptosis and aging.


Hours postoperation

24 48 72 168

Sham 1.35 � 0.13 1.27 � 0.09 1.08 � 0.05 1.08 � 0.11Resected 0.85 � 0.11* 1.01 � 0.06* 0.97 � 0.06 1.07 � 0.07

* P � 0.05 vs. sham by Student’s t test.


abstracts presented for the thirty-sixth annual meeting of the association for academic surgery

Documents