DISCOVERY AND CHARACTERIZATION OF' THREE GENES ENCODING G PROTEIN-COUPLED

RECEPTORS

Benjamin P. Jung

A thesis submitted in accordance with the requirements for the degree of Master of Science

Graduate Department of Pharmacology University of Toronto

OCopyright by Benjamin P. Jung 1997

National Library I*l of Canada Bibliothéque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 Wellington Street 395, rue Wellington Ottawa ON KI A ON4 ûttawaON K1AON4 Canada Canada

Yaur hie Voire nilemce

Our iCie Narre feterence

The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of ths thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/fXm, de

reproduction sur papier ou sur fomat électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

ABSTRACT

Discovery and Characterization of Three Genes Encoding G Protein-coupled Receptors Benjamin P. Jung, M.Sc. 1997 Department of Pharmacology

University of Toronto

The research work undertaken resulted in the d k c o v e ~ of three novel human G

protein-coupled receptor (GPCR) genes. Using a customized search procedure of a

database of expressed sequence tags (dbEST), human cDNA sequences that panially

encoded novel GPCRs were identified. These cDNA fragments were obtained and used

to screen a genomic library to isolate the full-length coding region of the genes. This

resulted in the isolation of genes GPR23 and GPR24. Gene G P R 3 was isolated by

ampIi@ing human genomic DNA with oligonucieotides based on GPR2-I and the related

somatostatin (sst) receptor genes. The receptor encoded by GPR23 e.xhibited significant

identity (60%) in the transmembrane (TM) domains to the chicken nucleotidic P?Y,

receptor. while the receptor encoded by GPR2-I shared -40% amino acid identity in the

TM regions to the five known sst receptors. The receptor encoded by GPR7j was most

closely related (4 1% in TM regions) to the GPRIS-encoded receptor. Northem blot and

in situ hybridization analyses revealed that GPRZ-I is expressed abundantly in many

discrete brain regions in human and rat, including the forebrain. hypothalamus. and

hippocampus. A repeat polymorphism of the form (CA), was discovered in the 5 ' -

untranslated region (UTR) of GPR2-I. Binding studies failed to identim the ligands for

any of the encoded receptors. Fluorescence in situ hybridization (FISH) was used to map

GPR73 to chromosome X, region q13-q21.1, GPR2-I to chromosome 22 region ql3.3.

and G P R D was mapped to chromosome 1 region q32.1.

ACKNOWLEDGMENTS

1 would like to sincerely thank Dr. Brian O'Dowd for the opportunity to pursue my

degree under his supervision and direction, and whose guidance has been invaluable to

me in the completion of my research. 1 wish to also thank Dr. Susan George. Mr.

Adnano Marchese. and Mr. Tuan Nguyen for their advice and expertise. al1 of whom

have contributed significantly to my research experience. 1 would like to mention also

Dr. Peter Wu. Dr. Antonio Lança, and Dr. Dave Hampson for their meaningful insight

and interest in my work. Finally, 1 would like to thank my family and fnends for their

continued encouragement and unending support in this endeavor.

PUBLICATIONS

The work reported has resulted in the following publications:

GPR23: O'Dowd. B.F.. Nguyen. T., J u w , Marchese. A.. Cheng, R.. Heng. H.H.Q.. Kolakowski. L.F.. Jr.. Lynch. KR., George. S.R. (1997) Cloning and chromosomal mapping of four putative novel human G-protein-coupled receptor genes. Gene 187: 75-81.

GPR24: Kolakowski. L.F.. Jr.. B.Pt, Nguyen. T., Johnson. M.P.. Lynch. KR.. Cheng, R., Heng, H.H.Q., George, S.R.. O'Dowd. B.F. (1 996) Characterization of a hurnan gene related to genes encoding somatostatin receptors. FEBS Lett. 3 98: 253 - 3 8 .

GPR25: June. B.P., Nguyen, T., Kolakowski, L.F., Lynch. KR.. Heng, H.H.Q.. George. S.R.. OIDowd. B.F. (1 997) Discovery of a novel human G protein-coupled receptor gene (GPR25) located on chromosome 1 . BBRC 230: 69-72.

GenBank Accession numbers have been obtained for each gene. They are U66578. U7 1092. U9 1939 for GPR23. GPR2.I. and GPR25. respectively.

TABLE OF CONTENTS

Page

. . ................................................................................. ABSTRACT i l

ACKNO WLEDGMENTS ................................................................. iv

PUBLICATIONS ............................................................................ v

... ..................... LIST OF TABLES ,. ..................................................... viri

................................................................................................... LIST OF FIGURES ix

LIST OF ABBREVIATIONS .............................................................. x

1 .O INTRODUCTION

....................................................................... 1.1 Overview of Introduction 1

3 1.2 The G Protein-coupled Receptor Superfamily .............................. - 1.3 Molecular Cloning of Receptors ............................................. 7

1.4 Methods of Receptor Identification .......................................... 10

1 .j Gene Databases and GPCR Gene Discovery ................................ II

1.6 Nucleotidic Receptors and the Uridine Nucleotide Receptor ............. 17

1.7 The Somatostatin Receptor Farnily ......................................... 19

1.8 Research Objective ............................................................. 2 1

2.0 METHODS

2.1 Overview of Methods .......................................................... 22

33 2.2 Cloning and Characterization of GPR23 .................................... -- 2.3 Cloning and Characterization of GPR2.I ..................................... 25

2.4 Cloning and Characterization of GPR2j .................................... 31

. . 2.5 Chromosomd Localization of GPRZ3 GPR2-I and GPRZj ............. 32

3.0 RESULTS

3.1 Overview of Results ............................................................. 34

3.2 Isolation and Characterization of GPRZ3 .................................... 34

3.3 Isolation and Characterization of GPR24 .................................... 42

3.4 Isolation and Characterization of GPRZj ................................... 53

4.0 DISCUSSION

4.1 Sumrnary of Findings .......................................................... 61

4.2 Insight into the Identity of GPR23 ........................................... 62

4.3 Insight into the Identity of GPR2-l ........................................... 66

4.4 Insight into the Identity of G P R X ........................................... 74

5.5 CONCLUSIONS ........................................................................ 76

6.6 REFERENCES ........................................................................... 77

LIST OF TABLES

.......................................... Table 3.1 Classification of PCR products 35

Table 3.2 Caiculation of TM amino acid identities ................................ 33

- - Table 3.3 Classification of GPCR genes arnplified ................................ s~

Table 4.1 Comparison of TM amino acid identities between the G P R X encoded receptor and sst subtypes ....................................... 68

Table 4.2 Surnmary of mutagenesis studies and molecular modeling ................................................................................... of sst receptors 70

LIST OF ABBREVIATIONS

ADP

ATP

BLAST

bp

CAMP

cDNA

DAPI

dbEST

DNA

EST

FlSH

G protein

GPCR

kb

mRNA

NCBI

nt

ORF

o u - 1

P2Y

PCR

sst

SST- 14

SST-28

TM

UDP

UNR

adenosine diphosphate

adenosine triphosphate

basic local alignment search tool

base pairs

cyclic adenosine monophosphate

complernentary deoxyribonucleic acid

4g,6-diamidino-2-phenylindole

expressed sequence tag database

deoxyribonucleic acid

expressed sequence tag

fluorescence in situ hy bridization

guanine nucleotide regdatory protein

G protein-coupled receptor

kilobase pairs

messenger ribonucleic acid

National Center for Biotechnology Information

nucleotides

open reading fiame

Opioid Receptor-Like- 1 receptor

nucleotidic receptor

polymerase chah reaction

somatostatin receptor subtype

somatostatin- 14

somatostatin-28

transmembrane

uridine diphosphate

uridine nucleotide receptor

UTP

UTR

uridine triphosphate

untranslated region

1.0 INTRODUCTION

1.1 Overview of Introduction

Receptors that couple to G proteins play an essential role in biological systems. They

represent. for many signalling molecules. the first step of a complex transduction cascade

in which exnacellular stimuli are converted into divene intracellular responses. In

addition to their participation in normal physiological hc t ion . G protein-coupled

receptors (GPCRs) have been investigated as potential targets for dmg therapy because

they are potent mediators of ce11 response. In the Iast fifteen years. study of G-linlied

systems has been greatly facilitated by the molecular cloning of many genes that encode

for these receptors. The benefits of identiQing GPCR-encoding genes are considerable as

their characterization can provide important information about the diversity of this family

of receptors and permit the study of the expressed receptors in vino. This thesis describes

how molecular cloning strategies have been applied successfully in the identification of

eenes encoding three novel members of this famil y. A general introduction to this famil y Cr

of receptors is first presented which is followed by a section documenting the

development of conventional methodologies used in GPCR discovery. This is followed

by a discussion of various methods of receptor identification and a brief history of

computerized gene databases, the latter being key to the discovery of these receptors.

Finally, background relevant to specific receptors of interest to Our laboratory (the

nucleotidic and somatostatin receptors) is provided.

1.2 The G Protein-coupled Receptor Superfamily

Except for lipid-soluble dnigs, which c m pemeate through the hydrophobie bilayer

and interact with intracellular receptors. the majority of dmgs act by binding to cell-

surface receptors. Cell-surface receptors can be classified into three different classes by

their participation in signal transduction systems: 1. receptor tyrosine kinase and

receptor guanylyl cyclase 2. ligand-gated ion channels 3. G protein-coupled receptors

(GPCR). WhiIe each receptor class in its own nght is fundamental to physiological

function. the farnily of GPCRs represents the largest group in terms of nurnber of unique

members and nurnber of different endogenous ligands that activate or regulate them. .4t

present, the number of unique hurnan GPCR-encoding genes that have been identified is

close to 200. This probably represents only one f i f i of the total nurnber of GPCRs

though upon the inclusion of the nurnber of predicted odorant receptors that exist. In

addition to mammalian species. GPCRs have been isolated from archebacteria. slime

mold. fungi. insects. amphibians. birds, various marine animals. and several species of

plant. Their involvement in physiological processes is best reflected in their capacity to

transduce a diverse array of extracellular stimuli: light. biogenic amines (e.g. adrenaline.

histamine, dopamine, serotonin, acetylcholine), neuropeptides (somatostatin. opioid

peptides. vasopressin, oxytocin, cholecystokinin, angiotensin). chemokines and

chemotactic factors, odorants, prostaglandins, nucleotides and nucleosides, glycoprotein

hormones (follicle stimulating hormone, lutropin-chonogonadotropic hormone,

thyrotropin), platelet activating factors, and releasing hormones (gonadotropin-releasing

honnone, thyrotropin-releasing honnone). It is estimated that over 80% of al1 known

pnmary messengea bind to this class of ce11 surface receptor. Furthemore. man?

GPCRs have been isolated for which the endogenous ligand has yet to be identified (see

section 1.4). In addition to studying receptors to understand how they function

physiologically. their participation in such a multitude of biological functions has sparked

interest into their possible involvement in diseased States. Genetic mutations and the

resultant dysfunctional receptors have been linked to nurnerous conditions including

vision impairment. a nurnber of hormonal and regulatory dysfûnctions. and metabolic

deficiencies (reviewed in Zastawny et al.. 1997; Spiegel et al.. 1997).

In G-linked systems. the GPCR is responsible for recognizing a specific extracellular

signal. In the basal state. GPCRs are bound to G proteins. Upon activation of the

appropriate agonist. the receptor undeqoes a conformational change which results in the

simultaneous dissociation and activation of the G protein into subunits (a and py) in the

cytosol. The subunits. in tum. modulate the activity of an appropriate dovmstream

effector. such as adenylyl cyclase (AC) and phospholipase C (PLC). The downstrearn

effector directly regulates levels of a second messenger (e.g. cyclic AMP (CAMP) in the

case of adenylyl cyclase. and inositol trisphosphate and diacylglycerol in the case of

phospholipase C), and in so doing, initiates a specific cascade of intracellular events that

eventually leads to the resultant cellular response.

Structural feaiures of GPCRs

Cornparison of the GPCR-encoding genes reveal that they are al1 remarkably similar

in structure and organization. Al1 GPCRs consist of a single polypeptide chain organized

into an analogous structural arrangement consisting of an extracellular amino terminus,

followed by seven a-helical transrnembrane (TM) domains intercomected by aitemating

extracellular loops and intracellular loops, and terrninating in a cytoplasmic carboxyl tail

(Figure 1.1). In vino mutagenesis studies of monoamine GPCRs indicate that the

agonist-binding determinants are located in the hydrophobie TM domains (for a review.

see Savarese et al., 1992). The extracellular segments have also been showm to be

binding determinants for peptide-activated GPCRs while the intracellular loop regions

and the carboxyl tail are essential for G protein coupling and in regulating receptor

responsiveness. Aligning the primary amino acid sequences of GPCRs reveals a

considerable conservation of sequence arnong receptors that bind the same or stmcturally

similar ligands. particularly and understandably in TM regions as they form the putative

ligand binding pocket. In fact, severai residues and motifs are almost always conserved

identically. or conservatively substituted. in the analogous position throughout members

belonging to this superfarnily, and almost exclusively within the TM regions (Figure 1.1).

It is this remarkable property of GPCRs that has been esploited to clone the majority

GPCR genes and is the basis for ongoing cloning strategies to identi- novel members.

The greatest divergence in sequence is observed in the extracellular and intracellular

portions of the receptor. The conservation of structural and/or hctional domains

suggests that GPCRs may have a comrnon ancestry. In support of this hypothesis, the

genes encoding chemokine GPCR (Murphy i 996) and those encoding certain adrenergic

receptor subtypes (Yang-Feng et al.. 1990) are found clustered in the human genome,

suggesting that receptor subwpes may have arisen through gene and/or chromosome

duplication events.

O 000000 4- SIZE OF M O TERMINUS - m OO()OO- NH,

n VARIES -

A" % CARBOXYL

SIZE OF LOOP VARIES

Figure 1.1 Diagram showing the typical 7 TM topology of a GPCR. Circles represent individual amino acid residues. Residues that are highly conserved across the GPCR superfarnily are Iabeled. Approximate sites of disulfide bond formation (S - S) and palmitoylation ( ) are indicated. Amino acid letter designations: G = glycine. N = asparagine. V = valine, L = Ieucine. A = alanine. D = aspartate. P = proline. C = cysteine. R = arginine.Y = tyrosine. W = tryptophan. F = phenylalanine.

Many receptors are subject to a host of post-translational modifications. which have

important implications for receptor function (reviewed in Strader et al.. 1994). Many of

these can be identified by pnmary sequence analysis of the GPCR. Specific asparagine

residues in the amino terminus and extracellular loops that conform to the consensus

sequence Asn-X-Serm have been found to be glycosylated. Giycosylation is believed

to be required for optimal membrane expression and trafficking. Particular cysteine

residues located in the second and third loops of most GPCRs may participate in disulfide

bond formation. The disulfide bond is believed to be important to stabilize the tertiary

protein structure. Intracellularly. senne andor threonine residues in the second and third

intracellular loop or carboxyl tail of the receptor c m be phosphorylated by various

serine/threonine protein kinases (Premont et al.. 1995). The phosphorylation of residues

by these enzymes have been shown to be involved in the phenornenon of agonist-induced

receptor desensitization. whereby a receptor's responsiveness to agonist stimulation is

attenuated because of receptor-G protein uncoupling (reviewed in Ferguson et al.. 1996).

In numerous receptors. a cysteine residue about 70 amino acids downstrearn from the

seventh TM has been shown to be palmitoylated. This post-translational modification is

believed to anchor the receptor to the plasma membrane to form a fourth intracellular

loop (see Figure 1.1 ). The function of palrnitoylation is currently being elucidated but

there is evidence supporting its involvement in effector uncoupling and agonist-induced

desensitization (Moffet et al.. 1993; O'Dowd et al.. 1989; Jensen et al. 1995) and/or

receptor intemalization, trafficking and targeting (Nussemeig et al.. 1993; Eason et al.

1994; Jin et al., 1997).

1.3 Molecular Cloning of Receptors

The first GPCR genes were cloned either by receptor protein purification or

expression cloning (Marchese et al., in press). (They are only bnefly mentioned here

with respect to their contribution to the development of cloning strategies used in the

present study). Both procedures were dependent on having pnor pharmacological

knowledge of the receptor (e.g ligand binding, specific tissue expression. sufficient

receptor expression), including the specific pharmacological response elicited upon

ligand binding in the case of expression cloning strategies. Both protein purification and

expression cloning strategies involve very resource-consurning methods: in protein

purification. a large arnount of intact receptor protein is required. while in expression

cloning, mRNA from a tissue expressing the receptor is required. In addition to these

restrictions. they are m e r complicated by other technical pitfalls as well. Despite these

limitations, the receptor gene thus isolated encodes the receptor that binds the ligand of

interest. and perhaps represent the best methods that c m ensure the isolation of a

functional receptor gene. Indeed. many important genes have been discovered using such

strategies. including rhodopsin (Nathans & Hogness. 1983). the pl-adrenergic (Dixon et

al. 1986). the P 1 -1ike adrenergic (Yarden et al.. I986), and M 1 (Kubo et al. 1986) and M2

muscarinic receptors (Peralta et al.. 1987a), neurokinin NK2 receptor (Masu et al.. 1917).

and the serotonin 5-HT2, receptor (Julius et al., 1988). More significantly. these early

discoveries revealed for the first time the remarkable structural and sequence

conservation between GPCR sequences. This cntical realization formulated the basis for

the deveiopment of other cloning approaches.

In 1987, Kobilka et al. reported the successful isolation of the gene encoding the 5-

HTIA recepior by screening a library with a radiolabeled pz, receptor cDNA probe. The

sequence similarity between the two receptor genes was suficient enough to permit

hybridization of the probe to the 5-HT,, gene. In the ensuing years. man- hnctional

GPCR genes have been isolated using this strategy or variations of this strateg?..

including the use of receptor cDNA or even short oligonucleotides as probes. and using

different hybndization conditions (e.g. temperature, washing conditions. salt

concentrations). This method of homology screening at reduced stringency has been used

to detect subtypes of a cloned receptor. The sequences encoding the M3 and M4

muscarinic receptor subtypes were obtained using previously cloned Ml and M2

muscarinic receptor cDNA as probes (Bonner et al.. 1987; Peralta et al.. 1987b). The

dopamine Dj receptor gene was isolated by screening with a dopamine D, gene fragment

(Sunahara et al.. 199 1 ). However, there are many examples of serendipitous discovery. in

which the probe cross-hybridizes with a receptor gene that is not a fùnctional subtype.

reflecting the versatility of the method and highlighting the degree of similarity between

even non-functionally related members of the superfarnily.

Sequence similarity is also the underlying b a i s for the success of the sequence

homoiogy-based PCR strategy. The procedure was first described by Libert et al. ( 1989).

Based upon conserved regions of 6 known GPCRs (the and a2, adrenergic, the

serotonin 5-HT,,, the muscarinic Ml, and the substance K recepton), a pair of

degenerate oligonucleotides were designed serving as pnmers to ampli@ cDNA using the

polymerase chah reaction (PCR). The underlying theory is that the degenerate pnmers

(one based on the coding m d , the other on the complementary strand) will anneaf to

cDNA sequences encoding GPCRs of significant similarity. The polymerase proceeds to

synthesize the complementary sequence in an extension reaction. This process of

denaturation. annealing of primers to template DNA, and extension is repeated for 25-30

cycles. yielding fragments encoding GPCR genes. The annealing temperature is a

variable parameter. allowing the researcher to set how stringent a match benveen the

primer and the template is required for successful annealing. and hence which GPCR

genes will be arnplified (O'Dowd et al.. 1990). Novel GPCR gene fragments can be

identified upon sequencing of these PCR products and the full length reading frarne

obtained by the subsequent screening of a library using a candidate fragment as a probe.

Libert et al., using degenerate primers derived from TM3 and TM6 were successful in

cloning four novel GPCRs. three of them subsequently identified (see section 1.4). Marty

researchers have since employed the PCR to identi@ many other genes. and the approach

has been particularly effective in cloning orthologous genes (i.e. the sarne gene in another

species). Because of the intronless nature of many GPCR genes, genomic DNA can be

used (instead of cDNA). This offers a solution to discovenng genes that rnay not be

expressed abundantly or at al1 as mRNA in the source tissue. Numerous functional

subtypes have been successfully identified using the PCR method. including the

neurokinin NK1 (Hershey & Krause. 1990), NKZ (Gerard et al., 1990), dopamine D,

(Sunahara et al., 1 WO), serotonin 5-HT, (Jin et al., 1 992) and histamine H2 (Gantz et al.,

1991) recepton. However, the PCR method is not without problems. its greatest

limitation being that the genes obtained may not encode the desired subtype, or instead,

the genes detected by PCR methods encode putative GPCRs for which the physiological

ligand is unknown-hence the coining of the term "orphan receptor". A negative

connotation has becorne attached to this term as orphan receptors appear to be of limited

irnmediate value. This viewpoint is unfortunate and undeserved as the publication of

orphan receptor gene sequences has Ied to many significant discovenes.

1.4 Methods of Receptor Identification

In protein purification and expression cloning methods. the investigator begins with

the receptor's known pharmacology: hence, the receptor gene of interest is directlp

targeted, generating genes in which the expressed receptor binds the desired ligand. In

contrast. any clones obtained using the PCR method. homology screening at reduced

stringency, (or EST searching: descnbed below) is by definition an orphan until it c m be

identified by ligand binding or functional studies. Pharmacological studies are performed

following the isolation of the clone. using ligands selected according to its homology

with other GPCRs. If an endogenous ligand is not found. the encoded receptor remains

an orphan and awaits identification.

Comparative sequence anaiysis can be used to predict the ligand for a new receptor.

and it represents the most simplistic ba i s for identification. Homology in the TM

regions and the presence of key motifs important for ligand binding in a panicular class

of receptors can strengthen the suspicion. Four orphan receptors were cloned from rat

thyroid cDNA (Libert et al., 1989). Three of these were subsequently identified as the

WT,, (Maenhaut, C. et al, 199 l ) , and the adenosine A, (Libert et al., 1991a) and A,

receptors (Maenhaut, C., et al, 1990) upon the observation that each showed 40-60%

homology with known receptors of the sarne family. This is a rather straightfonvard

method of deduction but is not applicable in the absence of significant sequence

homology (less than 40%).

Mapping the tissue distribution of the receptor has been shown to be useful in receptor

identification. An example of this is the adrenomedullin (AM) receptor. onginally

isolated as the orphan receptor GlOd (Harrison et al.. 1993). Tissue expression of the

orphan receptor was shown in lunp, liver. and adrenal gland tissue extracts. The

observation that the AM binding sites overlapped with this tissue distribution resulted in

the positive identification of Gl Od as the AM receptor (Kapas et al.. 1995). Another

example is the cannabinoid receptor. also onginally cloned as an orphan receptor gene.

SKR6 (Matsuda et al.. 1990). The identity was deduced upon noting that SKR6 mRNA

was present in ce11 lines and in brain regions that express cannabinoid sites. Knowledge

of tissue distribution of receptors was also key to determining other orphans. including

the neuropeptide Y, and the somatostatin sst, receptor (see Marchese et al.. in press).

Receptors that bind unknown ligands

The most difftcult task is to identi& orphan recepton for which the physiological

ligand itself has not been discovered. Strategies have been developed towards this

objective, which involve the rneasurement of a fûnctional response upon application of a

tissue extract. The rationale for the approach is that most GPCRs regulate adenylyl

cyclase activity or stimulate phosphoinositide metabolism, so that the application of a

tissue fraction containing the ligand will induce a meaurable response in an appropriate

ce11 line. However, this second rnessenger response method is much simpler in theory

than in practice. the major obstacle being the acquisition of sufficient tissue extract with a

high enough concentration of ligand. In mammals. only one orphan receptor has been

identified to date using this snategy. the nociceptin receptor (Meunier et al.. 1995:

Reinscheid et al.. 1995). This will be discussed in detail in a more appropriate section

(see Discussion).

;Merifs of orphan recepfor research

Despite the apparent difficulties involved with orphan receptor research. also referred

to as "reverse pharmacology" (Libert et al. 1991 b), orphan identification offers numerous

advantages. and has been surnrnarized by Mills and Duggan (1994). First. it has

succeeded in identibing receptor subtypes of known receptor classes which had not been

detected by pharmacological studies (e-g. nociceptin receptor). Second. elusive

receptors such as the cannabinoid receptor and AM receptors were identified when more

conventional approaches had failed. Finally. this technology has the potential to discover

receptors for yet undiscovered ligands. unveiling previously unknown physiological

function and new intercellular signalling pathways. The recent discovery of numerous

novel mRNA species isolated fiom rat stnatum (Usui et al. 1994) and hypothalamus

(Gautvik et al.. 1996) by directional tag PCR subtraction supports the possibility of the

existence of such ligands.

1.5 Gene Databases and GPCR Gene Discovery

The end of discovering novel GPCR genes is foreseeable within the next 10 years.

The international 15-year initiative is to sequence the entire three gigabase human

genome by the first decade of the new century. By that time, assuming objectives are

completed on schedule and that the required technological advances are developed. al1

genes including those that encode GPCRs will have been sequenced. Using any number

of available cornputer algorithms that convert genetic sequence into protein sequence. a

systematic analysis of the genome will idenlie any genes encoding putative GPCRs.

Functional identification will still have to be carried out using conventional methods and

strategies as described previously (in Introduction 1.4). -4s DNA sequences become

available and accessible through public gene databases (see below). they c m be analyzed

irnmediately. Unfominately, in its early infancy, the approach to the genome project was

to sequence genornic DNA which. to get high output, had to await the technological

innovations required for batch DNA sequencing. so that the avaiiability of sequences kvas

scarce and slow. However. an approach developed independently but in parallel wlth the

genome project has been more appropnate for cloning novel genes. including GPCR

genes. This strategy. which rapidly generates short cDNA sequences. called expressed

sequence tagged (EST) sequences. has now become adopted as an integral part of the

genome project. In this regard. EST sequences has facilitated the creation of a physical

map of the human genome. and are particularly usehl markers of expressed genes in the

genome.

Generafion of EST sequences

The seminal paper on EST sequences was published in 199 1 (Adams et al.) by a group

headed by Dr. J. Craig Venter of the National Institutes of Health (NIH) in the U S . The

authors discuss the mex-its of sequencing cDNA over genomic DNA, arguing that cDNA,

which represents expressed genes but only 3% of chromosomal DNA, comprise the vast

majority of the information content of the genome. They aiso point out that cDNA is

intronless so that o d y coding sequence is obtained in contrast to genomic DNA in which

the gene coding regions rnay be complicated by introns. These advantages prompted

them to undenake a pilot project to generate EST sequences. Briefly. selecred cDNA

libraries were converted en masse to pBluescript plasmids and transfected into a

competent bacterial strain (Escherichia coli XL 1 -Blue). Libraries containing random

primed and partial cDNA clones were ideal, as these would be more helpful in the

identification of genes and in the construction of a usefil EST database. The alternative.

sequencing the ends of full-length cDNAs (which contain 5' and 3' untranslated

sequences) would likely yield much less coding sequence. and such sequences will also

be biased toward the beginning or end of the expressed rnRNA. In the search for genes

encoding proteins where the conservation of sequence is observed M e r into the protein

(as in the TM domains of GPCRs). sequence of the ends of hl!-length cDNAs is not

revealing. Colonies were then randomly picked, and templates prepared for sequencing

either by PCR or the alkaline lysis method. Single-run sequencing of the templates was

perfomed with an automated sequencer. using prirners complementary to the plasmid

sequence. The generated cDNA (i.e. EST) sequences from the single-pass sequencing

was 150 to 400 bases in length. Indeed. the process was simple and fast. Also, the

accuracy of the automated sequencing was assessed and found to be high. averaging

97.7% for up to 400 bases. Using a number of cornputer algorithrns (see below) for

comparative sequence analysis with known genes and proteins, 230 of 609 (or 38%) EST

sequences did not match significantly, and hence represent new, previously

uncharacterized genes. Among other sirnilarities. 2 notable ESTs exhibited more than

85% identity at the nucleotide level with members of the P-tubulin or a-actinin gene

families, li kel y representing novel, previousl y unsuspected members. The extension of

EST sequencing to GPCR gene discovery was obvious: a library can be screened uith

the EST clone to obtain the Full length gene. Now five years following this first

description, we have used the EST approach for the identification of numerous GPCR-

encoding genes including GPR19 (OIDowd et al., 1996), GPRZI. GPR27. GPR73

(O'Dowd et al., 1997). and GPR2-I (Kolakowski et al.. 1996). The major impetus for

these discovenes has corne from the establishment of a database of EST sequences

accessible by any investigator.

Release of EST sequences in public databases

Following the invention of EST sequencing, Dr. Venter and the NIH tried to patent

EST sequences. However. it was argued by the scientific community that patent

protection should not be permitted for EST sequences as they are partial sequences only.

their function not as yet identified. Further to this. patents on EST sequences would deter

their M e r characterization. and thereby impede the progress of scientific investigation.

Unable to expand his research because of lack of govemmental Funding, Dr. Venter lefi

NIH in 1992 and spearheaded The Institute for Genomic Research (TIGR), a non-profit

organization financially backed by Human Genome Sciences. Inc. (HGS) and its

corporate sponsor, SrnithKline Beecham (Philadelphia). Dr. Venter became the target of

cnticism when TIGR and HGS restricted access to its EST sequence database; HGS and

SrnithKline Beecham were given first rights to exploit EST sequence discoveries and

therefore would cornmercially benefit fiom any resulting developments. The proprietary

stance of these companies was chailenged. prompting Merck & Co.. Inc. to independently

fund a separate EST sequencing operation centered amund the Genome Sequencing

Center at Washington University, accordingly called the WashU-Merck EST Project.

The EST sequences isolated by this group have been made available to the public

domain, and has been deposited into a separate EST database (dbEST) with other publicly

accessible computerized genetic databases (collectively known as GenBank) maintained

at the National Center for Biotechnology Information (NCBI). A recent survey shows

that the WashU-Merck EST Project has already deposited close to 350. 000 sequences in

the dbEST since its inception in 1994 (Hillier et al.. 1996). As new submissions to the

dbEST nurnber over 1000 sequences per day (Boguski and Schuler. 1995). it is fortunate

that a variety of' powerful cornputer algorithms have been developed to screen for

candidate EST sequences.

Screening for putative GPCR-encoding sequences

An efficient approach has been employed successfûlly to identify GPCR-encoding

genes GPR19. GPRZI. and GPRZZ by Dr. Lee Kolakowski. The strategy is a customized

search procedure that requires the use of cornputer algorithms available on the Intemet at

the NCBI site. They are al1 basic local alignment search tools (BLAST; Altschul et al..

1990) that compute identities of a query sequence with a selected database. The choice of

which BLAST search to use is dependent on whether the query is a nucleotide sequence

versus protein sequence (BLASTN and BLASTP respectively), if a conversion from

nucleotide to putative protein is required (BLASTX or TBLASTX. exclusive for EST

sequences), or if a cornparison of a protein with the m s l a t e d EST nucleotide sequence is

desired (TBLASTN). Briefly. in Dr. Kolakowski's method. the dbEST is queried with

various GPCR sequences using the TBLASTN aigorithm. The EST sequences re tmed

that have statistically significant scores are searched manually to detemine whether

highly conserved amino acid motifs found in GPCRs are present in transiated sequences.

EST sequences that are identical to known GPCR genes are determined by querying a

GPCR database with the conceptualized arnino acid sequence. and subsequently

eliminated. The EST sequences thus filtered are then used to query the SwissProt

(release 31) database using the FASTA algorithm, a more sensitive algorithm that c m

optimize protein alignments better than the BLAST farnily. Upon showing a significant

score. the clone sequenced to generate the EST sequence can be requested From the EST

sequencing institution. and subsequently used to screen a library to obtain the full length

clone. This strategy has been important in the present study in discovering and the

subsequent characterizing of genes encoding for additional members of the GPCR

superfamiIy. GPR23, GPRZ-C, and G P R X

1.6 Nucleotidic Receptors and the Uridine Nucleotide Receptor

From the large family of GPCRs, our laboratory is interested in neuropeptide

recepton. in particular those that are potentially involved in the development of drug

addictions. For this reason, we have specifically sought to identiQ novel members

belonging to the opioid and related somatostatin classes of GPCRs in hopes of

characterizing them and studying their contribution to neurobiological function. Our

cloning of a nucleotidic receptor. the uridine nucleotide receptor (IMR), has directed our

efforts to discover recepton of this type as well. As the receptors encoded by GPR23 and

GPR2-I are related to the nucleotidic and somatostatin GPCRs, respectively. the present

section and the next will present relevant background to these receptors which wiÇ1 be

further developed in the Discussion.

Nucleotidic receptors, also known as PZY receptors, bind extracellular ATP. ADP.

UTP, (or analogues with varying afinity). By acting as intercellular messengers. these

nucleotides activate P2Y receptors. thereby exerting widespread influence on numerous

physiological processes. They include endothelium-platelet ce11 function. chloride

secretion in lung epithelia, smooth muscle relaxation. metabolic function in hepatocytes.

and even neural transmission (reviewed in Boarder et al.. 1995). Five unique P2Y

subtypes have now been cloned fiom 5 different species, and several more have been

predicted based on a search of the EST database (Webb et al.. 1996). One of these. the

UNR or P?Y,. was cloned in our laboratory using a PCR-based approach (Nguyen et a!..

1995). P2Y receptors display significant homology to one another (sharing greater than

30% and up to 50% arnino acid identity) while showing low arnino acid identity (27% or

less) with any other members of the GPCR superfamily (Bumstock 1995). Furthemore.

the sequence motif LFLTCIS in the third TM domain found only in PZY receptors has

become a signature for this GPCR class. Each subtype binds nucleotides with varying

affinity and a different rank order of agonist potency. The LJNR is the only subtype

which binds UTP preferentially. but not ATP. This unique property has sparked our

interest in searching for further subtypes of UNR. Upon agonist-induced activation, P2Y

receptors can affect a number of different second messenger systems, including

phospholipases. PLC, and AC, and commonly leads to ~ a ' + mobilization from

intracellular stores. In fact, rneasuring the rnobilization of ca2' is one of two rnethods

used in the identification of P2Y receptors. The second method is not a fimctional assay.

but instead mesures binding of radiolabeled ATP. Recently. the use of this latter method

has been deemed insuficient if used as the only evidence for identification of P2Y

subtypes: NO receptors previously included in the P2Y class. the P2Y5 (Webb et al..

1996). and P2Y7 (Akbar et al.. 1996) have been shown not to be bonafide P2Y receptors

(Li et al.. 1997; Yokornizo et al., 1997). The incorrect identification of these receptors

has important implications in the analysis of GPR23, which has been lefi to be described

in the Discussion.

1.7 The Somatostatin Receptor Family

Physiotogical firnction of somatostatin

Somatostatin peptides are widely distributed in central and peripheral tissues.

participating in nurnerous and diverse physiological processes. i~icluding the regulation of

GH and TSH secretion from the p i tu i tq and the inhibition of secretion of

gastrointestinal and pancreatic hormones and enzymes (Schusdziarra 1992) Besides

being able to inhibit virtually every known endocrine and exocrine secretion. they have

anti-proliferative effects both in vitro and in vivo (Lambens et al., 199 1 ). In the brain.

they have been reported to act as neurotransrnitters and neuromodulators to regulate

neuronal firing (Ikeda et al.. 1989; Shaprio et al.. 1993: Meriney et al., 1994; Wang et al..

1990) and to modulate complex behaviors such as locomotor activity and cognition.

Chemical-induced depletion of somatostatin in rat brain ha been s h o w to affect

behavior, learning. memory and brain neurochemisûy (Haroutmian et al.. 1987: DeNoble

et al., 1989; Priestley 1992; Raynor et al.. 1993). There are two biologically active

somatostatin peptides. synthesized fiom a comrnon precursor (preprosomatostatin) that is

differentially processed to generate tissue-specific arnounts of the tetradecapeptide SST-

14 and the N-terminally extended SST-28.

:MoleclrZar cloning of the somatostatin (sst) receptors

The effects of somatostatin are mediated by GPCRs that have high affhity for both

major peptide products of somatostatin gene expression. They were cloned using various

strategies (reviewed in Patel et al., 1992), and revealed a greater genetic diversity in this

receptor family than previously predicted. Five subtypes to date have been identified.

nurnbered sst, thni sst5, al1 similar in amino acid Iength (336-391 amino acids).

Comparative sequence analysis reveals a significant degree of conservation in structure

across sst subtypes as compared to other GPCR. Overali there is 3937% amino acid

identity arnong the five subtypes. In the putative TM domains, the homology increases to

5570%. The closest related GPCR class. the opioid receptors, exhibit approximately

30% sequence identity.

The ability of al1 sst subtypes to bind both peptides has prompted numerous

investigations to determine which residues are cntical for binding. Certainly. amino acid

residues that are conserved in the TM regions across the subtypes would be obvious

candidates as they are implicated in the formation of the ligand binding pocket. Detailed

molecular modeling and site-directed mutagenesis studies have identified a number of

key residues believed to be required for specific interaction with SST-14 and SST-38.

n i e specifics of these studies have been lefi for the Discussion.

1.8 Research Objective

The present research attempted to take advantage of the EST sequencing project to

discover and characterize human genes encoding for GPCRs. particularly those related to

genes previously isolated in o u iaboratory, and those involved in neurobiological

function. The identification of novel GPCRs will M e r our understanding of ce11

signalling systems and may potentially identiQ as yet undiscovered receptor systems.

2.0 METHODS

2.1 Ovewiew of Methods

Only the specific methods used in the discovery and characterimion of GPCR genes

GPR23, GPR2.I. and GPRZj are descnbed in this section. They may aiso be found in

several reports (see Publications. page v). Standard techniques for preparation.

subcloning, transformation. sequencing, and radiolabeling of DNA. as well as protocols

for genomic library screenir~g and Southem blotting were employed as previously

reported (Marchese et al.. 1994), and are not detailed here.

Procedures for Northern blot and in situ hybndization were performed by Ms. Regina

Cheng of our laboratory. or Dr. Frank Kolakowski. FIuorescence in situ hybridization

was carried out by Dr. Henry Heng of SeeDNA Biotech Inc. These methods are only

briefly summarized be1ow.

2.2 Cloning and Ctiaracterization of GPR23

(a) PCR of human genomic DNA

One of the overall objectives of Our group has been to search for novel opioid or

peptide-binding receptors by employing a sequence homology-based PCR approach.

Two degenerate oligonucleotides (synthesized by the Biotechnology Service Centre.

University of Toronto) were designed based on conserved regions of opioid and

somatostatin receptors, a 5' primer and a 3' primer, and used to ampli@ human genomic

DNA by PCR. Different pairs were designed to ampli@ different populations of gene

fragments. PCR products were subcloned into Bluescript SK-, sequenced, and the

sequence anaiyzed. One of these pairs was designed on TM2 (OLIGO 966: 5'-TGGGA

HHSTGGCCVTTYGG; H =A.CorT, S = C or G, V = A , C.orG, Y = C orT; N.B. the

OLIGO nurnber is according to the numbering system of the biotechnology service) and

TM3 (OLIGO 1320: 5'-AATGTAGCGGTCSRCRCTCAT; R = A or G). To a sterile

PCR tube were added 33 pl sterile ddH20. 5 pl dimethylsulfoxide. 5 pL of a mixture

containing the four deoxynucleotides dATP. dCTP, dGTP, and dTTP (each at a 10 mM

each). 5 pl of 10X one-phor-al1 buffer, 1 pl of each primer (1 pg), and 1 pl of template

human pnomic DNA (1 pg/pL). The tube was heated in the PCR machine (Perkin-

Elmer Cetus Thermal Cycler) at 94°C for 5 minutes before removing and letting sir at

room temperature for 2 minutes. 1 pL of Pfu DNA polymerase (2.5 U) was added before

overlaying with sterilized nujol mineral oil and placed into the PCR machine. A preset

program was run using the following conditions: denaturation at 94OC for 2 minutes.

annealing at 50°C for 1 minute. and extension at 72°C for 2.5 minutes for 30 cycles.

followed by a 7 minute fnal extension at 72°C. The 50°C annealing temperature was

used as this temperature allows the pnmers to anneal with relatively high specificity to

complementary sequences of the template DNA. 10 pL of the reaction was

electrophoresed on a 0.5% low-melt agarose gel and a band of the appropriate size (-1 00

bp) was subcloned into Bluescnpt SK-. Samples were sequenced using a

T7SequencingTM kit (Pharrnacia) in accordance to the included protocol with minor

modifications. The sarnples were electrophoresed on an 8% polyacrylamide gel and

exposed on a sheet of Kodak-X-OMAT film to produce an autoradiograph.

fi) Cornputer analysis of sequenced fragments and database searching

The DNA sequence of f'ragments was translated into a six phase amino acid translation

and manually compared with our own GPCR database. Sequences that appeared to

partially encode novel receptors were used to query the Genbank database using the

BLASTN algorithm. One sequence. clone #7. was quened in this manner and found to be

identical to R12 (GenBank Acc. No.: U33447), a previously cloned gene encoding an

orphan GPCR (Raport et al.. 1996). In addition. the isolated clone also shared high

identity to an EST cDNA sequence (ID: 51646, 1.8 kb) that partially encoded a novel

GPCR tnincated in the putative T M2 domain.

fc) Genomic library screening and sequencing of the coding region

This EST cDNA was requested form the 1.MA.G.E. Consortium (Lennon et al.. 1996).

radiolabeled with [ a - 3 ' ~ ] d ~ ~ ~ by nick translation and used to screen a bacteriophage À

EMBL-3 T7/SP6 human genomic iibrary (Clontech). Previousl y. this 1 ibrary has been

used by our laboratory to successfully isolate many phage clones containing GPCR

genes. including the genes encoding the dopamine Dl (Sunahara et al., 1990). D,

(Sunahara et al.. 199 1). and serotonin 5-FITlB (Jin et al., 1992) receptors. Positive phage

clones were plaque purified and DNA was prepared. This was followed by restriction

endonuclease digestion and southem blot analysis using the same probe used to screen

the library. A fragment was isolated. containing the coding region of the GPCR gene.

called GPR23. subcloned into Bluescript SK- plasmid for sequencing and other

manipulations. To insure the accuracy of the sequencing, both coding and non-coding

DNA strands were sequenced.

(d) Northern bZot onalysis of GPR23

Northern blot analysis was performed using rnRNAs from various human tissues to

determine the tissue expression of GPRt3. Human rnRNAs fiom liver. thalamus.

putamen. caudate. frontal cortex. pons. hypothalamus. and hippocampus were extracted

as described (Marchese et al.. 1994). The tissues were purchased fiom The Canadian

Brain Tissue Bank (The Clarke Institute of Psychiatry, Toronto). The post mortem

interval for the tissues did not exceed 48 hours. Tissues were stored at -80°C. Briefly.

total RNA was extracted by the method of Chomczynski and Sacchi (1 987). and p o l y ( ~ ) *

RNA was isolated using oligo-dT cellulose spin columns (Pharmacia). RNA w s

denatured and size fractionated on a 1 % formaldehyde agarose gel. transferred ont0 nylon

membrane and imrnobilized by W irradiation. The biots were hybridized with a [.''PI-

labeled DNA probe. washed with 2X SSPE (SSPE contains 3M sodium chloride. 0.2 M

sodium hypophosphate. and 0.02 M EDTA. pH 7.4) and 0.1% SDS at 50°C for 20

minutes and with O. 1 X SSPE and 0.1% SDS at 50°C for 7 hr and exposed to X-ray film at

-70°C in the presence of an intensi&ing screen for at least one week. The probe was the

same as that used to screen the library.

2.3 Cloning and Characterization o f GPR24

(a) dbEST searching and analysis

dbEST searching was performed by Dr. Lee Kolakowski ro identiQ EST fragments

encoding novel GPCR, and is bnefly described here with references to other sources. We

queried the dbEST maintained by the NCBI on the Intemet with the complete arnino acid

sequence of GPCRs, such as the a-adrenoceptor, using the TBLASTN algorithrn

(Altschul et al., 1 990). EST sequences that were returned having statistically significant

scores were exarnined M e r . The concepnialized amino acid sequences of the EST

sequences were used to query (Pearson et al., 1988: Pearson 1995) our GPCR database

using the FASTA algorithm to determine whether the EST cDNAs represented known

GPCRs (Kolakowski 1994). The amino acid sequences thus filtered were used to que-

the Swiss Prot (release 3 l ) database using the FastA algorithm (BLOSSOM 50 matrix.

h p - 1 ) (Pearson et al.. 1988; Pearson 1993). The sequence of one EST (cloneID: c-

IzflO; GenBank Acc. No.: F07228) that met these criteria was used for further

investigation.

(61 Making a radiolabeied probe from EST sequence

As the EST fragment identified fiom the cornputerized database searches was

unavailable fiom the I.M.A.G.E. consortium. human genomic DNA was amplified using

PCR (similarly described in 2.2) using a set of specific oligonucleotides designed based

on the EST cDNA sequence (P 1 : 5'-CGGAATTCCTGGGCATCATCGGGAACTCCL4

CG; P2: 5'-CGT CTAGACAGGAGGCAGATCACCAGGGTGGC). Each primer

contained a self-inserted restriction enzyme recognition sequence (EcoRI for PI and daal

for P2) to facilitate subcloning. The PCR conditions were as follows: denaturation at

94°C for 1 minute, annealing at 55°C for 2 minutes and extension at 72°C for 2 minutes

for 30 cycles. followed by a 7 minute extension at 72OC. The resultant PCR products

were subcloned in Bluescript SK- plasmid. Colonies were selected. plasmid DNA was

purified. and the inserts sequenced. An insert identical in overlapping sequence with the

EST cDNA was successfi.xlly isolated.

/cl lsoIation of GPR21 and sequencing

The PCR-generated fiagrnent was radiolabeled with [ C Z - ~ ~ P I ~ C T P by nick translation.

used to screen the sarne human genomic library used to isolate GPR73. and a fragment

containing the gene, GPRZ4. was isolated and subcloned into Bluescript SK- plasmid for

sequencing as descnbed for GPR23 (section 2.2).

fd) Abrtbern blot analysis of human fissues

Northern blot of RNA isolated from severai human tissues was performed as described

for GPR-73 (section 2.2), except that the blots were hybridized with a 855 bp ["PI-labeled

fragment of the coding region of GPR2-I that was obtained from a Pst1 digestion. Central

and peripherai tissues were used: human Frontal cortex. basal forebrain. hippocampus.

substantia nigra. corpus callosum. caudate-putamen, hypothalamus. midbrain. arnygdala

subthalamus. thalamus. liver. heart. pancreas. kidney. muscle, lung, and placenta.

(e) PCR amplification ofrat orthologue of GPR24

To obtain more specific information about the tissue expression. we searched for a rat

orthologue of GPR2-i in order to perform northem blot analysis of RNA from rat tissues

and in situ hybridization of rat b r in slices. Rat genomic DNA was PCR-amplified (as

described in section 2.2) using degenerate oligonucleotides designed based on the

sequence encoding putative TM3 (OLIGO 1430: Y-CTGACCGYCATGRSCATTGACS

GCTAC; Y = C or T, R = A or G, S = C or G) and TM7 (OLIGO 1429: 5'-GGGGTTG

RSGCAGCTGTTGGCRTA) of the receptor encoded by GPR2-I and somatostatin

receptors. The PCR conditions were as foIlows: denaturation at 95°C for I minute,

annealing at 5j°C for 1 minute and extension at 72°C for 2.5 minutes for 30 cycles,

followed by a 7 minute extension at 7 2 T . The resultant PCR products were subcloned

and sequenced as described in previous sections. and the rat orthologue obtained.

~ Norrhern blot analysis of rar rissues

The rat orthologue PCR fragment (-500 bp) was radiolabeled by nick translation and

used to probe a blot prepared as descnbed for northem blot analysis for human tissues

(section 2.2) except that RNA was extracted from rat tissues. Central tissues were from

whole brain. frontal cortex, striatum. cortex. thalamus, pons, and cerebellum. Penpheral

tissues included liver, kidney, ovarv, fetus, neonate and hem.

(a in situ hybridization

The sarne rat orthologue PCR fragment was radiolabeled and used as a probe for in

situ hybridization of rat brain sections. Preparation of rat brain sections and in sitir

hybndization procedures were performed by Regina Cheng. and a briefly descnbed

protocol is uanscribed for the most part from a recent report fiom our laboratory

(O'Dowd et al.. 1996).

Male rats (Charles River. -200-500g) were killed by decapitation and brains removed

in 30 seconds and fiozen in crushed dry ice. Frozen brains were sectioned at 14 Fm

thickness on a Reichert-Jung cryostat at -20°C and thaw-mounted onto microscope slides.

Sections were fixed in fieshly prepared 4% pdormaldehyde in 0.02% DEPC water for

20 minutes at 4OC in an ice bath and then washed for 5 minutes in cold phosphate-

buffered saline, pH 7.4 before dehydration in an alcohol series. Fixed sections were

stored at -70°C until use.

The PCR-derived rat orthologue of GPR24 was labeled by random priming using

[)'s]~cTP. Rat brain sections were prehybridized for 2 hours in buffer containing 50%

deionized formamide. 0.6 M sodium chioride. 10 m M Tris-HCl. pH 7.5. 10% dextran

sulfate. 1% polyvinyl pyrrolidone, 2% SDS. 100 mM dithiothreitol. 200 p@ml hemng

sperm DNA. and hybridized with the labeled probe (106 cpm/slice) for 16 hours. and

washed in conditions of increasing temperature and decreasing ionic strength. The

hybridized sections were dehydrated in a graded alcohol senes and were esposed to X-ray

film (Dupont MW-34) for 4 weeks at -70°C and developed. For use as controls. adjacent

sections were hybridized following treatment with RNase. to confirm the specificity of

hybridization.

(h) Receptor expression and function

As the putative arnino acid sequence of the receptor encoded by GPR2.I shared

significant amino acid identity to the somatostatin farnily of receptors, an entire coding

region was inserted into the expression vector pcDNA3. Two different constmcts rvere

subcloned in pcDNA3: the first was a 1.6 kb Sad fragment containing -400 bp 5'

untranslated region (UTR) which contained a (CA), tandem repeat sequence upstrearn of

the start codon: the second construct was produced from a SmoI digest of the construct in

Bluescript SK- plasmid with a reduced YUTR (67 bp) and the CA repeat sequence

eliminated. Transient expression of both constructs was perfomed in Cos-7 cells using a

calcium phosphate transfection system according to the protocol included and is not

reiterated here. Ce11 culture. membrane preparation and radioligand binding studies were

adapted as descnbed in Zastawny et al., 1994.

Bnefly, Cos-7 cells were grown as monolayers in a Minimum Essential Medium witb

10% fetai bovine s e m in an atmosphere of 5% CO2 at 37°C. The membranes were

prepared at 4°C 48 hours post-transfection and when the cells had been g r o w to apparent

confluency. The cells were first washed in 10 ml of ice-cold phosphate buffered saline

before scraping off with a rubber policeman in 2 ml of phosphate buffered saline. Cells

were pelleted by spinning at 100 x g at 4OC for 10 minutes before Iysing in hypotonic

binding buffer pypotonic binding buffer contains 5 mM Tris-HCI. pH 7.8. 0.5 mEii

magnesium chioride, 0.1 rnM EGTA containing protease inhibitors (1 0 p g h l

b e r n i d i n e , 5 pgml leupeptin and 5 &ml soybean trypsin inhibitor)] and using a

Polytron homogenizer (Brinkman Instruments. Westbury, New York) twice for 30

seconds each at the 5.5 setting. The lysate was spun at 100 x g at 4OC for 10 minutes. the

supematant collected before spinning at 30.000 x g at 4°C for 30 minutes to pellet the

membrane fraction. The supematant was decanted. the pellet washed once with

hypotonic binding buffer. before spinning again at 30.000 x g at 4°C for 10 minutes. The

supematant was decanted. and the pellet was resuspended in 1 ml of binding buffer

(binding buffer contains 50 rnM Tris-HC1. pH 7.8. 5 mM MgClZ. 1 mM EGTA and

protease inhibitors as the hypotonic binding buffer). Protein concentration was

determined using the Bradford assay (1 976).

For saturation experiments, cell membranes (50 pg protein) were incubated with

increasing concentrations of ligand in a total volume of 1 ml for 2 hours before being

rapidly filtered through a 48-well ce11 harvester (Brandel. Montreai. Canada) ont0 0.5%

polyethylenimine presoaked GFK Wlatman filters (Clifion) and washed twice with 5 ml

of ice-cold 50 mM Tris-HC1. pH 7.4 bufTer. The ligands screened, using a range of

concentrations, were [125~]-~yr'-somatos~tin-14. ['HI-naloxone. [3~]-brernazocine. ['HI-

DTG. and ['Hl-haloperidol. Bindinp was rneasured using a Beckman LS6500 liquid

scintillation counter. Specific binding was determined by subtracting the amount of

binding in the presence of an antagonist from the amount of binding in its absence. The

antagonist used for [125~]-~yr1-somatostatin- 14 was ~~r ' - somatos~a t in - 14. naloxone for

['HI-naloxone and [3~]-brernazocine, and PPP for ['HI-DTG and [3~]-haloperido~. Cos-

7 cells were transfected with carrier DNA to serve as a control.

(i) Lhucleotide repeat analysis

Upon the discovery of a dinucleotide repeat sequence of the form (CA), in the YUTR.

genomic DNA fiom 10 different human individuals was amplified using oligonucleotides

flanking the repeat sequence (OLIGO 1355 Y-ACACTCAGGGCTACACATAGG-3':

OLIGO 1354 5'-TTCACTGTTGCTAATCTTGTC-3'). The resultant PCR products

were subcloned and sequenced to analyze for intenndividual differences in the length of

this repeat sequence.

2.1 Cloning and Characterization of GPR25

(a) PCR amplification of genomic DXA

The isolation of GPR2-I prompted us to perform a search for reiated receptor genes

employing a sequence homology-based PCR approach. Human genomic DNA was

arnplified by PCR using degenerate oligonucleotides designed based on the sequences

encoding TM regions TM3 (OLIGO 1430: 5'-CTGACCGYCATGRSCATTGACSGCT

AC; Y = C or T, R = A or G. S = C or G) and TM7 (OLIGO 1429: 5'-GGGGTTGRSGC

AGCTGTTGGCRTA) of somatostatin receptors and the receptor encoded by the

somatostatin-related gene. GPRZ-I. The PCR conditions were as follows: denaturation at

9j°C for 1 minute, anneding at either %OC, 4j°C, or 38OC for 1 minute and extension at

72°C for 2.5 minutes for 30 cycles. followed by a 7 minute extension at 72OC. The

resultant PCR products were subcloned into Bluescnpt SK- plasmid and sequenced as

described for GPR23 (section 7.3). One of these products, clone #37. when translated to

its amino acid sequence. exhibited sequence motifs consistent with a GPCR receptor.

f i) Isolation of GPR2j and sequencing

Clone #37 in Bluescript SK- plasmid was restriction endonuclease digested with

B m H I and XhoI to generate a DNA fragment (-500 bp) and radiolabeled with [''PI~CTP

by nick translation. The probe was used to screen the same human genomic library used

to isolate GPR23 and GPR2-I. and a Fragment containing the gene. GPRZj. was isolated

and subcloned into Bluescript SK- plasmid for sequencing as described for GPR23

(section 2.2).

(c) Northern blot analysis of hurnan tissues

Nonhem blot of RNA isolated fiom several human tissues was performed as described

for GPR23 (section 2.2), except that the blots were hybridized with the same radiolabeled

probe used to screen the library.

2.5 Chromosomal Localization of GPR23, GPR24, and GPR2S

Fluorescence in sifu hybridization ( F I S H ) analysis of human metaphase spread

chromosomes was used to identi@ the specific chromosomal localization of the three

novel genes. The method for FISH was performed by Dr. Henry Heng fiom SeeDNA

Biotech Inc. and was performed according to Heng et al. (1991) and Heng and Tsui

(1 9933. A brief surnmary of the protocol authored by Dr. Heng is transcribed here. The

first step was to prepare chromosomal slides for probing. Lymphocytes isolated from

human blood were cultured in a minimal essential medium supplemented with 10% fetal

calf serum and phytohemagglutinin at 37OC for 68-72 hours. The lymphocyte cultures

were treated with BrdU (0.18 mg/ml Sigma) to synchronize the ce11 population. The

synchronized cells were washed 3 times with serum-fiee medium to release the block and

recultured at 37°C for 6 hours in a minimal essential medium with thymidine (2.5 &nl:

Sigma). Cells were harvested and the slides were made by using standard procedures

including hypotonic treatment, fixing and air-drying. The slides were baked at 55°C for 1

hour. After m a s e treatment, the slides were denatured in 70% formamide in 2X SSC at

70°C for 2 minutes followed by dehydration with ethanoI. Biotinylated phages

containing either GPR73. GPR24, GPRZj were used as probes for FISH mapping.

Probes were denatured at 75OC for 5 minutes in a hybridization mix consisting of 50%

formamide and 10% dextran sulphate and human cot 1 DNA. Probes were loacied on the

denatured chromosomal slides afier incubation at 37°C for 15 minutes to reduce

interference by repetitive sequences. After hybridization overnight. the slides were

washed and detected as well as arnplified. FISH signals and the DAPI banding pattern

were recorded separately by taking photographs, and the assignment of the FISH

mapping data with chromosomal bands was achieved by superimposing FISH signal with

DAPI banded chromosomes.

3.0 RESULTS

3.1 Overview of Results

Several meihodologies were utilized in the cloning of the three hurnan GPCR genes

reported in this thesis. Each encoded receptor shared greatest sequence homology to a

separate class of the GPCR family. and this determined the type of characterization

subsequently performed. Thus, the cloning of each gene and its partial charactenzation is

presented in separate sections. and in chronological order. The GPR nomenclature used

(i.e. GPR23. GPRZ-I, GPR25) is in accordance to the scheme developed by our laboratory

with Dr. Phylis McAlpine (The Genome Database: htip://gdbwvw.gdb.org/ gdb) to

provide a spstem that would have each orphan receptor gene known under a single name.

3.2 Isolation and Characterization of GPR23

(a) CZoning of GPRZ3

From the large family of GPCRs. our group has a specific interest in opioid and

peptide-binding receptor genes. We have sought to identiQ novel opioid receptor genes.

with a particular interest in those involved in the acquisition of addictive behavion.

Initially based on the sequence encoding the 6-opioid receptor (Evans et al.. 1992) and

the somatostatin receptors. we have ernployed a sequence homology-based PCR

approach, in which degenerate oiigonucleotides together with human genomic DNA is

used to amplie GPCR genes of similar primary sequence. In one of these ongoing

experiments. degenerate oligonucleotides were designed based on opioid receptor

sequences following TMZ, and TM3, as described (see Methods 2.2). (TM domains 2.3,

6. and 7 are comrnoniy chosen because of the high sequence conservation in these regions

between subtypes). PCR of human genornic DNA with these oligonucleotides resulted in

nurnerous DNA fragments, mostly encoding previously cloned GPCRs (see Table 3.1 ).

] Nociceptin 85 1

( Non-GPCR encoding fragments 1 1

1 I

1 p-opioid SSTR2

( Total

13 1

Table 3.1 Classification of PCR products. GPCR genes amplified fiom hurnan genomic DNA by PCR using primers OLIGO 966 and OLIGO 1320 (see Methods 2.2).

Identification of fragments was perfomed by analyzing the DNA sequence. translating

the nucleotide into amino acid sequence using the StriderT" DNA analysis program. and

then manually cornparing the protein sequence to our own database of GPCRs.

Fragments that were not identical to any known GPCR but exhibited conserved sequence

motifs of GPCRs were used to query GenBank; using the BLASTN and BLASTP

algorithm (Altschul et al.. 1990), fnements were searched against al1 published GPCR

genes. One of the fragments thus generated, narned clone 7 (approximately 100 bp in

length) was found to be 100% identical to the previously cloned orphan R l 2 receptor

gene (Raport et al., 1 995). However, the GenBank search results also revealed that clone

7 shared high identity to a deposited sequence (480 bp) of an 1.8 kb EST cDNA

(Accession no.: H20663). This EST sequence was translated to its putative amino acid

sequence using StriderTM and manually analyzed and found to pariially encode a GPCR

encompassing TM2 to intracellular loop 3. The nucleotide sequence was used to query

the Genbank databases and the results indicated that this partial sequence encoded a novel

GPCR related to the genes encoding the nucleotidic P2Y receptors. At the time of this

observation, our laboratory had published a report on the cioning of the uridine nucleotide

receptor (UNR) gene (Nguyen et al.. 1996), a mernber of this farnily. As we were

interested in identiQing subtypes of the LNX receptor. we proceeded to isolate the full-

length coding region.

The EST cDNA kvas requested and subsequently obtained from the I.M.A.G.E.

Consortium, an organization that distributes publicly available EST cDNAs. The 1.8 kb

EST cDNA was found to oniy partially encode a GPCR. truncated upstrearn of the

putative TM2 domain. A human genomic library was screened with the radiolabeled

fiagment to obtain the full-length open reading f k n e (ORF). Five positive phage clones

were isolated, plaque purifîed and DNA was prepared. This was followed by restriction

endonuclease digestion and Southern blot analysis. A 4.5-kb Sac1 fragment. appearing in

2 of the phage clones (results not shown). was isolated and subcloned into the Bluescript

SK- plasmid. and sequenced. The Sac1 fragment was found to contain identical

overlapping sequence to the EST cDNA. This genomic clone was named GPR23. its

sequence recorded, and translated into its putative amino acid sequence using StriderTM.

GPR23 contained an intronless ORF of 1 1 10 bp encoding for a putative GPCR protein of

370 amino acids (Figure 3.1). The ORF was established by sequencing upstrearn and in-

frarne from TM1 and examining codons that encoded methionine residues that matched

with the Kozak consensus sequence (Kozak 1987). Only methionine residues that were

downstrearn from the fint in-frarne stop codon found were considered. Although none of

:le ':iI .:sc .;s~ Le: ?ke Lys y?: .a: Le-; .%T. ;lj K a ':dl - j r Ser V a l V a l Pht I h : l --- --- -. - --- --- -a,- ;-;& ...- . .- -mm .-.. J . . ICI. JA- ..- .A. .M- - - - ..? ;s2T ;c7 --F -. - .-- --- --- --- - - - - c : Ji.. .S- .-.ch 3 . . 3 - n -.- .-.-r - - -

Leu P r o P h e 1.1.2 :Ir 2P.e Yyr .b: --. -+- --- . . .-. ..-- ..-- ?ke .LA: .L-z 3 ~ 2 y : ~ ;:: ;ke il.; . G F 7:: Le: :y: ::: --- . ..-. - - . . . . . - -. .-.. .-. . . . ..-A- .=AC TTC .G-C I X 1.;; 72; Y:: -TT 1: f.::: XCZ :TC T:C ?

b b

Ile Ser V a l .:5~ .;=a ?fie Lc.: A;., :Le -;il :yr ;r: ?kt A:': Jer A:: 2: :le . k 3 Ykr ::l .-- - .- --.- -.* --"I --- --- --- .-- --- - r i --- --- -.-. -- --- . +* .-- .--- . -- , i , .-.. . .-.i- 2 . -. >A-.- j. . - - - - 2 >L - n. . :. - .;r. .-. . . . . 2-7 . -. -u. .-.-. -.. . .-.a.: .-L. + .-

t lU4 .k:: .=..=: .br. :e: .il3 E l e Vaï Cya Ala G l y V a l Txp Lle Leu V a l Leu Ser G l y G l y Ile : - : . -,. . .- " -- +-- . -- .-,- --- -- --- ; ----- --- --- --- --+ .-- -a- -+- .-- = . : .-.'a.~ .-au .-a. . -. i ~ c . .%- . > - i . J - JL IU. . - . iu n, - . .n 3 . - - .i nu. au^ 2". .-.- - . -.

- . Sly Fhe Ile Iie Pro L e u T l e Leu Asn V a l Ser Cys Sar 2c.r -:31 ':a: Le; .=..=: Y?,= L e s -:- .-- --- .-- .-- --- --- --- *-- ..t -+- --.. - - - --- -^- --- --_ _-- - _. . .- --- - - IUU . . . .-. . . -7 . -- - - i .-, .-. - .-, - . J .a-- -1. - . - . - 2'- - + - . - . 2. J 2. ., - .4 .-.a'-. .Tc - - . * c - :

- . . . .. , . - . :- .-.-A -e,: , 1 - .=.:: Ce: ;lr. .=-:A :le :y.: .a: ::;s ?.+ le.: i-: .:.:s ??.e .=.:A L ~ Z Ile : -: -- - --- --- --- - - - --- .--.- ,<- ..a 3. > -.,L --- -- ;La: -TT .;c: .-: --- ..-- --- -. - .JL ... ..J >.-,-. x z ,TT ;:.=. K.; .;y: ; - =

ln7 !!et T y r Pro I le T h r Leu Cys Leu Rla Thr Leu Asn Cys Cys Phe Rsp Pro Phe Ile Tyr J :i --- -. - --. .-- . +I -.,. * -- - --- --. .-1 --- - . - -,-- --- --- -. - -+- -- - . - - -. - - - - .-. . .J . .-.,- --.-. .Y. - .-.- L . . J . JL . . . 2- .-.- . - . J .---.L . J . . 2 - . . . I-TL - - . . . - .-.. . . .-. - + : 2

Figure 3.1 Nucleotide and translated arnino acid sequence of gene GPR73. Nucleotides and amino acids are numbered on the right relative to their position From the first amino acid of the protein. The putative TM domains are labeled and shaded (TM1 -TM7). Putative sites for N-linked glycosylation (*). and phosphorylation by PKA (V) and PKC ( + ) are indicated above the corresponding arnino acid residue.

the sequence conformed absolutely to the Kozak consensus sequence. there was a stop

codon intempting the sequence and the first methionine downstream of it was accepted

as the start codon.

6) Anclysis of the amino acid sequence of the receptor encoded by GPR23

Hydropathy analysis of the amino acid sequence encoded by GPR23 demonstrated

the seven putative TM regions characteristic of GPCRs. Prim- amino acid sequence

analysis revealed amino acids that are found almost invariably or conservatively in the

analogous position across members of the GPCR superfamily. In addition. the encoded

receptor has four N-linked glycosylation consensus sites (Asn 15. Asn24. Asn.28. Asn 183)

and several consensus sites for phosphorylation (see Figure 3.1): Serl55 by protein

kinase A (PKA); Thrl48, TnrlSl, Thr230. Thr242, and Thr341 by protein kinase C

(PKC).

An amino acid cornparison of the receptor encoded by GPR73 with other functional

GPCRs revealed that it shared highest identity (58% overall. 66% in TM domains) with

the chicken P2Y5 receptor (Webb et al.. 1996) and the human LJNR receptor (28%

overall. 40% in TM domains). The encoded receptor also e.xhibited significant identity to

the receptor encoded in intron 17 of the retinoblastoma susceptibility gene (Toguchida et

al., 1993) and the R12 orphan receptor gene (Raport et al., 1995); 68% and 41%

respectively in TM domains (Figure 3.2). The significant hornology with rnembers of the

P2Y group of GPCRs prompted us to check for binding with various nucleotide ligands.

A 4.5 kb fragment encoding GPR23 was inserted into the expression vector pLXSN. and

the constmct was sent ta Dr. John T. Tumer (University of Missouri). The construct was

g E R G % r r r r r

- -

- œ x x o la a auai ( I I . . . .

used to infect human 1321Nl astrocytoma ce11 lines. To assay for receptor activity.

intracellular calcium flux was measured after the addition of various nucleotides (ATP.

UTP, ADP, or UDP). However, no calcium flux was detected in response to any of the

nucleotides (results not shown). As a positive control. the UNR gene was aiso expressed

and found to respond norrnally (results not shown).

/c) Northern blor analysis of human tissues

Tissue distribution for the expression of GPRt3 was examined by northem blot

analysis using ~oI~(A)-RNA isolated from several adult human brain regions and human

liver and probing with the sarne radiolabeled fragment used to screen the library.

Transcripts for GPR2.3 were not detected in the brain regions examined: thalamus.

putarnen, caudate. frontal cortex. pons, hypothalamus, or hippocarnpus.

fd) Chromosomal localization of GPR-73

FISH of hurnan metaphase spread chromosomes was used to identify the specific

chromosomal localization of GPR23. Biotinylated phage containing GPR-3 was used as

a probe for FISH mapping. Of 100 mitotic figures checked, a signal appeared on only

one chromosome 94% of the time, indicating a very high hybridization efficiency. DAPI-

binding patterns on the mitotic chromosomes were used to identify the specific

chromosomes to which the phage hybndized. For higher resolution. a s u m a r y from ten

photographs was taken in order to identi@ the specific region on the chromosome to

which each phage hybridized. No additional loci were detected by FISH analysis under

the conditions used. GPR23 was assigned to the sex-linked chromosome X, region q13-

q2 1.1 (Figure 3.3). LJNR is located nearby at q 1 3.

Figure 3 3 FISH analysis of GPR23. (A) Results of metaphase spread chromosomes probed with a phage clone encoding GPR.23. Arrows point to the FISH signals on a pair of chromosomes. (B) A summary of the FISH anaiysis; each dot represents the location of a fluorescent signal on the chromosome using phage GPR23 as a probe.

3.3 Isolation and Characterization of GPR24

ta) CZming of GPR2-l

In contrat to the cloning of GPR23. the discovery of GPR24 began with a deliberate

search of the GenBank EST database (dbEST) for GPCR-encoding sequences. .As stated.

our laboratory has been searching for novel genes that belong to the GPCR gene

superfamily. EST cDNA sequence generation and the creation of a publicly available

EST database prompted us to search the dbEST for the presence of GPCR-encoding

sequences. A customized search of the dbEST (Kolakowski 1994) renimed a nurnber of

interesting sequences. Some of these represented GPCRs described and published

previously. while others partially encoded novel receptors. One of these EST cDNA

clones was of interest as it partially encoded a receptor protein from TM1 and TM3

which shared significant homology to the opioid and somatostatin family of receptors.

As the EST cDNA was not available from the I.M.A.G.E. consortium. we proceeded to

clone a 350 bp genomic DNA fragment amplified from PCR using specific

oligonucleotides encompassing the published EST cDNA sequence. This fragment was

radiolabeled and used to screen a human genomic library to obtain the full-length ORF.

Eight positive phage clones were isolated, purified and DNA prepared. Following

restriction enzyme digestion and Southem blot analysis, a 1.6 kb Sac1 fragment from one

phage was isolated (results not shown). subcloned into Bluescript SK- plasmid, and

sequenced. StriderrM was used to record the nucleotide sequence and to translate it into

its putative arnino acid sequence. The fragment was found to contain identical

overlapping sequence to the EST cDNA. This genomic clone, GPR24, contained a full-

length intronless ORF of 1206 bp encoding for a protein of 402 amino acids (Figure 3 A).

The start methionine was identified as the methionine residue downstrearn ffom the first

in-fiame stop codon upstrearn from the putative TM1 domain. Also. approxirnately 80 bp

upstream of this start codon was discovered a (CA), tandem repeat sequence.

[b) AnaZysis of the amino acid sequence of the receptor encoded by GPR24

The translated amino acid sequence revealed the typical 7 TM topology. and

displayed arnino acids that are charactenstically conserved across members of the GPCR

family. No putative N-linked glycosylation sites were present. Numerous consensus sites

for phosphorylation were observed: Ser207 and Th304 by PKA; Ser200. Ser297. Ser295.

Thr300. Thr366. and Ser374 by PKC (Figure 3.4).

Using BLAST search. highest identity was observed with the somatostatin receptor

eene farnily (Figure 3.5). The receptor encoded by GPRZ4 shares -40% identity with the C

five sst subtypes in the putative TM domains (Table 3.2).

Table 3.2 Cdculation of TM amino acid identities. Per cent arnino acid identities in the putative TM domains of the protein encoded by GPR2-I with the five sst subtypes.

Significantly, an aspartic acid residue, Asp172, is present in TM3 that aligns with the

sornatostatin receptors. It has been demonstrated in other GPCRs that this residue in the

analogous position is important for receptor-ligand interaction (Strader et al., 1987:

Fraser et al.. 1989; Surran et al., 1994). The receptor encoded by GPR24 has other

----.-,.---.-.-----.-.-.--.... ..... .- . I.--Z--.-lii - --.AC a*. .-.--.--. - --.'dCI%-----.U~-- 2- ,-- ---. ---eV --^- __....- --?-.L . -CI . . .... 2. ' ..... .-- ---.-- ---- ..-- --+ ---- . ---. - . r ; ; :-- . - ------- - - -. . -- --- - --*-- - ---.- . - =ui-.-.. i---i.-.- :.-.-ri - - - - .. - ;J. z----.:.--- JiJV<:- --.-------. -.~~.?i--.-i.n~- 2 - i.2.. - - .; . . -

rys Leu Leu - - - . . . . . .

.. - -- : < =,.* - , . - . . & - . - - ........ :-. i - . - - - -- - --- - - - -. . . . . . . . . . . . . . . . . . . .li .. . . . . . . . .

iM3 Phe T h r Ser T h r Tyr Ile --- - -- - - - - -- --- ....-...... s L .v- . . .TL ..... - - . . - - - - - . .-- -?r .'-: Y?.: L.z

-+- - - - - - - . * . - . - - . - - - ..- - . . - . - - .-.- m 4

T r p Aia Leu Ser Phe Ile A.- .+- +- . --- - - - . . . . . . . . . . - . . . . . . .

. - . . . . . - .. - - - - : - - - - . - * . - . . - - * - ... . - - . . . . . - : - ! : - z A- : .::: ::,. y , : ; - , 1: - . - A - - - - . - - .--.. . - .=2p ?.: .=.:: . . . . . - - + --.- - - - .-* -.. .-- --. -... . . - - --- - - - ...a - - + .-- - - - - - - - - - . A -- -. - " -. - . . ::*-. :.,- :..A-- I . : ::_ .:_ :2_.-.-.-- ._. - 2 - A - . - . - ----. :.-.- .-.-* :.-.- . - - T2.E --; .;-: .:- F r - Ti: Le-; 7 : : ;Ir. :=.- Phe Leu Ala Phe EUa Leu P r o Phe Val Val I l e --- -. -. - . . . --TL- --. . - . -- - - - - - - - --- --- --- . - - --- -.- -4- --- --- --- --. - - - - . .- .. -.2 ..-.L -.-.a . . . . . . -. . :. ... :'-- - - I . - . - - . . . . . . . . . .

' - - -.- : ..-.: :K.: ::- :: r 17. ::.r .k:. Ald a d . . . . . . . . . . . . . - - - ..- --.- - - - --- .-- -- - --- - - - ..- . . - - - - - - - - " . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

* Z y s Leu hsn P r r Phe V a l T y r Ile Val Leu Cys - - - --- - - A A.. --- --- -- - - - - --- a-- . - - - - . 4 - . . . . . . . . . . . . :.; . ; y . . -... :-: . . . . > - ;--.a

- . _r . - - . : - -':Z F:: .=.i~ .:.ii ;-F. :::. 1::. 1:: .'-.:: .=.- 3 - - - - - . . . -..- ............... . . . . .- . . . . - . - . . . . . . . . . . - - . . .---. i . . . . . . . . . . . - . - . .

Thr Ala fle X a f l e t y s Leu 'fa1 - -. - - - - - - - - . , - + ,.-- --. .-. ,-.-A. 2 . - - .-.m. : .-... - 1 . . . . .

Figure 3.1 Nucleotide and translated arnino acid sequence of gene GPR24. Nucleotides and arnino acids are nurnbered on the right relative to their position from the first amino acid of the protein. The putative TM domains are labeled and shaded (TM 1 -TM7). Putative sites for phosphorylation by PIC4 (V) and PKC ( 4 ) are indicated above the corresponding amino acid residue. The dinucleotide repeat sequence in the 5' UTR is bolded and underlined.

GPR24 M L C P S K T D G S G H S G R I H Q E T H G E G K R D K I SOMATOSTATIN RECEPTOR 1 (sst,) SOMATOSTATIN RECEPTOR 2 (sstl) SOMATOSTATIN RECEPTOR 3 (ss~,) SOMATOSTATIN RECEPTOR 4 (ss~,) M S A P S T L P P G G E E G I . G T A W P S A A N A S ~ A P A E A E E A 35 SOMATOSTATIN RECEPTOR 5 (ss~,) M ~ P L F P A S T P S W N ~ S S P G A A S G G G D N R T 2s

I T RANSMEMBRANE 1 l I TRANSMEMBRANE 2 I

1 1

1 TRANSMEMBRANE 3 1

O P R ~ ~ ~ S P ~ R T G S I ~ Y I N I sstl C I N G T L S E G Q G S A I L ~ - S F I Y S ~ ~ ~ ~ ~ ~ ~ ~ ~ SS~, E I Q T E P Y Y D L T S N A V L - T F I Y F V

SSti ~ P S P A G L A V ~ G V L I . B L M Y L V S S ~ ' J A G P G O A R A A G M V A I - Q C I Y A L O O 1 s t ~ L V G P A P S A G A R A V L V . ~ V L Y L L V C A A

OPR24 @ sst, L V sstl OT S S ~ , R A sst, S A ssts G A

# Y L A V V

I ~ @ s ~ F G T ~ C L L I

I I L G N T L V I Y V I VV L L & N S L V I Y V ~ L R H T A S P S V T N -

C L V L G N A L V I F V I

L G N T L V I

j+":'yf P L R A A T Y R R

I TRANSMEMBRANE 5 I

I G N S T V I F A ~ V K K S K L H W C N N V P D I F I L R Y A i K T A T I - . - ~ ~ L [ A i ~ ~ ~ V [ L V T o T L L R H - [ ] L ~ R 1 3 1 I N L s ~ v D L L F L L G M P F M I

L R Y A K M K T I J N . - - I Y I L N L A I A D E L F

- - V Y I L N L A L A D E L L R Y A K M K T A T N - . . I Y L L N L A V A D E L F

Y V M L R F A K M K T V T N - - I Y ~ L N L A V A D V L Y

1 TRANSMMBRANE 4 1

H ~ L M G N G V H F E T M T t 6 6

L G L P F L A M Q V A L V H - P F U A 1 R I 1 6

L G L P f L A A O N A L s Y - P F S L M R I 1 7 L S V P F V A S S A A L R H - P F S V L R i 2 0

L G L P F C A T ~ N A A S F . P F P V L R M

I C L N L G T M A

S A A N L G

S A A

A P A - - -OQRS L K A - - - G W Q Q O I R V . . - G S S K R R V W A P ~ c Q R LRIA~. - . G W Q Q

U

V R V - - - G C V R

I @ L R R K H S R K K S

A I ~ I V M M V V S l V v v@v V L M V

V L V V

T D L 2M Q R W 219 GAW204

A AVV 202 A W 207

G L W 197

SSt, T S G Q E R P P S R V A S K E Q Q L L P Q E A S T G E K S S T M R i S V 1

s s t R I P L T R T T T F

Figure 3.5 Amiiio acid coiriparisoii of the Gl'H2J-eiicoded receptor witli nlated soniatostatiii (sst) receptors. Aiiiino ucids identical to the GPR2.I-encoded receptor are boxed aiid sliaded. 'I'he predicted seveii TM doiiiains are indicated. G a p (-) have beeii introduced to

P niax iiiiize the al ignnients aiiioiig the seqiiciiccs.

residues considered to form the ligand binding pocket of sst receptors. being important

for binding of SST-14 and SST-28 (Kaupmann et al.. 1995). narnely: Tyr23O. Phe766.

Trp3 18, Tyr322. and GW25. Unlike other sst receptors. however. the encoded receptor

has a relativeiy large amino terminus and a short cpoplasmic tail.

fc) Cornparison with rat orrhologue rGPR2-I

Using PCR with oligonucleotides based on the sequence encoding TM3 and TM7 of

the receptor encoded by GPR2-I. we isolated the rat orthoiogue sequence. The protein

sequence is highly conserved with only three amino acid differences (from 357) or 98%

conservation in the compared region between the human and rat (results not shown).

which indicates little evolutionary divergence for this gene. at least in mamrnals.

Id) Northern blot analysis of human and rat tissues

Northem blot andysis was used to detect expression of GPR2-I in a number of human

and rat tissues of both central and peripheral origin. For human blots. the same probe

used to screen the genomic library was used. For rat blots. the radiolabeled rat

onhologue was used. Before probing, the ethidium bromide-stained agarose gel indicated

equai and abundant arnounts of mRNA in each lane. A single 2.4 kb mRNA species for

GPR2.I (in order of decreasing abundance) was detected in hurnan frontal cortex.

hypothalamus, basal forebrain, midbrain, amygdala, hippocarnpus. subthalarnus.

substantia nigra, thalamus, corpus calIosum. liver and heart. while no signals were

detected in the caudate-putamen, pancreas, kidney, muscle, h g , or placenta (selected

regions s h o w in Figure 3.6A). Northem blot analysis of rat brain tissues showed

transcripts expressed in order of decreasing abundance) in frontal cortex. striatum. cortex.

% pl.

-3

Figure 3.6 Northern blot analyses of the brain distribution of GPR2-I mRNA. In (A) human. and (B) rat. The hurnan blot was probed with a fragment isolated fiom the coding region of GPRZ4 and the rat blot probed with the rat orthologue (rGPR2-I). Each lane contained 5 pg of PO~~(A)+RNA.

thalamus, and pons (Figure 3.68). while no hybndizing signais were detected in the

cerebellurn. Analysis of rat penpherai tissues revealed that GPR2.I is expressed (in order

of decreasing abundance) in kidney, ovaq, fetus. and heart (Figure 3.7).

fe) in situ hybridization of rat brain sections

To determine more precisely where G P R B is expressed in brain structures. in sitic

hybndization of coronal rat brain sections was performed with the rat orthologue as a

probe. The distribution of GPR24 was found to be discretely localized to rnany areas

(Figure 3.8A. B). In cerebral cortex. signal was present in the anterior cingulate. frontal.

piriform. and somatosensory areas. Dense labeling was present in the septohippocarnpal

nucleus. which rnay be a component of the primordial hippocampus. Very dense labeling

was detected in the olfactory tubercle. islands of Calleja. media1 nucleus accurnbens. the

dentate gyms and the hippocampal areas CA 1. CM. and CA3. mRNA was also detected

in moderate abundance in the lateral marnrnillary and tuberomarnrnillary nuclei.

arnygdaloid nuclei and the entorhinal area. Lesser amounts of G P R X mRNA were

visualized in claustrurn. substantia nigra pars compacta central grey. laterai geniculate

nucleus. subparafascicular nucleus of thalamus. caudate putamen and nucleus accurnbens.

fl Pharmacological characrerimion ofthe receptor encoded by GPR2-I

The significant amino acid identity observed with the five sst receptors (particularly

within the TM domains). together with the presence of key residues that form the putative

ligand-binding pocket, prompted radioligand binding studies with the expressed receptor

using ['25~]-~yr'-sornatostatin-14. Opioid ligands. [3~]-naloxone and [3~]-brernazocine,

as well as sigma ligands, ['HI-DTG. and SHI-haloperidol, were also assayed for binding.

Figure 3.7 Northern blot analysis of peripheral distribution of GPR2-l mRNA in rat. The rat orthologue was used to as a probe. Each lane contained 5 pg of p o l y ( ~ ) ' ~ ~ .

Figure 3.8 Darktield autoradioyrarns of coronal sections of rat brain showing the localization of GPRX miL".-\. Rrpresentative sections arc s h o w at levcls relatiw to bregma ai (-4 J -0.7 mm and ( B i -4.8 mm. xcording to the stercotactic coordinates (Pasino & Li-atson, 1983). Fr =

irontopnrictal cortex: Cg = anterior cingulatc cones: Shi = scptohippoçampai nucleus: Cpu cliudotr putamen: Acb = nucleus nccumbens: Tu = olfactop tubercle: PO = prima-- olhctor? cones: C N . C X . C.43 = ficlds of Amnon's horn: DG = dcntate gynis: SN = substaniia nigra. pars sompacra: PMCo = posreromedial cortical amygdaloid nucleus: I.hl = latrral mammillary nuc leus: . \hi = mygdalohippocarnpal area: Ent = cntorhinal cortex.

Two different constructs. both pcDNA3 recombinants. were transiently expressed in Cos-

7 mammalian cells; one contained the CA repeat sequence. while the second one did not.

No specific binding was observed with either construct with any of the ligands listed

(results not show) . To ensure that this result was a truc negative result. as opposed to a

methodoiogy problem. the human p-opioid receptor was also transiently expressed in

Cos-7 cells. Specific binding to ?HI-naloxone was observed (data not shoun). indicating

that the protocols used were carried out correctly.

(a CA repeaf analysis

Eighty base pairs upstream of the start codon is a repeat sequence of the form (CA),.

This is the first time a dinucleotide repeat has been found so close to the initiation codon

in any GPCR-encoding gene. To determine the variability in the length of this sequence.

DNA sarnples frorn 10 individuals were amplified by PCR using oligonucleotides

flanking the repeat sequence. The products were subcloned into Bluescript SI(- plasmid

and sequenced (exemplary sequences shown in Figure 3.9). Five ifidividuals had

homoqgous repeat sequences of n= 12. three individuals n= 10, one n=l 1. and one

individual was heterozygous with n=13 and 1 1. The fùnctional significance of this repeat

polymorphism or its close proximity to the transcriptional start site requires further

investigation. Interestingly, (CA), tandem repeat polymorphisms have been reported for

both sst, and sstz (Yamada et al., 1993). which bear high arnino acid identity to the

GPR2-l-encoded receptor. The observed variations will certain1 y facilitate linkage studies

of the respective chromosomes and help investigate the potential contribution of these

genes to human disease.

f i) Chromosomal localization of GPR24

FISH anaiysis of human metaphase chromosomes in combination with DAPI bandine

patterns was used to map GPR2-I to its chromosome (Figure 3.10A. B). Thehybridization

eficiency was approximately 93% (or 93 of 100 rnitotic figures checked) using the

biotinylated phage encoding GPR24 as a probe. The detailed position was determined

using a surnmary of 1 O photos. Since no additional loci were detected. GPR7-I is located

at human chromosome 22. region q 13.3. It is noteworthy that the closest related receptor.

sst,. is located nearby at q 13.1 (Yamada et al.. 1993).

3.4 Isolation and Characterization of GPR25

(ai CIoning of GPRZS

Following the discovery of the somatostatin-Iike gene GPRZ-I. a search for related

receptor genes was performed using a sequence homology-based PCR approach.

Degenerate oligonucleotides were designed based on TM3 and TM7 of the receptors

encoded by GPR7-I and the 5 sst genes. as these regions are highly conserved arnong

them. Using these primers. human genomic DNA was amplified by PCR at various

annealing temperatures to search for GPCR-encoding fragments. The PCR products of

the appropriate size (results not shown) were subcloned into Bluescript SK- plasmid. The

DNA fragments were sequenced and analyzed for homology with known GPCRs by

rnanual searching of our GPCR databases and searching the Genbank databases

(summarized in Table 3.3). The overall population of clones yielded suggested that the

~Iigonucleotides were not optimal. since not al1 the sst genes were arnplified. Two

fragments. clone 37 and clone 42. partially encoded two novel members of the GPCR

Figure 3.10 FISH analysis of GPR24. (A) Results of metaphase spread chromosomes probed with a phage clone encoding GPRt4. Arrows point to the FISH signals on a pair of chromosomes. (B) A sllmmary of the FISH andysis; each dot represents the location of a fluorescent signal on the chromosome using phage GPR24 as a probe.

family. Each fragment was radiolabeled and used to screen a hurnan genomic library to

obtain the full-length ORE Initial atternpts at screening using the clone 42 probe failed

while strong hybndizing simals were obtained using the clone 37 probe. Hence. the gene

Receptors 55°C 45°C 38°C

Clone 37 GPR2-I SSTR2 s s m SSTR4 SSTRS GPR 7 GPRll Bradykinin B2 Olfactory 17 Clone 42 Non-GPCR encoding fragments To ta1

Table 3.3 Classification of GPCR genes amplified. Products obtained from a search for eenes encoding for novel GPCRs related to GPR2-I. Human genomic D N A was C

amplified using PCR with OLIGO 1429 and OLIGO 1430 (Methods 2.4).

containing clone 37 was pursued first. (The pene containing of clone 42 was later

isolated and characterized as a human galanin receptor by other individuals in our

laboratory and is not discussed here). Six positive phage clones were plaque purified,

restriction endonuclease digested and analyzed by Southern blot (results not show). A 4

kb Pst1 fragment detected in two of the phage clones was subsequently isolated and found

to contain the full length ORF of the gene upon sequencing. The genomic clone. narned

GPR75. with overlapping sequence with clone 37. contains an intronless ORF of 1080

bp. and encodes a protein of 360 amino acids (Figure 3.1 1). The putative initiation codon

conforms to the Kozak consensus sequence and was also preceded bp an in-frarne stop

codon.

fb) Analysis of the omino acid sequence of the receptor encoded by GPRZj

Hydropathy analysis indicated the characteristic seven putative TM regions and

arnino acids conserved across members of the GPCR superfarnily were obsenTed. The

receptor protein contains no N-linked glycosylation consensus sites in the amino terminus

or in any of the extracellular loops. Cysteine residues found in the extracellular loops

(Cys 130. Cys 179 or Cys275) may participate in disulphide bond formation. Numerous

consensus sites for phosphorylation were observed: Ser241 and Ser333 by PKA: T h 1 5 1.

Ser225. Ser241. Ser3 12. and Th325 by PKC. Cys322 was found in the carboxyl tail in

an analogous position to other GPCRs that have been demonstrated to be palrnitoylated.

BLAST analysis showed the receptor encoded by GPR2.5 was related to the receptor

encoded by GPRI 5 (30% overall. 41% in TM domains; Heiber et al.. 1996). followed by

angiotensin II type 1 receptor (27% overall, 38% in TM domains: Funira et al.. 1992) and

sst, (33% overall, 34% in TM domains; Panetta et al.. 1994) (Figure 3.12). The identity

to the other sst receptors and the GPRZJ-encoded receptor is lower. The weak homology

to sst receptors and GPR24 suggests that the receptor encoded by GPR2S is not likely a

somatostatin-binding receptor.

:TL 2-2 y:;: ;.i :?r ',-ri: :y: :Le ir3 .:.:A LC y:;= Leu Ala M a Phe Ala Val Gly Leu --- _-- -.- _ ^ _ -. _ -...- -.- --,- --- --- --- -.r --r --- --- --r --C -. J --- _.-.i s-L 3 - - .-.- -Lr ~ C J - r L - .c: JLJ 2 ~ - . . - JL- ;Y2 ZGC Y 7 T m

Leu Gly mn Ala Phe Val Val T w Leu Leu Ala Gly Arg Arg ;:y ? : z .ire .izz les ;.dl --- --- ..- --- --- _-- --,- --- --.- --- --^ - - - -?- --- - - - --- --- - - - -Cr - - A - - J I ' J L .---.- J , - - - - - J . 3 2 - J - 4 - - - 2 - - 2 1.L- JUU -JU --1U JUL - -J --'U -4" - - 4 i i 3

T w R j c Phf Phe Val Leu Bis Leu Ala Ala Ala i4sp Leu Gfy Pha Val Leu T h r Leu Pro Leu ..- --- --+ --- --' -.- --' --- --. -- -'? --- --- --r --- --- ."< --r --- -..- .- - - . .. .- ..-- . - - 1 . i -.i ---.,- _ - 1 2 L . 2 2.- 2,- - :--*- - - 2 f'2L . - - - - - - - - .-.-- - . i --i -. f

ler Trp Leu Pr3 Fhe Ser M a Leu mg Ala V a l ?kz L::s Lc.: .:.:A Ar; Le': :;, .:.1-i Le.; - - - - - . -...- -,-- --- . - . . r : a a : --. - * - i:c :.:z :? 2 :;ç ::.: :- : ::y 3: :Y': :Yi :Y ï.x :.:; :Y :

= - - - - Le,; 2 : ; y . , ; L-2 L e - 2 :-si .:-'a A r ? --- r - . . L e , :fi- - - - --- - - - - - - --. --- --- - - y --:

. . . .. & - --3 -2,- -%- - - J - ;Cs <Y; :x :x :G< ::: .:.<z m

.Ua Phe Val Asn Se: Cys k l a Asn Pro Leu Ile Tyr Leu Leu Leu .-- --- _-- .. - - -- --- --- -. - -.-- --- .-- - - A --,- --- --- : - - - + :. - .%.- .-.V- - ;L 2L- .--TC --b- .. - n. - ..-.- -. - -. 2 - . >

.:.id .:.zz .:-Li Le- .&? .?La J:.; .A:: Tk: A Z Z leq: .:.LA --- .-- --- --- - - - --- - - - - - - --- --- --- --- --- --- -'. - 1 Z : i _ - 2 W.- 2'2U :C - . 3C >UV - J ' - .-.L.. : 11- . >'- - . J J L J

Figure 3.11 Nucleotide and translated arnino acid sequence of gene GPR2j. Nucleotides and arnino acids are numbered on the right relative to their position from the first arnino acid of the protein. The putative TM domains are labeled and shaded (TMI- TM7). Putative sites for phosphorylation by PKA (V) and PKC ( + ) are indicated above the corresponding amino acid residue. The putative site for palmitoylation is indicated also (O).

8 Z b S r r r r

1 I o m - a

(c) Northern blor analysis of human tissues

The same probe used to screen the genomic library was used to detect the expression

of GPR2j in hurnan tissues. Northem biot analysis of p o l y ( ~ ) * mRNA revealed no

expression of GPRZj in liver. or in the 12 brain regions examined: basal forebrain.

frontal cortex. thalamus, hypothalamus. arnygdala caudate. putamen. hippocampus.

midbrain. medulla cerebellum and pituitary (data not shown). Many of these tissues had

been analyzed using GPRl j as a probe and also found not to express this related receptor

(Heiber et al.. 1996).

fd) Chromosornai localizarion of GP R23

FISH of human metaphase spread chromosomes were used to identib the specific

chromosomal localization of GPR2j. The phage clone was biotinylated and used as a

probe for FISH mapping, and the analysis performed as described for GPR23 and

GPR7-I. GPRZS was assigned to human chromosome 1. region q32.l (Figure 3.13~4. B.

C) , in close proximity to other GPCR genes. adenosine Al receptor (Townsend-

Nicholson et al., 1995) at q32.l. and rnuscarinic 3 cholinergic receptor (Bonner et al..

1991) at q41-q4-4.

Figure 3.13 FISH andysis of GPRZS. In: (A) Results of metaphase spread chromosomes probed with a phage clone encoding GPR.25. Arrows point to the FISH signals on a pair of chromosomes. (B) The same mitotic chromosomes stained with DAPI to iden@ chromosome 1. (C) A su~llfnary of the FISH analysis; each dot represents the location of a fluorescent signal on the chromosome using phage GPR25 as a probe.

4.0 DISCUSSION

1.1 Surnrnary of Findings

Isolating and characterizing novel members of the GPCR superfmily are ongoing

objectives of our laboratory. To this end, we have employed strategies centered on PCR

and genomic library screening. However, with the advent of EST sequence generation

and the Human Genome Project. we have now incorporated searching the public EST

database as another powerfixl approach in identifying such genes.

During the course of my research work. three novel genes. GPR23. GPR74. and

G P R X encoding for previously unknown members of the GPCR superfamil- were

discovered. Their isolation was, in part, dependent on the establishment of the public

EST database. Both GPR23 and GPR21 were obtained by screening a human genomic

DNA library with a radiolabeled EST fragment generated from a customized GPCR

search of the database. GPR25 \vas discovered using a sequence homology-based PCR

strategy with the intent of discoverhg genes related to G P R B and the related genes

encoding sst receptors. Following the complete sequencing of the coding region of each

receptor gene. fürther characterization was attempted. Northern blot analysis was

performed to examine expression in several human and rat tissues, and each gene was

mapped to its respective chromosome. As the receptors encoded by GPR23 and GPR2-I

displayed significant homology (Le. as measured by per cent amino acid identity) with

other functional GPCRs, preliminary binding studies were carried out. However. these

initial attempts failed to identify a ligand for these receptors. Hence, they remain orphan

receptors. In total our laboratory has previously isolated 17 such genes: APJ (O'Dowd et

al., 1993). GPRI. GPR2, GPR3 (Marchese et al., 1994), GPR4, GPRj. GPR6 (Heiber et

al., 1995). GPR7, GPR8 (O'Dowd et al.. 19959, GPR9, GPRIO, GPRN (Marchese et al..

1995). GPRIj (Heiber et al., 1996), GPRI9 (O'Dowd et al., 1 W 6 ) , GPR-O. G P R X and

GPR2Z (O'Dowd et al., 1996). The cloning and characterizaion of GPR73. GPRZ-I. and

G P R Z described in this thesis follow in this series of discoveries. and are the latest

additions to a growing nurnber of genes that encode GPCRs for which the endogenous

ligand is unknown. Thus, the discovery of orphan receptors predicts that there are many

signalling molecules that have yet to be discovered that participate in G-linked processes.

The following discussion will examine each of the newly discovered genes funher. in

attempts to identi- the encoded receptor's native ligand. The findings from rnutagenesis

studies of closely related recepton will be discussed to provide insight into the potential

characteristics and properties of these ligands. Also, the successfûl isolation of the

endogenous agonist of the orphan GPCR gene. ORL-1. will be described as it may

represent a precedent in the identification of novel GPCR systems. The application of

such strategies may become a viable rnethod for the identification of orphan GPCRs and

may facilitate the discovery of novel signalling systems in the brain and the elucidation of

their physiological function.

4.2 Does GPR23 Eocode a Nucleotide-binding GPCR?

The GPR23-encoded receptor bears signi ficant amino acid identity to the chicken

PZYS receptor (58% overall, 66% TM domains). greater than to any other member of the

GPCR family (Figure 4.1). In fact. this high degree of similarity was sufficient to predict

that GPR23 was the hurnan orthologue of PZY,. However, the results of searching

Genbank indicated that the gene contained in the RB-intronsusceptibility gene

(Toguchida et al., 1993) was the human orthologue of P2Yj. Hence. the GPR73-encoded

receptor is not the orthologue. but a highly related receptor to P2Y5. The next closest

related receptor was the UNR with 28% overail amino acid identity. Various members of

the P2Y famiIy also exhibited lower than 30% identity. From this analysis. the identity

of GPR23 depended on the pharmacology of the chicken P X 5 receptor.

The P2Y5 receptor was originally descnbed as an orphan GPCR named 6H1. cloned

in 1993 by Kaplan et al. from a chicken activated T ce11 cDNA library. In 1996. Webb et

al. reported specific binding of the expressed receptor with ligands defining nucleotidic

receptors; membranes prepared fiom transfected Cos-7 ce11 membranes displayed

specific. high afinity. and saturable binding to [ ' 'SI~ATP~S. This pharmacology was

fürther supported with displacement expenments that established a rank order affinity

with various nucleotides (ADP, 2-MeSATP. a$-meATP. and UTP). The researchers

concluded on the basis of this observed pharmacology and the amino acid identity

(around 30%) with other PZY receptors. that 6H1 encoded a novel P2Y subtype. the P X 5

receptor.

The publication of those findings together with the cloning of UNR by our laboratory

prompted an investigation of GPR23 as a gene that encoded a P2Y receptor. As

mentioned in Results (section 3.2), we failed to achieve a functional response with

various nucleotide ligands when expressing GPR23 in human 1 32 1 N 1 astrocytoma cell

lines. Another group has since reported data consistent with our results (Janssens et al.,

1997). Using a more extensive array of nucleotides and nucleosides. they were unable to

elicit a response in four functional assays. Thus. the evidence indicates that the GPR-3-

encoded receptor is not a nucleotidic receptor. ln support of this hypothesis. key residues

found to be important for agonist-stimulated receptor activation in P I Y receptors are

absent in the GPRZ3-encoded receptor. Mutagenesis studies on the P3Y2 receptor

revealed the significance of His262. Arg265, Lys289. and Arg292 in agonist-induced

receptor activation (Erb et ai.. 1995). Neutralization or consemative substitution of these

residues by site-directed mutagenesis dramatically decreased receptor activity as detected

by intracellular ca2+ flux assays. Hence, these four residues appear to be crucial binding

determinants for the P2Y receptor ciass, and they are preserved airnost identically in al1

P2Y subtypes. These residues in the GPRZ3-encoded receptor are replaced by Asn for

His262. Leu for Arg765. Pro for Lys289. and Leu for Arg292. Strikingly. these same

substituted residues are found in the P2Yj receptor too. This observation has led to the

contention that P2Y5 is not a nucleotidic receptor (J.T. Turner. personal communication).

In fact. a recent report demonstrated that P2Y5 is not a P2Y receptor (Li et al.. 1997).

Drawing fiom their finding that [ 3 ' ~ ] d ~ ~ ~ a ~ is not a general ligand for PZY receptors

(Schachter & Harden, 1997). and the observation that the P2Yj receptor was

characterized solely on the basis of binding assays with that same radioligand. Li et al.

sought to determine unarnbiguousIy if P3Y5 is a PZY receptor. The nirkey orthologue

was cloned, stably expressed in human 1321N1 astrocytoma cells, and tested for second

messenger responses using a series of nucleotides. No effect was obsemed with any of

the functional assays used. PZY, does not mediate nucleotide-promoted second

messenger responses and. hence. is not a P2Y receptor. The true native ligand for PZY,

is thus unknown.

GPR23 is therefore most closely related to the orphan receptor P2Y5. The P2Y5 and

the GPRZ3-encoded receptors most likely form a distinct subgroup close to the P?Y

family that do not bind classical nucleotides. The significant sequence identity. including

the sarne substituted residues at critical positions for binding for P2Y receptors. predicts

that both receptors will bind the sarne endogenous ligand. perhaps an uncharactenzed

nucleotide.

4.3 Insight into the Identity of GPR24

Cornparison with somatostatin (sst) receprors

An alignment of the receptor encoded by GPR2.I with the five sst subtypes is

compelling evidence that GPR2-I is closely related to the genes encoding sst receptors

(see Figure 3.5). This relationship is better illustrated with a tw-O-dimensional

representation. showing the conservation of identical residues throughout the protein

sequence (Figure 4.2). Several features can be observed from this schematic

representation. First, high homology with sst receptors occun throughout most of the

receptor, except in the arnino terminus. Second. significant amino acid identity is found

in al1 7 TM regions. particularly in TM2, TM3. and TM7. Findings from in vitro

mutagenesis studies of GPCRs support the participation of al1 TM domains in forming

the ligand-binding site (Savarese et al., 1992). Interestingly, the sequence in the second

intracellular loop exhibits a degree of conservation not observed in the other loop regions

or the amino or carboxyl termini. This sequence, begiming with the hailmark Asp-Arg-

Tyr motif. is well conserved among sst receptos. and has been implicated in G protein

coupling.

Calcuiation of TM identities M e r highlights the degree of relatedness of the

GPRtCencoded receptor with the sst receptor farnily (Table 4.1).

Table 1.1 Cornparison of TM amino acid identities between the GPR2-l-encoded receptor and sst subtypes.

Identities in individual TM regions (TM2, TM3, and TM7) between the GPR2-l-encoded

receptor and certain sst subtypes exceed 50% (see Table 3.2). GPCRs which exhibit

greater than 50% TM homology ofien comprise receptor subfamilies (Sibley and

Monsma, 1992). Cornparisons with other rnembers of the GPCR family show that the

GPR2Cencoded receptor is also related to the opioid receptors and the opiate-related

nociceptin receptor (although less so than with sst receptors). The relatedness to these

peptidergic receptors predicts a peptide ligand for the GPRX-encoded receptor.

Empirical cornparisons, however. can only provide a useful starting point in elucidating a

receptor's identity.

Mutagenesis studies of ssf receprors

Detailed molecular modeling together with results of several site-directed mutagenesis

studies on the five sst subtypes have begun to elucidate the amino acids that are

determinants of somatostatin binding. The presence of an aspartic residue in TM3

(Asp172) provides an important ciue to the receptor's identity. Mutation of the

corresponding residue to the conserved glutamic residue in sst receptors has been

reported to effect a drastic reduction in SST-14 binding (Kaupmann et al.. 1995). In

addition to sst receptors. the aspartic acid appears in the analogous position of the

closely-related opiate receptors. and the nociceptin receptor. but is absent in most other

peptide-binding GPCRs. The results of other studies have been sumrnarized in Table 4.2.

The residues that have been shown to be important for binding SST-14 are located in the

TM domains. and are believed to form a ligand binding pocket by interacting specifically

with particular moieties of the peptide ligand. Using a cornputer-generated 3D receptor

mode1 based on the formation of favorable Iipophilic interactions of sst, with SST-14.

Kaupmann et al. (1995) proposed a ligand binding pocket forrned by these residues: (in

sst,) Phel95. Phe232, Trp284. Phe287. Tyr288. Gln.291, and Ser305. In the GPR2-I-

encoded receptor. residues located in the corresponding positions are found identically in

at least one sst subtype (see Figure 4.2), except for a conserved Tyr for Phe in TM6

(Tyr32 1 ). This remarkable conservation of residues lining the putative binding pocket

predicts a somatostatin-related ligand.

sstz Asp89 in Mutation to Asn abolished ~ a + mediated Kong et al.. TM2 inhibition of agonist binding 1993

sst, & Sst j Phe265 Substitution with Tyr shifted binding Ozenberger & characteristics of sst5 close to that of other Hadcock. 1994 subtypes

-- -- - - -- - - -

sst, & sst- Gln29 1 in Substitution of these residues in sst5 with Kaupmann et al.. TM6 and residues of sst, conferred subtype- 1995 Ser305 in selective binding of agonists. 3D TM7 of sst, cornputer mode1 predicts ligand binding

pocket of (using sst, as reference): Phe 195. Phe232, Trp284, Phe287. Tyr288. Gln291. and Ser305

Table 1.2 Sumrnary of mutagenesis studies and molecular modeling of sst receptors.

In addition to the participation of TM region residues. other studies have underscored the

importance of extracellular regions of sst receptors in ligand binding (Fitzpatnck &

Vandlen. 1994: Liapakis et al.. 1 996). Involvement o f extracellular regions of receptors

have been previously reported for other peptide-binding GPCRs. (Xue et al.. 1994: Wang

et al.. 1994a; Kong et al., 1994). The sequence homology and the length of the

extracellular loups in the sst subtypes as well as in the GPR24-encoded receptor show the

greatest variation, and it is possible that if GPR24-encoded receptor binds a somatostatin-

related peptide. the determinants of binding may partially be defined by these regions.

Conclusions fiom binding studies

Binding assays performed on Cos-7 membranes expressing GPR2-I with typical

ligands that define sornatostatin. opioid. and the predicted sigma GPCRs have failed (as

reported in Results 3.3). GPR2-I had also been sent to Sandoz PharmaceuticaI. and Dr.

Te. Reisine of the University of Pemsylvania. Binding studies with somatostatin. or

adenylyi cyclase assays, failed to produce promising results. A gene identical to GPR7-I

(except for one nt) had been cloned by Dr. Derk Bergsma of SrnithKline Beecham

Corporation (unpublished). Expression of this gene also failed to bind somatostatin

(Bergsma, persona1 communication). Thus. the encoded receptor is not a somatostatin or

opioid subtype or a sigma receptor. and there exists an uncharacterized somatostatin-like

neuropeptide for this receptor.

Searching for other peptides

We are currently searching for the endogenous ligand of the GPRUencoded receptor.

A novel neuropeptide, preprocortistatin isolated from rat shares profound structural

organizational similarity with preprosomatostatin. the precursor of SST-14 and SST-28

(de Lecea et al.. 1996). Cortistatin- 14, the mature tetradecapeptide. exhibits significant

primary sequence identity (1 1 of 14 amino acids) to SST-14 (Figure 4.3). We are

currenrly investigating cortistatin- l 4 and its human orthologue as possible ligands of the

GPR2-l-encoded receptor. We are also searching the dbEST for other somatostatin- or

cortistatin-related sequences. Numerous unidentified rnRNA species from rat striatum

(Usui et al., 1994) and hypothalamus (Gautvik et al.. 1996) have been isolated by other

researchers by directional tag PCR subtraction; their characterization may lead to the

SST-14 Rat Cortistatin-14 Human Cortistatin-17

C K N F F W K T F ~ S C C K N F F W K T F S S C

Figure 4.3 .&no acid cornparison of peptides somatostatin (SST-14) and human and rat cortistatin. Amino acids identicai between any two peptides are boxed and shaded.

discovery of unknown neuropeptides and perhaps the native ligand for the receptor

encoded by GPR2-I as well. Altematively. employing the method of identification used

in the discovery of die nociceptin peptide may prove successful. as descnbed below.

Idenrification of the nociceptin receptor - drming porallels

In 1994. several groups reponed the isolation of a receptor with remarkable sequence

h o r n o l o ~ (52-54% overall identity) to the three opioid subtypes. 6. p. and K (Moilereau

et al.: Lachowicz et al.; Wang et al.. Wick et al.. Bunzow et al.. Fukuda et al.).

Expression of receptor rnRNA was abundant in brain. including regions involved in pain

perception (Bunzow et al.. 1994). Surprisingly, no binding could be achieved with any

classical opiate ligands. The orphan receptor became known as ORL- 1 (Opioid Receptor-

Like-1).

The identity of ORL-1 was resolved by the independent discovery of the receptor's

endogenous ligand by two groups using very similar fhctional approaches but in

different species: rat (Meunier et al.. 1995) and pig (Reinscheid et al.. 1995). The method

of Meunier et al. is briefly described here. A crude estract was freshly dissected from rat

brains and divided into 10 fractions by size exclusion chromatography. Each fraction was

assayed for its ability to affect second rnessenger response in CHO ce11 lines stably

expressing ORL-I . Active fractions were fùrther fractionated. and used to assay for

activity as before. until a single active compound was obtained. A heptadecapeptide with

remarkable structural resemblance to the classical opioid peptides was thus isolated.

However. in contrast to the analgesic effects associated with activating opioid receptors,

binding of this neuropeptide to ORL-1 elicited hyperalgesia. Because of its observed pro-

nociceptive properties, the authors named the peptide nociceptin. The exarnple of ORL-

lhociceptin is an exarnple of a receptor bearing significant homology to one particular

GPCR class that does not bind ligands of that class, but binds a reiated ligand. The

approaches described may also prove to be a viable method for identiSing GPRZ4.

Many studies have begun to characterize nociceptin M e r . its binding properties. its

distribution in central and penpheral tissues. and its role in physiological hnction. Its

isolation has identified an entireiy novel peptidergic newonansmitter signalling system in

the brain that, based upon its remarkable relationship to the opioid system. likely evolved

in parallel with the opiate receptors. A s w e y of the number of articles published since

the nociceptin discovery (over 60 repons) reflects the scientific benefit that can be

obtained from identiSing the native ligand for an orphan receptor. The eventual isolation

of the endogenous Ligand of the GPRWencoded receptor holds equal potential. The

abundance of GPR24 mRNA expression in brain with regional localization to discrete

areas involved in functions such as emotion. memory and sensory perception make the

isolation of its endogenous ligand an important priority.

4.4 Insight into the Identity of GPR25

Applying the same kind of analyses used for GPR23 and GPRB to provide insight to

their identities is more difficult for GPR2j because the encoded receptor is related closest

to a receptor which is also an orphan receptor, namely GPRlj . Sequence identity to the

GPRlj-encoded receptor is highest in the TM regions (41%). The closest functionally

characterized receptor is the angiotensin II type 1 receptor (38% TM) and sst5. suggesting

a peptide ligand. GPR25 was not found to express in liver or in 12 brain regions

exarnined using Northem blot analysis, mirronng the absence of GPRl j mRNA in the

sarne tissues. GPR25 rnay be discretely localized to specific brain tissues not examined

or it may be involved in physioiogicai functions in peripheral tissues. Interestingly. it has

been shown recently that the receptor encoded by GPR I J c m be used as an en- cofactor

in primate imunodeficiency vims infection (Deng et al.. 1997; Farzan et al.. 1997).

Also, GPRI.5 expression was demonstrated in various human peripheral organs (spleen.

thymus. small intestine, colon), and also in peripheral blood leukocytes and alveolar

macrophages. Nevertheless, its nanual ligand remains unidentified. The significant

amino acid identity to the receptor encoded by G P R I j suggests that the receptor encoded

by GPR25 may bind a similar endogenous ligand. These two related receptors likely

represent the first of a subfarnily of receptors predicted to bind an endogenous peptide

ligand.

5.0 CONCLUSIONS

In summary, three novel genes encoding for G protein-coupled receptors were

discovered and characterized in the present snidy. GPR24 is paxticularly interesting

because of its abundant expression in many discrete b r i n regions. Although none of the

encoded receptors were functionally identified, their remarkable relationships to other

GPCR subclasses have provided insight that may lead to the isolation of their respective

native ligands. Significantly, the findings herald the exciting potential of identifjing

novel signalling systems in the body.

The study also demonstrates the success of utilizing the public genetic databases to

search for new GPCR-encoding genes. GenBank database searching has emerged as a

powerfûl rneans of gene discovery. In addition to GPR23, GPR24. and GPR-5. we have

employed similar methods to obtain GPRI9 (O'Dowd et al.. 1996). GPRZO. GPRZI.

GPR22 (O'Dowd et al. 1997). and a human galanin GALZ receptor subtype (Nguyen et

al.. in preparation). Some of these genes too rnay represent novel subclasses of the GPCR

superfamily. Also. these genes may not have been isoiated. or isolated as quickly, using

traditional cloning strategies. The isolation and characteriùng of novel GPCR genes will

certainly advance our understanding of G-linked receptor systems and their contribution

to diseased States. Furthemore. there exists the promise of discovering novel ligands and

M e r subtypes which will facilitate the development of highly specific drugs and drug

therapies.

6.0 REFERENCES

Adams, M.D., Kelley, J.M., Gocayne, J.D.. Dubnick. M.. Polymeropoulos. M.H.. Xiao. H., Merril, CR., WU, A., Olde, B., Moreno, R.F.. Kerlavage. A.R.. McCombie. W.R.. Venter, J-C. ( 1 99 1 ) Cornplementary DNA sequencing: expressed sequence tags and human genome project. Science 252: 165 1 - 1656.

Akbar. M.G.K.. Dasari. V.R.. Webb, T., Ayyanaihan. K.. Pillarisetti. K.. Sandhu. A.K.. Athwal. R.S.. Daniel, J.L., Ashby, B.. Barnard. E.A.. Kunapuli. S.P. (1996) Molecular Cloning of a Novel P3 Purinoceptor from Human Erythroleukemia Cells. J. Biol. Chem. 271 : 18363-1 8367.

Altschul, S.F.. Gish, W., Miller, W., Myers, E.W., Lipman, D.J. (1990) Basic local alignrnent search tool. J. Mol. Biol. 2 15: 403-4 10.

Boarder, M.R., Weisman. G.A., Turner, J.T., Wilkinson. G.F. G protein-coupled P:! purinoceptors: fiom molecular biology to functionai responses. Trends Pharmacol. Sci. 16: 133-9.

Boguski. M.S.. Schuler. G.D. (1995) ESTabIishing a Human Transcnpt Map. Nature Genetics 10: 369-3 7 1.

Bonner, T.I.. Modi, W.S.. Sevanet H.N.. O'Bnen. S.J. (1991) Localization of the muscarinic 3 cholinergic receptor to chromosome 1 q3Z. 1. Cytogenet. Ce11 Genet. 58: 1850-1851.

Bunzow, J.R.. Saez. C.. Mortrud. M., Bouvier. C.. Williams. J.T.. Low. M., Grandy. D.K. (1994) Molecular cloning and tissue distribution of a putative member of the opioid receptor gene family that is not a p.& or K opioid receptor type. FEBS Lea. 347: 284- 288.

Burnstock, G. (1 995) Current state of purinoceptor research. Phannaceutica Acta Helvetiae 69: 33 1-242.

Chomczynski. P.. Sacchi, N. (1987) Single-step rnethod of RNA isolation by acid guanidiniurn thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156- 159.

Deng, H., Unutmaz, D., KewalRamani, V.N., Littman. D.R. (1997) Expression cloning of new receptors used by simian and human immunodeficiency vimes. Nature 388: 296-300.

DeNoble. V., Hepler, D.. Barto, R. (1989) Cysteamine-induced depletion of SRlF produces differential cognitive deficits in rats. Brain Res. 482: 42-48.

Dixon. R.A., Kobilka, B.K., Smder, D.J., Benovic, J.L., Dohlman. H.G.. Frielle. T.. Bolanowski. M.A., Bennett, C.D., Rands, E., Diehi, R.E.. Murnford. RA.. Slater. E.E.. Sigal, I.S., Caron, M.G.. Lefkowitz R.J., Strader, C.D. (1 986) Cloning of the gene and cDNA for marnmalian beta-adrenergic receptor and homology with rhodopsin. Nature 321: 75-79.

Eason, M.G.. Jacinto, M.T.. Theiss. C.T., Liggett. S.B. (1994) The palmitoylated cysteine of the cytoplasmic tail of alpha ?A-adrenergic receptors confers subtype-specific agonist-prornoted downregulation. Proc. Natl. Acad. Sci. USA 9 1 : 1 1 1 78-82.

Erb, L.. G m d , R., Wang, Y.. Quinn. T., Turner, J.T.. Weisman. G.A. (1995) Site- directed mutagenesis of P2U purinoceptors. Positively charged arnino acids in transmembrane helices 6 and 7 affect agonist potency and specificity. J. Biol. Chem. 270: 4 185-4 188.

Evans. C.J.. Keith, D.E.. Jr., Momson, H., Magendzo, K.. Edwards. R.H. ( 1 992) Cloning of a delta opioid receptor by functional expression. Science 258: 1952- 1955.

Fargin, A.. Raymond, J.R.. Lohse, M.J.. Kobilka B.K.. Caron. M.G.. Lefkowitz. R.J. (1 988) The clone G-2 1 which resembles a beta-adreneqic receptor sequence encodes the 5-HT 1 A receptor. Nature 358-360.

Farzan. M.. Choe. H.. Martin. K.. Marcon, L., Hohann. W.. Karlsson. G.. Sun. Y.. Barrett, P.. Marchand, N., Sullivan. N.! Gerard. N., Gerard. C., Sodroski. J. (1997) Two orphan seven-transmembrane segment recepton which are expressed in CDCpositive cells suppon sirnian irnmunodeficiency virus infection. J. Exp. Med. 186: 405-4 1 1 .

Ferguson. S.S.G.. Barak. L.S.. Zhang, J., Caron. M.G. (1996) G-protein-coupled receptor regulation: role of G-protein-coupled receptor kinases and arrestins. Cm. J. Physiol. Pharmacol. 74: 1095-1110.

Fields. H.L. ( 1987) Pain. McGraw-Hill, New York.

Fitzpatrick, V.D.. Vandlen. R.L. (1 994) Agonist selectivity determinants in somatostatin receptor subtypes 1 and II. J. Biol. Chem. 269: 5462 1-24626.

Fraser, CM., Wang, C.D.. Robinson. D.A., Gocayne, J.D., Venter. J.C. (1 989) Site- directed mutagenesis of m 1 muscarinic acetylcholine receptors: conserved aspartic acids play important roles in receptor function. Mol. Pharmacol. 36: 840-847.

Fukuda K., Kato, S., Mori, K., Nishi, M., Takeshima, H.. Iwabe, N.. Miyata, T., Houtani, T., Sugimoto, T. (1 994) cDNA cloning and regional distribution of a novel member of the opioid receptor family. FEBS Lett. 343: 42-46.

Fun~ta, H., Guo, D.R., Inagarni, T. (1992) Molecular cloning, sequence analysis and expression of a cDNA encoding hurnan type4 angiotensin II receptor. Biochem. Biophys. Res. Commun. 183: 8-13.

Gantz. I., Schaffer, M.. DelValle. J.. Logsdon, C., Campbell, V.. Uhler. M.. Yamada. T. (199 1) Molecular cloning of a gene encoding the histamine H2 receptor. Proc. Natl. Acad. Sci. USA 88: 429-433.

Gautvik, K.M., de Lecea, L., Gautvik. V.T.. Danielson, P.E.. Tranque. P.. Dopazo. A. Bloom, F.E.. Sutcliffe. J.G. ( 1996) Overview of the most prevalent hypothalarnus- specific mRNAs. as identified by directional tag PCR subtraction. Proc. Natl. Acad. Sci. USA 93: 8733-8738.

Gerard, NP.. Eddy, R.L.. Jr., Shows, T.B., Gerard. C. (1990) The hurnan neurokinin A (substance K) receptor. Molecular cloning of the gene, chromosome localization. and isolation of cDNA from tracheal and gastric tissues. J. Biol. Chem. 265: 20455-62.

Haroutunian. V., Mantin, G., Carnpell. G.. Tsuboyarna G., Davis. K. (1987) Cysteamine-induced depletion of central SEUF-like irnmunoreactivity: effects on behavior. leaniing, mernos, and brain neurochemistry. Brain Res. 403: 234-242.

Heiber, M.. Marchese. A.. Nguyen, T.. Heng, H.H.Q.. George. SR.. O'Dowd. B.F. (1996) A novel human gene encoding a G-protein-coupled receptor (GPRL 5) is located on chromosome 3. Genomics 32: 462-465.

Heiber. M.. Docherty, J.M., Shah. G., Nguyen. T.. Cheng, R.. Heng. H.H.Q.. Marchese. A.. Tsui, L.-C.. Shi, X.. George. S.R.. O'Dowd. B.F. (1995) Isolation of three novle human p n e s encoding G protein-coupled receptors. DNA Ce11 Biol. 14: 25-35.

Heng, H.H.Q., Squire, J., Tsui. L.-C. ( 1992) High-resolution mapping of marnmalian genes by in situ hybridization to fiee chromatin. Proc. Natl. Acad. Sci. U.S.A 89: 9509- 95 13.

Heng. H.H.Q., Tsui, L.-C. (1993) Modes of DAPI banding and simultaneous in situ hybridization. Chromosoma 102: 325-332.

Hershey, A.D., Krause J.E. (1 990) Molecular characterization of a functional cDNA encoding the rat substance P receptor. Science 247: 958-62.

Herzog, H., Darby, K., Hort, Y.J.. Shine, J. (1996) Intron 17 of the Human Retinoblastoma Susceptibility Gene Encodes an Actively Transcnbed G Protein-coupled Receptor. Genome Research 6:858-861.

Hillier. L.. Lennon. G., Becker, M., Bonaldo, M.F., Chiapelli, B., Chissoe, S.. Dietrich, N., DuBuque, T., Favello, A., Gish, W., Hawkins, M., Hultrnan, M.. Kucaba, T.. Lacy,

M., Le, Maithao, Le, N., Mardis, E., Moore, B.. Moms, M.. Parsons. J., Prange. C.. Ri£kin, L., Rohlfiing, T., Schellenberg, K., Soares. M.B.. Tan, F., Thierry-Meg. J.. Trevaskis, E.. Underwood, K., Wohldrnan, P., Waterston. R., Wilson. R.. Marra. M. (1 996) Generation and analysis of 280,000 human expressed sequence tags. Genome Research 6: 807-828.

Houtani, T., Nishi. M., Takeshima, H., Nukada. T.. Sugimoto. T. (1996) Structure and regionai distribution of nociceptidorphanin FQ precursor. Biochem. Biophys. Res. Commun. 219: 714-719.

Ikeda, S.. Schofield. G. (1 989) SRIF blocks a ~ a * curent in rat sympathetic ganglion neurons. J. Physiol. 409: 22 1 -240.

Janssens, R.. Boeynaems. L M . , G o d a M.. Cornmuni, D. (1997) CIoning of a human heptahelical receptor closely related to the P2Y5 receptor. Biochem. Biophys. Res. Commun. 236: 106-1 12.

Jensen. A.A., Pedersen. U.B.. Kiemer, A.. Din, N.. Andersen. P.H. (1 995) Functional importance of the carboxyl tail cysteine residues in the human D, dopamine receptor. Journal of Neurochemistry 65: 1325-3 1.

Jin. H., Zastawny, R., George, S.R.. O'Dowd, B.F. (1997) Elimination of palmitoylation sites in the human dopamine D, receptor does not affect receptor-G protein interaction. Eur. J. Pharmacol. 324: 109- 1 16.

Julius. D.. MacDermott. A.B.. Axel. R.. Jessell, T.M. (1988) Molecular characterization of a functional cDNA encoding the serotonin Ic receptor. Science 241 : 558-564.

Kapas, S.. Catt, K.J.. Clark. A.J. (1995) Cloning and expression of cDNA encoding a rat adrenomedullin receptor. J. Biol. Chem. 270: 25344-25347.

Kaplan, M.H., Smith, D.I.. Sundick. R.S. (1993) Identification of a G protein coupled receptor induced in activated T cells. J. Irnmunol. 1 5 1 : 628-636.

Kaupmann, K., Bruns, C., Raulf, F., Weber, H.P., Mattes, H., Lübbrrt, H. (1995) Two amino acids, located in trammembrane domains VI and VII, determine the selectivity of the peptide agonist SMS 20 1-995 for the SSTW somatostatin receptor. EMBO J. 14: 727-735.

Kobilka, B.K.. Frielle, T., Collins, S.. Yang-Feng, T., Kobilka, T.S., Francke, U., Lefkowitz. R.J., Caron. M.G. (1987) An intronless gene encoding a potential member of the farnily of recepton coupled to guanine nucleotide regulatory proteins. Nature 329: 75-79.

Kolakowski. L.F., Jr., Jung, B.P., Nguyen, T., Johnson, M.P.. Lynch. KR.. Cheng. R.. Heng, H.H.Q., George. S.R., O'Dowd, B.F. (1996) Chamcterization of a human gene related to genes encoding somatostatin receptors. FEBS Len. 3 98: 233 -258.

Kolakowski. L.F., Jr. (1 994) GCRDb: a G-protein-coupled receptor database. Receptors & Channels 2: 1-7.

Kong, H.. Raynor. K., Yasuda, K.. Bell. G.I., Reisine. T. (1993) Mutation of an aspartate at residue 89 in somatostatin rcceptor subtype 2 prevents Na* regulation of agonist binding but does not alter receptor-G protein association. Mol. Pharmacol. 41: 3 80-3 84.

Kong, H.. Raynor. K., Yano. H.. Takeda J.. Bell, G.I.. Reisine. T. (1994) Agonists and antagonists bind to different domains of the cloned kappa opioid receptor. Proc. Natl. Acad. Sci. USA 9 1 : 8042-8046.

Kozak. M. (1987) An analysis of Y-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Research 15: 8 125-8 13 1.

Lachowicr LE.. Shen. Y.. Monsma. F.J.. Jr.. Sibley. D.R. (1 995) Molecular cloning of a novel G protein-coupled receptor related to the opiate receptor fmily. I. Neurochem. 64: 34-40,

Larnberts, S.. Krenning. E.. and Reubi. J.-C. (1 99 1) The role of SRIF and its analogs in the diagnosis and treatment of tumors. Endocrine Rev. 12: 450-482.

Lennon. G.. Auffray. C.. Polymeropoulos. M.. Soares. M.B. (1996) The I.M.A.G.E. consortium: an integrated molecular analysis of genomes and their expression. Genomics 33: 151-152.

Li. Q., Schachter. J.B., Harden, K.. Nicholas, R.A. (1997) The 6H1 orphan receptor. claimed to be the p2y5 receptor. does not mediate nucleotide-prornoted second messenger responses. Biochem. Biophys. Res. Commun. 236:455-460.

Liapakis, G., Fitzpatrick. D., Hoeger, C.. Rivier. J., Vandlen. R., Reisine. T. (1996) Identification of ligand binding determinants in the somatostatin rcceptor subtypes 1 and 2. J. Biol. Chem. 27 1 : 2033 1-20339.

Libert. F., Parmentier, M.. Lefort. A., Dinsart, C.. Van Sande. J., Maenhaut. C.. Simons. M.J., Dumont. J.E., Vassart. G. (1989) Selective amplification and cloning of four new members of the G protein-coupled receptor farnily. Science 244: 569-572.

Libert. F., Schifiann, SN., Lefort. A., Parmentier, M., Gerard, C., Dumont, J.E., Vanderhaeghen, J.I., Vassart, G. (1 991 a) The orphan receptor cDNA RDC7 encodes an A 1 adenosine receptor. EMBO J. 10: 1677- 1682.

Liben. F.. Vassart, G., Parmentier, M. ( 1 99 1 b) Current developments in G-protein- coupled receptors. Curr. Opin. Ce11 Biol. 3: 218-223.

Maenhaut. C., Van Sande, J-, Massart, C., Dinsart, C.. Libert. F.. Moderini. E., Giraldo. E.. Ladinsky. H., Vassart, G., Dumont, J.E. (1991) The orphan receptor cDNA W C 4 encodes a 5-HTI D serotonin receptor. Biochem. Biophys. Res. Commun. 180: 1460- 1468.

Maenhaut. C.. Van Sande, J.. Libert. F., Abramowicz. M.. Parmentier. M.. Vanderhaegen. J., Dumont. J.E., Vassart. G., Schiffinann, S. (1990) RDC8 codes for an adenosine A2 receptor with physiological constitutive activity. Biochem. Biophys. Res. Commun. 173 : I 169-78.

Marchese, A.. George, S.R., O'Dowd, B.F. (1997) Cloning of G protein-coupled receptor genes: the use of homology screening and the polymerase chain reaction. In Lynch. K.R. (ed): "Identification and Expression of G Protein-coupled Receptors." New York, Wiley-Liss, Inc. (in press).

Marchese. A.. Docherty, J.M.. Nguyen, T.. Heiber. M.. Cheng, R.. Heng. H.H.Q.. Tsui. L X . . Shi. X.. George, S.R.. O'Dowd, B.F. ( 1 994) Cloning of human genes encoding novel G protein-coupled receptors. Grnomics 23: 609-6 18.

Marchese. A.. Heiber. M.. Nguyen. T., Heng. H.H.Q.. Saldivia V.R.. Cheng. R.. Murphy. P.M.. Tsui, L X . , Shi. X.. Gregor, P.. George. S.R.. O'Dowd. B.F, Dochertv, J.M. (1 995) Cloning and chromosomal mapping of three novel genes. GPR9. GPRI O. and GPR14. encoding receptors related to interieukin 8. neuropeptide Y. and somatostatin receptors. Genomics 29: 3 3 5-344.

Masu. Y.. Nakayama, K., Tamaki. H.. Harada, Y.. Kuno, M.. Nakanishi. S. (1987) cDNA cloning of bovine substance-K receptor through oocyte expression system. Nature 339: 836-838.

Matsuda. L.A.. Lolait, S.J.. Brownstein. M.J.. Young. A.C., Bonner T.I. (1990) Structure of a cannabinoid receptor and functional expression of the cloned cDNA. Nature 346: 56 1-564.

Meriney, S., Gray, D., Pilar. G. (1 994) SRIF-induced inhibition of neuronal ~ a " current modulated by cGMP-dependent protein kinase. Nature 3 69: 336-3 39.

Meunier. J.-C., Mollereau, C., Toll, L., Suaudeau, C.. Moisand. C., Alvinerle, P.. Butour. J.-L.. Guillemot, J.-C.. Ferrara, P.. Monsarrat, B., Mazargull, H.. Vassart. G.. Parmentier, M., Costentin, J. (1995) Isolation and structure of the endogenous agonist of opioid receptor-like ORL , receptor. Nature 377: 532-535.

Mills, A., Duggan, M.J. (1994) Orphan seven transmembrane domain receptors: reversing pharmacology TIBTECH 12: 47-49.

Moffet. S., Mouilac, B., Bonin, H., Bouvier. M. (1993) Altered phosphorylation and desensitization patterns of a human PZ-adrenergic receptor lacking the palmitoylated Cys341. EMBO J 12: 349-356.

Mollereau, C.. Parmentier, M.. Mailleu. P.. Butour, J.-L.. Moisand. C.. Chalon. P.. Caput. D., Vassart, G.. Meunier, J.-C. (1994) ORLI. a novel member of the opioid receptor family. FEBS Lett. M l : 33-38.

Mollereau, C.. Simons. M A , Soularue, P.. Liners. F.. Vassart. G.. Meunier. J.-C.. Parmentier. M. (1 996) Structure, tissue distribution, and chromosomal localization of the prepronociceptin gene. Proc. Natl. Acad. Sci. USA 93: 8666-8670.

Murphy, P.M. ( 1 996) C hemokine receptors: cloning strategies. Methods: a cornpanion to Methods in Enzymology. 10: 104- 1 18.

Murphv, T.J.. Alexander. R. W.. Gnendling, K.K., Runge. M.S.. Bernstein. K.E. ( 199 1 ) Isolation of a cDNA encoding the vascular type- 1 angiotensin II receptor. Nature 35 1 : 233-236.

Nathans, J.. Hogness. D.S. ( 1983) Isolation. sequence analysis. and intron-exon arrangement of the gene encoding bovine rhodopsin. Cell 34: 807-8 14.

Nguyen, T.. Erb, L.. Weisman. G.A.. Marchese. A., Heng, H.H.Q.. Garrad. R.C.. George. S .R., Turner, J.T.. O' Dowd. B.F. ( 1 995) Cloning. expression. and chromosomal localization of the human uridine nucleotide receptor gene. J. Biol. Chem. 270: 30845- 30848.

Nothacker. H.-P.. Reinscheid. R.K., Mansour, A.. Henningsen. R.A.. Ardati, A.. Monsrna, F.J.. Jr.. Watson, S.J.. Civelli. 0. (1996) Pnmary structure and tissue distribution of the orphanin FQ precursor. Proc. Natl. Acad. Sci. USA 93: 8677-8682.

Nussenzveig. D.R., Heinflink, M.. Gershengom. M.C. ( 1993) Agonist-stirnulated intemalization of the thyrotropin-releasing hormone receptor is dependent on two domains in the receptor carboxyl terminus. J. Biol. Chem. 268: 2389-2392.

O'Dowd, B.F., Hnatowich, M., Caron, M.G., Lefkowitz, R.J., Bouvier, M. (1989) Palmitoylation of the human p2-adrenergic receptor. Mutation of Cys341 in the carboxyl tail leads to an uncoupled non-palmitoylated form of the receptor. J. Biol. Chem. 264: 7564-7569.

O'Dowd, B.F.. Nguyen, T.. Tirpak, A.. Jarvie, KR.. Israel, Y.. Seeman. P.. Nimik. H. (1990) Cloning of two additional catecholamine receptors f?om rat brain. FEBS Len. 262: 8-12.

O'Dowd, B.F., Heiber. M.. Chan, A.. Heng, H.H.Q., Tsui. L.-C.. Kennedy. J.L.. Shi. X.. Petronis, A., George. SR., Nguyen, T. (1993) A human gene that shows identity with the gene encoding the angiotensin receptor is located on chromosome 1 1. Gene 136: 355-360.

O'Dowd. B.F.. Scheideler. MA.. Nguyen, T.. Cheng, R.. Rasmussen. J.S.. Marchese. A.. Zastawny, R.. Heng, H.H.Q., Tsui, L.-C., Shi, X., Asa, S., Puy, L., George, S.R. ( 1993) The cloning and chromosomal mapping of two novel human opioid-somatostatin-Iike receptor genes. GPR7 and GPR8. expressed in discrete areas of the brain. Genomics 28: 84-9 1.

O'Dowd. B.F.. Nguyen, T.. Lynch. K.R., Kolakowski, L.F., Jr.. Thompson. M.. Cheng. R.. Marchese. A.. Ng, G.. Heng, H.H.Q., George. S.R. (1 996) A novel gene codes for a putative G protein-coupled receptor with abundant expression in brain. FEBS Lett. 394: 325-329.

O'Dowd, B.F., Nguyen, T., Jung, B.P.. Marchese, A.. Cheng. R.. Heng. H.H.Q.. Kolakowski. L.F.. Jr.. Lynch. K.R., George, S.R. (1997) Cloning and chromosomal mapping of four putative novel human G-protein-coupled receptor genes. Gene 187: 75- 81.

Owji, A.A.. Smith. D.M., Coppock. H.A., Morgan. D.G.. Bhogal. R.. Ghatei. MA.. Bloom, S.R. (1995) An abundant and specific binding site for the novel vasodilator adrenomedullin in the rat. Endocrinology. 136: 2 127-2 131.

Panetta, R.. Greenwood, MT.. Warszynska. A., Demchyshyn. L.L.. Day, R.. Niznik. H.B., Srikant. C.B., Patel, Y .C. (1 994) Molecular cloning, functional characterization and chromosomal localization of a human SRIF receptor (SRIF receptor type 5) with preferentid affinity for SRIF 28. Molec. Pharmac. 45: 41 7-427.

Patel. Y.C.. Greenwood. M.T.. Panetta. R., Demchyshyn. L., Nimik. H.. Snkant. C.B. (1 995) The somatostatin receptor family. Life Sciences 57: 1249- 1265.

Paxinos, G., Watson. C. (1 982) The Rat Brain, Academic Press. New York.

Pearson, W.R. (1 995) Cornparison of methods for searching protein sequence databases. Protein Sci. 4: 1 145- 1 160.

Pearson, W.R., Lipman, D.J. (1 988) Improved tools for biologicai sequence cornparison. Proc. Natl. Acad. Sci. USA 85: 2444-2448.

Perdta, E.G.. Winslow. LW.. Petenon, G.L.. Smith. DM.. Ashkenazi. A.. Ramachandran, J., Schimerlik, M.I., Capon, D.J. (1 987a): Primary structure and biochemical properties of an MZ muscarinic receptor. Science 236: 600-605.

Peralta, E.G.. Ashkenazi. Winslow. J.W.. Smith. D.H.. Rarnachmdran J.. Capon. D.J. ( 1 98 7b) Distinct primary structures. ligand-binding properties and tissue-speci fic expression of four human muscarinic acetylcholine receptors. EMBO 6: 3923-3929.

Premont. R.T.. Koch. W.J.. Inglese. J.. And Lefkowitz, R.J. (1995) Protein kinases that phospho~late a-tisaied G protein-coupled receptors. FASEB. J. 9: 175-1 81.

Priestley, T. (1992) The effect of baclofen and somatostatin on neuronal activity in the rat ventromedial hypothalamic nucleus in vitro. Neuropharmacology 3 1 : 103-1 09.

Raport. C.J.. Schweickart. V.L., Eddy, R.J.. Jr., Shows, T.B.. Gray, P.W. (1995) The orphan G protein-coupled receptor-encoding gene V28 is closely related to genes for chemokine receptors and is expressed in Iymphoid and neural tissues. Gene 163: 195- 299.

Raynor, K.. Lucki, 1.. Reisine. T. (1993) SRIF, receptors in nucleus accurnbens selectively mediate the stimulatory effect of SRIF on locomotor activity in rats. J. Pharmac. Exp. Ther. 265: 67-73.

Reinscheid. R.K.. Nothacker, H.P., Bourson. A.. Ardati. A., Hemingsen. RA.. Bunzow. J.R.. Grandy. D.K.. Langen. H., Monsma. F.J.. Civelli. 0. (1 995) Orphanin FQ: a novel neuropeptide which is a nanird ligand of an opioid-like G protein-coupled receptor. Science 270:792-794.

Savarese. T.M.. Fraser. C.M. (1992) In vitro mutagenesis and the search for structure- hinction relationships among G protein-coupled receptors. Biochem. J. 283: 1-1 9.

Schachter. J.B.. Harden, T.K. (1997) An examination of deoxyadenosine jq(alpha thio)triphosphate as a ligand to define P2Y receptors and its selectivity as a low potency partial agonist of the P î Y (1) receptor. Br. J. Pharmacol. 12 1 : 338-344.

Schusdziarra. V. (1 992) in: Basic and Clinical Aspects of Neuroscience (Weil. C.. Muller. E.E.. and Thorner, M.O. eds), Somatostatin. Vol 4 pp. 43-54. Springer, Heidelberg.

Shapno M.. Hille, B. (1993) Substance P and somatostatin inhibit calcium channels in rat sympathetic neurons via different G protein pathways. Neuron 10: 1 1-20.

Sibley. D.R.. Monsma. F.J., Jr. (1992) Molecular biology of dopamine receptors. Trends Pharmacol. Sci. f 3: 6 1-69.

Snyder. S.H. (1 986) Dmgs and the Brain. Freeman New York.

Spiegel, A.M. (1997) Inbom errors of signal transduction: Mutations in G proteins and G protein-coupled receptors as a cause of disease. I. M e r . Metab. Dis. 20: 1 1 3- 1 1 1.

Strader. CD., Fong, T.M.. Tota M.R.. Underwood. D.. Dixon. R.A.F. (1994) Structure and function of G-protein-coupled receptors. Annu. Rev. Biochem. 63 : 10 1 - 137.

Strader. CD., Sigal. I.S.. Register. RB.. Candelore. M.R.. Rands. E.. Dixon. R.A.F. (1987) Identification of residues required for ligand binding to the beta-adrenergic receptor. Proc. Natl. Acad. Sci. USA 84: 43844388.

Sunahara R.K., Nimik. H.B.. Winer, D.M.. Stormann. T.M.. Brann. M.R.. Kennedy. J.L.. Gelernter. J.E., Romahel. R.. Yang, Y.. Israel. Y.. Seeman. P.. O'Dowd. B.F. (1990) Human dopamine Dl recepor encoded by an intronless gene on chromosome 5. Nature 347: 80-83.

Sunahara. R.K.. Guan. H.-C.. O'Dowd, B.F.. Seeman. P.. Laurier. L.G.. Ng. G.. George. S.R.. Torcha. Joeseph. Van Toi. H.H.M.. Nimik. H.B. (1991) Cloning of the gene for a human dopamine Dj receptor with higher affinity for dopamine than D,. Nature 350: 613-619.

Surratt. C.K.. Johnson. P.S.. Mori~vaki. A.. Sidleck. B.K.. Blaschak. C.J.. Wang. J.B.. Uhl. G.R. (1994) Mu opiate receptor. Charged transmembrane domain arnino acids are cntical for agonist recognition and intrinsic activity. J.Biol. Chem. 269: 20548-20553.

Toguchida. J.. McGee. T.L.. Paterson. J.C.. Eagle. J.R.. Tucker. S.. Yandell. D.W.. Dryja. T.P. (1993) Complete genomic sequence of the human retinobiastoma susceptibilitg gene. Genornics 1 7: 535-543.

Townsend-Nicholson, A.. Baker. E.. Schofield. P.R.. Sutherland. G. R. ( 1 995) Localization of the adenosine A l receptor subtype gene (ADORAI) to chromosome 1 q32.l. Genomics 26: 423425.

Usui, H., Jefiey, D.F.. Dopazo. A.. de Lecea. L., Erlander. M.G.. Sutcliffe. J.G. (1 994) Isolation of clones of rat stria--specific mRNAs by directional tag PCR subtraction. Journal of Neuroscience. 14: 49 15-4926.

Wang, H.. Reisine, T., Dichter, M. (1990) SRIF-14 and SRIF-28 inhibit calcium currents in rat neocortical neurons. Neuroscience 38: 335-342.

Wang, J.B.. Johnson, P.. Wu. J.M., Wang, F.W., Uhl. G. (1994a) Human kappa opiate receptor second extracellular loop elevates dynorphin's afinity for human mukappa chimeras. J. Biol. Chem. 269: 25966-25969.

Wang, J.B., Johnson, P.S., Imai. Y., Persico, A.M., Ozenberger, B.A., Eppler. C.M.. Uhl. G.R. (1994b) cDNA cloning of an orphan opiate receptor gene family rnember and its splice variant. FEBS Lett. 348: 75-79.

Webb, T.E.. Kaplan, M.G., Barnard. E.A. (1996) Identification of 6H1 as a purinoceptor: P X , . Biochem. Biophys. Res. Commun. 7 19: 105- 1 10.

Wick, M.J.. Mimerath. S.R.. Lin. X.. Elde. R., Law. P.-Y.. Loh. H.H. (1 991) Isolation of a novel cDNA encoding a putative membrane receptor with high homology ro the cloned p.6. and IC opioid receptors. Molec. Brain Res. 27: 37-44.

Xue, J.. Chen, C., Zhu. J.. Kunapuli, S., DeRiel, K., Yu. L., Liu-Chem. L. (1994) Differential binding domains of peptide and non-peptide ligands in the cloned rat kappa opioid receptor. J. Biol. Chem. 269: 30 195-30 199.

Yamada Y., Stoffel. M., Espinosa III. R., Kun-san, X.. Seino. M.. Seino, S.. Le Beau. M.M., Bell. G.I. (1 993) Human somatostatin receptor genes: localization to human chromosomes 14, 17. and 22 and identification of simple tandem repeat polymorphisms. Genomics 1 5: 449-452.

Yang-Feng. T.L.. Xue. F.Y.. Zhong. W.W.. Cotecchia, S., Frielle, T.. Caron. M.G.. Lefkowitz, R.J.. Francke, U. (1990) Chromosomal organization of adrenergic receptor genes. Proc. Natl. Acad. Sci. USA 87: 15 16-1 520.

Yarden. Y.. Rodriguez. H.. Wong. S.K.. Brandt. D.R., May. D.C.. Burnier. J.. Harkins. R N . Chen. E.Y., Ramachandran. J.. Ullrich. A.. Ross. E.M. (1986) The avian beta- adrenergic receptor: primary structure and membrane topology. Proc. Natl. Acad. Sci. USA 83: 6795-6799.

Yokomizo. T., Izurni. T.. Chang, K.. Takuwa. Y.. Shimizu, T. (1997) A G-protein- coupled receptor for leukotriene B, that mediates chemotêuis. Nature 387: 620-624.

Zastawny, R.L.. George, S.R.. Nguyen. T., Cheng, R.. Tsatsos. J.. Briones-Urbina. R.. O'Dowd. B.F. (1994) Cloning. charactenzation. and distribution of a p-opioid receptor in rat brain. J. Neurochem. 62: 2099-2 105.

Zastawny, R.L., George, S.R., Bouvier, M.. O' Dowd. B.F. ( 1 997) Adrenergic and related G protein-coupled receptors. In: "Encyclopedia of Human Biology." Second ed. Vollane X: A28- 1 4 2 8 - 1 1. New York. Academic Press. Inc.

IMAGE EVALUATION TEST TARGET (QA-3)

APPLIEO INIAGE . lnc 1653 East Main Street -

I . , , Rochester. NY 14609 USA -- -- - - Phone: 71 W482-O3OO -- -- - - Fax: 71 61288-5989

O 1993. Agpiiad Image. inc.. All Flights Reserved